Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
International Nuclear Information System (INIS)
Billen, D.; Hellermann, G.R.
1977-01-01
An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)
Hepatitis B virus DNA polymerase gene polymorphism based ...
African Journals Online (AJOL)
Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...
Chromosomal location of the human gene for DNA polymerase β
International Nuclear Information System (INIS)
McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.
1987-01-01
Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene
The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.
Burgers, P M; Kornberg, A; Sakakibara, Y
1981-09-01
An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.
Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA
Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.
2010-01-01
The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with
International Nuclear Information System (INIS)
Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.
1987-01-01
The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein
Distinct co-evolution patterns of genes associated to DNA polymerase III DnaE and PolC
Directory of Open Access Journals (Sweden)
Engelen Stefan
2012-02-01
Full Text Available Abstract Background Bacterial genomes displaying a strong bias between the leading and the lagging strand of DNA replication encode two DNA polymerases III, DnaE and PolC, rather than a single one. Replication is a highly unsymmetrical process, and the presence of two polymerases is therefore not unexpected. Using comparative genomics, we explored whether other processes have evolved in parallel with each polymerase. Results Extending previous in silico heuristics for the analysis of gene co-evolution, we analyzed the function of genes clustering with dnaE and polC. Clusters were highly informative. DnaE co-evolves with the ribosome, the transcription machinery, the core of intermediary metabolism enzymes. It is also connected to the energy-saving enzyme necessary for RNA degradation, polynucleotide phosphorylase. Most of the proteins of this co-evolving set belong to the persistent set in bacterial proteomes, that is fairly ubiquitously distributed. In contrast, PolC co-evolves with RNA degradation enzymes that are present only in the A+T-rich Firmicutes clade, suggesting at least two origins for the degradosome. Conclusion DNA replication involves two machineries, DnaE and PolC. DnaE co-evolves with the core functions of bacterial life. In contrast PolC co-evolves with a set of RNA degradation enzymes that does not derive from the degradosome identified in gamma-Proteobacteria. This suggests that at least two independent RNA degradation pathways existed in the progenote community at the end of the RNA genome world.
Structure and function of DNA polymerase μ
International Nuclear Information System (INIS)
Matsumoto, Takuro; Maezawa, So
2013-01-01
DNA polymerases are enzymes playing the central role in DNA metabolism, including DNA replication, DNA repair and recombination. DNA polymerase μ (pol μ DNA polymerase λ (pol λ) and terminal deoxynucleotidyltransferase (TdT) in X family DNA polymerases function in non-homologous end-joining (NHEJ), which is the predonmiant repair pathway for DNA double-strand breaks (DSBs). NHEJ involves enzymes that capture both ends of the broken DNA strand, bring them together in a synaptic DNA-protein complex, and repair the DSB. Pol μ and pol λ fill in the gaps at the junction to maintain the genomic integrity. TdT synthesizes N region at the junction during V(D)J recombination and promotes diversity of immunoglobulin or T-cell receptor gene. Among these three polymerases, the regulatory mechanisms of pol μ remain rather unclear. We have approached the mechanism of pol μ from both sides of structure and cellular dynamics. Here, we propose some new insights into pol μ and the probable NHEJ model including our findings. (author)
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-07-14
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-01-01
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618
PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.
Cline, J; Braman, J C; Hogrefe, H H
1996-09-15
The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.
DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli
International Nuclear Information System (INIS)
Dorson, J.W.; Moses, R.E.
1978-01-01
DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair
Discovery of cyanophage genomes which contain mitochondrial DNA polymerase.
Chan, Yi-Wah; Mohr, Remus; Millard, Andrew D; Holmes, Antony B; Larkum, Anthony W; Whitworth, Anna L; Mann, Nicholas H; Scanlan, David J; Hess, Wolfgang R; Clokie, Martha R J
2011-08-01
DNA polymerase γ is a family A DNA polymerase responsible for the replication of mitochondrial DNA in eukaryotes. The origins of DNA polymerase γ have remained elusive because it is not present in any known bacterium, though it has been hypothesized that mitochondria may have inherited the enzyme by phage-mediated nonorthologous displacement. Here, we present an analysis of two full-length homologues of this gene, which were found in the genomes of two bacteriophages, which infect the chlorophyll-d containing cyanobacterium Acaryochloris marina. Phylogenetic analyses of these phage DNA polymerase γ proteins show that they branch deeply within the DNA polymerase γ clade and therefore share a common origin with their eukaryotic homologues. We also found homologues of these phage polymerases in the environmental Community Cyberinfrastructure for Advanced Microbial Ecology Research and Analysis (CAMERA) database, which fell in the same clade. An analysis of the CAMERA assemblies containing the environmental homologues together with the filter fraction metadata indicated some of these assemblies may be of bacterial origin. We also show that the phage-encoded DNA polymerase γ is highly transcribed as the phage genomes are replicated. These findings provide data that may assist in reconstructing the evolution of mitochondria.
International Nuclear Information System (INIS)
Halas, A.; Policinska, Z.; Baranowska, H.; Jachymczyk, W.J.
1999-01-01
We have studied the ability of yeast DNA polymerases to carry out repair of lesions caused by UV irradiation in Saccharomyces cerevisiae. By the analysis of postirradiation relative molecular mass changes in cellular DNA of different DNA polymerases mutant strains, it was established that mutations in DNA polymerases δ and ε showed accumulation of single-strand breaks indicating defective repair. Mutations in other DNA polymerase genes exhibited no defects in DNA repair. Thus, the data obtained suggest that DNA polymerases δ and ε are both necessary for DNA replication and for repair of lesions caused by UV irradiation. The results are discussed in the light of current concepts concerning the specificity of DNA polymerases in DNA repair. (author)
DNA repair synthesis in human fibroblasts requires DNA polymerase delta
International Nuclear Information System (INIS)
Nishida, C.; Reinhard, P.; Linn, S.
1988-01-01
When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernatant of similarly treated HeLa cells. Extensive purification of this factor yielded a 10.2 S, 220,000-dalton polypeptide with the DNA polymerase and 3'- to 5'-exonuclease activities reported for DNA polymerase delta II. Monoclonal antibody to KB cell DNA polymerase alpha, while binding to HeLa DNA polymerase alpha, did not bind to the HeLa DNA polymerase delta. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGTP) and 2-(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase alpha, but did not inhibit the DNA polymerase delta. Neither purified DNA polymerase alpha nor beta could promote repair DNA synthesis in the permeabilized cells. Furthermore, under conditions which inhibited purified DNA polymerase alpha by greater than 90%, neither monoclonal antibodies to DNA polymerase alpha, BuPdGTP, nor BuAdATP was able to inhibit significantly the DNA repair synthesis mediated by the DNA polymerase delta. Thus, it appears that a major portion of DNA repair synthesis induced by UV irradiation might be catalyzed by DNA polymerase delta. When xeroderma pigmentosum human diploid fibroblasts were utilized, DNA repair synthesis dependent upon ultraviolet light could be restored by addition of both T4 endonuclease V and DNA polymerase delta, but not by addition of either one alone
International Nuclear Information System (INIS)
Budd, M.E.; Wittrup, K.D.; Bailey, J.E.; Campbell, J.L.
1989-01-01
We have used a set of seven temperature-sensitive mutants in the DNA polymerase I gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase I in various aspects of DNA synthesis in vivo. Previously, we showed that DNA polymerase I is required for mitotic DNA replication. Here we extend our studies to several stages of meiosis and repair of X-ray-induced damage. We find that sporulation is blocked in all of the DNA polymerase temperature-sensitive mutants and that premeiotic DNA replication does not occur. Commitment to meiotic recombination is only 2% of wild-type levels. Thus, DNA polymerase I is essential for these steps. However, repair of X-ray-induced single-strand breaks is not defective in the DNA polymerase temperature-sensitive mutants, and DNA polymerase I is therefore not essential for repair of such lesions. These results suggest that DNA polymerase II or III or both, the two other nuclear yeast DNA polymerases for which roles have not yet been established, carry out repair in the absence of DNA polymerase I, but that DNA polymerase II and III cannot compensate for loss of DNA polymerase I in meiotic replication and recombination. These results do not, however, rule out essential roles for DNA polymerase II or III or both in addition to that for DNA polymerase I
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta
2015-07-13
We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.
Functional roles of DNA polymerases β and γ
International Nuclear Information System (INIS)
Huebscher, U.; Kuenzle, C.C.; Spadari, S.
1979-01-01
The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded
Analysis of DNA polymerase activity in Petunia protoplasts treated with clastogenic agents
International Nuclear Information System (INIS)
Benediktsson, I.; Spampinato, C.P.; Andreo, C.S.; Schieder, O.
1994-01-01
Clastogenic agents, i.e. agents that can induce chromosome or DNA breakage, have been shown to enhance the role of direct gene transfer to protoplasts. The effect was analysed at the enzymatic level using protoplast homogenates as well as intact protoplasts. For that purpose existing procedures were modified to enable measurement of DNA polymerase in vivo. In the system used, external DNA was able to enter the cells without the addition of membrane-permeabilizing compounds. When comparing total DNA polymerase activity of protoplasts irradiated with X-rays or UV-light with that of untreated cells we did not observe significant differences. Incubation of protoplasts with high doses of bleomycin affected total DNA polymerase activity negatively. but dideoxythymidine triphosphate-sensitive activity was not influenced. We conclude that the DNA strand-breaks induced by low doses of X-rays. UV-light or bleomycin do not increase the total or the repair-DNA polymerase activity and. therefore. that the increase in the transformation rates after DNA strand-breaking is not preceded by enhanced DNA polymerase activity. (author)
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C
2009-10-30
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.
2009-01-01
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688
Effect of γ-irradiated DNA on the activity of DNA polymerase
International Nuclear Information System (INIS)
Leadon, S.A.; Ward, J.F.
1981-01-01
A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation
PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.
Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi
2009-07-01
Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.
Directory of Open Access Journals (Sweden)
Marcin Olszewski
Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.
Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.
2003-01-01
Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...
Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian
2013-12-01
Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
The role of DNA polymerase {iota} in UV mutational spectra
Energy Technology Data Exchange (ETDEWEB)
Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail: gpfeifer@coh.org
2006-07-25
UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.
DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis
Energy Technology Data Exchange (ETDEWEB)
Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.
1987-06-01
Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
DNA repair synthesis dependent on the uvrA,B gene products
International Nuclear Information System (INIS)
Moses, R.E.; Moody, E.E.M.
1975-01-01
Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
Structure of human DNA polymerase iota and the mechanism of DNA synthesis.
Makarova, A V; Kulbachinskiy, A V
2012-06-01
Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.
Site-directed mutagenesis of the foot-and-mouth disease virus RNA-polymerase gene
International Nuclear Information System (INIS)
Brindeiro, R.M.; Soares, M.A.; Vianna, A.L.M.; Pontes, O.H.A. de; Pacheco, A.B.F.; Almeida, D.F. de; Tanuri, A.
1991-01-01
The foot-and-mouth disease virus RNA-polymerase gene was mutagenised in its active site. Pst I digestion of the polymerase gene (cDNA) generated a 790 bp fragment containing the critical sequence. This fragment was subcloned in M13mp8 for mutagenesis method. The polymerase gene was then reconstructed and subcloned in pUC19. These mutants will be used to study the enzyme structure and activity and to develop intracellular immunization assays in eukaryotic cells. (author)
DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present
Directory of Open Access Journals (Sweden)
Cheng-Yao eChen
2014-06-01
Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.
Repair of Clustered Damage and DNA Polymerase Iota.
Belousova, E A; Lavrik, O I
2015-08-01
Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.
COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR
Directory of Open Access Journals (Sweden)
Masashi Miura
2013-12-01
Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.
DNA repair in DNA-polymerase-deficient mutants of Escherichia coli
International Nuclear Information System (INIS)
Smith, D.W.; Tait, R.C.; Harris, A.L.
1975-01-01
Escherichia coli mutants deficient in DNA polymerase I, in DNA polymerases I and II, or in DNA polymerase III can efficiently and completely execute excision-repair and postreplication repair of the uv-damaged DNA at 30 0 C and 43 0 C when assayed by alkaline sucrose gradients. Repair by Pol I - and Pol I - , Pol II - cells is inhibited by 1-β-D-arabinofuranosylcytosine (araC) at 43 0 C but not at 30 0 C, whereas that by Pol III - cells is insensitive to araC at any temperature. Thus, either Pol I or Pol III is required for complete and efficient repair, and in their absence Pol II mediates a limited, incomplete dark repair of uv-damaged DNA
Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.
Directory of Open Access Journals (Sweden)
Fabio Lapenta
Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.
DEFF Research Database (Denmark)
Blomberg Jensen, M; Leffers, H; Petersen, J H
2008-01-01
BACKGROUND: A possible association between the polymorphic CAG repeat in the DNA polymerase gamma (POLG) gene and the risk of testicular germ-cell tumours (TGCT) was investigated in this study. The hypothesis was prompted by an earlier preliminary study proposing an association of the absence...
Oates, A C; Wollberg, P; Achen, M G; Wilks, A F
1998-08-28
The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.
Directory of Open Access Journals (Sweden)
Yonghe Qi
2016-10-01
Full Text Available Hepatitis B virus (HBV infection of hepatocytes begins by binding to its cellular receptor sodium taurocholate cotransporting polypeptide (NTCP, followed by the internalization of viral nucleocapsid into the cytoplasm. The viral relaxed circular (rc DNA genome in nucleocapsid is transported into the nucleus and converted into covalently closed circular (ccc DNA to serve as a viral persistence reservoir that is refractory to current antiviral therapies. Host DNA repair enzymes have been speculated to catalyze the conversion of rcDNA to cccDNA, however, the DNA polymerase(s that fills the gap in the plus strand of rcDNA remains to be determined. Here we conducted targeted genetic screening in combination with chemical inhibition to identify the cellular DNA polymerase(s responsible for cccDNA formation, and exploited recombinant HBV with capsid coding deficiency which infects HepG2-NTCP cells with similar efficiency of wild-type HBV to assure cccDNA synthesis is exclusively from de novo HBV infection. We found that DNA polymerase κ (POLK, a Y-family DNA polymerase with maximum activity in non-dividing cells, substantially contributes to cccDNA formation during de novo HBV infection. Depleting gene expression of POLK in HepG2-NTCP cells by either siRNA knockdown or CRISPR/Cas9 knockout inhibited the conversion of rcDNA into cccDNA, while the diminished cccDNA formation in, and hence the viral infection of, the knockout cells could be effectively rescued by ectopic expression of POLK. These studies revealed that POLK is a crucial host factor required for cccDNA formation during a de novo HBV infection and suggest that POLK may be a potential target for developing antivirals against HBV.
[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].
D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V
1980-11-01
A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.
Enhancement of DNA polymerase activity in potato tuber slices
International Nuclear Information System (INIS)
Watanabe, Akira; Imaseki, Hidemasa
1977-01-01
DNA polymerase was extracted from potato (Soleum tuberosum L.) tuber discs and the temporal correlation of its activity change to DNA synthesis in vivo was examined during aging of the discs. Most of the DNA polymerase was recovered as a bound form in the 18,000 x g precipitate. Reaction with the bound-form enzyme was dependent on the presence of four deoxynucleoside triphosphates, Mg 2+ , and a template. ''Activated'' DNA and heat-denatured DNA, but not native DNA, were utilized as templates. The polymerase activity was sensitive to SH reagents. Fresh discs, which do not synthesize DNA in vivo, contained a significant amount of DNA polymerase and its activity increased linearly with time until 48 hr after slicing and became four times that of fresh discs after 72 hr, whereas the activity of DNA synthesis in vivo increased with time and decreased after reaching a maximum at 30 hr. Cycloheximide inhibited the enhancement of polymerase activity. DNA polymerase from aged and fresh discs had identical requirements for deoxynucleotides and a template in their reactions, sensitivity to SH reagent, and affinity to thymidine triphosphate. (auth.)
DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease
Energy Technology Data Exchange (ETDEWEB)
Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki
1980-09-19
Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.
DNA Polymerase Fidelity: Beyond Right and Wrong.
Washington, M Todd
2016-11-01
Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.
Leem, S H; Ropp, P A; Sugino, A
1994-01-01
We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...
Directory of Open Access Journals (Sweden)
Elena K Braithwaite
2010-08-01
Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.
Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro
Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi
2012-01-01
Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263
DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair
Directory of Open Access Journals (Sweden)
Elisa Mentegari
2016-08-01
Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.
DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.
Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele
2016-08-31
DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.
Single gene retrieval from thermally degraded DNA
Indian Academy of Sciences (India)
To simulate single gene retrieval from ancient DNA, several related factors have been investigated. By monitoring a 889 bp polymerase chain reaction (PCR) product and genomic DNA degradation, we find that heat and oxygen (especially heat) are both crucial factors influencing DNA degradation. The heat influence ...
Engineering of a DNA Polymerase for Direct m6 A Sequencing.
Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas
2018-01-08
Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I
2012-03-13
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.
Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2012-01-01
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201
Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer
Directory of Open Access Journals (Sweden)
Anthony J. Berdis
2017-11-01
Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
International Nuclear Information System (INIS)
Dreslor, S.L.; Frattini, M.G.
1987-01-01
Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N 2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α
Fowler, Jason D.; Brown, Jessica A.; Kvaratskhelia, Mamuka; Suo, Zucai
2009-01-01
SUMMARY Crystallographic studies of the C-terminal, DNA polymerase β-like domain of human DNA polymerase lambda (fPolλ) suggested that the catalytic cycle might not involve a large protein domain rearrangement as observed with several replicative DNA polymerases and DNA polymerase β. To examine solution-phase protein conformation changes in fPolλ, which also contains a breast cancer susceptibility gene 1 C-terminal domain and a Proline-rich domain at its N-terminus, we used a mass spectrometry - based protein footprinting approach. In parallel experiments, surface accessibility maps for Arg residues were compared for the free fPolλ versus the binary complex of enzyme•gapped DNA and the ternary complex of enzyme•gapped DNA•dNTP. These experiments suggested that fPolλ does not undergo major conformational changes during the catalysis in the solution phase. Furthermore, the mass spectrometry-based protein footprinting experiments revealed that active site residue R386 was shielded from the surface only in the presence of both a gapped DNA substrate and an incoming nucleotide dNTP. Site-directed mutagenesis and pre-steady state kinetic studies confirmed the importance of R386 for the enzyme activity, and indicated the key role for its guanidino group in stabilizing the negative charges of an incoming nucleotide and the leaving pyrophosphate product. We suggest that such interactions could be shared by and important for catalytic functions of other DNA polymerases. PMID:19467241
Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.
André, P; Kim, A; Khrapko, K; Thilly, W G
1997-08-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.
Tubeleviciute, Agne; Skirgaila, Remigijus
2010-08-01
The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Hammond, R.A.; Miller, M.R.; McClung, J.K.
1990-01-01
The involvement of DNA polymerases α, β, and δ in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was investigated in human fibroblasts (HF). The effects of anti-(DNA polymerase α) monoclonal antibody, (p-n-butylphenyl)deoxyguanosine triphosphate (BuPdGTP), dideoxythymidine triphosphate (ddTTP), and aphidicolin on MNNG-induced DNA repair synthesis were investigated to dissect the roles of the different DNA polymerases. A subcellular system (permeable cells), in which DNA repair synthesis and DNA replication were differentiated by CsCl gradient centrifugation of BrdUMP density-labeled DNA, was used to examine the effects of the polymerase inhibitors. Another approach investigated the effects of several of these inhibitors of MNNG-induced DNA repair synthesis in intact cells by measuring the amount of [ 3 H]thymidine incorporated into repair DNA as determined by autoradiography and quantitation with an automated video image analysis system. In permeable cells, MNNG-induced DNA repair synthesis was inhibited 56% by 50 μg of aphidicolin/mL, 6% by 10 μM BuPdGTP, 13% by anti-(DNA polymerse α) monoclonal antibodies, and 29% by ddTTP. In intact cells, MNNG-induced DNA repair synthesis was inhibited 57% by 50 μg of aphidicolin/mL and was not significantly inhibited by microinjecting anti-(DNA polymerase α) antibodies into HF nuclei. These results indicate that both DNA polymerase δ and β are involved in repairing DNA damage caused by MNNG
Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.
2010-01-01
The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.
Ghosh, Sharmistha
2010-04-06
The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.
General misincorporation frequency: Re-evaluation of the fidelity of DNA polymerases.
Yang, Jie; Li, Bianbian; Liu, Xiaoying; Tang, Hong; Zhuang, Xiyao; Yang, Mingqi; Xu, Ying; Zhang, Huidong; Yang, Chun
2018-02-19
DNA replication in cells is performed in the presence of four dNTPs and four rNTPs. In this study, we re-evaluated the fidelity of DNA polymerases using the general misincorporation frequency consisting of three incorrect dNTPs and four rNTPs but not using the traditional special misincorporation frequency with only the three incorrect dNTPs. We analyzed both the general and special misincorporation frequencies of nucleotide incorporation opposite dG, rG, or 8-oxoG by Pseudomonas aeruginosa phage 1 (PaP1) DNA polymerase Gp90 or Sulfolobus solfataricus DNA polymerase Dpo4. Both misincorporation frequencies of other DNA polymerases published were also summarized and analyzed. The general misincorporation frequency is obviously higher than the special misincorporation frequency for many DNA polymerases, indicating the real fidelity of a DNA polymerase should be evaluated using the general misincorporation frequency. Copyright © 2018 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Khare, Vineeta; Eckert, Kristin A.
2002-01-01
The 3'→5' exonuclease activity intrinsic to several DNA polymerases plays a primary role in genetic stability; it acts as a first line of defense in correcting DNA polymerase errors. A mismatched basepair at the primer terminus is the preferred substrate for the exonuclease activity over a correct basepair. The efficiency of the exonuclease as a proofreading activity for mispairs containing a DNA lesion varies, however, being dependent upon both the DNA polymerase/exonuclease and the type of DNA lesion. The exonuclease activities intrinsic to the T4 polymerase (family B) and DNA polymerase γ (family A) proofread DNA mispairs opposite endogenous DNA lesions, including alkylation, oxidation, and abasic adducts. However, the exonuclease of the Klenow polymerase cannot discriminate between correct and incorrect bases opposite alkylation and oxidative lesions. DNA damage alters the dynamics of the intramolecular partitioning of DNA substrates between the 3'→5' exonuclease and polymerase activities. Enzymatic idling at lesions occurs when an exonuclease activity efficiently removes the same base that is preferentially incorporated by the DNA polymerase activity. Thus, the exonuclease activity can also act as a kinetic barrier to translesion synthesis (TLS) by preventing the stable incorporation of bases opposite DNA lesions. Understanding the downstream consequences of exonuclease activity at DNA lesions is necessary for elucidating the mechanisms of translesion synthesis and damage-induced cytotoxicity
Structural Transformation of Wireframe DNA Origami via DNA Polymerase Assisted Gap-Filling.
Agarwal, Nayan P; Matthies, Michael; Joffroy, Bastian; Schmidt, Thorsten L
2018-03-27
The programmability of DNA enables constructing nanostructures with almost any arbitrary shape, which can be decorated with many functional materials. Moreover, dynamic structures can be realized such as molecular motors and walkers. In this work, we have explored the possibility to synthesize the complementary sequences to single-stranded gap regions in the DNA origami scaffold cost effectively by a DNA polymerase rather than by a DNA synthesizer. For this purpose, four different wireframe DNA origami structures were designed to have single-stranded gap regions. This reduced the number of staple strands needed to determine the shape and size of the final structure after gap filling. For this, several DNA polymerases and single-stranded binding (SSB) proteins were tested, with T4 DNA polymerase being the best fit. The structures could be folded in as little as 6 min, and the subsequent optimized gap-filling reaction was completed in less than 3 min. The introduction of flexible gap regions results in fully collapsed or partially bent structures due to entropic spring effects. Finally, we demonstrated structural transformations of such deformed wireframe DNA origami structures with DNA polymerases including the expansion of collapsed structures and the straightening of curved tubes. We anticipate that this approach will become a powerful tool to build DNA wireframe structures more material-efficiently, and to quickly prototype and test new wireframe designs that can be expanded, rigidified, or mechanically switched. Mechanical force generation and structural transitions will enable applications in structural DNA nanotechnology, plasmonics, or single-molecule biophysics.
DNA polymerase beta participates in mitochondrial DNA repair
DEFF Research Database (Denmark)
Sykora, P; Kanno, S; Akbari, M
2017-01-01
We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...
DNA structure in human RNA polymerase II promoters
DEFF Research Database (Denmark)
Pedersen, Anders Gorm; Baldi, Pierre; Chauvin, Yves
1998-01-01
with a very low level of sequence similarity. The sequences, which include both TATA-containing and TATA-less promoters, are aligned by hidden Markov models. Using three different models of sequence-derived DNA bendability, the aligned promoters display a common structural profile with bendability being low...... protein in a manner reminiscent of DNA in a nucleosome. This notion is further supported by the finding that the periodic bendability is caused mainly by the complementary triplet pairs CAG/CTG and GGC/GCC, which previously have been found to correlate with nucleosome positioning. We present models where......The fact that DNA three-dimensional structure is important for transcriptional regulation begs the question of whether eukaryotic promoters contain general structural features independently of what genes they control. We present an analysis of a large set of human RNA polymerase II promoters...
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...
Identification of genes involved in DNA replication of the Autographa californica baculovirus
Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.
1994-01-01
By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,
Leem, S H; Ropp, P A; Sugino, A
1994-08-11
We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.
Energy Technology Data Exchange (ETDEWEB)
Santiago, Maria Jesus [Departamento de Genetica, Facultad de Ciencias, Edificio Gregor Mendel, Campus Rabanales, Universidad de Cordoba (Spain); Alejandre-Duran, Encarna [Departamento de Genetica, Facultad de Ciencias, Edificio Gregor Mendel, Campus Rabanales, Universidad de Cordoba (Spain); Ruiz-Rubio, Manuel [Departamento de Genetica, Facultad de Ciencias, Edificio Gregor Mendel, Campus Rabanales, Universidad de Cordoba (Spain)]. E-mail: ge1rurum@uco.es
2006-10-10
DNA polymerase {eta} belongs to the Y-family of DNA polymerases, enzymes that are able to synthesize past template lesions that block replication fork progression. This polymerase accurately bypasses UV-associated cis-syn cyclobutane thymine dimers in vitro and therefore may contributes to resistance against sunlight in vivo, both ameliorating survival and decreasing the level of mutagenesis. We cloned and sequenced a cDNA from Arabidopsis thaliana which encodes a protein containing several sequence motifs characteristics of Pol{eta} homologues, including a highly conserved sequence reported to be present in the active site of the Y-family DNA polymerases. The gene, named AtPOLH, contains 14 exons and 13 introns and is expressed in different plant tissues. A strain from Saccharomyces cerevisiae, deficient in Pol{eta} activity, was transformed with a yeast expression plasmid containing the AtPOLH cDNA. The rate of survival to UV irradiation in the transformed mutant increased to similar values of the wild type yeast strain, showing that AtPOLH encodes a functional protein. In addition, when AtPOLH is expressed in Escherichia coli, a change in the mutational spectra is detected when bacteria are irradiated with UV light. This observation might indicate that AtPOLH could compete with DNA polymerase V and then bypass cyclobutane pyrimidine dimers incorporating two adenylates.
Polymerase Gamma Disease through the Ages
Saneto, Russell P.; Naviaux, Robert K.
2010-01-01
The most common group of mitochondrial disease is due to mutations within the mitochondrial DNA polymerase, polymerase gamma 1 ("POLG"). This gene product is responsible for replication and repair of the small mitochondrial DNA genome. The structure-function relationship of this gene product produces a wide variety of diseases that at times, seems…
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Directory of Open Access Journals (Sweden)
Tom eKillelea
2014-05-01
Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.
Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes
2017-02-07
Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
International Nuclear Information System (INIS)
Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.
1988-01-01
DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ
Recent Insight into the Kinetic Mechanisms and Conformational Dynamics of Y-Family DNA Polymerases
Maxwell, Brian A.; Suo, Zucai
2014-01-01
The kinetic mechanisms by which DNA polymerases catalyze DNA replication and repair have long been areas of active research. Recently discovered Y-family DNA polymerases catalyze the bypass of damaged DNA bases that would otherwise block replicative DNA polymerases and stall replication forks. Unlike DNA polymerases from the five other families, the Y-family DNA polymerases have flexible, solvent-accessible active sites that are able to tolerate various types of damaged template bases and all...
UVB DNA dosimeters analyzed by polymerase chain reactors
International Nuclear Information System (INIS)
Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL
1997-01-01
Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)
Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II
B. Steurer (Barbara); J.A. Marteijn (Jurgen)
2016-01-01
textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The
DNA polymerases in the rat pituitary gland. Effect of oestrogens and sulpiride.
Jahn, G A; Kalbermann, L E; Machiavelli, G; Szijan, I; Burdman, J A
1980-06-01
Changes in the activity of DNA polymerase and [3H]thymidine incorporation into the DNA of the anterior pituitary gland were studied in oestrogenized male and pregnant rats. The activities of DNA polymerases alpha and beta, extracted in Tris--HCl or in sodium phosphate buffer were characterized according to their optimum pH and sensitivity to N-ethyl-maleimide. In the Tris-soluble fraction DNA polymerase activity is almost exclusively alpha, while in the phosphate soluble fraction it is a mixture of alpha and beta. The administration of oestrogens to male rats increases [3H]thymidine incorporation and enhances the activity of DNA polymerases in the Tris-soluble fraction, while the activity of the phosphate-soluble enzyme does not change. Sulpiride administration results in a further increment of [3H]thymidine incorporation and of DNA polymerase activity in the Tris-soluble fraction. In pregnant rats sulpiride also produces an increment of DNA polymerase activity only in the Tris-soluble fraction. Thus, the activity of the Tris-soluble fraction from APG behaves as DNA polymerase alpha. This activity changes in parallel with [3H]thymidine incorporation into DNA which is an indication of cell proliferation in the gland. This is discussed with respect to a negative feedback mechanism between intracellular prolactin concentration and DNA synthesis in the APG.
Directory of Open Access Journals (Sweden)
DasSarma Shiladitya
2007-06-01
Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten
DNA polymerase η mutational signatures are found in a variety of different types of cancer.
Rogozin, Igor B; Goncearenco, Alexander; Lada, Artem G; De, Subhajyoti; Yurchenko, Vyacheslav; Nudelman, German; Panchenko, Anna R; Cooper, David N; Pavlov, Youri I
2018-01-01
DNA polymerase (pol) η is a specialized error-prone polymerase with at least two quite different and contrasting cellular roles: to mitigate the genetic consequences of solar UV irradiation, and promote somatic hypermutation in the variable regions of immunoglobulin genes. Misregulation and mistargeting of pol η can compromise genome integrity. We explored whether the mutational signature of pol η could be found in datasets of human somatic mutations derived from normal and cancer cells. A substantial excess of single and tandem somatic mutations within known pol η mutable motifs was noted in skin cancer as well as in many other types of human cancer, suggesting that somatic mutations in A:T bases generated by DNA polymerase η are a common feature of tumorigenesis. Another peculiarity of pol ηmutational signatures, mutations in YCG motifs, led us to speculate that error-prone DNA synthesis opposite methylated CpG dinucleotides by misregulated pol η in tumors might constitute an additional mechanism of cytosine demethylation in this hypermutable dinucleotide.
EBV DNA polymerase inhibition of tannins from Eugenia uniflora.
Lee, M H; Chiou, J F; Yen, K Y; Yang, L L
2000-06-30
Nasopharyngeal carcinoma (NPC) is one of the high population malignant tumors among Chinese in southern China and southeast Asia. Epstein-Barr virus (EBV) is a human B lymphotropic herpes virus which is known to be closely associated with NPC. EBV DNA polymerase is a key enzyme during EBV replication and is measured by its radioactivity. The addition of phorbol 12-myristate 13-acetate to Raji cell cultures led to a large increase in EBV DNA polymerase, which was purified by sequential DEAE-cellulose, phosphocellulose and DNA-cellulose column chromatography. Four tannins were isolated from the active fractions of Eugenia uniflora L., which were tested for the inhibition of EBV DNA polymerase. The results showed the 50% inhibitory concentration (IC(50)) values of gallocatechin, oenothein B, eugeniflorins D(1) and D(2) were 26.5 62.3, 3.0 and 3.5 microM, respectively. Furthermore, when compared with the positive control (phosphonoacetic acid), an inhibitor of EBV replication, the IC(50) value was 16.4 microM. In view of the results, eugeniflorins D(1) and D(2) are the potency principles in the inhibition of EBV DNA polymerase from E. uniflora.
Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M
1986-09-01
The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
Isolation and characterization of high affinity aptamers against DNA polymerase iota.
Lakhin, Andrei V; Kazakov, Andrei A; Makarova, Alena V; Pavlov, Yuri I; Efremova, Anna S; Shram, Stanislav I; Tarantul, Viacheslav Z; Gening, Leonid V
2012-02-01
Human DNA-polymerase iota (Pol ι) is an extremely error-prone enzyme and the fidelity depends on the sequence context of the template. Using the in vitro systematic evolution of ligands by exponential enrichment (SELEX) procedure, we obtained an oligoribonucleotide with a high affinity to human Pol ι, named aptamer IKL5. We determined its dissociation constant with homogenous preparation of Pol ι and predicted its putative secondary structure. The aptamer IKL5 specifically inhibits DNA-polymerase activity of the purified enzyme Pol ι, but did not inhibit the DNA-polymerase activities of human DNA polymerases beta and kappa. IKL5 suppressed the error-prone DNA-polymerase activity of Pol ι also in cellular extracts of the tumor cell line SKOV-3. The aptamer IKL5 is useful for studies of the biological role of Pol ι and as a potential drug to suppress the increase of the activity of this enzyme in malignant cells.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
Replicative DNA polymerase mutations in cancer☆
Heitzer, Ellen; Tomlinson, Ian
2014-01-01
Three DNA polymerases — Pol α, Pol δ and Pol ɛ — are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson–Crick base pairing and 3′exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to ‘polymerase proofreading associated polyposis’ (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an ‘ultramutator’ phenotype, with a dramatic increase in base substitutions. PMID:24583393
International Nuclear Information System (INIS)
Gilmour, D.S.; Lis, J.T.
1986-01-01
By using a protein-DNA cross-linking method, we examined the in vivo distribution of RNA polymerase II on the hsp70 heat shock gene in Drosophila melanogaster Schneider line 2 cells. In heat shock-induced cells, a high level of RNA polymerase II was detected on the entire gene, while in noninduced cells, the RNA polymerase II was confined to the 5' end of the hsp70 gene, predominantly between nucleotides -12 and +65 relative to the start of transcription. This association of RNA polymerase II was apparent whether the cross-linking was performed by a 10-min UV irradiation of chilled cells with mercury vapor lamps or by a 40-microsecond irradiation of cells with a high-energy xenon flash lamp. We hypothesize that RNA polymerase II has access to, and a high affinity for, the promoter region of this gene before induction, and this poised RNA polymerase II may be critical in the mechanism of transcription activation
StpA and Hha stimulate pausing by RNA polymerase by promoting DNA-DNA bridging of H-NS filaments.
Boudreau, Beth A; Hron, Daniel R; Qin, Liang; van der Valk, Ramon A; Kotlajich, Matthew V; Dame, Remus T; Landick, Robert
2018-06-20
In enterobacteria, AT-rich horizontally acquired genes, including virulence genes, are silenced through the actions of at least three nucleoid-associated proteins (NAPs): H-NS, StpA and Hha. These proteins form gene-silencing nucleoprotein filaments through direct DNA binding by H-NS and StpA homodimers or heterodimers. Both linear and bridged filaments, in which NAPs bind one or two DNA segments, respectively, have been observed. Hha can interact with H-NS or StpA filaments, but itself lacks a DNA-binding domain. Filaments composed of H-NS alone can inhibit transcription initiation and, in the bridged conformation, slow elongating RNA polymerase (RNAP) by promoting backtracking at pause sites. How the other NAPs modulate these effects of H-NS is unknown, despite evidence that they help regulate subsets of silenced genes in vivo (e.g. in pathogenicity islands). Here we report that Hha and StpA greatly enhance H-NS-stimulated pausing by RNAP at 20°C. StpA:H-NS or StpA-only filaments also stimulate pausing at 37°C, a temperature at which Hha:H-NS or H-NS-only filaments have much less effect. In addition, we report that both Hha and StpA greatly stimulate DNA-DNA bridging by H-NS filaments. Together, these observations indicate that Hha and StpA can affect H-NS-mediated gene regulation by stimulating bridging of H-NS/DNA filaments.
Global conformational dynamics of a Y-family DNA polymerase during catalysis.
Directory of Open Access Journals (Sweden)
Cuiling Xu
2009-10-01
Full Text Available Replicative DNA polymerases are stalled by damaged DNA while the newly discovered Y-family DNA polymerases are recruited to rescue these stalled replication forks, thereby enhancing cell survival. The Y-family DNA polymerases, characterized by low fidelity and processivity, are able to bypass different classes of DNA lesions. A variety of kinetic and structural studies have established a minimal reaction pathway common to all DNA polymerases, although the conformational intermediates are not well defined. Furthermore, the identification of the rate-limiting step of nucleotide incorporation catalyzed by any DNA polymerase has been a matter of long debate. By monitoring time-dependent fluorescence resonance energy transfer (FRET signal changes at multiple sites in each domain and DNA during catalysis, we present here a real-time picture of the global conformational transitions of a model Y-family enzyme: DNA polymerase IV (Dpo4 from Sulfolobus solfataricus. Our results provide evidence for a hypothetical DNA translocation event followed by a rapid protein conformational change prior to catalysis and a subsequent slow, post-chemistry protein conformational change. Surprisingly, the DNA translocation step was induced by the binding of a correct nucleotide. Moreover, we have determined the directions, rates, and activation energy barriers of the protein conformational transitions, which indicated that the four domains of Dpo4 moved in a synchronized manner. These results showed conclusively that a pre-chemistry conformational change associated with domain movements was too fast to be the rate-limiting step. Rather, the rearrangement of active site residues limited the rate of correct nucleotide incorporation. Collectively, the conformational dynamics of Dpo4 offer insights into how the inter-domain movements are related to enzymatic function and their concerted interactions with other proteins at the replication fork.
Structure of a preternary complex involving a prokaryotic NHEJ DNA polymerase.
Brissett, Nigel C; Martin, Maria J; Pitcher, Robert S; Bianchi, Julie; Juarez, Raquel; Green, Andrew J; Fox, Gavin C; Blanco, Luis; Doherty, Aidan J
2011-01-21
In many prokaryotes, a specific DNA primase/polymerase (PolDom) is required for nonhomologous end joining (NHEJ) repair of DNA double-strand breaks (DSBs). Here, we report the crystal structure of a catalytically active conformation of Mycobacterium tuberculosis PolDom, consisting of a polymerase bound to a DNA end with a 3' overhang, two metal ions, and an incoming nucleotide but, significantly, lacking a primer strand. This structure represents a polymerase:DNA complex in a preternary intermediate state. This polymerase complex occurs in solution, stabilizing the enzyme on DNA ends and promoting nucleotide extension of short incoming termini. We also demonstrate that the invariant Arg(220), contained in a conserved loop (loop 2), plays an essential role in catalysis by regulating binding of a second metal ion in the active site. We propose that this NHEJ intermediate facilitates extension reactions involving critically short or noncomplementary DNA ends, thus promoting break repair and minimizing sequence loss during DSB repair. Copyright © 2011 Elsevier Inc. All rights reserved.
Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong
2016-01-01
Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149
Parasuram, Ramya; Coulther, Timothy A; Hollander, Judith M; Keston-Smith, Elise; Ondrechen, Mary Jo; Beuning, Penny J
2018-02-20
The process of DNA replication is carried out with high efficiency and accuracy by DNA polymerases. The replicative polymerase in E. coli is DNA Pol III, which is a complex of 10 different subunits that coordinates simultaneous replication on the leading and lagging strands. The 1160-residue Pol III alpha subunit is responsible for the polymerase activity and copies DNA accurately, making one error per 10 5 nucleotide incorporations. The goal of this research is to determine the residues that contribute to the activity of the polymerase subunit. Homology modeling and the computational methods of THEMATICS and POOL were used to predict functionally important amino acid residues through their computed chemical properties. Site-directed mutagenesis and biochemical assays were used to validate these predictions. Primer extension, steady-state single-nucleotide incorporation kinetics, and thermal denaturation assays were performed to understand the contribution of these residues to the function of the polymerase. This work shows that the top 15 residues predicted by POOL, a set that includes the three previously known catalytic aspartate residues, seven remote residues, plus five previously unexplored first-layer residues, are important for function. Six previously unidentified residues, R362, D405, K553, Y686, E688, and H760, are each essential to Pol III activity; three additional residues, Y340, R390, and K758, play important roles in activity.
Seco, Elena M.
2017-01-01
Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448
Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently
Yu, Chuanhe; Gan, Haiyun
2017-01-01
ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720
DEFF Research Database (Denmark)
Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer
DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...
Vautrin, Sonia; Zhang, David
2007-01-01
A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
Kozmin, Stanislav G; Pavlov, Youri I; Kunkel, Thomas A; Sage, Evelyne
2003-08-01
Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase eta (Poleta) and polymerase zeta (Polzeta), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310-1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Delta, rev3Delta and rev3Delta rad30Delta strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6-4) photoproducts derived from studies with UVC. They further suggest that Poleta participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polzeta is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polzeta, Poleta contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine.
Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1
DEFF Research Database (Denmark)
Xing, Xuanxuan; Zhang, Likui; Guo, Li
2014-01-01
the hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....
Replicative DNA polymerase mutations in cancer.
Heitzer, Ellen; Tomlinson, Ian
2014-02-01
Three DNA polymerases - Pol α, Pol δ and Pol ɛ - are essential for DNA replication. After initiation of DNA synthesis by Pol α, Pol δ or Pol ɛ take over on the lagging and leading strand respectively. Pol δ and Pol ɛ perform the bulk of replication with very high fidelity, which is ensured by Watson-Crick base pairing and 3'exonuclease (proofreading) activity. Yeast models have shown that mutations in the exonuclease domain of Pol δ and Pol ɛ homologues can cause a mutator phenotype. Recently, we identified germline exonuclease domain mutations (EDMs) in human POLD1 and POLE that predispose to 'polymerase proofreading associated polyposis' (PPAP), a disease characterised by multiple colorectal adenomas and carcinoma, with high penetrance and dominant inheritance. Moreover, somatic EDMs in POLE have also been found in sporadic colorectal and endometrial cancers. Tumors with EDMs are microsatellite stable and show an 'ultramutator' phenotype, with a dramatic increase in base substitutions. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A
2016-06-14
Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting
Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV ...
African Journals Online (AJOL)
Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV-infected Zulu population of South Africa. ... D B A Ojwach, C Aldous, P Kocheleff, B Sartorius ... of their capacity to impede human mitochondrial DNA polymerase-γ (POLG), ...
Structure and mechanism of human DNA polymerase [eta
Energy Technology Data Exchange (ETDEWEB)
Biertümpfel, Christian; Zhao, Ye; Kondo, Yuji; Ramón-Maiques, Santiago; Gregory, Mark; Lee, Jae Young; Masutani, Chikahide; Lehmann, Alan R.; Hanaoka, Fumio; Yang, Wei (Sussex); (NIH); (Gakushuin); (Osaka)
2010-11-03
The variant form of the human syndrome xeroderma pigmentosum (XPV) is caused by a deficiency in DNA polymerase {eta} (Pol{eta}), a DNA polymerase that enables replication through ultraviolet-induced pyrimidine dimers. Here we report high-resolution crystal structures of human Pol{eta} at four consecutive steps during DNA synthesis through cis-syn cyclobutane thymine dimers. Pol{eta} acts like a 'molecular splint' to stabilize damaged DNA in a normal B-form conformation. An enlarged active site accommodates the thymine dimer with excellent stereochemistry for two-metal ion catalysis. Two residues conserved among Pol{eta} orthologues form specific hydrogen bonds with the lesion and the incoming nucleotide to assist translesion synthesis. On the basis of the structures, eight Pol{eta} missense mutations causing XPV can be rationalized as undermining the molecular splint or perturbing the active-site alignment. The structures also provide an insight into the role of Pol{eta} in replicating through D loop and DNA fragile sites.
Translesion DNA polymerases Pol ζ, Pol η, Pol ι, Pol κ and Rev1 are ...
Indian Academy of Sciences (India)
MADU
Specialized DNA polymerases called translesion polymerases are among the major determinants of spontaneous and DNA damage-induced mutation in both prokaryotes and eukaryotes. (Livneh 2001). The classical replicative DNA polymerases can synthesize DNA with remarkable efficiency and fidelity.
Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ
DEFF Research Database (Denmark)
Euro, Liliya; Haapanen, Outi; Róg, Tomasz
2017-01-01
of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable......DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site...... changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform...
Shpakovskiĭ, G V; Lebedenko, E N
1997-05-01
The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.
Church, Trenton Mel; Verma, Dinesh; Thompson, Jacob; Swaminathan, Sankar
2018-03-15
Epstein-Barr virus (EBV) is linked to the development of both lymphoid and epithelial malignancies worldwide. The M81 strain of EBV, isolated from a Chinese patient with nasopharyngeal carcinoma (NPC), demonstrates spontaneous lytic replication and high-titer virus production in comparison to the prototype B95-8 EBV strain. Genetic comparisons of M81 and B95-8 EBVs were previously been performed in order to determine if the hyperlytic property of M81 is associated with sequence differences in essential lytic genes. EBV SM is an RNA-binding protein expressed during early lytic replication that is essential for virus production. We compared the functions of M81 SM and B95-8 SM and demonstrate that polymorphisms in SM do not contribute to the lytic phenotype of M81 EBV. However, the expression level of the EBV DNA polymerase protein was much higher in M81- than in B95-8-infected cells. The relative deficiency in the expression of B95-8 DNA polymerase was related to the B95-8 genome deletion, which truncates the BALF5 3' untranslated region (UTR). Similarly, the insertion of bacmid DNA into the widely used recombinant B95-8 bacmid creates an inefficient BALF5 3' UTR. We further showed that the while SM is required for and facilitates the efficient expression of both M81 and B95-8 mRNAs regardless of the 3' UTR, the BALF5 3' UTR sequence is important for BALF5 protein translation. These data indicate that the enhanced lytic replication and virus production of M81 compared to those of B95-8 are partly due to the robust translation of EBV DNA polymerase required for viral DNA replication due to a more efficient BALF5 3' UTR in M81. IMPORTANCE Epstein-Barr virus (EBV) infects more than 90% of the human population, but the incidence of EBV-associated tumors varies greatly in different parts of the world. Thus, understanding the connection between genetic polymorphisms from patient isolates of EBV, gene expression phenotypes, and disease is important and may help in
Directory of Open Access Journals (Sweden)
Olivier Martínez
Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.
Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η
O’Flaherty, D. K.; Patra, A.; Su, Y.; Guengerich, F. P.; Egli, M.; Wilds, C. J.
2016-01-01
DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O4-Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4-O4 bond on processing by human DNA polymerase η (hPol η) was studied for oligonucleotides containing O4-methylthymidine, O4-ethylthymidine, and analogs restricting the O4-methylene group in an anti-orientation. Primer extens...
Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.
Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar
2018-06-05
The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.
PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.
Cline, J; Braman, J C; Hogrefe, H H
1996-01-01
The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...
Separation of DNA-dependent polymerase activities in Micrococcus radiodurans
Energy Technology Data Exchange (ETDEWEB)
Kitayama, S; Matsuyama, A [Institute of Physical and Chemical Research, Wako, Saitama (Japan)
1977-03-02
DNA polymerase activities in Micrococcus radiodurans were separated into two fractions after purification more than 2000 fold. They differ in pH optimum and residual activities in the absence of a full deoxyribonucleoside triphosphates complement. NAD partly inhibited one of the activities. Both activities were eluted as a single peak on gel filtration and sedimented at the same rate on glycerol gradient centrifugation. Molecular weight 140000 was calculated from Stokes radius and sedimentation constant. Deoxyribonuclease activity was detected on one of the polymerase activities which preferentially degraded double-stranded DNA. Priming activity of nicked DNA was reduced by ..gamma.. radiation. These results have been related to the possible roles in repair synthesis in vivo or DNA synthesis in permeable cells of M. radiodurans.
Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus.
De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M
1999-08-06
Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.
Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K
1999-01-01
The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...
Directory of Open Access Journals (Sweden)
Hirokazu Takahashi
Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.
Directory of Open Access Journals (Sweden)
Claudia Huber
Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.
Involvement of the yeast DNA polymerase delta in DNA repair in vivo
Energy Technology Data Exchange (ETDEWEB)
Giot, L. [State University of New York at Stony Brook, Stony Brook, NY. (United States); Chanet, R.; Simon, M.; Facca, C.; Faye, G.
1997-08-15
The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)
Mechanistic Studies with DNA Polymerases Reveal Complex Outcomes following Bypass of DNA Damage
Directory of Open Access Journals (Sweden)
Robert L. Eoff
2010-01-01
Full Text Available DNA is a chemically reactive molecule that is subject to many different covalent modifications from sources that are both endogenous and exogenous in origin. The inherent instability of DNA is a major obstacle to genomic maintenance and contributes in varying degrees to cellular dysfunction and disease in multi-cellular organisms. Investigations into the chemical and biological aspects of DNA damage have identified multi-tiered and overlapping cellular systems that have evolved as a means of stabilizing the genome. One of these pathways supports DNA replication events by in a sense adopting the mantra that one must “make the best of a bad situation” and tolerating covalent modification to DNA through less accurate copying of the damaged region. Part of this so-called DNA damage tolerance pathway involves the recruitment of specialized DNA polymerases to sites of stalled or collapsed replication forks. These enzymes have unique structural and functional attributes that often allow bypass of adducted template DNA and successful completion of genomic replication. What follows is a selective description of the salient structural features and bypass properties of specialized DNA polymerases with an emphasis on Y-family members.
Assessing the contribution of the herpes simplex virus DNA polymerase to spontaneous mutations
Directory of Open Access Journals (Sweden)
Leary Jeffry J
2002-05-01
Full Text Available Abstract Background The thymidine kinase (tk mutagenesis assay is often utilized to determine the frequency of herpes simplex virus (HSV replication-mediated mutations. Using this assay, clinical and laboratory HSV-2 isolates were shown to have a 10- to 80-fold higher frequency of spontaneous mutations compared to HSV-1. Methods A panel of HSV-1 and HSV-2, along with polymerase-recombinant viruses expressing type 2 polymerase (Pol within a type 1 genome, were evaluated using the tk and non-HSV DNA mutagenesis assays to measure HSV replication-dependent errors and determine whether the higher mutation frequency of HSV-2 is a distinct property of type 2 polymerases. Results Although HSV-2 have mutation frequencies higher than HSV-1 in the tk assay, these errors are assay-specific. In fact, wild type HSV-1 and the antimutator HSV-1 PAAr5 exhibited a 2–4 fold higher frequency than HSV-2 in the non-HSV DNA mutatagenesis assay. Furthermore, regardless of assay, HSV-1 recombinants expressing HSV-2 Pol had error rates similar to HSV-1, whereas the high mutator virus, HSV-2 6757, consistently showed signficant errors. Additionally, plasmid DNA containing the HSV-2 tk gene, but not type 1 tk or LacZ DNA, was shown to form an anisomorphic DNA stucture. Conclusions This study suggests that the Pol is not solely responsible for the virus-type specific differences in mutation frequency. Accordingly, it is possible that (a mutations may be modulated by other viral polypeptides cooperating with Pol, and (b the localized secondary structure of the viral genome may partially account for the apparently enhanced error frequency of HSV-2.
International Nuclear Information System (INIS)
O'Connor, D.; Stoehrer, G.
1985-01-01
Oligodeoxyribonucleotides with site-specific modifications have been used as substrates for Escherichia coli DNA polymerase I holoenzyme and Klenow fragment. Modifications included the bulky guanine-8-aminofluorene adduct and a guanine oxidation product resembling the product of photosensitized DNA oxidation. By a combination of primers and nick-mers, conditions of single-strand-directed DNA synthesis and nick-translation could be created. The results show that the polymerase can bypass both types of lesions. Bypass occurs on a single-stranded template but is facilitated on a nicked, double-stranded template. Only purines, with guanine more favored than adenine, are incorporated across both lesions. The results indicate that site-specifically modified oligonucleotides can be sensitive probes for the action of polymerases on damaged templates. They also suggest a function for polymerase I, in its nick-translation capacity, during DNA repair and mutagenesis
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
van den Berg, A.A.
2017-01-01
During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and
Directory of Open Access Journals (Sweden)
Haifeng eChen
2015-11-01
Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.
International Nuclear Information System (INIS)
Wernette, C.M.; Kaguni, L.S.
1986-01-01
The mitochondrial DNA polymerase has been purified to near-homogeneity from early embryos of Drosophila melanogaster. Sodium dodecyl sulfate gel electrophoresis of the highly purified enzyme reveals two polypeptides with molecular masses of 125,000 and 35,000 daltons, in a ratio of 1:1. The enzyme has a sedimentation coefficient of 7.6 S and a stokes radius of 51 A. Taken together, the data suggest that the D. melanogaster DNA polymerase γ is a heterodimer. DNA polymerase activity gel analysis has allowed the assignment of the DNA polymerization function to the large subunit. The DNA polymerase exhibits a remarkable ability to utilize efficiently a variety of template-primers including gapped DNA, poly(rA).oligo(dT) and singly primed phiX174 DNA. Both the crude and the highly purified enzymes are stimulated by KCl, and inhibited by dideoxythymidine triphosphate and by N-ethylmaleimide. Thus, the catalytic properties of the near-homogeneous Drosophila enzyme are consistent with those of DNA polymerase γ as partially purified from several vertebrates
Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis
Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai
2010-01-01
The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817
Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase
Directory of Open Access Journals (Sweden)
Nigel C. Brissett
2013-11-01
Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.
Interactions and Localization of Escherichia coli Error-Prone DNA Polymerase IV after DNA Damage.
Mallik, Sarita; Popodi, Ellen M; Hanson, Andrew J; Foster, Patricia L
2015-09-01
Escherichia coli's DNA polymerase IV (Pol IV/DinB), a member of the Y family of error-prone polymerases, is induced during the SOS response to DNA damage and is responsible for translesion bypass and adaptive (stress-induced) mutation. In this study, the localization of Pol IV after DNA damage was followed using fluorescent fusions. After exposure of E. coli to DNA-damaging agents, fluorescently tagged Pol IV localized to the nucleoid as foci. Stepwise photobleaching indicated ∼60% of the foci consisted of three Pol IV molecules, while ∼40% consisted of six Pol IV molecules. Fluorescently tagged Rep, a replication accessory DNA helicase, was recruited to the Pol IV foci after DNA damage, suggesting that the in vitro interaction between Rep and Pol IV reported previously also occurs in vivo. Fluorescently tagged RecA also formed foci after DNA damage, and Pol IV localized to them. To investigate if Pol IV localizes to double-strand breaks (DSBs), an I-SceI endonuclease-mediated DSB was introduced close to a fluorescently labeled LacO array on the chromosome. After DSB induction, Pol IV localized to the DSB site in ∼70% of SOS-induced cells. RecA also formed foci at the DSB sites, and Pol IV localized to the RecA foci. These results suggest that Pol IV interacts with RecA in vivo and is recruited to sites of DSBs to aid in the restoration of DNA replication. DNA polymerase IV (Pol IV/DinB) is an error-prone DNA polymerase capable of bypassing DNA lesions and aiding in the restart of stalled replication forks. In this work, we demonstrate in vivo localization of fluorescently tagged Pol IV to the nucleoid after DNA damage and to DNA double-strand breaks. We show colocalization of Pol IV with two proteins: Rep DNA helicase, which participates in replication, and RecA, which catalyzes recombinational repair of stalled replication forks. Time course experiments suggest that Pol IV recruits Rep and that RecA recruits Pol IV. These findings provide in vivo evidence
Vermeulen, C.; Verwijs-Janssen, M.; Begg, A.C.; Vens, C.
2008-01-01
PURPOSE: The purpose of the present study was to determine the role of DNA polymerase beta in repair and response after ionizing radiation in different phases of the cell cycle. METHODS AND MATERIALS: Synchronized cells deficient and proficient in DNA polymerase beta were irradiated in different
Fidelity and Mutational Spectrum of Pfu DNA Polymerase on a Human Mitochondrial DNA Sequence
André, Paulo; Kim, Andrea; Khrapko, Konstantin; Thilly, William G.
1997-01-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10−6 must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or “PCR noise”. Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 × 10−7, and five of its more frequent mutations (hot spots) consisted of three transversions (GC → TA, AT → TA, and AT → CG), one transition (AT → GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes
International Nuclear Information System (INIS)
Zhang, H.; Wang, J.C.; Liu, L.F.
1988-01-01
Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role
Rodríguez, Irene; Lázaro, José M.; Blanco, Luis; Kamtekar, Satwik; Berman, Andrea J.; Wang, Jimin; Steitz, Thomas A.; Salas, Margarita; de Vega, Miguel
2005-01-01
Recent crystallographic studies of φ29 DNA polymerase have provided structural insights into its strand displacement and processivity. A specific insertion named terminal protein region 2 (TPR2), present only in protein-primed DNA polymerases, together with the exonuclease, thumb, and palm subdomains, forms two tori capable of interacting with DNA. To analyze the functional role of this insertion, we constructed a φ29 DNA polymerase deletion mutant lacking TPR2 amino acid residues Asp-398 to Glu-420. Biochemical analysis of the mutant DNA polymerase indicates that its DNA-binding capacity is diminished, drastically decreasing its processivity. In addition, removal of the TPR2 insertion abolishes the intrinsic capacity of φ29 DNA polymerase to perform strand displacement coupled to DNA synthesis. Therefore, the biochemical results described here directly demonstrate that TPR2 plays a critical role in strand displacement and processivity. PMID:15845765
International Nuclear Information System (INIS)
Morita, T.; Nakamura, H.; Tsutsui, Y.; Nishiyama, Y.; Yoshida, S.
1982-01-01
Aphidicolin specifically inhibits eukaryotic DNA polymerase α, while 2',3'-dideoxythymidine 5'-triphosphate (d 2 TTP) inhibits DNA polymerase ν and ν but not α. 1-ν-D-Arabinofuranosylcytosine 5'-triphosphate (araCTP) inhibits both DNA polymerase α and ν although to a different extent. Here we measured the effects of these inhibitors on repair DNA synthesis of U.V.-irradiated HeLa cells by two different methods. Firstly, aphidicolin, 1-ν-D-arabinofuranosylcytosine (araC, a precursor of araCTP) and 2',3'-dideoxythimidine (d 2 Thd, a precursor of d 2 TTP) were added directly to the culture medium. In this case, aphidicolin and araC strongly inhibited replicative DNA synthesis of HeLa cells, and they also inhibited repair synthesis after U.V.-irradiation but to a much lesser extent. In contrast, high concentrations of d 2 Thd inhibited repair DNA synthesis to a higher extent than replicative DNA synthesis. Secondly, the active form of inhibitor, d 2 TTP, was microinjected directly into cytoplasm or nuclei or U.V.-irradiated HeLa cells. Microinjection of d 2 TTP effectively inhibited repair synthesis. The microinjection of d 2 TTP, into either cytoplasm or nucleus, strongly inhibited replicative synthesis. These results might indicate that multiple DNA polymerases are involved in repair synthesis as well as in replicative synthesis
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
Kozmin, Stanislav G.; Pavlov, Youri I.; Kunkel, Thomas A.; Sage, Evelyne
2003-01-01
Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase η (Polη) and polymerase ζ (Polζ), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310–1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Δ, rev3Δ and rev3Δ rad30Δ strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6–4) photoproducts derived from studies with UVC. They further suggest that Polη participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polζ is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polζ, Polη contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine. PMID:12888515
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
International Nuclear Information System (INIS)
Bernges, F.; Holler, E.
1988-01-01
The effects of the reaction of cis- and trans-diamminedichloroplatinum(II) with DNA have been measured with regard to DNA synthesis, 3'-5' exonuclease (proofreading), and 5'-3' exonuclease (repair) activities of Escherichia coli DNA polymerase I. Both isomers inhibit DNA synthetic activity of the polymerase through an increase in K/sub m/ values and a decrease in V/sub max/ values for platinated DNA but not for the nucleoside 5'-triphosphates as the varied substrates. The inhibition is a consequence of lowered binding affinity between platinated DNA and DNA polymerase, and of a platination-induced separation of template and primer strands. Strand separation enhances initial rates of 3'-5' excision of [ 3 H]dCMP from platinated DNA (proofreading), while total excision levels of nucleotides are decreased. In contrast to proofreading activity, the 5'-3' exonuclease activity (repair) discriminates between DNA which had reacted with cis- and with trans-diamminedichloroplatinum(II). While both initial rates and total excision are inhibited for the cis isomer, they are almost not affected for the trans isomer. This differential effect could explain why bacterial growth inhibition requires much higher concentrations of trans- than cis-diamminedichloroplatinum(II)
Sherrer, Shanen M.; Taggart, David J.; Pack, Lindsey R.; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2012-01-01
N- (deoxyguanosin-8-yl)-1-aminopyrene (dGAP) is the predominant nitro polyaromatic hydrocarbon product generated from the air pollutant 1-nitropyrene reacting with DNA. Previous studies have shown that dGAP induces genetic mutations in bacterial and mammalian cells. One potential source of these mutations is the error-prone bypass of dGAP lesions catalyzed by the low-fidelity Y-family DNA polymerases. To provide a comparative analysis of the mutagenic potential of the translesion DNA synthesis (TLS) of dGAP, we employed short oligonucleotide sequencing assays (SOSAs) with the model Y-family DNA polymerase from Sulfolobus solfataricus, DNA Polymerase IV (Dpo4), and the human Y-family DNA polymerases eta (hPolη), kappa (hPolκ), and iota (hPolι). Relative to undamaged DNA, all four enzymes generated far more mutations (base deletions, insertions, and substitutions) with a DNA template containing a site-specifically placed dGAP. Opposite dGAP and at an immediate downstream template position, the most frequent mutations made by the three human enzymes were base deletions and the most frequent base substitutions were dAs for all enzymes. Based on the SOSA data, Dpo4 was the least error-prone Y-family DNA polymerase among the four enzymes during the TLS of dGAP. Among the three human Y-family enzymes, hPolκ made the fewest mutations at all template positions except opposite the lesion site. hPolκ was significantly less error-prone than hPolι and hPolη during the extension of dGAP bypass products. Interestingly, the most frequent mutations created by hPolι at all template positions were base deletions. Although hRev1, the fourth human Y-family enzyme, could not extend dGAP bypass products in our standing start assays, it preferentially incorporated dCTP opposite the bulky lesion. Collectively, these mutagenic profiles suggest that hPolkk and hRev1 are the most suitable human Y-family DNA polymerases to perform TLS of dGAP in humans. PMID:22917544
Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N
2004-07-16
A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.
Role of DNA polymerase α in chromosomal aberration production by ionizing radiation
International Nuclear Information System (INIS)
Bender, M.A.
1983-01-01
Aphidicolin is a tetracyclic diterpinoid fungal antibiotic which inhibits DNA synthesis in eukaryotic cells by interfering specifically with DNA polymerase α, apparently by binding to and inactivating the DNA-polymerase α complex. We have shown that aphidicolin, like other inhibitors of DNA synthesis, both induces chromosomal aberrations in human peripheral lymphocytes, and, as a post-treatment, interacts synergistically with x rays to produce greatly enhanced aberration yields. The present experiments explore the effects of aphidicolin in human lymphocytes in the post-DNA-synthetic G 2 phase of the cell cycle. These experiments utilized labeling with tritiated thymidine to positively identify cells in the S phase at the time of treatment, and used serial colcemid collections and fixations to determine aberration yields over as much of the G 2 phase as feasible. Because DNA polymerase α is the only DNA synthetic or repair enzyme known to be affected by aphidicolin, we infer that this enzyme is directly involved in the repair of DNA lesions which can result in visible chromosomal aberrations. (DT)
Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene.
Horvath, Rita; Hudson, Gavin; Ferrari, Gianfrancesco; Fütterer, Nancy; Ahola, Sofia; Lamantea, Eleonora; Prokisch, Holger; Lochmüller, Hanns; McFarland, Robert; Ramesh, V; Klopstock, Thomas; Freisinger, Peter; Salvi, Fabrizio; Mayr, Johannes A; Santer, Rene; Tesarova, Marketa; Zeman, Jiri; Udd, Bjarne; Taylor, Robert W; Turnbull, Douglass; Hanna, Michael; Fialho, Doreen; Suomalainen, Anu; Zeviani, Massimo; Chinnery, Patrick F
2006-07-01
Mutations in the gene coding for the catalytic subunit of the mitochondrial DNA (mtDNA) polymerase gamma (POLG1) have recently been described in patients with diverse clinical presentations, revealing a complex relationship between genotype and phenotype in patients and their families. POLG1 was sequenced in patients from different European diagnostic and research centres to define the phenotypic spectrum and advance understanding of the recurrence risks. Mutations were identified in 38 cases, with the majority being sporadic compound heterozygotes. Eighty-nine DNA sequence changes were identified, including 2 predicted to alter a splice site, 1 predicted to cause a premature stop codon and 13 predicted to cause novel amino acid substitutions. The majority of children had a mutation in the linker region, often 1399G-->A (A467T), and a mutation affecting the polymerase domain. Others had mutations throughout the gene, and 11 had 3 or more substitutions. The clinical presentation ranged from the neonatal period to late adult life, with an overlapping phenotypic spectrum from severe encephalopathy and liver failure to late-onset external ophthalmoplegia, ataxia, myopathy and isolated muscle pain or epilepsy. There was a strong gender bias in children, with evidence of an environmental interaction with sodium valproate. POLG1 mutations cause an overlapping clinical spectrum of disease with both dominant and recessive modes of inheritance. 1399G-->A (A467T) is common in children, but complete POLG1 sequencing is required to identify multiple mutations that can have complex implications for genetic counselling.
Amplified Detection of the Aptamer-Vanillin Complex with the Use of Bsm DNA Polymerase.
Andrianova, Mariia; Komarova, Natalia; Grudtsov, Vitaliy; Kuznetsov, Evgeniy; Kuznetsov, Alexander
2017-12-26
The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET)-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10 -6 -1 × 10 -8 M) was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10 -8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4).
Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB
Directory of Open Access Journals (Sweden)
Lenice Roteia Cardoso Jung
2015-06-01
Full Text Available Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR. The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.
Identification of Leptospira serovars by RFLP of the RNA polymerase beta subunit gene (rpoB).
Jung, Lenice Roteia Cardoso; Bomfim, Maria Rosa Quaresma; Kroon, Erna Geessien; Nunes, Álvaro Cantini
2015-06-01
Leptospires are usually classified by methods based on DNA-DNA hybridization and the conventional cross-agglutination absorption test, which uses polyclonal antibodies against lipopolysaccharides. In this study, the amplification of the rpoB gene, which encodes the beta-subunit of RNA polymerase, was used as an alternative tool to identify Leptospira. DNA extracts from sixty-eight serovars were obtained, and the hypervariable region located between 1990 and 2500-bp in the rpoB gene was amplified by polymerase chain reaction (PCR). The 600-bp amplicons of the rpoB gene were digested with the restriction endonucleases TaqI, Tru1I, Sau3AI and MslI, and the restriction fragments were separated by 6% polyacrylamide gel electrophoresis. Thirty-five fragment patters were obtained from the combined data of restriction fragment length polymorphism (PCR-RFLP) analysis and used to infer the phylogenetic relationships among the Leptospira species and serovars. The species assignments obtained were in full agreement with the established taxonomic classifications. Twenty-two serovars were effectively identified based on differences in their molecular profiles. However, the other 46 serovars remained clustered in groups that included more than one serovar of different species. This study demonstrates the value of RFLP analysis of PCR-amplified rpoB as an initial method for identifying Leptospira species and serovars.
International Nuclear Information System (INIS)
Sidorenko, Julia; Jatsenko, Tatjana; Saumaa, Signe; Teras, Riho; Tark-Dame, Mariliis; Horak, Rita; Kivisaar, Maia
2011-01-01
The majority of bacteria possess a different set of specialized DNA polymerases than those identified in the most common model organism Escherichia coli. Here, we have studied the ability of specialized DNA polymerases to substitute Pol I in DNA replication in Pseudomonas putida. Our results revealed that P. putida Pol I-deficient cells have severe growth defects in LB medium, which is accompanied by filamentous cell morphology. However, growth of Pol I-deficient bacteria on solid rich medium can be restored by reduction of reactive oxygen species in cells. Also, mutants with improved growth emerge rapidly. Similarly to the initial Pol I-deficient P. putida, its adapted derivatives express a moderate mutator phenotype, which indicates that DNA replication carried out in the absence of Pol I is erroneous both in the original Pol I-deficient bacteria and the adapted derivatives. Analysis of the spectra of spontaneous Rif r mutations in P. putida strains lacking different DNA polymerases revealed that the presence of specialized DNA polymerases Pol II and Pol IV influences the frequency of certain base substitutions in Pol I-proficient and Pol I-deficient backgrounds in opposite ways. Involvement of another specialized DNA polymerase DnaE2 in DNA replication in Pol I-deficient bacteria is stimulated by UV irradiation of bacteria, implying that DnaE2-provided translesion synthesis partially substitutes the absence of Pol I in cells containing heavily damaged DNA.
International Nuclear Information System (INIS)
Baksi, K.; Kumar, A.
1978-01-01
Effect of neonatal undernutrition on the two forms of DNA polymerases obtained by DEAF-cellulose column chromatography of the solubilized nuclei and the high speed supernatant fractions of cerebellum and liver of rats has been studied. The form of DNA polymerase eluting with 0.1 M potassium phosphate buffer (pH 7.5) was significantly reduced, whereas that eluting with 0.3 M buffer (pH 7.5) was devoid of neonatal undernutrition effect. The properties of the separated DNA polymerases, both from cerebellum and liver, of control and undernourished groups were also studied. [Me- 3 H]thymidine-5--'triphosphate has been used in the study. (author)
Enrichment of deleterious variants of mitochondrial DNA polymerase gene (POLG1) in bipolar disorder.
Kasahara, Takaoki; Ishiwata, Mizuho; Kakiuchi, Chihiro; Fuke, Satoshi; Iwata, Nakao; Ozaki, Norio; Kunugi, Hiroshi; Minabe, Yoshio; Nakamura, Kazuhiko; Iwata, Yasuhide; Fujii, Kumiko; Kanba, Shigenobu; Ujike, Hiroshi; Kusumi, Ichiro; Kataoka, Muneko; Matoba, Nana; Takata, Atsushi; Iwamoto, Kazuya; Yoshikawa, Takeo; Kato, Tadafumi
2017-08-01
Rare missense variants, which likely account for a substantial portion of the genetic 'dark matter' for a common complex disease, are challenging because the impacts of variants on disease development are difficult to substantiate. This study aimed to examine the impacts of amino acid substitution variants in the POLG1 found in bipolar disorder, as an example and proof of concept, in three different modalities of assessment: in silico predictions, in vitro biochemical assays, and clinical evaluation. We then tested whether deleterious variants in POLG1 contributed to the genetics of bipolar disorder. We searched for variants in the POLG1 gene in 796 Japanese patients with bipolar disorder and 767 controls and comprehensively investigated all 23 identified variants in the three modalities of assessment. POLG1 encodes mitochondrial DNA polymerase and is one of the causative genes for a Mendelian-inheritance mitochondrial disease, which is occasionally accompanied by mood disorders. The healthy control data from the Tohoku Medical Megabank Organization were also employed. Although the frequency of carriers of deleterious variants varied from one method to another, every assessment achieved the same conclusion that deleterious POLG1 variants were significantly enriched in the variants identified in patients with bipolar disorder compared to those in controls. Together with mitochondrial dysfunction in bipolar disorder, the present results suggested deleterious POLG1 variants as a credible risk for the multifactorial disease. © 2016 The Authors. Psychiatry and Clinical Neurosciences published by John Wiley & Sons Australia, Ltd on behalf of Japanese Society of Psychiatry and Neurology.
Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping
2015-11-01
Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.
Energy Technology Data Exchange (ETDEWEB)
Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)
1999-02-01
DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
Czech Academy of Sciences Publication Activity Database
Matyašovský, Ján; Perlíková, Pavla; Malnuit, Vincent; Pohl, Radek; Hocek, Michal
2016-01-01
Roč. 55, č. 51 (2016), s. 15856-15859 ISSN 1433-7851 R&D Projects: GA ČR GA14-04289S EU Projects: European Commission(XE) 642023 - ClickGene Institutional support: RVO:61388963 Keywords : bioconjugation * DNA modification * DNA polymerase * nucleotides * fluorescent labelling Subject RIV: CC - Organic Chemistry Impact factor: 11.994, year: 2016 http://onlinelibrary.wiley.com/doi/10.1002/anie.201609007/full
Amplified Detection of the Aptamer–Vanillin Complex with the Use of Bsm DNA Polymerase
Directory of Open Access Journals (Sweden)
Mariia Andrianova
2017-12-01
Full Text Available The electrochemical detection of interactions between aptamers and low-molecular-weight targets often lacks sensitivity. Signal amplification improves the detection of the aptamer-analyte complex; Bsm DNA polymerase was used to amplify the signal from the interaction of vanillin and its aptamer named Van_74 on an ion-sensitive field-effect transistor (ISFET-based biosensor. The aptamer was immobilized on the ISFET sensitive surface. A short DNA probe was hybridized with the aptamer and dissociated from it upon vanillin addition. A free probe interacted with a special DNA molecular beacon initiated the Bsm DNA polymerase reaction that was detected by ISFET. A buffer solution suitable for both aptamer action and Bsm DNA polymerase activity was determined. The ISFET was shown to detect the Bsm DNA polymerase reaction under the selected conditions. Vanillin at different concentrations (1 × 10−6–1 × 10−8 M was detected using the biosensor with signal amplification. The developed detection system allowed for the determination of vanillin, starting at a 10−8 M concentration. Application of the Bsm DNA polymerase resulted in a 15.5 times lower LoD when compared to the biosensor without signal amplification (10.1007/s00604-017-2586-4.
Directory of Open Access Journals (Sweden)
Partha Sarathi Mandal
2017-03-01
Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.
DNA polymerase ι: The long and the short of it!
Frank, Ekaterina G; McLenigan, Mary P; McDonald, John P; Huston, Donald; Mead, Samantha; Woodgate, Roger
2017-10-01
The cDNA encoding human DNA polymerase ι (POLI) was cloned in 1999. At that time, it was believed that the POLI gene encoded a protein of 715 amino acids. Advances in DNA sequencing technologies led to the realization that there is an upstream, in-frame initiation codon that would encode a DNA polymerase ι (polι) protein of 740 amino acids. The extra 25 amino acid region is rich in acidic residues (11/25) and is reasonably conserved in eukaryotes ranging from fish to humans. As a consequence, the curated Reference Sequence (RefSeq) database identified polι as a 740 amino acid protein. However, the existence of the 740 amino acid polι has never been shown experimentally. Using highly specific antibodies to the 25 N-terminal amino acids of polι, we were unable to detect the longer 740 amino acid (ι-long) isoform in western blots. However, trace amounts of the ι-long isoform were detected after enrichment by immunoprecipitation. One might argue that the longer isoform may have a distinct biological function, if it exhibits significant differences in its enzymatic properties from the shorter, well-characterized 715 amino acid polι. We therefore purified and characterized recombinant full-length (740 amino acid) polι-long and compared it to full-length (715 amino acid) polι-short in vitro. The metal ion requirements for optimal catalytic activity differ slightly between ι-long and ι-short, but under optimal conditions, both isoforms exhibit indistinguishable enzymatic properties in vitro. We also report that like ι-short, the ι-long isoform can be monoubiquitinated and polyubiuquitinated in vivo, as well as form damage induced foci in vivo. We conclude that the predominant isoform of DNA polι in human cells is the shorter 715 amino acid protein and that if, or when, expressed, the longer 740 amino acid isoform has identical properties to the considerably more abundant shorter isoform. Published by Elsevier B.V.
Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II.
Steurer, Barbara; Marteijn, Jurgen A
2017-10-27
The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Melissis, S; Labrou, N E; Clonis, Y D
2006-07-28
The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.
Dapa, Tanja; Fleurier, Sébastien; Bredeche, Marie-Florence; Matic, Ivan
2017-07-01
Mitomycin C (MMC) is a genotoxic agent that induces DNA cross-links, DNA alkylation, and the production of reactive oxygen species (ROS). MMC induces the SOS response and RpoS regulons in Escherichia coli SOS-encoded functions are required for DNA repair, whereas the RpoS regulon is typically induced by metabolic stresses that slow growth. Thus, induction of the RpoS regulon by MMC may be coincidental, because DNA damage slows growth; alternatively, the RpoS regulon may be an adaptive response contributing to cell survival. In this study, we show that the RpoS regulon is primarily induced by MMC-induced ROS production. We also show that RpoS regulon induction is required for the survival of MMC-treated growing cells. The major contributor to RpoS-dependent resistance to MMC treatment is DNA polymerase Pol II, which is encoded by the polB gene belonging to the SOS regulon. The observation that polB gene expression is controlled by the two major stress response regulons that are required to maximize survival and fitness further emphasizes the key role of this DNA polymerase as an important factor in genome stability. Copyright © 2017 by the Genetics Society of America.
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Tetsuya, E-mail: suzukite@hiroshima-u.ac.jp [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Grúz, Petr; Honma, Masamitsu [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Adachi, Noritaka [Graduate School of Nanobioscience, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama 236-0027 (Japan); Nohmi, Takehiko [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan)
2016-09-15
Highlights: • Human cells knockout (KO) and expressing catalytically dead (CD) variant of DNA polymerase ζ (Pol ζ) have been established by gene targeting techniques with Nalm-6 cells. • Both Pol ζ KO and CD cells displayed prolonged cell cycle and higher incidence of micronucleus formation than the wild-type cells in the absence of exogenous genotoxic treatments. • Pol ζ protects human cells from genotoxic stresses that induce bulky DNA lesions and cross-links. • Pol ζ plays quite limited roles in protection against strand-breaks in DNA. - Abstract: Translesion DNA synthesis (TLS) is a cellular defense mechanism against genotoxins. Defects or mutations in specialized DNA polymerases (Pols) involved in TLS are believed to result in hypersensitivity to various genotoxic stresses. Here, DNA polymerase ζ (Pol ζ)-deficient (KO: knockout) and Pol ζ catalytically dead (CD) human cells were established and their sensitivity towards cytotoxic activities of various genotoxins was examined. The CD cells were engineered by altering the DNA sequence encoding two amino acids essential for the catalytic activity of Pol ζ, i.e., D2781 and D2783, to alanines. Both Pol ζ KO and CD cells displayed a prolonged cell cycle and higher incidence of micronuclei formation than the wild-type (WT) cells in the absence of exogenous genotoxic treatments, and the order of abnormality was CD > KO > WT cells. Both KO and CD cells exhibited higher sensitivity towards the killing effects of benzo[a]pyrene diol epoxide, mitomycin C, potassium bromate, N-methyl-N′-nitro-N-nitrosoguanidine, and ultraviolet C irradiation than WT cells, and there were no differences between the sensitivities of KO and CD cells. Interestingly, neither KO nor CD cells were sensitive to the cytotoxic effects of hydrogen peroxide. Since KO and CD cells displayed similar sensitivities to the genotoxins, we employed only KO cells to further examine their sensitivity to other genotoxic agents. KO cells were
International Nuclear Information System (INIS)
Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko
2016-01-01
Highlights: • Human cells knockout (KO) and expressing catalytically dead (CD) variant of DNA polymerase ζ (Pol ζ) have been established by gene targeting techniques with Nalm-6 cells. • Both Pol ζ KO and CD cells displayed prolonged cell cycle and higher incidence of micronucleus formation than the wild-type cells in the absence of exogenous genotoxic treatments. • Pol ζ protects human cells from genotoxic stresses that induce bulky DNA lesions and cross-links. • Pol ζ plays quite limited roles in protection against strand-breaks in DNA. - Abstract: Translesion DNA synthesis (TLS) is a cellular defense mechanism against genotoxins. Defects or mutations in specialized DNA polymerases (Pols) involved in TLS are believed to result in hypersensitivity to various genotoxic stresses. Here, DNA polymerase ζ (Pol ζ)-deficient (KO: knockout) and Pol ζ catalytically dead (CD) human cells were established and their sensitivity towards cytotoxic activities of various genotoxins was examined. The CD cells were engineered by altering the DNA sequence encoding two amino acids essential for the catalytic activity of Pol ζ, i.e., D2781 and D2783, to alanines. Both Pol ζ KO and CD cells displayed a prolonged cell cycle and higher incidence of micronuclei formation than the wild-type (WT) cells in the absence of exogenous genotoxic treatments, and the order of abnormality was CD > KO > WT cells. Both KO and CD cells exhibited higher sensitivity towards the killing effects of benzo[a]pyrene diol epoxide, mitomycin C, potassium bromate, N-methyl-N′-nitro-N-nitrosoguanidine, and ultraviolet C irradiation than WT cells, and there were no differences between the sensitivities of KO and CD cells. Interestingly, neither KO nor CD cells were sensitive to the cytotoxic effects of hydrogen peroxide. Since KO and CD cells displayed similar sensitivities to the genotoxins, we employed only KO cells to further examine their sensitivity to other genotoxic agents. KO cells were
Kinetic Analysis of the Bypass of a Bulky DNA Lesion Catalyzed by Human Y-family DNA Polymerases
Sherrer, Shanen M.; Sanman, Laura E.; Xia, Cynthia X.; Bolin, Eric R.; Malik, Chanchal K.; Efthimiopoulos, Georgia; Basu, Ashis K.; Suo, Zucai
2012-01-01
1-Nitropyrene (1-NP), a mutagen and potential carcinogen, is the most abundant nitro polyaromatic hydrocarbon in diesel exhaust, which reacts with DNA to form predominantly N-(deoxyguanosin-8-yl)-1-aminopyrene (dGAP). If not repaired, this DNA lesion is presumably bypassed in vivo by any of human Y-family DNA polymerases kappa (hPolκ), iota (hPolτ), eta (hPolη), and Rev1 (hRev1). Our running start assays demonstrated that each of these enzymes was indeed capable of traversing a site-specifically placed dGAP on a synthetic DNA template but hRev1 was stopped after lesion bypass. The time required to bypass 50% of the dGAP sites (t50bypass ) encountered by hPolη, hPolκ and hPolτ was determined to be 2.5 s, 4.1 s, and 106.5 s, respectively. The efficiency order of catalyzing translesion synthesis of dGAP (hPolη > hPolκ > hPolτ >> hRev1) is the same as the order for these human Y-family enzymes to elongate undamaged DNA. Although hPolη bypassed dGAP efficiently, replication by both hPolκ and hPolτ was strongly stalled at the lesion site and at a site immediately downstream from dGAP. By employing pre-steady state kinetic methods, a kinetic basis was established for polymerase pausing at these DNA template sites. Besides efficiency of bypass, the fidelity of those low-fidelity polymerases at these pause sites was also significantly decreased. Thus, if the translesion DNA synthesis of dGAP in vivo is catalyzed by a human Y-family DNA polymerase, e.g. hPolη, the process is certainly mutagenic. PMID:22324639
Directory of Open Access Journals (Sweden)
Modesto Redrejo-Rodríguez
2017-11-01
Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.
International Nuclear Information System (INIS)
Livneh, Z.
1986-01-01
Replication of UV-irradiated circular single-stranded phage M13 DNA by Escherichia coli RNA polymerase (EC 2.7.7.6) and DNA polymerase III holoenzyme (EC 2.7.7.7) in the presence of single-stranded DNA binding protein yielded full-length as well as partially replicated products. A similar result was obtained with phage G4 DNA primed with E. coli DNA primase, and phage phi X174 DNA primed with a synthetic oligonucleotide. The fraction of full-length DNA was several orders of magnitude higher than predicted if pyrimidine photodimers were to constitute absolute blocks to DNA replication. Recent models have suggested that pyrimidine photodimers are absolute blocks to DNA replication and that SOS-induced proteins are required to allow their bypass. Our results demonstrate that, under in vitro replication conditions, E. coli DNA polymerase III holoenzyme can insert nucleotides opposite pyrimidine dimers to a significant extent, even in the absence of SOS-induced proteins
International Nuclear Information System (INIS)
Sharma, Ajeet K; Chowdhury, Debashish
2013-01-01
A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)
Kazachenko, Konstantin Y; Miropolskaya, Nataliya A; Gening, Leonid V; Tarantul, Vyacheslav Z; Makarova, Alena V
2017-02-01
Y-family DNA polymerase iota (Pol ι) possesses both DNA polymerase and dRP lyase activities and was suggested to be involved in DNA translesion synthesis and base excision repair in mammals. The 129 strain of mice and its derivatives have a natural nonsense codon mutation in the second exon of the Pol ι gene resulting in truncation of the Pol ι protein. These mice were widely used as a Pol ι-null model for in vivo studies of the Pol ι function. However whether 129-derived strains of mice are fully deficient in the Pol ι functions was a subject of discussion since Pol ι mRNA undergoes alternative splicing at exon 2. Here we report purification of mouse Pol ι lacking the region encoded by exon 2, which includes several conserved residues involved in catalysis. We show that the deletion abrogates both the DNA polymerase and dRP lyase activities of Pol ι in the presence of either Mg 2+ or Mn 2+ ions. Thus, 129-derived strains of mice express catalytically inactive alternatively spliced Pol ι variant, whose cellular functions, if any exist, remain to be established. Copyright © 2017 Elsevier B.V. All rights reserved.
Brown, Jessica A.; Zhang, Likui; Sherrer, Shanen M.; Taylor, John-Stephen; Burgers, Peter M. J.; Suo, Zucai
2010-01-01
Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη), a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers) in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average) than the ground-state binding step (18-fold on average). Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides. PMID:20798853
Directory of Open Access Journals (Sweden)
Jessica A. Brown
2010-01-01
Full Text Available Understanding polymerase fidelity is an important objective towards ascertaining the overall stability of an organism's genome. Saccharomyces cerevisiae DNA polymerase η (yPolη, a Y-family DNA polymerase, is known to efficiently bypass DNA lesions (e.g., pyrimidine dimers in vivo. Using pre-steady-state kinetic methods, we examined both full-length and a truncated version of yPolη which contains only the polymerase domain. In the absence of yPolη's C-terminal residues 514–632, the DNA binding affinity was weakened by 2-fold and the base substitution fidelity dropped by 3-fold. Thus, the C-terminus of yPolη may interact with DNA and slightly alter the conformation of the polymerase domain during catalysis. In general, yPolη discriminated between a correct and incorrect nucleotide more during the incorporation step (50-fold on average than the ground-state binding step (18-fold on average. Blunt-end additions of dATP or pyrene nucleotide 5′-triphosphate revealed the importance of base stacking during the binding of incorrect incoming nucleotides.
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
Jatsenko, Tatjana; Sidorenko, Julia; Saumaa, Signe; Kivisaar, Maia
2017-01-01
Translesion DNA synthesis (TLS), facilitated by low-fidelity polymerases, is an important DNA damage tolerance mechanism. Here, we investigated the role and biological function of TLS polymerase ImuC (former DnaE2), generally present in bacteria lacking DNA polymerase V, and TLS polymerase DinB in response to DNA alkylation damage in Pseudomonas aeruginosa and P. putida. We found that TLS DNA polymerases ImuC and DinB ensured a protective role against N- and O-methylation induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) in both P. aeruginosa and P. putida. DinB also appeared to be important for the survival of P. aeruginosa and rapidly growing P. putida cells in the presence of methyl methanesulfonate (MMS). The role of ImuC in protection against MMS-induced damage was uncovered under DinB-deficient conditions. Apart from this, both ImuC and DinB were critical for the survival of bacteria with impaired base excision repair (BER) functions upon alkylation damage, lacking DNA glycosylases AlkA and/or Tag. Here, the increased sensitivity of imuCdinB double deficient strains in comparison to single mutants suggested that the specificity of alkylated DNA lesion bypass of DinB and ImuC might also be different. Moreover, our results demonstrated that mutagenesis induced by MMS in pseudomonads was largely ImuC-dependent. Unexpectedly, we discovered that the growth temperature of bacteria affected the efficiency of DinB and ImuC in ensuring cell survival upon alkylation damage. Taken together, the results of our study disclosed the involvement of ImuC in DNA alkylation damage tolerance, especially at low temperatures, and its possible contribution to the adaptation of pseudomonads upon DNA alkylation damage via increased mutagenesis.
Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente
2001-01-01
We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
International Nuclear Information System (INIS)
Shwartz, H.; Livneh, Z.
1987-01-01
During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers. The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP. The reinitiation events are nonproductive and are not followed by further elongation. The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase. Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers. We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini
Characterization of DNA polymerase. beta. mRNA: cell-cycle growth response in cultured human cells
Energy Technology Data Exchange (ETDEWEB)
Zmudzka, B Z; Fornace, A; Collins, J; Wilson, S H
1988-10-25
DNA polymerase ..beta.. (..beta..-polymerase) is a housekeeping enzyme involved in DNA repair in vertebrate cells. The authors used a cDNA probe to study abundance of ..beta..-polymerase mRNA in cultured human cells. The mRNA level in synchronized HeLa cells, representing different stages of the cell-cycle, varied only slightly. Contact inhibited fibroblasts AG-1522 contained the same level of mRNA as growing cells. The steady-state level of mRNA in fibroblasts is equivalent to 6 molecules per cell. The results indicate that the ..beta..-polymerase transcript is low abundance and is neither cell-cycles nor growth phase responsive.
Data of self-made Taq DNA polymerase prepared for screening purposes
Directory of Open Access Journals (Sweden)
E.V. Konovalova
2017-04-01
Full Text Available DNA analysis is a key procedure in genetic engineering. Nowadays the analysis is often done by PCR with Taq DNA polymerase. Although the last enzyme price is quite low, demand for numerous analyses results in much money expenditure which are not affordable for many laboratories. In a meanwhile, many screening tasks do not require the highly purified enzyme. Taking into account the enzyme unique properties it makes possible to marginally simplify its production without resorting to costly or lengthy techniques such as column chromatography and/or dialysis. Here the data of routine usage of Taq DNA polymerase prepared according to the protocol developed in our laboratory is presented. The protocol takes only several hours to realize and does not need qualified personnel or expensive equipment. Yet it gives the enzyme preparation suitable for most screening purposes. The isolated Taq DNA polymerase stock can be stored as ammonium sulfate suspension in a refrigerator for prolonged period, not less than 6 months. The working enzyme solution is prepared from the stock suspension on demand, not more than once in a month and can be stored also in a refrigerator.
Energy Technology Data Exchange (ETDEWEB)
Jones, J.C.; Stevsner, Tinna; Bohr, Vilhelm A. (National Cancer Institute, NIH, Bethesda, MD (USA). Division of Cancer Treatment, Laboratory of Molecular Pharmacology); Mattern, M.R. (Smith Kline Beecham Pharmaceuticals, King of Prussia, PA (USA). Department of Biomolecular Discovery)
1991-09-01
The effects were studied of some specific enzyme inhibitors on DNA repair and replication after UV damage in Chinese hamster ovary cells. The DNA repair was studied at the level of the average, overall genome and also in the active dihydrofolate reductase gene. Replication was measured in the overall genome. The inhibitors were tested of DNA poly-merase {alpha} and {delta} (aphidicolin), of poly(ADPr) polymerase (3-aminobenzamide), of ribonucleotide reductase (hydroxyurea), of topo-isomerase I (camptothecin), and of topoisomerase II (merbarone, VP-16). In addition, the effects were tested of the potential topoisomerase I activator, {beta}-lapachone. All of these compounds inhibited genome replication and all topoisomerase inhibitors affected the overall genome repair; {beta}-lapachone stimulated it. None of these compounds had any effect on the gene-specific repair. (author). 36 refs.; 3 figs.; 2 tabs.
International Nuclear Information System (INIS)
Upton, C.; Pinney, R.J.
1981-01-01
No DNA polymerase I-like activity was found associated with the ultraviolet (u.v.)-protecting plasmids R205, R46 or pKM101 in either uninduced or u.v.-induced wild-type or DNA polymerase I-deficient strains of Escherichia coli. Nor was any plasmid-associated polymerase activity detectable in similar systems containing u.v.-irradiated DNA as template. However, plasmids R205, R46 and pKM 101 still increased survival and mutagenesis of the polymerase I-deficient E. coli strain after u.v. irradiation. (author)
Transient expression and activity of human DNA polymerase iota in loach embryos.
Makarova, Irina V; Kazakov, Andrey A; Makarova, Alena V; Khaidarova, Nella V; Kozikova, Larisa V; Nenasheva, Valentina V; Gening, Leonid V; Tarantul, Vyacheslav Z; Andreeva, Ludmila E
2012-02-01
Human DNA polymerase iota (Pol ι) is a Y-family DNA polymerase with unusual biochemical properties and not fully understood functions. Pol ι preferentially incorporates dGTP opposite template thymine. This property can be used to monitor Pol ι activity in the presence of other DNA polymerases, e.g. in cell extracts of tissues and tumors. We have now confirmed the specificity and sensitivity of the method of Pol ι activity detection in cell extracts using an animal model of loach Misgurnus fossilis embryos transiently expressing human Pol ι. The overexpression of Pol ι was shown to be accompanied by an increase in abnormalities in development and the frequency of pycnotic nuclei in fish embryos. Further analysis of fish embryos with constitutive or regulated Pol ι expression may provide insights into Pol ι functions in vertebrate animals.
Directory of Open Access Journals (Sweden)
Grégory Hoff
2016-11-01
Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.
A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering.
Nørholm, Morten H H
2010-03-16
The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.
Kinetic mechanism of DNA polymerase I (Klenow)
International Nuclear Information System (INIS)
Kuchta, R.D.; Mizrahi, V.; Benkovic, P.A.; Johnson, K.A.; Benkovic, S.J.
1987-01-01
The minimal kinetic scheme for DNA polymerization catalyzed by the Klenow fragment of DNA polymerase I (KF) from Escherichia coli has been determined with short DNA oligomers of defined sequence, labeled with [ 32 P]-nucleotides. A key feature of this scheme is a minimal two-step sequence that interconverts the ternary KF-DNA/sub n/-dNTP and KF-DNA/sub n+1/-PP/sub i/ complexes. The rate is not limited by the actual polymerization but by a separate step, possibly important in ensuring fidelity. Evidence for this sequence is supplied by the observation of biphasic kinetics in single-turnover pyrophosphorolysis experiments (the microscopic reverse of polymerization). Data analysis then provides an estimate of the internal equilibrium constant. The dissociations of DNA, dNTP, and PP/sub i/ from the various binary and ternary complexes were measured by partitioning (isotope-trapping) experiments. The rate constant for DNA dissociation from KF is sequence dependent and is rate limiting during nonprocessive DNA synthesis. The combination of single-turnover (both directions) and isotope-trapping experiments provides sufficient information to permit a quantitative evaluation of the kinetic scheme for specific DNA sequences
Limited ability of DNA polymerase kappa to suppress benzo[a]pyrene-induced genotoxicity in vivo.
Masumura, Kenichi; Toyoda-Hokaiwado, Naomi; Niimi, Naoko; Grúz, Petr; Wada, Naoko A; Takeiri, Akira; Jishage, Kou-Ichi; Mishima, Masayuki; Nohmi, Takehiko
2017-12-01
DNA polymerase kappa (Polk) is a specialized DNA polymerase involved in translesion DNA synthesis. To understand the protective roles against genotoxins in vivo, we established inactivated Polk knock-in gpt delta (inactivated Polk KI) mice that possessed reporter genes for mutations and expressed inactive Polk. In this study, we examined genotoxicity of benzo[a]pyrene (BP) to determine whether Polk actually suppressed BP-induced genotoxicity as predicted by biochemistry and in vitro cell culture studies. Seven-week-old inactivated Polk KI and wild-type (WT) mice were treated with BP at doses of 5, 15, or 50 mg/(kg·day) for three consecutive days by intragastric gavage, and mutations in the colon and micronucleus formation in the peripheral blood were examined. Surprisingly, no differences were observed in the frequencies of mutations and micronucleus formation at 5 or 50 mg/kg doses. Inactivated Polk KI mice exhibited approximately two times higher gpt mutant frequency than did WT mice only at the 15 mg/kg dose. The frequency of micronucleus formation was slightly higher in inactivated Polk KI than in WT mice at the same dose, but it was statistically insignificant. The results suggest that Polk has a limited ability to suppress BP-induced genotoxicity in the colon and bone marrow and also that the roles of specialized DNA polymerases in mutagenesis and carcinogenesis should be examined not only by in vitro assays but also by in vivo mouse studies. We also report the spontaneous mutagenesis in inactivated Polk KI mice at young and old ages. Environ. Mol. Mutagen. 58:644-653, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Fixing the model for transcription: the DNA moves, not the polymerase.
Papantonis, Argyris; Cook, Peter R
2011-01-01
The traditional model for transcription sees active polymerases tracking along their templates. An alternative (controversial) model has active enzymes immobilized in "factories." Recent evidence supports the idea that the DNA moves, not the polymerase, and points to alternative explanations of how regulatory motifs like enhancers and silencers work.
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.
Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J
2015-05-26
DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Livneh, Z.
1986-01-01
Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed
Djachenko, A G; Lapin, B A
1981-01-01
A new DNA-polymerase was found in the cells of suspension lymphoblastoid cultures which produce lymphotropic baboon herpesvirus (HVP). This enzyme was isolated in a partially purified form. Some of its properties vary from those of other cellular DNA-polymerases. HVP-induced DNA-polymerase has a molecule weight of 160,000 and sedimentation coefficient of about 8 S. The enzyme is resistant to high salt concentration and N-ethylmaleimide, but it is very sensitive to phosphonoacetate. It effectively copies "activated" DNA and synthetic deoxyribohomopolymers. Attempts to reveal the DNA-polymerase activity in HVP virions were unsuccessful.
Verbruggen, Paul; Ruf, Marius; Blakqori, Gjon; Överby, Anna K; Heidemann, Martin; Eick, Dirk; Weber, Friedemann
2011-02-04
La Crosse encephalitis virus (LACV) is a mosquito-borne member of the negative-strand RNA virus family Bunyaviridae. We have previously shown that the virulence factor NSs of LACV is an efficient inhibitor of the antiviral type I interferon system. A recombinant virus unable to express NSs (rLACVdelNSs) strongly induced interferon transcription, whereas the corresponding wt virus (rLACV) suppressed it. Here, we show that interferon induction by rLACVdelNSs mainly occurs through the signaling pathway leading from the pattern recognition receptor RIG-I to the transcription factor IRF-3. NSs expressed by rLACV, however, acts downstream of IRF-3 by specifically blocking RNA polymerase II-dependent transcription. Further investigations revealed that NSs induces proteasomal degradation of the mammalian RNA polymerase II subunit RPB1. NSs thereby selectively targets RPB1 molecules of elongating RNA polymerase II complexes, the so-called IIo form. This phenotype has similarities to the cellular DNA damage response, and NSs was indeed found to transactivate the DNA damage response gene pak6. Moreover, NSs expressed by rLACV boosted serine 139 phosphorylation of histone H2A.X, one of the earliest cellular reactions to damaged DNA. However, other DNA damage response markers such as up-regulation and serine 15 phosphorylation of p53 or serine 1524 phosphorylation of BRCA1 were not triggered by LACV infection. Collectively, our data indicate that the strong suppression of interferon induction by LACV NSs is based on a shutdown of RNA polymerase II transcription and that NSs achieves this by exploiting parts of the cellular DNA damage response pathway to degrade IIo-borne RPB1 subunits.
Trans-Lesion DNA Polymerases May Be Involved in Yeast Meiosis
Arbel-Eden, Ayelet; Joseph-Strauss, Daphna; Masika, Hagit; Printzental, Oxana; Rachi, Eléanor; Simchen, Giora
2013-01-01
Trans-lesion DNA polymerases (TLSPs) enable bypass of DNA lesions during replication and are also induced under stress conditions. Being only weakly dependent on their template during replication, TLSPs introduce mutations into DNA. The low processivity of these enzymes ensures that they fall off their template after a few bases are synthesized and are then replaced by the more accurate replicative polymerase. We find that the three TLSPs of budding yeast Saccharomyces cerevisiae Rev1, PolZeta (Rev3 and Rev7), and Rad30 are induced during meiosis at a time when DNA double-strand breaks (DSBs) are formed and homologous chromosomes recombine. Strains deleted for one or any combination of the three TLSPs undergo normal meiosis. However, in the triple-deletion mutant, there is a reduction in both allelic and ectopic recombination. We suggest that trans-lesion polymerases are involved in the processing of meiotic double-strand breaks that lead to mutations. In support of this notion, we report significant yeast two-hybrid (Y2H) associations in meiosis-arrested cells between the TLSPs and DSB proteins Rev1-Spo11, Rev1-Mei4, and Rev7-Rec114, as well as between Rev1 and Rad30. We suggest that the involvement of TLSPs in processing of meiotic DSBs could be responsible for the considerably higher frequency of mutations reported during meiosis compared with that found in mitotically dividing cells, and therefore may contribute to faster evolutionary divergence than previously assumed. PMID:23550131
Stumpf, Jeffrey D; Copeland, William C
2014-10-01
Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but
Directory of Open Access Journals (Sweden)
Xi-Peng Liu
Full Text Available Recombinant uracil-DNA glycosylase (UDG from Aeropyrum pernix (A. pernix was expressed in E. coli. The biochemical characteristics of A. pernix UDG (ApeUDG were studied using oligonucleotides carrying a deoxyuracil (dU base. The optimal temperature range and pH value for dU removal by ApeUDG were 55-65°C and pH 9.0, respectively. The removal of dU was inhibited by the divalent ions of Zn, Cu, Co, Ni, and Mn, as well as a high concentration of NaCl. The opposite base in the complementary strand affected the dU removal by ApeUDG as follows: U/C≈U/G>U/T≈U/AP≈U/->U/U≈U/I>U/A. The phosphorothioate around dU strongly inhibited dU removal by ApeUDG. Based on the above biochemical characteristics and the conservation of amino acid residues, ApeUDG was determined to belong to the IV UDG family. ApeUDG increased the yield of PCR by Pfu DNA polymerase via the removal of dU in amplified DNA. Using the dU-carrying oligonucleotide as an inhibitor and ApeUDG as an activator of Pfu DNA polymerase, the yield of undesired DNA fragments, such as primer-dimer, was significantly decreased, and the yield of the PCR target fragment was increased. This strategy, which aims to amplify the target gene with high specificity and yield, can be applied to all family B DNA polymerases.
New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.
Lama, Lodoe; Seidl, Christine I; Ryan, Kevin
2014-01-01
Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.
Directory of Open Access Journals (Sweden)
Manjula Pandey
2014-03-01
Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.
International Nuclear Information System (INIS)
Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.
1988-01-01
The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG
Ubiquitylation and degradation of elongating RNA polymerase II
DEFF Research Database (Denmark)
Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q
2013-01-01
During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....
Archaeal RNA polymerase arrests transcription at DNA lesions.
Gehring, Alexandra M; Santangelo, Thomas J
2017-01-01
Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.
Zheng, Wenjun; Wang, Qingsong; Bi, Qun
2016-04-01
Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.
Interaction between DNA Polymerase β and BRCA1.
Directory of Open Access Journals (Sweden)
Aya Masaoka
Full Text Available The breast cancer 1 (BRCA1 protein is a tumor suppressor playing roles in DNA repair and cell cycle regulation. Studies of DNA repair functions of BRCA1 have focused on double-strand break (DSB repair pathways and have recently included base excision repair (BER. However, the function of BRCA1 in BER is not well defined. Here, we examined a BRCA1 role in BER, first in relation to alkylating agent (MMS treatment of cells and the BER enzyme DNA polymerase β (pol β. MMS treatment of BRCA1 negative human ovarian and chicken DT40 cells revealed hypersensitivity, and the combined gene deletion of BRCA1 and pol β in DT40 cells was consistent with these factors acting in the same repair pathway, possibly BER. Using cell extracts and purified proteins, BRCA1 and pol β were found to interact in immunoprecipitation assays, yet in vivo and in vitro assays for a BER role of BRCA1 were negative. An alternate approach with the human cells of immunofluorescence imaging and laser-induced DNA damage revealed negligible BRCA1 recruitment during the first 60 s after irradiation, the period typical of recruitment of pol β and other BER factors. Instead, 15 min after irradiation, BRCA1 recruitment was strong and there was γ-H2AX co-localization, consistent with DSBs and repair. The rapid recruitment of pol β was similar in BRCA1 positive and negative cells. However, a fraction of pol β initially recruited remained associated with damage sites much longer in BRCA1 positive than negative cells. Interestingly, pol β expression was required for BRCA1 recruitment, suggesting a partnership between these repair factors in DSB repair.
International Nuclear Information System (INIS)
Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.
1989-01-01
Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions
Two Family B DNA Polymerases From Aeropyrum pernix, Based on Revised Translational Frames
Directory of Open Access Journals (Sweden)
Katsuya Daimon
2018-04-01
Full Text Available Living organisms are divided into three domains, Bacteria, Eukarya, and Archaea. Comparative studies in the three domains have provided useful information to understand the evolution of the DNA replication machinery. DNA polymerase is the central enzyme of DNA replication. The presence of multiple family B DNA polymerases is unique in Crenarchaeota, as compared with other archaeal phyla, which have a single enzyme each for family B (PolB and family D (PolD. We analyzed PolB1 and PolB3 in the hyperthermophilic crenarchaeon, Aeropyrum pernix, and found that they are larger proteins than those predicted from the coding regions in our previous study and from public database annotations. The recombinant larger PolBs exhibited the same DNA polymerase activities as previously reported. However, the larger PolB3 showed remarkably higher thermostability, which made this enzyme applicable to PCR. In addition, the high tolerance to salt and heparin suggests that PolB3 will be useful for amplification from the samples with contaminants, and therefore it has a great potential for diagnostic use in the medical and environmental field.
A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.
Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang
2005-12-01
The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.
Garbacz, Marta A; Lujan, Scott A; Burkholder, Adam B; Cox, Phillip B; Wu, Qiuqin; Zhou, Zhi-Xiong; Haber, James E; Kunkel, Thomas A
2018-02-27
To investigate nuclear DNA replication enzymology in vivo, we have studied Saccharomyces cerevisiae strains containing a pol2-16 mutation that inactivates the catalytic activities of DNA polymerase ε (Pol ε). Although pol2-16 mutants survive, they present very tiny spore colonies, increased doubling time, larger than normal cells, aberrant nuclei, and rapid acquisition of suppressor mutations. These phenotypes reveal a severe growth defect that is distinct from that of strains that lack only Pol ε proofreading (pol2-4), consistent with the idea that Pol ε is the major leading-strand polymerase used for unstressed DNA replication. Ribonucleotides are incorporated into the pol2-16 genome in patterns consistent with leading-strand replication by Pol δ when Pol ε is absent. More importantly, ribonucleotide distributions at replication origins suggest that in strains encoding all three replicases, Pol δ contributes to initiation of leading-strand replication. We describe two possible models.
Directory of Open Access Journals (Sweden)
Alden C Klarer
Full Text Available Y-family DNA-polymerases have larger active sites that can accommodate bulky DNA adducts allowing them to bypass these lesions during replication. One member, polymerase eta (pol eta, is specialized for the bypass of UV-induced thymidine-thymidine dimers, correctly inserting two adenines. Loss of pol eta function is the molecular basis for xeroderma pigmentosum (XP variant where the accumulation of mutations results in a dramatic increase in UV-induced skin cancers. Less is known about the role of pol eta in the bypass of other DNA adducts. A commonly encountered DNA adduct is that caused by benzo[a]pyrene diol epoxide (BPDE, the ultimate carcinogenic metabolite of the environmental chemical benzo[a]pyrene. Here, treatment of pol eta-deficient fibroblasts from humans and mice with BPDE resulted in a significant decrease in Hprt gene mutations. These studies in mammalian cells support a number of in vitro reports that purified pol eta has error-prone activity on plasmids with site-directed BPDE adducts. Sequencing the Hprt gene from this work shows that the majority of mutations are G>T transversions. These data suggest that pol eta has error-prone activity when bypassing BPDE-adducts. Understanding the basis of environmental carcinogen-derived mutations may enable prevention strategies to reduce such mutations with the intent to reduce the number of environmentally relevant cancers.
Vyas, Rajan; Zahurancik, Walter J.; Suo, Zucai
2014-01-01
DNA polymerases are known to select against L-nucleotides, the enantiomers of natural D-nucleotides. However, the structural basis for D-stereoselectivity of a DNA polymerase has not been established, although two L-nucleoside analogs, lamivudine and emtricitabine, have been widely used as anti-HIV and anti-hepatitis B drugs. Here, we report ternary crystal structures of human DNA polymerase λ in complex with DNA and L-deoxycytidine 5′-triphosphate, or its analogs (the triphosphates of lamivu...
Gadkari, Varun V.; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2014-01-01
3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2’-deoxyguanosin-8-yl)-3-aminobenzanthrone (dGC8-N-ABA). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dGC8-N-ABA is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dGC8-N-ABA on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dGC8-N-ABA lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dGC8-N-ABA lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dGC8-N-ABA bypass catalyzed by Dpo4. PMID:25048879
Backbone assignment of the little finger domain of a Y-family DNA polymerase.
Ma, Dejian; Fowler, Jason D; Suo, Zucai
2011-10-01
Sulfolobus solfataricus DNA polymerase IV (Dpo4), a prototype Y-family DNA polymerase, contains a unique little finger domain besides a catalytic core. Here, we report the chemical shift assignments for the backbone nitrogens, α and β carbons, and amide protons of the little finger domain of Dpo4. This work and our published backbone assignment for the catalytic core provide the basis for investigating the conformational dynamics of Dpo4 during catalysis using solution NMR spectroscopy.
Directory of Open Access Journals (Sweden)
Javier Abellón-Ruiz
2016-01-01
Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.
Crystal structure of Pfu, the high fidelity DNA polymerase from Pyrococcus furiosus.
Kim, Suhng Wook; Kim, Dong-Uk; Kim, Jin Kwang; Kang, Lin-Woo; Cho, Hyun-Soo
2008-05-01
We have determined a 2.6A resolution crystal structure of Pfu DNA polymerase, the most commonly used high fidelity PCR enzyme, from Pyrococcus furiosus. Although the structures of Pfu and KOD1 are highly similar, the structure of Pfu elucidates the electron density of the interface between the exonuclease and thumb domains, which has not been previously observed in the KOD1 structure. The interaction of these two domains is known to coordinate the proofreading and polymerization activity of DNA polymerases, especially via H147 that is present within the loop (residues 144-158) of the exonuclease domain. In our structure of Pfu, however, E148 rather than H147 is located at better position to interact with the thumb domain. In addition, the structural analysis of Pfu and KOD1 shows that both the Y-GG/A and beta-hairpin motifs of Pfu are found to differ with that of KOD1, and may explain differences in processivity. This information enables us to better understand the mechanisms of polymerization and proofreading of DNA polymerases.
Czech Academy of Sciences Publication Activity Database
Villani, G.; Hübscher, U.; Gironis, N.; Parkkinen, S.; Pospiech, H.; Shevelev, Igor; di Cicco, G.; Markennen, E.; Syvaaja, J.E.; Le Gac, N.T.
2011-01-01
Roč. 286, č. 37 (2011), s. 32094-32104 ISSN 0021-9258 Grant - others:Academy of Finland(FI) 106986; Academy of Finland(FI) 123082 Institutional research plan: CEZ:AV0Z50520514 Keywords : DNA damage * DNA polymerase * DNA repair * DNA replication * DNA -protein interaction Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.773, year: 2011
Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P
1997-02-01
The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).
An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation
Gao, Zhihuan
2010-04-21
DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.
Hansen, Connie J.; Wu, Lydia; Fox, Jeffrey D.; Arezi, Bahram; Hogrefe, Holly H.
2011-01-01
Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (−1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure. PMID:21062827
Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H
2011-03-01
Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.
In Silico Screening Hepatitis B Virus DNA Polymerase Inhibitors from Medicinal Plants
Directory of Open Access Journals (Sweden)
Mokhtar Nosrati
2017-08-01
Full Text Available Abstract Background: Hepatitis B virus infection (HBV is a significant global health problem and is a major cause of morbidity and mortality worldwide. Therefore, currently, introducing novel anti Hepatitis B drugs is taken into consideration. This study was planned to in silico screening novel Hepatitis B virus DNA polymerase inhibitors from two medicinal plants Terminalis chebula and Caesalpinia sappan. Materials and Methods: This is a descriptive-analytic study. In the study, three-dimensional structure of the Hepatitis B virus DNA polymerase was predicted using homology modeling method. A set of phytochemicals from mentioned plants were retrieved from Pubchem database in SDF format. In silico screening was carried out using molecular docking between mentioned phytochemicals and modeled polymerase by iGemdock 2.1 software. Results: Results of the study confirmed that all evaluated ligands have appropriate interactions to the polymerase with least toxicity and without genotoxicity potential. Results also showed that most interactions occur in reverse transcriptase domain which located in 354-694 area in the amino acid sequence of tested polymerase. Analysis of energy and amino acids involved in ligand-polymerase interaction revealed that Terchebin, Chebulinic Acid and Terflavin A have more effective interaction with the polymerase in compared to other ligands. Conclusion: Based on the results it can be concluded that evaluated compounds could be good candidates for in vitro and in vivo research in order to develop novel anti- Hepatitis B drugs.
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Directory of Open Access Journals (Sweden)
Melissa G. eCastillo-Lizardo
2014-08-01
Full Text Available Replication slippage or slipped-strand mispairing involves the misalignment of DNA strands during the replication of repeated DNA sequences, and can lead to genetic rearrangements such as microsatellite instability. Here, we show that PolB and PolD replicative DNA polymerases from the archaeal model Pyrococcus abyssi (Pab slip in vitro during replication of a single-stranded DNA template carrying a hairpin structure and short direct repeats. We find that this occurs in both their wild-type (exo+ and exonuclease deficient (exo- forms. The slippage behavior of PabPolB and PabPolD, probably due to limited strand displacement activity, resembles that observed for the high fidelity Pyrococcus furiosus (Pfu DNA polymerase. The presence of PabPCNA inhibited PabPolB and PabPolD slippage. We propose a model whereby PabPCNA stimulates strand displacement activity and polymerase progression through the hairpin, thus permitting the error-free replication of repetitive sequences.
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η.
O'Flaherty, D K; Patra, A; Su, Y; Guengerich, F P; Egli, M; Wilds, C J
2016-08-01
DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O 4 -Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4- O 4 bond on processing by human DNA polymerase η (hPol η ) was studied for oligonucleotides containing O 4 -methylthymidine, O 4 -ethylthymidine, and analogs restricting the O 4 -methylene group in an anti -orientation. Primer extension assays revealed that the O 4 -alkyl orientation influences hPol η bypass. Crystal structures of hPol η •DNA•dNTP ternary complexes with O 4 -methyl- or O 4 -ethylthymidine in the template strand showed the nucleobase of the former lodged near the ceiling of the active site, with the syn - O 4 -methyl group engaged in extensive hydrophobic interactions. This unique arrangement for O 4 -methylthymidine with hPol η , inaccessible for the other analogs due to steric/conformational restriction, is consistent with differences observed for nucleotide incorporation and supports the concept that lesion conformation influences extension across DNA damage. Together, these results provide mechanistic insights on the mutagenicity of O 4 MedT and O 4 EtdT when acted upon by hPol η .
Directory of Open Access Journals (Sweden)
Caroline Chénard
2016-06-01
Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.
International Nuclear Information System (INIS)
Yamagoe, S.; Kohda, T.; Oishi, M.
1991-01-01
Gene expression of human immunodeficiency virus type 1 (HIV-1) is induced not only by trans activation mediated through a gene product (tat) encoded by the virus but also by treatment of virus-carrying cells with DNA-damaging agents such as UV light. Employing an artificially constructed DNA in which the chloramphenicol acetyltransferase gene was placed under the control of the HIV-1 long terminal repeat, we analyzed the induction process in HeLa cells and found that inhibitors of poly(ADP-ribose) polymerase suppressed UV-induced HIV-1 gene expression but not tat-mediated expression. We also found that suppression occurs at the posttranscriptional level. These results indicate that HIV-1 gene expression is activated by at least two different mechanisms, one of which involves poly-ADP ribosylation. A possible new role of poly-ADP ribosylation in the regulation of specific gene expression is also discussed
Energy Technology Data Exchange (ETDEWEB)
B Akabayov; A Kulczyk; S Akabayov; C Thiele; L McLaughlin; B Beauchamp; C Richardson
2011-12-31
DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-V distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.
Mechanisms for the initiation of bacteriophage T7 DNA replication
International Nuclear Information System (INIS)
Fuller, C.W.; Beauchamp, B.B.; Engler, M.J.; Lechner, R.L.; Matson, S.W.; Tabor, S.; White, J.H.; Richardson, C.C.
1983-01-01
Genetic analysis of bacteriophage T7 has shown that the products of phage genes 1, 2, 3, 4, 5, and 6 are required for phage DNA synthesis in vivo. T7 RNA polymerase is the translation product of gene 1. This RNA polymerase is required for transcription of most of the phage genome, including genes 2 through 6. T7 RNA polymerase promoters consist of a highly conserved 23-bp DNA sequence. There are 17 such promoters in the T7 DNA molecule, all of which direct transcription from the same strand of the DNA. 70 references, 11 figures
International Nuclear Information System (INIS)
Doucet-Chabeaud, G.
2000-01-01
Arabidopsis thaliana, the model-system in plant genetics, has been used to study the responses to DNA damage, experimentally introduced by γ-irradiation. We have characterised a radiation-induced gene coding a 111 kDa protein, AthPARP-1, homologous to the human poly(ADP-ribose)polymerase-1 (hPARP-1). As hPARP-1 is composed by three functional domain with characteristic motifs, AthPARP-1 binds to DNA bearing single-strand breaks and shows DNA damage-dependent poly(ADP-ribosyl)ation. The preferential expression of AthPARP-1 in mitotically active tissues is in agreement with a potential role in the maintenance of genome integrity during DNA replication, as proposed for its human counterpart. Transcriptional gene activation by ionising radiation of AthPARP-1 and AthPARP-2 genes is to date plant specific activation. Our expression analyses after exposure to various stress indicate that 1) AthPARP-1 and AthPARP-2 play an important role in the response to DNA lesions, particularly they are activated by genotoxic agents implicating the BER DNA repair pathway 2) AthPARP-2 gene seems to play an additional role in the signal transduction induced by oxidative stress 3) the observed expression profile of AthPARP-1 is in favour of the regulation of AthPARP-1 gene expression at the level of transcription and translation. This mode of regulation of AthPARP-1 protein biosynthesis, clearly distinct from that observed in animals, needs the implication of a so far unidentified transcription factor that is activated by the presence of DNA lesions. The major outcome of this work resides in the isolation and characterisation of such new transcription factor, which will provide new insight on the regulation of plant gene expression by genotoxic stress. (author) [fr
Mechanistic Basis for the Bypass of a Bulky DNA Adduct Catalyzed by a Y-Family DNA Polymerase
Vyas, Rajan; Efthimiopoulos, Georgia; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai
2015-01-01
1-Nitropyrene (1-NP), an environmental pollutant, induces DNA damage in vivo and is considered to be carcinogenic. The DNA adducts formed by the 1-NP metabolites stall replicative DNA polymerases but are presumably bypassed by error-prone Y-family DNA polymerases at the expense of replication fidelity and efficiency in vivo. Our running start assays confirmed that a site-specifically placed 8-(deoxyguanosin-N2-yl)-1-aminopyrene (dG1,8), one of the DNA adducts derived from 1-NP, can be bypassed by Sulfolobus solfataricus DNA polymerase IV (Dpo4), although this representative Y-family enzyme was paused strongly by the lesion. Pre-steady-state kinetic assays were employed to determine the low nucleotide incorporation fidelity and establish a minimal kinetic mechanism for the dG1,8 bypass by Dpo4. To reveal a structural basis for dCTP incorporation opposite dG1,8, we solved the crystal structures of the complexes of Dpo4 and DNA containing a templating dG1,8 lesion in the absence or presence of dCTP. The Dpo4·DNA-dG1,8 binary structure shows that the aminopyrene moiety of the lesion stacks against the primer/template junction pair, while its dG moiety projected into the cleft between the Finger and Little Finger domains of Dpo4. In the Dpo4·DNA-dG1,8·dCTP ternary structure, the aminopyrene moiety of the dG1,8 lesion, is sandwiched between the nascent and junction base pairs, while its base is present in the major groove. Moreover, dCTP forms a Watson–Crick base pair with dG, two nucleotides upstream from the dG1,8 site, creating a complex for “-2” frameshift mutation. Mechanistically, these crystal structures provide additional insight into the aforementioned minimal kinetic mechanism. PMID:26327169
Glyde, Robert; Ye, Fuzhou; Darbari, Vidya Chandran; Zhang, Nan; Buck, Martin; Zhang, Xiaodong
2017-07-06
Gene transcription is carried out by RNA polymerases (RNAPs). For transcription to occur, the closed promoter complex (RPc), where DNA is double stranded, must isomerize into an open promoter complex (RPo), where the DNA is melted out into a transcription bubble and the single-stranded template DNA is delivered to the RNAP active site. Using a bacterial RNAP containing the alternative σ 54 factor and cryoelectron microscopy, we determined structures of RPc and the activator-bound intermediate complex en route to RPo at 3.8 and 5.8 Å. Our structures show how RNAP-σ 54 interacts with promoter DNA to initiate the DNA distortions required for transcription bubble formation, and how the activator interacts with RPc, leading to significant conformational changes in RNAP and σ 54 that promote RPo formation. We propose that DNA melting is an active process initiated in RPc and that the RNAP conformations of intermediates are significantly different from that of RPc and RPo. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
M. Molinete; W. Vermeulen (Wim); A. Bürkle; J. Mé nissier-de Murcia; J.H. Küpper; J.H.J. Hoeijmakers (Jan); G. de Murcia
1993-01-01
textabstractThe zinc-finger DNA-binding domain (DBD) of poly (ADP-ribose) polymerase (PARP, EC 2.4.2.30) specifically recognizes DNA strand breaks induced by various DNA-damaging agents in eukaryotes. This, in turn, triggers the synthesis of polymers of ADP-ribose linked to nuclear proteins during
Structural basis for the suppression of skin cancers by DNA polymerase [eta
Energy Technology Data Exchange (ETDEWEB)
Silverstein, Timothy D.; Johnson, Robert E.; Jain, Rinku; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K. (Texas-MED); (Mount Sinai Hospital)
2010-09-13
DNA polymerase {eta} (Pol{eta}) is unique among eukaryotic polymerases in its proficient ability for error-free replication through ultraviolet-induced cyclobutane pyrimidine dimers, and inactivation of Pol{eta} (also known as POLH) in humans causes the variant form of xeroderma pigmentosum (XPV). We present the crystal structures of Saccharomyces cerevisiae Pol{eta} (also known as RAD30) in ternary complex with a cis-syn thymine-thymine (T-T) dimer and with undamaged DNA. The structures reveal that the ability of Pol{eta} to replicate efficiently through the ultraviolet-induced lesion derives from a simple and yet elegant mechanism, wherein the two Ts of the T-T dimer are accommodated in an active site cleft that is much more open than in other polymerases. We also show by structural, biochemical and genetic analysis that the two Ts are maintained in a stable configuration in the active site via interactions with Gln55, Arg73 and Met74. Together, these features define the basis for Pol{eta}'s action on ultraviolet-damaged DNA that is crucial in suppressing the mutagenic and carcinogenic consequences of sun exposure, thereby reducing the incidence of skin cancers in humans.
International Nuclear Information System (INIS)
Yoshida, S.; Masaki, S.; Nakamura, H.; Morita, T.
1981-01-01
The amount of DNA synthesis in vitro with the ultraviolet-irradiated poly(dT).oligo(rA) template initiators catalysed by DNA polymerase α (Masaki, S. and Yoshida, S., Biochim. Biophys. Acta 521, 74-88) decreased with the dose of ultraviolet-irradiation. The ultraviolet irradiation to the template, however, did not affect the rate of incorporation of incorrect deoxynucleotides into the newly synthesized poly(dA). The addition of terminal deoxynucleotidyl transferase to this system enhanced the DNA synthesis to a level which is comparable to that of the control and it concomitantly increased the incorporation of the mismatched deoxynucleotide into the newly synthesized poly(dA) strands. On the other hand, with an unirradiated template initiator, the misincorporation was only slightly enhanced by the addition of terminal deoxynucleotidyl transferase. The sizes of newly synthesized DNA measured by the sedimentation velocities were found to be smaller with the ultraviolet-irradiated templates but they increased to the control level with the addition of terminal deoxynucleotidyl transferase to the systems. These results suggest that terminal deoxynucleotidyl transferase can help DNA polymerase α to bypass thymine dimers in vitro by the formation of mismatched regions at the positions opposite to pyrimidine dimers on the template. (Auth.)
International Nuclear Information System (INIS)
Licastro, F.; Sarafian, T.; Verity, A.M.; Walford, R.L.
1985-01-01
The effects of hydroxyurea, aphidicolin and dideoxythymidine on UV-induced DNA repair of mouse neuronal granular cells were studied. Aphidicolin, which is considered a specific inhibitor of polymerase-alpha, decreased spontaneous DNA synthesis by 93% and totally suppressed DNA repair. Dideoxythymidine, an inhibitor of polymerase-beta, was more potent in decreasing scheduled DNA synthesis than aphidicolin, and also completely blocked the UV-induced DNA repair. Hydroxyurea, a specific inhibitor of ribonucleotide reductase, inhibited scheduled DNA synthesis, but unscheduled DNA synthesis after UV irradiation was always well detectable. Our data suggest that in neuronal cells from 5 to 10 days old mice both polymerases-alpha and -beta are required for both DNA synthesis and repair. These two enzymes may act jointly in filling up the gaps along the DNA molecule and elongating the DNA chain
Corzett, Christopher H; Goodman, Myron F; Finkel, Steven E
2013-06-01
Escherichia coli DNA polymerases (Pol) II, IV, and V serve dual roles by facilitating efficient translesion DNA synthesis while simultaneously introducing genetic variation that can promote adaptive evolution. Here we show that these alternative polymerases are induced as cells transition from exponential to long-term stationary-phase growth in the absence of induction of the SOS regulon by external agents that damage DNA. By monitoring the relative fitness of isogenic mutant strains expressing only one alternative polymerase over time, spanning hours to weeks, we establish distinct growth phase-dependent hierarchies of polymerase mutant strain competitiveness. Pol II confers a significant physiological advantage by facilitating efficient replication and creating genetic diversity during periods of rapid growth. Pol IV and Pol V make the largest contributions to evolutionary fitness during long-term stationary phase. Consistent with their roles providing both a physiological and an adaptive advantage during stationary phase, the expression patterns of all three SOS polymerases change during the transition from log phase to long-term stationary phase. Compared to the alternative polymerases, Pol III transcription dominates during mid-exponential phase; however, its abundance decreases to SOS induction by exogenous agents and indicate that cell populations require appropriate expression of all three alternative DNA polymerases during exponential, stationary, and long-term stationary phases to attain optimal fitness and undergo adaptive evolution.
Dynamic regulation of cerebral DNA repair genes by psychological stress
DEFF Research Database (Denmark)
Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta
2015-01-01
Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...
Functional Analysis of Cancer-Associated DNA Polymerase ε Variants in Saccharomyces cerevisiae
Directory of Open Access Journals (Sweden)
Stephanie R. Barbari
2018-03-01
Full Text Available DNA replication fidelity relies on base selectivity of the replicative DNA polymerases, exonucleolytic proofreading, and postreplicative DNA mismatch repair (MMR. Ultramutated human cancers without MMR defects carry alterations in the exonuclease domain of DNA polymerase ε (Polε. They have been hypothesized to result from defective proofreading. However, modeling of the most common variant, Polε-P286R, in yeast produced an unexpectedly strong mutator effect that exceeded the effect of proofreading deficiency by two orders of magnitude and indicated the involvement of other infidelity factors. The in vivo consequences of many additional Polε mutations reported in cancers remain poorly understood. Here, we genetically characterized 13 cancer-associated Polε variants in the yeast system. Only variants directly altering the DNA binding cleft in the exonuclease domain elevated the mutation rate. Among these, frequently recurring variants were stronger mutators than rare variants, in agreement with the idea that mutator phenotype has a causative role in tumorigenesis. In nearly all cases, the mutator effects exceeded those of an exonuclease-null allele, suggesting that mechanisms distinct from loss of proofreading may drive the genome instability in most ultramutated tumors. All mutator alleles were semidominant, supporting the view that heterozygosity for the polymerase mutations is sufficient for tumor development. In contrast to the DNA binding cleft alterations, peripherally located variants, including a highly recurrent V411L, did not significantly elevate mutagenesis. Finally, the analysis of Polε variants found in MMR-deficient tumors suggested that the majority cause no mutator phenotype alone but some can synergize with MMR deficiency to increase the mutation rate.
International Nuclear Information System (INIS)
Shwartz, H.; Shavitt, O.; Livneh, Z.
1988-01-01
The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected
Identification of an Unfolding Intermediate for a DNA Lesion Bypass Polymerase
Sherrer, Shanen M.; Maxwell, Brian A.; Pack, Lindsey R.; Fiala, Kevin A.; Fowler, Jason D.; Zhang, Jun; Suo, Zucai
2012-01-01
Sulfolobus solfataricusDNA Polymerase IV (Dpo4), a prototype Y-family DNA polymerase, has been well characterized biochemically and biophysically at 37 °C or lower temperatures. However, the physiological temperature of the hyperthermophile S. solfataricus is approximately 80 °C. With such a large discrepancy in temperature, the in vivo relevance of these in vitro studies of Dpo4 has been questioned. Here, we employed circular dichroism spectroscopy and fluorescence-based thermal scanning to investigate the secondary structural changes of Dpo4 over a temperature range from 26 to 119 °C. Dpo4 was shown to display a high melting temperature characteristic of hyperthermophiles. Unexpectedly, the Little Finger domain of Dpo4, which is only found in the Y-family DNA polymerases, was shown to be more thermostable than the polymerase core. More interestingly, Dpo4 exhibited a three-state cooperative unfolding profile with an unfolding intermediate. The linker region between the Little Finger and Thumb domains of Dpo4 was found to be a source of structural instability. Through site-directed mutagenesis, the interactions between the residues in the linker region and the Palm domain were identified to play a critical role in the formation of the unfolding intermediate. Notably, the secondary structure of Dpo4 was not altered when the temperature was increased from 26 to 87.5 °C. Thus, in addition to providing structural insights into the thermal stability and an unfolding intermediate of Dpo4, our work also validated the relevance of the in vitro studies of Dpo4 performed at temperatures significantly lower than 80 °C. PMID:22667759
International Nuclear Information System (INIS)
Johnson, R.C.
1978-01-01
Daughter strand gaps are secondary lesions caused by interrupted DNA synthesis in the proximity of uv-induced pyrimidine dimers. The relative roles of DNA recombination and de novo DNA synthesis in filling such gaps have not been clarified, although both are required for complete closure. In this study, the Escherichia coli E486 and E511 dnaE(Ts) mutants, in which DNA polymerase I but not DNA polymerase III is active at 43 0 C, were examined. Both mutants demonstrated reduced gap closure in comparison with the progenitor strain at the nonpermissive temperature. These results and those of previous studies support the hypothesis that both DNA polymerase I and DNA polymerase III contribute to gap closure, suggesting a cooperative effort in the repair of each gap. Benzoylated, naphthoylated diethylaminoethyl-cellulose chromatography analysis for persistence of single-strand DNA in the absence of DNA polymerase III activity suggested that de novo DNA synthesis initiates the filling of daughter strand gaps
Czech Academy of Sciences Publication Activity Database
Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal
2016-01-01
Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016
Hamster endogenous retrovirus (HaER) - distinct properties of structural proteins and DNA polymerase
International Nuclear Information System (INIS)
Goldschmied-Reouven, A.; Yaniv, A.
1983-01-01
The structural proteins as well as some features of the RNA-dependent DNA polymerase of the hamster endogenous retrovirus (HaER) were examined. The polypeptide pattern of this virus is substantially different from that of other known retroviruses in containing major polypeptides with molecular weights of 68000, 59000, 27000, 24000 daltons. Double antibody competitive radioimmunoassays showed that the HaER particles do not share any detectable antigenic relatedness with the murine viruses' p30, but manifest a considerable relatedness with the feline leukemia virus p27 and a slight cross-reactivity with the rat virus major protein. The RNA-dependent DNA polymerase of HaER virus has a molecular size of approximately 73000 daltons and in contrast to other mammalian retroviruses shows no significant preference for Mn 2+ over Mg 2+ . Apart from the lack of antigenic relatedness between the HaER virus proteins and the p30 protein of murine viruses, there is also no antigenic relatedness between HaER and murine viruses insofar as their DNA polymerase is concerned. (Author)
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
DEFF Research Database (Denmark)
Zhen, Zhuo; Liu, Jingwen; Rensing, Christopher Günther T
2017-01-01
and diversity analysis. In this study, two clone libraries were constructed with two different DNA polymerases, Q5 high-fidelity DNA polymerase and exTaq polymerase, to compare the differences in their capability to accurately reflect the cyanobacterial community structure and diversity in a subtropical deep......-fidelity DNA polymerase. It is noteworthy that so far Q5 high-fidelity DNA polymerase was the first time to be employed in the genetic analysis of cyanobacterial community. And it is for the first time that the cyanobacterial community structure in Dongzhen reservoir was analyzed using molecular methods...
Directory of Open Access Journals (Sweden)
Xiakun Chu
2014-09-01
Full Text Available Protein-DNA recognition is a central biological process that governs the life of cells. A protein will often undergo a conformational transition to form the functional complex with its target DNA. The protein conformational dynamics are expected to contribute to the stability and specificity of DNA recognition and therefore may control the functional activity of the protein-DNA complex. Understanding how the conformational dynamics influences the protein-DNA recognition is still challenging. Here, we developed a two-basin structure-based model to explore functional dynamics in Sulfolobus solfataricus DNA Y-family polymerase IV (DPO4 during its binding to DNA. With explicit consideration of non-specific and specific interactions between DPO4 and DNA, we found that DPO4-DNA recognition is comprised of first 3D diffusion, then a short-range adjustment sliding on DNA and finally specific binding. Interestingly, we found that DPO4 is under a conformational equilibrium between multiple states during the binding process and the distributions of the conformations vary at different binding stages. By modulating the strength of the electrostatic interactions, the flexibility of the linker, and the conformational dynamics in DPO4, we drew a clear picture on how DPO4 dynamically regulates the DNA recognition. We argue that the unique features of flexibility and conformational dynamics in DPO4-DNA recognition have direct implications for low-fidelity translesion DNA synthesis, most of which is found to be accomplished by the Y-family DNA polymerases. Our results help complete the description of the DNA synthesis process for the Y-family polymerases. Furthermore, the methods developed here can be widely applied for future investigations on how various proteins recognize and bind specific DNA substrates.
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
Directory of Open Access Journals (Sweden)
Julie A Law
2011-07-01
Full Text Available DNA methylation is an evolutionarily conserved epigenetic modification that is critical for gene silencing and the maintenance of genome integrity. In Arabidopsis thaliana, the de novo DNA methyltransferase, domains rearranged methyltransferase 2 (DRM2, is targeted to specific genomic loci by 24 nt small interfering RNAs (siRNAs through a pathway termed RNA-directed DNA methylation (RdDM. Biogenesis of the targeting siRNAs is thought to be initiated by the activity of the plant-specific RNA polymerase IV (Pol-IV. However, the mechanism through which Pol-IV is targeted to specific genomic loci and whether factors other than the core Pol-IV machinery are required for Pol-IV activity remain unknown. Through the affinity purification of nuclear RNA polymerase D1 (NRPD1, the largest subunit of the Pol-IV polymerase, we found that several previously identified RdDM components co-purify with Pol-IV, namely RNA-dependent RNA polymerase 2 (RDR2, CLASSY1 (CLSY1, and RNA-directed DNA methylation 4 (RDM4, suggesting that the upstream siRNA generating portion of the RdDM pathway may be more physically coupled than previously envisioned. A homeodomain protein, SAWADEE homeodomain homolog 1 (SHH1, was also found to co-purify with NRPD1; and we demonstrate that SHH1 is required for de novo and maintenance DNA methylation, as well as for the accumulation of siRNAs at specific loci, confirming it is a bonafide component of the RdDM pathway.
Role of DNA polymerase I in liquid holding recovery of uv-irradiated Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Tang, M S; Patrick, M H [Texas Univ., Dallas (USA)
1977-09-01
Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in DNA of different strains of E.coli K12 were determined during liquid holding recovery after uv irradiation. The extent of Pyr <> Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' ..-->.. 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' ..-->.. 3' exonuclease.
Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET
Hohlbein, J.; Kapanidis, A.N.
2016-01-01
Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open
Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast
International Nuclear Information System (INIS)
Lin, Y.H.; Keil, R.L.
1991-01-01
HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination
Sergerie, Yan; Boivin, Guy
2008-01-01
Drug-resistant herpes simplex virus type 1 (HSV-1) recombinant strains harboring mutations in the thymidine kinase and/or the DNA polymerase genes were evaluated for their susceptibility to various antivirals in the presence of 25 microg/ml of hydroxyurea (HyU). The latter compound decreased the 50% inhibitory concentrations of acyclovir by 1.5-3.8-fold and that of cidofovir by 2.7-14.4-fold. However, HyU did not affect the susceptibilities of the various recombinant mutants to foscarnet. Hydroxyurea, a ribonucleotide reductase inhibitor, can increase the activity of nucleoside/nucleotide analogues against drug-resistant viruses.
WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response
Energy Technology Data Exchange (ETDEWEB)
Yoshimura, Akari, E-mail: akari_yo@stu.musashino-u.ac.jp [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Kobayashi, Yume [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan); Tada, Shusuke [Department of Medical Biochemistry, Faculty of Pharmaceutical Sciences, Toho University, 2-2-1 Miyama, Funabashi-shi, Chiba 274-8510 (Japan); Seki, Masayuki [Department of Biochemistry, Tohoku Pharmaceutical University, 4-4-1 Komatsushima, Aoba-ku, Sendai-shi, Miyagi 981-8558 (Japan); Enomoto, Takemi [Molecular Cell Biology Laboratory, Research Institute of Pharmaceutical Sciences, Faculty of Pharmacy, Musashino University, 1-1-20 Shinmachi, Nishitokyo-shi, Tokyo 202-8585 (Japan)
2014-09-12
Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.
Replicative DNA polymerase δ but not ε proofreads errors in Cis and in Trans.
Directory of Open Access Journals (Sweden)
Carrie L Flood
2015-03-01
Full Text Available It is now well established that in yeast, and likely most eukaryotic organisms, initial DNA replication of the leading strand is by DNA polymerase ε and of the lagging strand by DNA polymerase δ. However, the role of Pol δ in replication of the leading strand is uncertain. In this work, we use a reporter system in Saccharomyces cerevisiae to measure mutation rates at specific base pairs in order to determine the effect of heterozygous or homozygous proofreading-defective mutants of either Pol ε or Pol δ in diploid strains. We find that wild-type Pol ε molecules cannot proofread errors created by proofreading-defective Pol ε molecules, whereas Pol δ can not only proofread errors created by proofreading-defective Pol δ molecules, but can also proofread errors created by Pol ε-defective molecules. These results suggest that any interruption in DNA synthesis on the leading strand is likely to result in completion by Pol δ and also explain the higher mutation rates observed in Pol δ-proofreading mutants compared to Pol ε-proofreading defective mutants. For strains reverting via AT→GC, TA→GC, CG→AT, and GC→AT mutations, we find in addition a strong effect of gene orientation on mutation rate in proofreading-defective strains and demonstrate that much of this orientation dependence is due to differential efficiencies of mispair elongation. We also find that a 3'-terminal 8 oxoG, unlike a 3'-terminal G, is efficiently extended opposite an A and is not subject to proofreading. Proofreading mutations have been shown to result in tumor formation in both mice and humans; the results presented here can help explain the properties exhibited by those proofreading mutants.
Energy Technology Data Exchange (ETDEWEB)
Janowska, Beata [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Kurpios-Piec, Dagmara [Department of Biochemistry, Medical University of Warsaw, Banacha 1, 02-097 Warsaw (Poland); Prorok, Paulina [Institute of Genetics and Biotechnology, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland); Szparecki, Grzegorz [Medical University of Warsaw, Zwirki i Wigury 61, 02-097 Warsaw (Poland); Komisarski, Marek [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Kowalczyk, Pawel [Interdisciplinary Centre for Mathematical and Computational Modelling, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland); Janion, Celina [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Tudek, Barbara, E-mail: tudek@ibb.waw.pl [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Institute of Genetics and Biotechnology, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland)
2012-01-03
One of the major lipid peroxidation products trans-4-hydroxy-2-nonenal (HNE), forms cyclic propano- or ethenoadducts bearing six- or seven-carbon atom side chains to G > C Much-Greater-Than A > T. To specify the role of SOS DNA polymerases in HNE-induced mutations, we tested survival and mutation spectra in the lacZ{alpha} gene of M13mp18 phage, whose DNA was treated in vitro with HNE, and which was grown in uvrA{sup -}Escherichia coli strains, carrying one, two or all three SOS DNA polymerases. When Pol IV was the only DNA SOS polymerase in the bacterial host, survival of HNE-treated M13 DNA was similar to, but mutation frequency was lower than in the strain containing all SOS DNA polymerases. When only Pol II or Pol V were present in host bacteria, phage survival decreased dramatically. Simultaneously, mutation frequency was substantially increased, but exclusively in the strain carrying only Pol V, suggesting that induction of mutations by HNE is mainly dependent on Pol V. To determine the role of Pol II and Pol IV in HNE induced mutagenesis, Pol II or Pol IV were expressed together with Pol V. This resulted in decrease of mutation frequency, suggesting that both enzymes can compete with Pol V, and bypass HNE-DNA adducts in an error-free manner. However, HNE-DNA adducts were easily bypassed by Pol IV and only infrequently by Pol II. Mutation spectrum established for strains expressing only Pol V, showed that in uvrA{sup -} bacteria the frequency of base substitutions and recombination increased in relation to NER proficient strains, particularly mutations at adenine sites. Among base substitutions A:T {yields} C:G, A:T {yields} G:C, G:C {yields} A:T and G:C {yields} T:A prevailed. The results suggest that Pol V can infrequently bypass HNE-DNA adducts inducing mutations at G, C and A sites, while bypass by Pol IV and Pol II is error-free, but for Pol II infrequent.
Kasai, Kentaro; Nishiyama, Norihito; Izumi, Yushi; Otsuka, Shunsuke; Ishihara, Akinori; Yamauchi, Kiyoshi
2015-11-06
Thyroid hormones (THs) play a critical role in amphibian metamorphosis, during which the TH receptor (TR) gene, thrb, is upregulated in a tissue-specific manner. The Xenopus laevis thrb gene has 3 TH response elements (TREs) in the 5' flanking regulatory region and 1 TRE in the exon b region, around which CpG sites are highly distributed. To clarify whether exposure to 3,3',5-triiodothyronine (T3) affects histone and RNA polymerase II (RNAPII) modifications and the level of DNA methylation in the 5' regulatory region, we conducted reverse transcription-quantitative polymerase chain reaction, bisulfite sequencing and chromatin immunoprecipitation assay using X. laevis cultured cells and premetamorphic tadpoles treated with or without 2 nM T3. Exposure to T3 increased the amount of the thrb transcript, in parallel with enhanced histone H4 acetylation and RNAPII recruitment, and probably phosphorylation of RNAPII at serine 5, in the 5' regulatory and exon b regions. However, the 5' regulatory region remained hypermethylated even with exposure to T3, and there was no significant difference in the methylation status between DNAs from T3-untreated and -treated cultured cells or tadpole tissues. Our results demonstrate that exposure to T3 induced euchromatin-associated epigenetic marks by enhancing histone acetylation and RNAPII recruitment, but not by decreasing the level of DNA methylation, in the 5' regulatory region of the X. laevis thrb gene. Copyright © 2015 Elsevier Inc. All rights reserved.
Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium
Energy Technology Data Exchange (ETDEWEB)
Cooper, Karen L.; Dashner, Erica J. [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Tsosie, Ranalda [Department of Chemistry and Biochemistry, University of Montana, Missoula, MT 59812 (United States); Cho, Young Mi [Department of Food and Nutrition, College of Human Ecology, Hanyang University, Seoul 133-791 (Korea, Republic of); Lewis, Johnnye [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States); Community Environmental Health Program, University of New Mexico Health Sciences Center College of Pharmacy, Albuquerque, NM 87131 (United States); Hudson, Laurie G., E-mail: lhudson@salud.unm.edu [Department of Pharmaceutical Sciences, College of Pharmacy, University of New Mexico Health Sciences Center, Albuquerque, NM 87131 (United States)
2016-01-15
Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; < 10 μM) is not cytotoxic to human embryonic kidney cells or normal human keratinocytes; however, uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. - Highlights: • Low micromolar concentration of uranium inhibits polymerase-1 (PARP-1) activity. • Uranium causes zinc loss from multiple DNA repair proteins. • Uranium enhances retention of DNA damage caused by ultraviolet radiation. • Zinc reverses the effects of uranium on PARP activity and DNA damage repair.
Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA
Directory of Open Access Journals (Sweden)
Ana Lisa do Vale Gomes
2006-10-01
Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.
Energy Technology Data Exchange (ETDEWEB)
Yamaguchi, H; Tatara, A; Naito, T [Tokyo Univ. (Japan). Faculty of Agriculture
1976-09-01
After dry barley seeds were irradiated with ..gamma..-rays and soaked for various times, the squashed preparations were made of the first leaf meristems and incubated with E.coli DNA polymerase I with appropriate substrates. The incorporation of nucleotides with DNA polymerase occurred in the cells fixed at late G/sub 1/ after 15 kR and at middle and late G/sub 1/ after 30 kR, respectively. There was an interrelation between the incorporation of nucleotides by DNA polymerase and the chromatin diffusion throughout a nucleus. The observations were interpreted in terms of the accessibility of 3'-0H groups of DNA breaks which accompanies the change of the conformation of chromatin fibres.
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.
2014-01-01
The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713
Baños, Benito; Lázaro, José M; Villar, Laurentino; Salas, Margarita; de Vega, Miguel
2008-10-01
Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolX(Bs)), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolX(Bs) possesses an intrinsic 3'-5' exonuclease activity specialized in resecting unannealed 3'-termini in a gapped DNA substrate. Biochemical analysis of a PolX(Bs) deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3'-5' exonuclease activity of PolX(Bs) resides in its PHP domain. Furthermore, site-directed mutagenesis of PolX(Bs) His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3'-termini resection by the 3'-5' exonuclease activity of PolX(Bs) in the DNA repair context are discussed.
Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai
2011-01-01
Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702
Are There Mutator Polymerases?
Directory of Open Access Journals (Sweden)
Miguel Garcia-Diaz
2003-01-01
Full Text Available DNA polymerases are involved in different cellular events, including genome replication and DNA repair. In the last few years, a large number of novel DNA polymerases have been discovered, and the biochemical analysis of their properties has revealed a long list of intriguing features. Some of these polymerases have a very low fidelity and have been suggested to play mutator roles in different processes, like translesion synthesis or somatic hypermutation. The current view of these processes is reviewed, and the current understanding of DNA polymerases and their role as mutator enzymes is discussed.
van den Berg, A.A.; Depken, S.M.
2017-01-01
During eukaryotic transcription, RNA polymerase (RNAP) translocates along DNA molecules covered with nucleosomes and other DNA binding proteins. Though the interactions between a single nucleosome and RNAP are by now fairly well understood, this understanding has not been synthesized into a
Hu, Jian-Hua; Wang, Feng; Liu, Chun-Zhao
2015-04-01
An efficient induction strategy that consisted of multiple additions of small doses of isopropyl-β-D-thiogalactopyranoside (IPTG) in the early cell growth phase was developed for enhancing Pfu DNA polymerase production in Escherichia coli. In comparison to the most commonly used method of a single induction of 1 mM IPTG, the promising induction strategy resulted in an increase in the Pfu activity of 13.5% in shake flasks, while simultaneously decreasing the dose of IPTG by nearly half. An analysis of the intracellular IPTG concentrations indicated that the cells need to maintain an optimum intracellular IPTG concentration after 6 h for efficient Pfu DNA polymerase production. A significant increase in the Pfu DNA polymerase activity of 31.5% under the controlled dissolved oxygen concentration of 30% in a 5 L fermentor was achieved using the multiple IPTG induction strategy in comparison with the single IPTG induction. The induction strategy using multiple inputs of IPTG also avoided over accumulation of IPTG and reduced the cost of Pfu DNA polymerase production.
Gaur, Vineet; Vyas, Rajan; Fowler, Jason D.; Efthimiopoulos, Georgia; Feng, Joy Y.; Suo, Zucai
2014-01-01
Considering that all natural nucleotides (D-dNTPs) and the building blocks (D-dNMPs) of DNA chains possess D-stereochemistry, DNA polymerases and reverse transcriptases (RTs) likely possess strongD-stereoselectivity by preferably binding and incorporating D-dNTPs over unnatural L-dNTPs during DNA synthesis. Surprisingly, a structural basis for the discrimination against L-dNTPs by DNA polymerases or RTs has not been established although L-deoxycytidine analogs (lamivudine and emtricitabine) a...
International Nuclear Information System (INIS)
Creissen, D.M.; Hill, C.K.
1991-01-01
Studies of repair enzyme activities in a uv-sensitive cell line (V79/UC) derived from Chinese hamster V79 cells have revealed levels of total DNA polymerase that are about 50% of the levels in the parental cell line. There are a number of DNA polymerase inhibitors available which allow us to distinguish between the major forms of DNA polymerase (alpha, beta, gamma, and delta) identified in mammalian cells. Enzyme assays with these inhibitors indicate that the aphidicolin-sensitive DNA polymerase is defective in the V79/UC cell line. This could be either polymerase alpha or delta, or both. The V79/UC cells do not express resistance to aphidicolin in standard toxicity studies. However, when aphidicolin is added postirradiation in survival assays designed to measure the extent of inhibitable repair, V79/UC cells do not respond with the further decrease in survival seen in the parental line. Further evidence of a polymerase-dependent repair defect is evident from alkaline elution data. In this case the V79/UC cells show the appearance of single-strand breaks following uv irradiation in the absence of any added inhibitor. Cells of the V79/M12G parental line, on the other hand, show the appearance of single-strand breaks only when aphidicolin is present
Mirzakhanyan, Yeva; Gershon, Paul D
2017-09-01
The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.
International Nuclear Information System (INIS)
Billen, D.
1981-01-01
In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is observed. This is an exaggerated repair synthesis which can be abruptly terminated by the addition of the DNA ligase cofactor, nicotinamide adenine dinucleotide. This communication describes experiments which bear on the relationship between measurable strand breaks, DNA polymerase I-directed, exaggerated repair synthesis, and strand-break repair
The role of DNA polymerase I in liquid holding recovery of UV-irradiated Escherichia coli
International Nuclear Information System (INIS)
Tang, M.-S.; Patrick, M.H.
1977-01-01
Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in, DNA of different strains of E.coli K12 were determined during liquid holding recovery after UV irradiation. The extent of Pyr Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' → 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' → 3' exonuclease. (author)
A structural role for the PHP domain in E. coli DNA polymerase III.
Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H
2013-05-14
In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.
Effect of human cell malignancy on activity of DNA polymerase iota.
Kazakov, A A; Grishina, E E; Tarantul, V Z; Gening, L V
2010-07-01
An increased level of mutagenesis, partially caused by imbalanced activities of error prone DNA polymerases, is a key symptom of cell malignancy. To clarify the possible role of incorrect DNA polymerase iota (Pol iota) function in increased frequency of mutations in mammalian cells, the activity of this enzyme in extracts of cells of different mouse organs and human eye (melanoma) and eyelid (basal-cell skin carcinoma) tumor cells was studied. Both Mg2+, considered as the main activator of the enzyme reaction of in vivo DNA replication, and Mn2+, that activates homogeneous Pol iota preparations in experiments in vitro more efficiently compared to all other bivalent cations, were used as cofactors of the DNA polymerase reaction in these experiments. In the presence of Mg2+, the enzyme was active only in cell extracts of mouse testicles and brain, whereas in the presence of Mn2+ the activity of Pol iota was found in all studied normal mouse organs. It was found that in cell extracts of both types of malignant tumors (basal-cell carcinoma and melanoma) Pol iota activity was observed in the presence of either Mn2+ or Mg2+. Manganese ions activated Pol iota in both cases, though to a different extent. In the presence of Mn2+ the Pol iota activity in the basal-cell carcinoma exceeded 2.5-fold that in control cells (benign tumors from the same eyelid region). In extracts of melanoma cells in the presence of either cation, the level of the enzyme activity was approximately equal to that in extracts of cells of surrounding tumor-free tissues as well as in eyes removed after traumas. The distinctive feature of tissue malignancy (in basal-cell carcinoma and in melanoma) was the change in DNA synthesis revealed as Mn2+-activated continuation of DNA synthesis after incorrect incorporation of dG opposite dT in the template by Pol iota. Among cell extracts of different normal mouse organs, only those of testicles exhibited a similar feature. This similarity can be explained by
Czech Academy of Sciences Publication Activity Database
Furukawa, T.; Angelis, Karel; Britt, A.B.
2015-01-01
Roč. 6, MAY 27 (2015) ISSN 1664-462X R&D Projects: GA ČR GA13-06595S Institutional support: RVO:61389030 Keywords : DNA polymerase * DNA repair * Non homologous end joining Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.495, year: 2015
Energy Technology Data Exchange (ETDEWEB)
Cooper, P [Stanford Univ., Calif. (USA). Dept. of Biological Sciences
1977-01-01
The UV sensitivity of E.coli mutants deficient in the 5'..-->..3' exonuclease activity of DNA polymerase I is intermediate between that of pol/sup +/ strains and mutants which are deficient in the polymerizing activity of pol I (polA1). Like polA1 mutants, the 5'-econuclease deficient mutants exhibit increased UV-induced DNA degradation and increased repair synthesis compared to a pol/sup +/ strain, although the increase is not as great as in polA1 or in the conditionally lethal mutant BT4113ts deficient in both polymerase I activities. When dimer excision was measured at UV doses low enough to avoid interference from extensive DNA degradation, all three classes of polymerase I deficient mutants were found to remove dimers efficiently from their DNA. We conclude that enzymes alternative to polymerase I can operate in both the excision and resynthesis steps of excision repair and that substitution for either of the polymerase I functions results in longer patches of repair. A model is proposed detailing the possible events in the alternative pathways.
Effects of benzo[a]pyrene-DNA adducts on a reconstituted replication system
International Nuclear Information System (INIS)
Brown, W.C.; Romano, L.J.
1991-01-01
The authors have used a partially reconstituted replication system consisting of T7 DNA polymerase and T7 gene 4 protein to examine the effect of benzo[a]pyrene (B[a]P) adducts on DNA synthesis and gene 4 protein activities. The gene 4 protein is required for T7 DNA replication because of its ability to act as both a primase and helicase. They show here that total synthesis decreases as the level of adducts per molecule of DNA increases, suggesting that the B[a]P adducts are blocking an aspect of the replication process. By challenging synthesis on oligonucleotide-primed B[a]P-modified DNA with unmodified DNA, they present evidence that the T7 DNA polymerase freely dissociates after encountering an adduct. Prior studies have shown that the gene 4 protein alone does not dissociate from the template during translocation upon encountering an adduct. However, when gene 4 protein primed DNA synthesis is challenged, they observe an increase in synthesis but to a lesser extent than observed on oligonucleotide-primed synthesis. Finally, they have examined DNA synthesis on duplex templates and show the B[a]P adducts inhibit synthesis by the T7 DNA polymerase and gene 4 protein to the same extent regardless of whether the adducts are positioned in the leading or lagging strand, while synthesis by the polymerase alone is inhibited only when the adducts are in the template strand
Localized Cerebral Energy Failure in DNA Polymerase Gamma-Associated Encephalopathy Syndromes
Tzoulis, Charalampos; Neckelmann, Gesche; Mork, Sverre J.; Engelsen, Bernt E.; Viscomi, Carlo; Moen, Gunnar; Ersland, Lars; Zeviani, Massimo; Bindoff, Laurence A.
2010-01-01
Mutations in the catalytic subunit of the mitochondrial DNA-polymerase gamma cause a wide spectrum of clinical disease ranging from infantile hepato-encephalopathy to juvenile/adult-onset spinocerebellar ataxia and late onset progressive external ophthalmoplegia. Several of these syndromes are associated with an encephalopathy that…
Directory of Open Access Journals (Sweden)
Véronique Schenten
Full Text Available DNA polymerase µ is involved in DNA repair, V(DJ recombination and likely somatic hypermutation of immunoglobulin genes. Our previous studies demonstrated that spaceflight conditions affect immunoglobulin gene expression and somatic hypermutation frequency. Consequently, we questioned whether Polμ expression could also be affected. To address this question, we characterized Polμ of the Iberian ribbed newt Pleurodeles waltl and exposed embryos of that species to spaceflight conditions or to environmental modifications corresponding to those encountered in the International Space Station. We noted a robust expression of Polμ mRNA during early ontogenesis and in the testis, suggesting that Polμ is involved in genomic stability. Full-length Polμ transcripts are 8-9 times more abundant in P. waltl than in humans and mice, thereby providing an explanation for the somatic hypermutation predilection of G and C bases in amphibians. Polμ transcription decreases after 10 days of development in space and radiation seem primarily involved in this down-regulation. However, space radiation, alone or in combination with a perturbation of the circadian rhythm, did not affect Polμ protein levels and did not induce protein oxidation, showing the limited impact of radiation encountered during a 10-day stay in the International Space Station.
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Energy Technology Data Exchange (ETDEWEB)
B Akabayov; C Richardson
2011-12-31
Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstrate that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.
Exonuclease of human DNA polymerase gamma disengages its strand displacement function.
He, Quan; Shumate, Christie K; White, Mark A; Molineux, Ian J; Yin, Y Whitney
2013-11-01
Pol γ, the only DNA polymerase found in human mitochondria, functions in both mtDNA repair and replication. During mtDNA base-excision repair, gaps are created after damaged base excision. Here we show that Pol γ efficiently gap-fills except when the gap is only a single nucleotide. Although wild-type Pol γ has very limited ability for strand displacement DNA synthesis, exo(-) (3'-5' exonuclease-deficient) Pol γ has significantly high activity and rapidly unwinds downstream DNA, synthesizing DNA at a rate comparable to that of the wild-type enzyme on a primer-template. The catalytic subunit Pol γA alone, even when exo(-), is unable to synthesize by strand displacement, making this the only known reaction of Pol γ holoenzyme that has an absolute requirement for the accessory subunit Pol γB. © 2013. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))
1989-09-01
Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.
Inhibitory effects of vitamin K3 on DNA polymerase and angiogenesis.
Matsubara, Kiminori; Kayashima, Tomoko; Mori, Masaharu; Yoshida, Hiromi; Mizushina, Yoshiyuki
2008-09-01
Vitamins play essential roles in cellular reactions and maintain human health. Recent studies have revealed that some vitamins including D3, B6 and K2 and their derivatives have an anti-cancer effect. As a mechanism, their inhibitory effect on cancer-related angiogenesis has been demonstrated. Vitamin K2 (menaquinones) has an anti-cancer effect in particular for hepatic cancer and inhibits angiogenesis. In the current study, we demonstrated that sole vitamin K3 (menadione) selectively inhibits the in vitro activity of eukaryotic DNA polymerase gamma, which is a mitochondrial DNA polymerase, and suppresses angiogenesis in a rat aortic ring model. The anti-angiogenic effect of vitamin K3 has been shown in angiogenesis models using human umbilical vein endothelial cells (HUVECs) with regard to HUVEC growth, tube formation on reconstituted basement membrane and chemotaxis. These results suggest that vitamin K3 may be a potential anti-cancer agent like vitamin K2.
Fahrimal, Y; Goff, W L; Jasmer, D P
1992-01-01
Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551
Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation
Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali
2017-11-01
The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.
Human DNA polymerase delta double-mutant D316A;E318A interferes with DNA mismatch repair in vitro
DEFF Research Database (Denmark)
Liu, Dekang; Frederiksen, Jane H.; Liberti, Sascha Emilie
2017-01-01
DNA mismatch repair (MMR) is a highly-conserved DNA repair mechanism, whose primary role is to remove DNA replication errors preventing them from manifesting as mutations, thereby increasing the overall genome stability. Defects in MMR are associated with increased cancer risk in humans and other...... organisms. Here, we characterize the interaction between MMR and a proofreading-deficient allele of the human replicative DNA polymerase delta, PolδD316A;E318A, which has a higher capacity for strand displacement DNA synthesis than wild type Polδ. Human cell lines overexpressing PolδD316A;E318A display...
Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A
2014-01-01
The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Putative DNA-dependent RNA polymerase in Mitochondrial Plasmid of Paramecium caudatum Stock GT704
Directory of Open Access Journals (Sweden)
Trina Ekawati Tallei
2015-10-01
Full Text Available Mitochondria of Paramecium caudatum stock GT704 has a set of four kinds of linear plasmids with sizes of 8.2, 4.1, 2.8 and 1.4 kb. The plasmids of 8.2 and 2.8 kb exist as dimers consisting of 4.1- and 1.4-kb monomers, respectively. The plasmid 2.8 kb, designated as pGT704-2.8, contains an open reading frame encodes for putative DNA-dependent RNA polymerase (RNAP. This study reveals that this RNAP belongs to superfamily of DNA/RNA polymerase and family of T7/T3 single chain RNA polymerase and those of mitochondrial plasmid of fungi belonging to Basidiomycota and Ascomycota. It is suggested that RNAP of pGT704-2.8 can perform transcription without transcription factor as promoter recognition. Given that only two motifs were found, it could not be ascertained whether this RNAP has a full function independently or integrated with mtDNA in carrying out its function.
International Nuclear Information System (INIS)
SenGupta, D.N.; Kumar, P.; Zmudzka, B.Z.; Coughlin, S.; Vishwanatha, J.K.; Robey, F.A.; Parrott, C.; Wilson, S.H.
1987-01-01
A new polyclonal antibody against the α-polymerase catalytic polypeptide was prepared by using homogeneous HeLa cellα-polymerase. The antibody neutralized α-polymerase activity and was strong and specific for the α-polymerase catalytic polypeptide (M/sub r/ 183,000) in Western blot analysis of crude extracts of HeLa cells. The antibody was used to screen a cDNA library of newborn rat brain poly(A+) RNA in λgt11. A positive phage was identified and plaque purified. This phage, designated λpolα1.2, also was found to be positive with an antibody against Drosophila α-polymerase. The insert in λpolα1.2 (1183 base pairs) contained a poly(A) sequence at the 3' terminus and a short in-phase open reading frame at the 5' terminus. A synthetic oligopeptide (eight amino acids) corresponding to the open reading frame was used to raise antiserum in rabbits. Antibody affinity purified from this serum was found to be immunoreactive against purified α-polymerase by enzyme-linked immunosorbent assay and was capable of immunoprecipitating α-polymerase. This indicated the λpolα1.2 insert encoded an α-polymerase epitope and suggested that the cDNA corresponded to an α-polymerase mRNA. This was confirmed in hybrid selection experiments using pUC9 containing the cDNA insert and poly(A+) RNA from newborn rat brain; the insert hybridized to mRNA capable of encoding α-polymerase catalytic polypeptides. Northern blot analysis of rat brain poly(A+) RNA revealed that this mRNA is ∼5.4 kilobases
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1991-01-01
A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene
Bera, Bidhan Ch; Virmani, Nitin; Kumar, Naveen; Anand, Taruna; Pavulraj, S; Rash, Adam; Elton, Debra; Rash, Nicola; Bhatia, Sandeep; Sood, Richa; Singh, Raj Kumar; Tripathi, Bhupendra Nath
2017-08-23
Equine influenza is a major health problem of equines worldwide. The polymerase genes of influenza virus have key roles in virus replication, transcription, transmission between hosts and pathogenesis. Hence, the comprehensive genetic and codon usage bias of polymerase genes of equine influenza virus (EIV) were analyzed to elucidate the genetic and evolutionary relationships in a novel perspective. The group - specific consensus amino acid substitutions were identified in all polymerase genes of EIVs that led to divergence of EIVs into various clades. The consistent amino acid changes were also detected in the Florida clade 2 EIVs circulating in Europe and Asia since 2007. To study the codon usage patterns, a total of 281,324 codons of polymerase genes of EIV H3N8 isolates from 1963 to 2015 were systemically analyzed. The polymerase genes of EIVs exhibit a weak codon usage bias. The ENc-GC3s and Neutrality plots indicated that natural selection is the major influencing factor of codon usage bias, and that the impact of mutation pressure is comparatively minor. The methods for estimating host imposed translation pressure suggested that the polymerase acidic (PA) gene seems to be under less translational pressure compared to polymerase basic 1 (PB1) and polymerase basic 2 (PB2) genes. The multivariate statistical analysis of polymerase genes divided EIVs into four evolutionary diverged clusters - Pre-divergent, Eurasian, Florida sub-lineage 1 and 2. Various lineage specific amino acid substitutions observed in all polymerase genes of EIVs and especially, clade 2 EIVs underwent major variations which led to the emergence of a phylogenetically distinct group of EIVs originating from Richmond/1/07. The codon usage bias was low in all the polymerase genes of EIVs that was influenced by the multiple factors such as the nucleotide compositions, mutation pressure, aromaticity and hydropathicity. However, natural selection was the major influencing factor in defining the
Akabayov, Barak; Kulczyk, Arkadiusz W.; Akabayov, Sabine R.; Theile, Christopher; McLaughlin, Larry W.; Beauchamp, Benjamin; van Oijen, Antoine M.; Richardson, Charles C.
2011-01-01
DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PPi). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry
Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard
2018-06-01
The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-09-01
Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms
Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.
2015-01-01
Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578
International Nuclear Information System (INIS)
Shavitt, O.; Livneh, Z.
1989-01-01
The cycling time of DNA polymerase III holoenzyme during replication of UV-irradiated single-stranded (ss) DNA was longer than with unirradiated DNA (8 versus 3 min, respectively), most likely due to slow dissociation from lesion-terminated nascent DNA strands. Initiation of elongation on primed ssDNA was not significantly inhibited by the presence of UV lesions as indicated by the identical distribution of replication products synthesized at early and late reaction times and by the identical duration of the initial synthesis bursts on both unirradiated and UV-irradiated DNA templates. When replication was performed with DNA polymerase III* supplemented with increasing quantities of purified beta 2 subunit, the cycling time on UV-irradiated DNA decreased from 14.8 min at 1.7 nM beta 2 down to 6 min at 170 nM beta 2, a concentration in which beta 2 was in large excess over the polymerase. In parallel to the reduction in cycling time, also the bypass frequency of cyclobutane-photodimers decreased with increasing beta 2 concentration, and at 170 nM beta 2, bypass of photodimers was essentially eliminated. It has been shown that polymerase complexes with more than one beta 2 per polymerase molecule were formed at high beta 2 concentrations. It is plausible that polymerase complexes obtained under high beta 2 concentration dissociate from lesion-terminated primers faster than polymerase complexes formed at a low beta 2 concentration. This is expected to favor termination over bypass at pyrimidine photodimers and thus decrease their bypass frequency. These results suggest that the beta 2 subunit might act as a sensor for obstacles to replication caused by DNA damage, and that it terminates elongation at these sites by promoting dissociation. The intracellular concentration of beta 2 was estimated to be 250 nM
Sokol, Anna M.; Cruet-Hennequart, Séverine; Pasero, Philippe; Carty, Michael P.
2013-11-01
Human cells lacking DNA polymerase η (polη) are sensitive to platinum-based cancer chemotherapeutic agents. Using DNA combing to directly investigate the role of polη in bypass of platinum-induced DNA lesions in vivo, we demonstrate that nascent DNA strands are up to 39% shorter in human cells lacking polη than in cells expressing polη. This provides the first direct evidence that polη modulates replication fork progression in vivo following cisplatin and carboplatin treatment. Severe replication inhibition in individual platinum-treated polη-deficient cells correlates with enhanced phosphorylation of the RPA2 subunit of replication protein A on serines 4 and 8, as determined using EdU labelling and immunofluorescence, consistent with formation of DNA strand breaks at arrested forks in the absence of polη. Polη-mediated bypass of platinum-induced DNA lesions may therefore represent one mechanism by which cancer cells can tolerate platinum-based chemotherapy.
Directory of Open Access Journals (Sweden)
Thomas Spaller
Full Text Available The amoeba Dictyostelium discoideum has a haploid genome in which two thirds of the DNA encodes proteins. Consequently, the space available for selfish mobile elements to expand without excess damage to the host genome is limited. The non-long terminal repeat retrotransposon TRE5-A maintains an active population in the D. discoideum genome and apparently adapted to this gene-dense environment by targeting positions ~47 bp upstream of tRNA genes that are devoid of protein-coding regions. Because only ~24% of tRNA genes are associated with a TRE5-A element in the reference genome, we evaluated whether TRE5-A retrotransposition is limited to this subset of tRNA genes. We determined that a tagged TRE5-A element (TRE5-Absr integrated at 384 of 405 tRNA genes, suggesting that expansion of the current natural TRE5-A population is not limited by the availability of targets. We further observed that TRE5-Absr targets the ribosomal 5S gene on the multicopy extrachromosomal DNA element that carries the ribosomal RNA genes, indicating that TRE5-A integration may extend to the entire RNA polymerase III (Pol III transcriptome. We determined that both natural TRE5-A and cloned TRE5-Absr retrotranspose to locations on the extrachromosomal rDNA element that contain tRNA gene-typical A/B box promoter motifs without displaying any other tRNA gene context. Based on previous data suggesting that TRE5-A targets tRNA genes by locating Pol III transcription complexes, we propose that A/B box loci reflect Pol III transcription complex assembly sites that possess a function in the biology of the extrachromosomal rDNA element.
Law, Julie A.; Ausí n, Israel; Johnson, Lianna M.; Vashisht, Ajay A Amar; Zhu, Jian-Kang; Wohlschlegel, James A A.; Jacobsen, Steven E.
2010-01-01
DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.
Law, Julie A.
2010-05-01
DNA methylation is an epigenetic modification associated with gene silencing. In Arabidopsis, DNA methylation is established by DOMAINS REARRANGED METHYLTRANSFERASE 2 (DRM2), which is targeted by small interfering RNAs through a pathway termed RNA-directed DNA methylation (RdDM) [1, 2]. Recently, RdDM was shown to require intergenic noncoding (IGN) transcripts that are dependent on the Pol V polymerase. These transcripts are proposed to function as scaffolds for the recruitment of downstream RdDM proteins, including DRM2, to loci that produce both siRNAs and IGN transcripts [3]. However, the mechanism(s) through which Pol V is targeted to specific genomic loci remains largely unknown. Through affinity purification of two known RdDM components, DEFECTIVE IN RNA-DIRECTED DNA METHYLATION 1 (DRD1) [4] and DEFECTIVE IN MERISTEM SILENCING 3 (DMS3) [5, 6], we found that they copurify with each other and with a novel protein, RNA-DIRECTED DNA METHYLATION 1 (RDM1), forming a complex we term DDR. We also found that DRD1 copurified with Pol V subunits and that RDM1, like DRD1 [3] and DMS3 [7], is required for the production of Pol V-dependent transcripts. These results suggest that the DDR complex acts in RdDM at a step upstream of the recruitment or activation of Pol V. © 2010 Elsevier Ltd. All rights reserved.
The Chilo iridescent virus DNA polymerase promoter contains an essential AAAAT motif
Nalcacioglu, R.; Ince, I.A.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2007-01-01
The delayed-early DNA polymerase promoter of Chilo iridescent virus (CIV), officially known as Invertebrate iridescent virus, was fine mapped by constructing a series of increasing deletions and by introducing point mutations. The effects of these mutations were examined in a luciferase reporter
Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.
Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang
2017-12-01
Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.
Directory of Open Access Journals (Sweden)
Deanna N Edwards
Full Text Available Recent research indicates that hundreds of thousands of G-rich sequences within the human genome have the potential to form secondary structures known as G-quadruplexes. Telomeric regions, consisting of long arrays of TTAGGG/AATCCC repeats, are among the most likely areas in which these structures might form. Since G-quadruplexes assemble from certain G-rich single-stranded sequences, they might arise when duplex DNA is unwound such as during replication. Coincidentally, these bulky structures when present in the DNA template might also hinder the action of DNA polymerases. In this study, single-stranded telomeric templates with the potential to form G-quadruplexes were examined for their effects on a variety of replicative and translesion DNA polymerases from humans and lower organisms. Our results demonstrate that single-stranded templates containing four telomeric GGG runs fold into intramolecular G-quadruplex structures. These intramolecular G quadruplexes are somewhat dynamic in nature and stabilized by increasing KCl concentrations and decreasing temperatures. Furthermore, the presence of these intramolecular G-quadruplexes in the template dramatically inhibits DNA synthesis by various DNA polymerases, including the human polymerase δ employed during lagging strand replication of G-rich telomeric strands and several human translesion DNA polymerases potentially recruited to sites of replication blockage. Notably, misincorporation of nucleotides is observed when certain translesion polymerases are employed on substrates containing intramolecular G-quadruplexes, as is extension of the resulting mismatched base pairs upon dynamic unfolding of this secondary structure. These findings reveal the potential for blockage of DNA replication and genetic changes related to sequences capable of forming intramolecular G-quadruplexes.
Yuan, Quan; McHenry, Charles S
2009-11-13
In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of gamma-complex to support the reaction in the absence of tau. However, if gamma-complex is present to load beta(2), a truncated tau protein containing only domains III-V will suffice. This truncated protein is sufficient to bind both the alpha subunit of DNA polymerase (Pol) III and chipsi. This is reminiscent of the minimal requirements for Pol III to replicate short single-stranded DNA-binding protein (SSB)-coated templates where tau is only required to serve as a scaffold to hold Pol III and chi in the same complex (Glover, B., and McHenry, C. (1998) J. Biol. Chem. 273, 23476-23484). We propose a model in which strand displacement by DNA polymerase III holoenzyme depends upon a Pol III-tau-psi-chi-SSB binding network, where SSB is bound to the displaced strand, stabilizing the Pol III-template interaction. The same interaction network is probably important for stabilizing the leading strand polymerase interactions with authentic replication forks. The specificity constant (k(cat)/K(m)) for the strand displacement reaction is approximately 300-fold less favorable than reactions on single-stranded templates and proceeds with a slower rate (150 nucleotides/s) and only moderate processivity (approximately 300 nucleotides). PriA, the initiator of replication restart on collapsed or misassembled replication forks, blocks the strand displacement reaction, even if added to an ongoing reaction.
pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.
Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne
2016-07-15
Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
Energy Technology Data Exchange (ETDEWEB)
Zhu,H.; Nandakumar, J.; Aniukwu, J.; Wang, L.; Glickman, M.; Lima, C.; Shuman, S.
2006-01-01
DNA ligase D (LigD) is a large polyfunctional protein that participates in a recently discovered pathway of nonhomologous end-joining in bacteria. LigD consists of an ATP-dependent ligase domain fused to a polymerase domain (Pol) and a phosphoesterase module. The Pol activity is remarkable for its dependence on manganese, its ability to perform templated and nontemplated primer extension reactions, and its preference for adding ribonucleotides to blunt DNA ends. Here we report the 1.5- Angstroms crystal structure of the Pol domain of Pseudomonas LigD and its complexes with manganese and ATP-dATP substrates, which reveal a minimized polymerase with a two-metal mechanism and a fold similar to that of archaeal DNA primase. Mutational analysis highlights the functionally relevant atomic contacts in the active site. Although distinct nucleoside conformations and contacts for ATP versus dATP are observed in the cocrystals, the functional analysis suggests that the ATP-binding mode is the productive conformation for dNMP and rNMP incorporation. We find that a mutation of Mycobacterium LigD that uniquely ablates the polymerase activity results in increased fidelity of blunt-end double-strand break repair in vivo by virtue of eliminating nucleotide insertions at the recombination junctions. Thus, LigD Pol is a direct catalyst of mutagenic nonhomologous end-joining in vivo. Our studies underscore a previously uncharacterized role for the primase-like polymerase family in DNA repair.
Wieczorek, Anna; Downey, Christopher D; Dallmann, H Garry; McHenry, Charles S
2010-09-17
The DnaX complex (DnaX(3)δδ'χ psi) within the Escherichia coli DNA polymerase III holoenzyme serves to load the dimeric sliding clamp processivity factor, β(2), onto DNA. The complex contains three DnaX subunits, which occur in two forms: τ and the shorter γ, produced by translational frameshifting. Ten forms of E. coli DnaX complex containing all possible combinations of wild-type or a Walker A motif K51E variant τ or γ have been reconstituted and rigorously purified. DnaX complexes containing three DnaX K51E subunits do not bind ATP. Comparison of their ability to support formation of initiation complexes, as measured by processive replication by the DNA polymerase III holoenzyme, indicates a minimal requirement for one ATP-binding DnaX subunit. DnaX complexes containing two mutant DnaX subunits support DNA synthesis at about two-thirds the level of their wild-type counterparts. β(2) binding (determined functionally) is diminished 12-30-fold for DnaX complexes containing two K51E subunits, suggesting that multiple ATPs must be bound to place the DnaX complex into a conformation with maximal affinity for β(2). DNA synthesis activity can be restored by increased concentrations of β(2). In contrast, severe defects in ATP hydrolysis are observed upon introduction of a single K51E DnaX subunit. Thus, ATP binding, hydrolysis, and the ability to form initiation complexes are not tightly coupled. These results suggest that although ATP hydrolysis likely enhances β(2) loading, it is not absolutely required in a mechanistic sense for formation of functional initiation complexes.
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
Energy Technology Data Exchange (ETDEWEB)
Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)
2009-07-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
International Nuclear Information System (INIS)
Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.
2009-01-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Mechanism of Error-Free DNA Replication Past Lucidin-Derived DNA Damage by Human DNA Polymerase κ.
Yockey, Oliver P; Jha, Vikash; Ghodke, Pratibha P; Xu, Tianzuo; Xu, Wenyan; Ling, Hong; Pradeepkumar, P I; Zhao, Linlin
2017-11-20
DNA damage impinges on genetic information flow and has significant implications in human disease and aging. Lucidin-3-O-primeveroside (LuP) is an anthraquinone derivative present in madder root, which has been used as a coloring agent and food additive. LuP can be metabolically converted to genotoxic compound lucidin, which subsequently forms lucidin-specific N 2 -2'-deoxyguanosine (N 2 -dG) and N 6 -2'-deoxyadenosine (N 6 -dA) DNA adducts. Lucidin is mutagenic and carcinogenic in rodents but has low carcinogenic risks in humans. To understand the molecular mechanism of low carcinogenicity of lucidin in humans, we performed DNA replication assays using site-specifically modified oligodeoxynucleotides containing a structural analogue (LdG) of lucidin-N 2 -dG DNA adduct and determined the crystal structures of DNA polymerase (pol) κ in complex with LdG-bearing DNA and an incoming nucleotide. We examined four human pols (pol η, pol ι, pol κ, and Rev1) in their efficiency and accuracy during DNA replication with LdG; these pols are key players in translesion DNA synthesis. Our results demonstrate that pol κ efficiently and accurately replicates past the LdG adduct, whereas DNA replication by pol η, pol ι is compromised to different extents. Rev1 retains its ability to incorporate dCTP opposite the lesion albeit with decreased efficiency. Two ternary crystal structures of pol κ illustrate that the LdG adduct is accommodated by pol κ at the enzyme active site during insertion and postlesion-extension steps. The unique open active site of pol κ allows the adducted DNA to adopt a standard B-form for accurate DNA replication. Collectively, these biochemical and structural data provide mechanistic insights into the low carcinogenic risk of lucidin in humans.
Lee, Jong-Hyuk; Kang, Byung-Hee; Jang, Hyonchol; Kim, Tae Wan; Choi, Jinmi; Kwak, Sojung; Han, Jungwon; Cho, Eun-Jung; Youn, Hong-Duk
2015-05-19
Post-translational modifications of core histones affect various cellular processes, primarily through transcription. However, their relationship with the termination of transcription has remained largely unknown. In this study, we show that DNA damage-activated AKT phosphorylates threonine 45 of core histone H3 (H3-T45). By genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis, H3-T45 phosphorylation was distributed throughout DNA damage-responsive gene loci, particularly immediately after the transcription termination site. H3-T45 phosphorylation pattern showed close-resemblance to that of RNA polymerase II C-terminal domain (CTD) serine 2 phosphorylation, which establishes the transcription termination signal. AKT1 was more effective than AKT2 in phosphorylating H3-T45. Blocking H3-T45 phosphorylation by inhibiting AKT or through amino acid substitution limited RNA decay downstream of mRNA cleavage sites and decreased RNA polymerase II release from chromatin. Our findings suggest that AKT-mediated phosphorylation of H3-T45 regulates the processing of the 3' end of DNA damage-activated genes to facilitate transcriptional termination. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DNA methylation in inflammatory genes among children with obstructive sleep apnea.
Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David
2012-02-01
Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Directory of Open Access Journals (Sweden)
Tiana Milanda
2014-12-01
Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
Shrihari, Rohinishree Yadahalli; Singh, Negi Pradeep
2012-02-01
Staphylococcus aureus survives well in different stress conditions. The ability of this organism to adapt to various stresses is the result of a complex regulatory response, which is attributed to regulation of multiple genes. The aims of the present study were (1) to develop a multiplex PCR for the detection of genes which are involved in stress adaptation (asp23, dnaK, and groEL); alternative sigma factor (sigB) and virulence determination (entB and spa) and (2) to study the expression of these genes during stress conditions for S. aureus culture collection strains (FRI 722 and ATCC 6538) and S. aureus food isolates at mRNA level using multiplex reverse transcription polymerase chain reaction (RT-PCR). During heat shock treatment groEL, dnaK, asp23, sodA, entB, spa, and sigB genes were up regulated up to 2.58, 2.07, 2.76, 2.55, 3.55, 2.71, and 2.62- folds, respectively, whereas in acid shock treatment, sodA and groEL were up regulated; dnaK was downregulated; and entB and sigB genes were not expressed in food isolates. Multiplex PCR assay standardized in this study offers an inexpensive alternative to uniplex PCR for detection of various virulence and stress response genes. This study is relevant to rapid and accurate detection of potential pathogenic S. aureus in foods. © 2012 Institute of Food Technologists®
The expanding polymerase universe.
Goodman, M F; Tippin, B
2000-11-01
Over the past year, the number of known prokaryotic and eukaryotic DNA polymerases has exploded. Many of these newly discovered enzymes copy aberrant bases in the DNA template over which 'respectable' polymerases fear to tread. The next step is to unravel their functions, which are thought to range from error-prone copying of DNA lesions, somatic hypermutation and avoidance of skin cancer, to restarting stalled replication forks and repairing double-stranded DNA breaks.
Copani, Agata; Hoozemans, Jeroen J. M.; Caraci, Filippo; Calafiore, Marco; van Haastert, Elise S.; Veerhuis, Robert; Rozemuller, Annemieke J. M.; Aronica, Eleonora; Sortino, Maria Angela; Nicoletti, Ferdinando
2006-01-01
Cultured neurons exposed to synthetic beta-amyloid (Abeta) fragments reenter the cell cycle and initiate a pathway of DNA replication that involves the repair enzyme DNA polymerase-beta (DNA pol-beta) before undergoing apoptotic death. In this study, by performing coimmunoprecipitation experiments
Baños, Benito; Lázaro, José M.; Villar, Laurentino; de Vega, Miguel
2008-01-01
Bacillus subtilis gene yshC encodes a family X DNA polymerase (PolXBs), whose biochemical features suggest that it plays a role during DNA repair processes. Here, we show that, in addition to the polymerization activity, PolXBs possesses an intrinsic 3′–5′ exonuclease activity specialized in resecting unannealed 3′-termini in a gapped DNA substrate. Biochemical analysis of a PolXBs deletion mutant lacking the C-terminal polymerase histidinol phosphatase (PHP) domain, present in most of the bacterial/archaeal PolXs, as well as of this separately expressed protein region, allow us to state that the 3′–5′ exonuclease activity of PolXBs resides in its PHP domain. Furthermore, site-directed mutagenesis of PolXBs His339 and His341 residues, evolutionary conserved in the PHP superfamily members, demonstrated that the predicted metal binding site is directly involved in catalysis of the exonucleolytic reaction. The implications of the unannealed 3′-termini resection by the 3′–5′ exonuclease activity of PolXBs in the DNA repair context are discussed. PMID:18776221
Inactivation of Pol θ and C-NHEJ eliminates off-target integration of exogenous DNA.
Zelensky, Alex N; Schimmel, Joost; Kool, Hanneke; Kanaar, Roland; Tijsterman, Marcel
2017-07-07
Off-target or random integration of exogenous DNA hampers precise genomic engineering and presents a safety risk in clinical gene therapy strategies. Genetic definition of random integration has been lacking for decades. Here, we show that the A-family DNA polymerase θ (Pol θ) promotes random integration, while canonical non-homologous DNA end joining plays a secondary role; cells double deficient for polymerase θ and canonical non-homologous DNA end joining are devoid of any integration events, demonstrating that these two mechanisms define random integration. In contrast, homologous recombination is not reduced in these cells and gene targeting is improved to 100% efficiency. Such complete reversal of integration outcome, from predominately random integration to exclusively gene targeting, provides a rational way forward to improve the efficacy and safety of DNA delivery and gene correction approaches.Random off-target integration events can impair precise gene targeting and poses a safety risk for gene therapy. Here the authors show that repression of polymerase θ and classical non-homologous recombination eliminates random integration.
Zahurancik, Walter J.; Baranovskiy, Andrey G.; Tahirov, Tahir H.; Suo, Zucai
2015-01-01
Numerous genetic studies have provided compelling evidence to establish DNA polymerase ε (Polε) as the primary DNA polymerase responsible for leading strand synthesis during eukaryotic nuclear genome replication. Polε is a heterotetramer consisting of a large catalytic subunit that contains the conserved polymerase core domain as well as a 3′ → 5′ exonuclease domain common to many replicative polymerases. In addition, Polε possesses three small subunits that lack a known catalytic activity but associate with components involved in a variety of DNA replication and maintenance processes. Previous enzymatic characterization of the Polε heterotetramer from budding yeast suggested that the small subunits slightly enhance DNA synthesis by Polε in vitro. However, similar studies of the human Polε heterote-tramer (hPolε) have been limited by the difficulty of obtaining hPolε in quantities suitable for thorough investigation of its catalytic activity. Utilization of a baculovirus expression system for overexpression and purification of hPolε from insect host cells has allowed for isolation of greater amounts of active hPolε, thus enabling a more detailed kinetic comparison between hPolε and an active N-terminal fragment of the hPolε catalytic subunit (p261N), which is readily overexpressed in Escherichia coli. Here, we report the first pre-steady-state studies of fully-assembled hPolε. We observe that the small subunits increase DNA binding by hPolε relative to p261N, but do not increase processivity during DNA synthesis on a single-stranded M13 template. Interestingly, the 3′ → 5′ exonuclease activity of hPolε is reduced relative to p261N on matched and mismatched DNA substrates, indicating that the presence of the small subunits may regulate the proofreading activity of hPolε and sway hPolε toward DNA synthesis rather than proofreading. PMID:25684708
The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.
2015-01-01
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667
Stripped-down DNA repair in a highly reduced parasite
Directory of Open Access Journals (Sweden)
Fast Naomi M
2007-03-01
Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the
Energy Technology Data Exchange (ETDEWEB)
Boiteux, S.; Laval, J. (Institut Gustave-Roussy, 94 - Villejuif (France))
After treatment of poly(dC) by the simple alkylating agent (/sup 3/H)dimethylsulfate, 90 percent of the radioactivity cochromatographed with 3-methylcytosine and 10 percent with 5-methylcytosine which is the normally occurring methylated base. In order to study the influence of 3-methylcytosine on DNA replication, untreated and MDS-treated poly(dC) were used as templates for E. coli DNA polymerase I. The alkylation of poly(dC) inhibits DNA chain elongation, and does not induce any mispairing under high fidelity conditions. The alteration of DNA polymerase I fidelity by manganese ions allows some replication of 3-methylcytosine which mispairs with either dAMP or dTMP. Our results suggest that 3-methylcytosine could be responsible, at least partially, for killing and the mutagenesis observed after cell treatment by alkylating agents.
Mechanism of error-free DNA synthesis across N1-methyl-deoxyadenosine by human DNA polymerase-ι
Energy Technology Data Exchange (ETDEWEB)
Jain, Rinku; Choudhury, Jayati Roy; Buku, Angeliki; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.
2017-03-08
N1-methyl-deoxyadenosine (1-MeA) is formed by methylation of deoxyadenosine at the N1 atom. 1-MeA presents a block to replicative DNA polymerases due to its inability to participate in Watson-Crick (W-C) base pairing. Here we determine how human DNA polymerase-ι (Polι) promotes error-free replication across 1-MeA. Steady state kinetic analyses indicate that Polι is ~100 fold more efficient in incorporating the correct nucleotide T versus the incorrect nucleotide C opposite 1-MeA. To understand the basis of this selectivity, we determined ternary structures of Polι bound to template 1-MeA and incoming dTTP or dCTP. In both structures, template 1-MeA rotates to the syn conformation but pairs differently with dTTP versus dCTP. Thus, whereas dTTP partakes in stable Hoogsteen base pairing with 1-MeA, dCTP fails to gain a “foothold” and is largely disordered. Together, our kinetic and structural studies show how Polι maintains discrimination between correct and incorrect incoming nucleotide opposite 1-MeA in preserving genome integrity.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
International Nuclear Information System (INIS)
Morimyo, Mitsuoki
1995-01-01
Fission yeast S. pombe is assumed to be a good model for cloning of human DNA repair genes, because human gene is normally expressed in S. pombe and has a very similar protein sequence to yeast protein. We have tried to elucidate the DNA repair mechanisms of S. pombe as a model system for those of mammals. (J.P.N.)
Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R
2000-06-01
We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-08-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the beta clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25 degrees C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25 degrees C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42 degrees C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25 degrees C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25 degrees C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway.
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-01-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the β clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25°C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25°C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42°C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25°C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25°C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway. PMID:18502852
Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.
2017-04-01
Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.
Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.
1992-04-01
Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.
Sun, Daekyu; Hurley, Laurence H
2010-01-01
The proximal promoter region of many human growth-related genes contains a polypurine/polypyrimidine tract that serves as multiple binding sites for Sp1 or other transcription factors. These tracts often contain a guanine-rich sequence consisting of four runs of three or more contiguous guanines separated by one or more bases, corresponding to a general motif known for the formation of an intramolecular G-quadruplex. Recent results provide strong evidence that specific G-quadruplex structures form naturally within these polypurine/polypyrimidine tracts in many human promoter regions, raising the possibility that the transcriptional control of these genes can be modulated by G-quadruplex-interactive agents. In this chapter, we describe three general biochemical methodologies, electrophoretic mobility shift assay (EMSA), dimethylsulfate (DMS) footprinting, and the DNA polymerase stop assay, which can be useful for initial characterization of G-quadruplex structures formed by G-rich sequences.
International Nuclear Information System (INIS)
Kadowaki, T.; Kadowaki, H.; Taylor, S.I.
1990-01-01
Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam
2017-01-01
Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided
Kashiwagi, Sayo; Kuraoka, Isao; Fujiwara, Yoshie; Hitomi, Kenichi; Cheng, Quen J.; Fuss, Jill O.; Shin, David S.; Masutani, Chikahide; Tainer, John A.; Hanaoka, Fumio; Iwai, Shigenori
2010-01-01
Human DNA polymerase η (HsPolη) plays an important role in translesion synthesis (TLS), which allows for replication past DNA damage such as UV-induced cis-syn cyclobutane pyrimidine dimers (CPDs). Here, we characterized ApPolη from the thermophilic worm Alvinella pompejana, which inhabits deep-sea hydrothermal vent chimneys. ApPolη shares sequence homology with HsPolη and contains domains for binding ubiquitin and proliferating cell nuclear antigen. Sun-induced UV does not penetrate Alvinella's environment; however, this novel DNA polymerase catalyzed efficient and accurate TLS past CPD, as well as 7,8-dihydro-8-oxoguanine and isomers of thymine glycol induced by reactive oxygen species. In addition, we found that ApPolη is more thermostable than HsPolη, as expected from its habitat temperature. Moreover, the activity of this enzyme was retained in the presence of a higher concentration of organic solvents. Therefore, ApPolη provides a robust, human-like Polη that is more active after exposure to high temperatures and organic solvents. PMID:20936172
Wynne, Samantha A.; Pinheiro, Vitor B.; Holliger, Philipp; Leslie, Andrew G. W.
2013-01-01
Thermophilic DNA polymerases of the polB family are of great importance in biotechnological applications including high-fidelity PCR. Of particular interest is the relative promiscuity of engineered versions of the exo- form of polymerases from the Thermo- and Pyrococcales families towards non-canonical substrates, which enables key advances in Next-generation sequencing. Despite this there is a paucity of structural information to guide further engineering of this group of polymerases. Here we report two structures, of the apo form and of a binary complex of a previously described variant (E10) of Pyrococcus furiosus (Pfu) polymerase with an ability to fully replace dCTP with Cyanine dye-labeled dCTP (Cy3-dCTP or Cy5-dCTP) in PCR and synthesise highly fluorescent “CyDNA” densely decorated with cyanine dye heterocycles. The apo form of Pfu-E10 closely matches reported apo form structures of wild-type Pfu. In contrast, the binary complex (in the replicative state with a duplex DNA oligonucleotide) reveals a closing movement of the thumb domain, increasing the contact surface with the nascent DNA duplex strand. Modelling based on the binary complex suggests how bulky fluorophores may be accommodated during processive synthesis and has aided the identification of residues important for the synthesis of unnatural nucleic acid polymers. PMID:23940661
The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F
2015-05-15
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
Gammon, Don B; Evans, David H
2009-05-01
Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
Comparison of checkpoint responses triggered by DNA polymerase inhibition versus DNA damaging agents
International Nuclear Information System (INIS)
Liu, J.-S.; Kuo, S.-R.; Melendy, Thomas
2003-01-01
To better understand the different cellular responses to replication fork pausing versus blockage, early DNA damage response markers were compared after treatment of cultured mammalian cells with agents that either inhibit DNA polymerase activity (hydroxyurea (HU) or aphidicolin) or selectively induce S-phase DNA damage responses (the DNA alkylating agents, methyl methanesulfonate (MMS) and adozelesin). These agents were compared for their relative abilities to induce phosphorylation of Chk1, H2AX, and replication protein A (RPA), and intra-nuclear focalization of γ-H2AX and RPA. Treatment by aphidicolin and HU resulted in phosphorylation of Chk1, while HU, but not aphidicolin, induced focalization of γ-H2AX and RPA. Surprisingly, pre-treatment with aphidicolin to stop replication fork progression, did not abrogate HU-induced γ-H2AX and RPA focalization. This suggests that HU may act on the replication fork machinery directly, such that fork progression is not required to trigger these responses. The DNA-damaging fork-blocking agents, adozelesin and MMS, both induced phosphorylation and focalization of H2AX and RPA. Unlike adozelesin and HU, the pattern of MMS-induced RPA focalization did not match the BUdR incorporation pattern and was not blocked by aphidicolin, suggesting that MMS-induced damage is not replication fork-dependent. In support of this, MMS was the only reagent used that did not induce phosphorylation of Chk1. These results indicate that induction of DNA damage checkpoint responses due to adozelesin is both replication fork and fork progression dependent, induction by HU is replication fork dependent but progression independent, while induction by MMS is independent of both replication forks and fork progression
Comparison of checkpoint responses triggered by DNA polymerase inhibition versus DNA damaging agents
Energy Technology Data Exchange (ETDEWEB)
Liu, J.-S.; Kuo, S.-R.; Melendy, Thomas
2003-11-27
To better understand the different cellular responses to replication fork pausing versus blockage, early DNA damage response markers were compared after treatment of cultured mammalian cells with agents that either inhibit DNA polymerase activity (hydroxyurea (HU) or aphidicolin) or selectively induce S-phase DNA damage responses (the DNA alkylating agents, methyl methanesulfonate (MMS) and adozelesin). These agents were compared for their relative abilities to induce phosphorylation of Chk1, H2AX, and replication protein A (RPA), and intra-nuclear focalization of {gamma}-H2AX and RPA. Treatment by aphidicolin and HU resulted in phosphorylation of Chk1, while HU, but not aphidicolin, induced focalization of {gamma}-H2AX and RPA. Surprisingly, pre-treatment with aphidicolin to stop replication fork progression, did not abrogate HU-induced {gamma}-H2AX and RPA focalization. This suggests that HU may act on the replication fork machinery directly, such that fork progression is not required to trigger these responses. The DNA-damaging fork-blocking agents, adozelesin and MMS, both induced phosphorylation and focalization of H2AX and RPA. Unlike adozelesin and HU, the pattern of MMS-induced RPA focalization did not match the BUdR incorporation pattern and was not blocked by aphidicolin, suggesting that MMS-induced damage is not replication fork-dependent. In support of this, MMS was the only reagent used that did not induce phosphorylation of Chk1. These results indicate that induction of DNA damage checkpoint responses due to adozelesin is both replication fork and fork progression dependent, induction by HU is replication fork dependent but progression independent, while induction by MMS is independent of both replication forks and fork progression.
Fission yeast shelterin regulates DNA polymerases and Rad3(ATR kinase to limit telomere extension.
Directory of Open Access Journals (Sweden)
Ya-Ting Chang
2013-11-01
Full Text Available Studies in fission yeast have previously identified evolutionarily conserved shelterin and Stn1-Ten1 complexes, and established Rad3(ATR/Tel1(ATM-dependent phosphorylation of the shelterin subunit Ccq1 at Thr93 as the critical post-translational modification for telomerase recruitment to telomeres. Furthermore, shelterin subunits Poz1, Rap1 and Taz1 have been identified as negative regulators of Thr93 phosphorylation and telomerase recruitment. However, it remained unclear how telomere maintenance is dynamically regulated during the cell cycle. Thus, we investigated how loss of Poz1, Rap1 and Taz1 affects cell cycle regulation of Ccq1 Thr93 phosphorylation and telomere association of telomerase (Trt1(TERT, DNA polymerases, Replication Protein A (RPA complex, Rad3(ATR-Rad26(ATRIP checkpoint kinase complex, Tel1(ATM kinase, shelterin subunits (Tpz1, Ccq1 and Poz1 and Stn1. We further investigated how telomere shortening, caused by trt1Δ or catalytically dead Trt1-D743A, affects cell cycle-regulated telomere association of telomerase and DNA polymerases. These analyses established that fission yeast shelterin maintains telomere length homeostasis by coordinating the differential arrival of leading (Polε and lagging (Polα strand DNA polymerases at telomeres to modulate Rad3(ATR association, Ccq1 Thr93 phosphorylation and telomerase recruitment.
International Nuclear Information System (INIS)
Berger, N.A.; Berger, S.J.
1986-01-01
Recent studies show that DNA damage can produce rapid alterations in steady state levels of deoxynucleoside triphosphate pools, for example, MNNG or uv-irradiation cause rapid increases in dATP and dTTP pools without significant changes in dGTP or dCTP pools. In vitro, studies with purified eukaryotic DNA polymerases show that the frequency of nucleotide misincorporation was affected by alterations in relative concentrations of the deoxynucleoside triphosphates. Thus the alterations in dNTP pool sizes that occur consequent to DNA damage may contribute to an increased mutagenic frequency. Poly(ADP-ribose) polymerase mediated suicide mechanism may participate in the toxicity of adenosine deaminase deficiency and severe combined immune deficiency disease in humans. Individuals with this disease suffer severe lymphopenia due to the toxic effects of deoxyadenosine. The lymphocytotoxic effect of adenosine deaminase deficiency can be simulated in lymphocyte cell lines from normal individuals by incubating them with the adenosine deaminase inhibitor, deoxycoformycin. Incubation of such leukocytes with deoxycoformycin and deoxyadenosine results in the gradual accumulation of DNA strand breaks and the depletion of NAD + leading to cell death over a period of several days. This depletion of NAD and loss of cell viability were effectively blocked by nicotinamide or 3-amino benzamide. Thus, persistent activation of poly(ADP-ribose) polymerase by unrepaired or recurrent DNA strand breaks may activate the suicide mechanism of cell death. This study provides a basis for the interesting suggestion that treatment with nicotinamide could block the persistent activity of poly(ADP-ribose) polymerase and may help preserve lymphocyte function in patients with adenosine deaminase deficiency. 16 refs., 3 figs., 2 tabs
Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium.
Cooper, Karen L; Dashner, Erica J; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye; Hudson, Laurie G
2016-01-15
Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. Copyright © 2015 Elsevier Inc. All rights reserved.
Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.
Warwicker, J; Ollis, D; Richards, F M; Steitz, T A
1985-12-05
The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.
Study of the activity of DNA polymerases β and λ using 5-formyluridine containing DNA substrates
Directory of Open Access Journals (Sweden)
Lavrik O. I.
2012-06-01
Full Text Available Aim. To investigate the TLS-activity of human DNA polymerases β and λ (pols β and λ using 5-formyluridine (5-foU containing DNA duplexes which are imitating the intermediates during replication of the leading DNA strand, and to study the influence of replication factors hRPA and hPCNA on this activity. Methods. The EMSA and the methods of enzyme’s kinetics were used. Results. The capability of pols β and λ to catalyze DNA synthesis across 5-foU was investigated and the kinetic characteristics of this process in the presence and in the absence of protein factors hRPA and hPCNA were evaluated. Conclusions. It was shown that: (i both proteins are able to catalyze TLS on used DNA substrates regardless of the reaction conditions, however, pol λ was more accurate enzyme; (ii hRPA can stimulate the efficacy of the nonmutagenic TLS catalyzed by pol at the nucleotide incorporation directly opposite of 5-foU, at the same time it doesn’t influence the incorporation efficacy if the damage displaced into the duplex; (iii hPCNA doesn’t influence the efficacy of TLS catalyzed by both enzymes.
Directory of Open Access Journals (Sweden)
Olivier J Becherel
2013-04-01
Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.
Yuan, Quan; McHenry, Charles S.
2009-01-01
In addition to the well characterized processive replication reaction catalyzed by the DNA polymerase III holoenzyme on single-stranded DNA templates, the enzyme possesses an intrinsic strand displacement activity on flapped templates. The strand displacement activity is distinguished from the single-stranded DNA-templated reaction by a high dependence upon single-stranded DNA binding protein and an inability of γ-complex to support the reaction in the absence of τ. However, if γ-complex is p...
Zhu, Hui; Bhattarai, Hitesh; Yan, Han-Guang; Shuman, Stewart; Glickman, Michael S
2012-12-21
Mycobacteria exploit nonhomologous end-joining (NHEJ) to repair DNA double-strand breaks. The core NHEJ machinery comprises the homodimeric DNA end-binding protein Ku and DNA ligase D (LigD), a modular enzyme composed of a C-terminal ATP-dependent ligase domain (LIG), a central 3'-phosphoesterase domain (PE), and an N-terminal polymerase domain (POL). LigD POL is proficient at adding templated and nontemplated deoxynucleotides and ribonucleotides to DNA ends in vitro and is the catalyst in vivo of unfaithful NHEJ events involving nontemplated single-nucleotide additions to blunt DSB ends. Here, we identify two mycobacterial proteins, PolD1 and PolD2, as stand-alone homologues of the LigD POL domain. Biochemical characterization of PolD1 and PolD2 shows that they resemble LigD POL in their monomeric quaternary structures, their ability to add templated and nontemplated nucleotides to primer-templates and blunt ends, and their preference for rNTPs versus dNTPs. Deletion of polD1, polD2, or both from a Mycobacterium smegmatis strain carrying an inactivating mutation in LigD POL failed to reveal a role for PolD1 or PolD2 in templated nucleotide additions during NHEJ of 5'-overhang DSBs or in clastogen resistance. Whereas our results document the existence and characteristics of new stand-alone members of the LigD POL family of RNA/DNA polymerases, they imply that other polymerases can perform fill-in synthesis during mycobacterial NHEJ.
Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal
2017-11-01
5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome.
Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa
2017-07-01
The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2009-04-01
The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.
Lucas, Daniel; Escudero, Beatriz; Ligos, José Manuel; Segovia, Jose Carlos; Estrada, Juan Camilo; Terrados, Gloria; Blanco, Luis; Samper, Enrique; Bernad, Antonio
2009-01-01
Polymerase mu (Polμ) is an error-prone, DNA-directed DNA polymerase that participates in non-homologous end-joining (NHEJ) repair. In vivo, Polμ deficiency results in impaired Vκ-Jκ recombination and altered somatic hypermutation and centroblast development. In Polμ−/− mice, hematopoietic development was defective in several peripheral and bone marrow (BM) cell populations, with about a 40% decrease in BM cell number that affected several hematopoietic lineages. Hematopoietic progenitors were reduced both in number and in expansion potential. The observed phenotype correlates with a reduced efficiency in DNA double-strand break (DSB) repair in hematopoietic tissue. Whole-body γ-irradiation revealed that Polμ also plays a role in DSB repair in non-hematopoietic tissues. Our results show that Polμ function is required for physiological hematopoietic development with an important role in maintaining early progenitor cell homeostasis and genetic stability in hematopoietic and non-hematopoietic tissues. PMID:19229323
Directory of Open Access Journals (Sweden)
Mukul Sharma
2017-01-01
Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the
Chaturvedula, V S Prakash; Zhou, Bing-Nan; Gao, Zhijie; Thomas, Shannon J; Hecht, Sidney M; Kingston, David G I
2004-12-01
Bioassay-directed fractionation of a methyl ethyl ketone extract of Solidago canadensis L. (Asteraceae), using an assay to detect the lyase activity of DNA polymerase beta, resulted in the isolation of the four new lupane triterpenoids 1-4 and the seven known compounds lupeol, lupeyl acetate, ursolic acid, cycloartenol, cycloartenyl palmitate, alpha-amyrin acetate, and stigmasterol. The structures of the new compounds were established as 3beta-(3R-acetoxyhexadecanoyloxy)-lup-20(29)-ene (1), 3beta-(3-ketohexadecanoyloxy)-lup-20(29)-ene (2), 3beta-(3R-acetoxyhexadecanoyloxy)-29-nor-lupan-20-one (3), and 3beta-(3-hetohexadecanoyloxy)-29-nor-lupan-20-one (4), respectively, on the basis of extensive 1D and 2D NMR spectroscopic interpretation and chemical modification studies. All 11 compounds were inhibitory to the lyase activity of DNA polymerase beta.
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
Microsatellites grant more stable flanking genes
Directory of Open Access Journals (Sweden)
Joukhadar Reem
2012-10-01
Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are DNA sequences that include tandem copies of specific sequences no longer than six bases. SSRs are ubiquitous in all genomes and highly mutable. Presentation of the hypothesis Results from previous studies suggest that flanking regions of SSR are exhibit high stability in a wide range of organisms. We hypothesized that the SSRs ability to discard weak DNA polymerases could be responsible for this unusual stability. . When the weak polymerases are being decayed over SSRs, the flanking sequences would have higher opportunity to be replicated by more stable DNA polymerases. We present evidence of the molecular basis of our hypothesis. Testing the hypothesis The hypothesis could be tested by examining the activity of DNA polymerase during and after a number of PCRs. The PCR reactions should be run with the same SSR locus possessing differences in the SSR length. The hypothesis could also be tested by comparing the mutational rate of a transferred gene between two transformations. The first one has a naked T-DNA (transferred DNA, while the second one has the same T-DNA flanked with two SSRs. Implications of the hypothesis In any transformation experiment, flanking the T-DNA fragment with SSR sequences would result in more stably transferred genes. This process would decrease the unpredictable risks that may occur because of the mutational pressure on this foreign segment.
Adjaye, James; Daniels, Rob; Monk, Marilyn
1998-01-01
Purpose:The construction and application of polymerase chain reaction (PCR)-based cDNA libraries from unfertilized human oocytes and single preimplantation-stage embryos are described. The purpose of these studies is to provide a readily available resource for the study of gene expression during human preimplantation development.
Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai
2014-01-01
Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327
Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko
2016-09-01
Translesion DNA polymerases (TLS pols) play critical roles in defense mechanisms against genotoxic agents. The defects or mutations of TLS pols are predicted to result in hypersensitivity of cells to environmental mutagens. In this study, human cells expressing DNA polymerase ζ (Pol ζ) variants with low fidelity or weak catalytic activity have been established with Nalm-6-MSH+ cells and their sensitivity to mutagenicity and cytotoxicity of benzo[a]pyrene diol epoxide (BPDE) and ultraviolet-C light (UV-C) was examined. The low-fidelity mutants were engineered by knocking-in DNA sequences that direct changes of leucine 2618 to either phenylalanine (L2618F) or methionine (L2618M) of Pol ζ. The weak-catalytic-activity mutants were generated by knocking-in DNA sequences that direct changes of either tyrosine 2779 to phenylalanine (Y2779F) or aspartate 2781 to asparagine (D2781N). In addition, a +1 frameshift mutation, i.e., CCC to CCCC, was introduced in the coding region of the TK1 gene to measure the mutant frequencies. Doubling time and spontaneous TK mutant frequencies of the established cell lines were similar to those of the wild-type cells. The low-fidelity mutants displayed, however, higher sensitivity to the mutagenicity of BPDE and UV-C than the wild-type cells although their cytotoxic sensitivity was not changed. In contrast, the weak-catalytic-activity mutants were more sensitive to the cytotoxicity of BPDE and UV-C than the wild-type cells, and displayed much higher sensitivity to the clastogenicity of BPDE than the wild-type cells in an in vitro micronucleus assay. These results indicate that human Pol ζ is involved in TLS across DNA lesions induced by BPDE and UV-C and also that the TLS plays important roles in induction of mutations, clastogenicity and in cellular survival of the damaged human cells. Similarities and differences in in vivo roles of yeast and human Pol ζ in genome integrity are discussed. Copyright © 2016 Elsevier B.V. All rights
Structural insight into dynamic bypass of the major cisplatin-DNA adduct by Y-family polymerase Dpo4
Energy Technology Data Exchange (ETDEWEB)
Wong, Jimson H.Y.; Brown, Jessica A.; Suo, Zucai; Blum, Paul; Nohmi, Takehiko; Ling, Hong (OSU); (NINA-Japan); (UNL); (UWO)
2010-08-23
Y-family DNA polymerases bypass Pt-GG, the cisplatin-DNA double-base lesion, contributing to the cisplatin resistance in tumour cells. To reveal the mechanism, we determined three structures of the Y-family DNA polymerase, Dpo4, in complex with Pt-GG DNA. The crystallographic snapshots show three stages of lesion bypass: the nucleotide insertions opposite the 3{prime}G (first insertion) and 5{prime}G (second insertion) of Pt-GG, and the primer extension beyond the lesion site. We observed a dynamic process, in which the lesion was converted from an open and angular conformation at the first insertion to a depressed and nearly parallel conformation at the subsequent reaction stages to fit into the active site of Dpo4. The DNA translocation-coupled conformational change may account for additional inhibition on the second insertion reaction. The structures illustrate that Pt-GG disturbs the replicating base pair in the active site, which reduces the catalytic efficiency and fidelity. The in vivo relevance of Dpo4-mediated Pt-GG bypass was addressed by a dpo-4 knockout strain of Sulfolobus solfataricus, which exhibits enhanced sensitivity to cisplatin and proteomic alterations consistent with genomic stress.
International Nuclear Information System (INIS)
Kedzierska, Barbara; Glinkowska, Monika; Iwanicki, Adam; Obuchowski, Michal; Sojka, Piotr; Thomas, Mark S.; Wegrzyn, Grzegorz
2003-01-01
The bacteriophage λ cII gene codes for a transcriptional activator protein which is a crucial regulator at the stage of the 'lysis-versus-lysogeny' decision during phage development. The CII protein is highly toxic to the host, Escherichia coli, when overproduced. However, the molecular mechanism of this toxicity is not known. Here we demonstrate that DNA synthesis, but not total RNA synthesis, is strongly inhibited in cII-overexpressing E. coli cells. The toxicity was also observed when the transcriptional stimulator activity of CII was abolished either by a point mutation in the cII gene or by a point mutation, rpoA341, in the gene coding for the RNA polymerase α subunit. Moreover, inhibition of cell growth, caused by both wild-type and mutant CII proteins in either rpoA + or rpoA341 hosts, could be relieved by overexpression of the E. coli dnaB and dnaC genes. In vitro replication of an oriC-based plasmid DNA was somewhat impaired by the presence of the CII, and several CII-resistant E. coli strains contain mutations near dnaC. We conclude that the DNA replication machinery may be a target for the toxic activity of CII
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L
2012-06-27
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.
Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L
2012-01-01
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140
International Nuclear Information System (INIS)
Kapiszewska, M.; Szumiel, I.; Lange, C.S.
1988-01-01
We have used the inhibitor of DNA polymerase alpha, aphidicolin (apc) (0.5 μg/ml for 1 h), or that of DNA polymerase beta, dideoxythymidine triphosphate (ddTTP) (5 μg/ml), as well as heat (15 min at 43 deg C) to examine fixation of sublethal damage (SLD) induced by X-rays in L5178Y-S (LY-S) cells. This cell line has the unique property of responding to split X-ray doses at 37 deg C by decreased survival. This effect was partly abolished by heating the cells before irradiation with the second dose; the protection was most pronounced when the cells were heated 30-120 min. after the first dose of radiation. Since similar changes in postirradiation survival occurred when ddTTP was applied, we suggest that heat induces a loss of polymerase beta activity. Apc gave a smaller protective effect. We interpreted these results as suggesting that mismatching takes place during DNA semiconservative replication or repair; inhibition of replication results in survival increase, by preventing misrepair. A proper timing of treatment with the inhibitors or heat is essential to obtain the sparing effect, i.e. to prevent SLD fixation. 27 refs., 3 figs., 1 tab. (author)
A Caenorhabditis elegans RNA polymerase II gene, ama-1 IV, and nearby essential genes.
Rogalski, T M; Riddle, D L
1988-01-01
The amanitin-binding subunit of RNA polymerase II in Caenorhabditis elegans is encoded by the ama-1 gene, located approximately 0.05 map unit to the right of dpy-13 IV. Using the amanitin-resistant ama-1(m118) strain as a parent, we have isolated amanitin-sensitive mutants that carry recessive-lethal ama-1 alleles. Of the six ethyl methanesulfonate-induced mutants examined, two are arrested late in embryogenesis. One of these is a large deficiency, mDf9, but the second may be a novel point mutation. The four other mutants are hypomorphs, and presumably produce altered RNA polymerase II enzymes with some residual function. Two of these mutants develop into sterile adults at 20 degrees but are arrested as larvae at 25 degrees, and two others are fertile at 20 degrees and sterile at 25 degrees. Temperature-shift experiments performed with the adult sterile mutant, ama-1(m118m238ts), have revealed a temperature-sensitive period that begins late in gonadogenesis and is centered around the initiation of egg-laying. Postembryonic development at 25 degrees is slowed by 30%. By contrast, the amanitin-resistant allele of ama-1 has very little effect on developmental rate or fertility. We have identified 15 essential genes in an interval of 4.5 map units surrounding ama-1, as well as four gamma-ray-induced deficiencies and two duplications that include the ama-1 gene. The larger duplication, mDp1, may include the entire left arm of chromosome IV, and it recombines with the normal homologue at a low frequency. The smallest deficiency, mDf10, complements all but three identified genes: let-278, dpy-13 and ama-1, which define an interval of only 0.1 map unit. The terminal phenotype of mDf10 homozygotes is developmental arrest during the first larval stage, suggesting that there is sufficient maternal RNA polymerase II to complete embryonic development.
Vens, C.; Hofland, I.; Begg, A.C.
2007-01-01
Characteristic of damage introduced in DNA by ionizing radiation is the induction of a wide range of lesions. Single-strand breaks (SSBs) and base damages outnumber double-strand breaks (DSBs). If unrepaired, these lesions can lead to DSBs and increased mutagenesis. XRCC1 and DNA polymerase beta
Molecular organization of the 5S rDNA gene type II in elasmobranchs.
Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian
2016-01-01
The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.
Brauburger, Kristina; Boehmann, Yannik; Krähling, Verena; Mühlberger, Elke
2016-02-15
The highly pathogenic Ebola virus (EBOV) has a nonsegmented negative-strand (NNS) RNA genome containing seven genes. The viral genes either are separated by intergenic regions (IRs) of variable length or overlap. The structure of the EBOV gene overlaps is conserved throughout all filovirus genomes and is distinct from that of the overlaps found in other NNS RNA viruses. Here, we analyzed how diverse gene borders and noncoding regions surrounding the gene borders influence transcript levels and govern polymerase behavior during viral transcription. Transcription of overlapping genes in EBOV bicistronic minigenomes followed the stop-start mechanism, similar to that followed by IR-containing gene borders. When the gene overlaps were extended, the EBOV polymerase was able to scan the template in an upstream direction. This polymerase feature seems to be generally conserved among NNS RNA virus polymerases. Analysis of IR-containing gene borders showed that the IR sequence plays only a minor role in transcription regulation. Changes in IR length were generally well tolerated, but specific IR lengths led to a strong decrease in downstream gene expression. Correlation analysis revealed that these effects were largely independent of the surrounding gene borders. Each EBOV gene contains exceptionally long untranslated regions (UTRs) flanking the open reading frame. Our data suggest that the UTRs adjacent to the gene borders are the main regulators of transcript levels. A highly complex interplay between the different cis-acting elements to modulate transcription was revealed for specific combinations of IRs and UTRs, emphasizing the importance of the noncoding regions in EBOV gene expression control. Our data extend those from previous analyses investigating the implication of noncoding regions at the EBOV gene borders for gene expression control. We show that EBOV transcription is regulated in a highly complex yet not easily predictable manner by a set of interacting cis
International Nuclear Information System (INIS)
Billen, D.
1985-01-01
The radiosensitivity of an Escherichia coli mutant deficient in DNA polymerase I was measured in the presence of OH radical scavengers. The extreme X-ray sensitivity of the mutant could be abolished by OH radical scavengers if a sufficiently high level of radioprotector was present. There was a direct correlation between the OH radical scavenging activity of the chemicals tested (NO 2 - , n-butanol, glycerol, t-amyl alcohol, and t-butanol) and their protective ability. The author interprets the data as showing that the indirect actions of X rays (primarily OH radicals) result in major damage to the bacterial DNA which in large part consists of potentially lethal lesions. This potentially lethal damage is repaired through an enzymatic pathway requiring DNA polymerase I. I. In the mutant lacking DNA polymerase I, these potentially lethal lesions are expressed as cell lethality
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum
2014-08-01
A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.
Human Parvovirus B19 Utilizes Cellular DNA Replication Machinery for Viral DNA Replication.
Zou, Wei; Wang, Zekun; Xiong, Min; Chen, Aaron Yun; Xu, Peng; Ganaie, Safder S; Badawi, Yomna; Kleiboeker, Steve; Nishimune, Hiroshi; Ye, Shui Qing; Qiu, Jianming
2018-03-01
Human parvovirus B19 (B19V) infection of human erythroid progenitor cells (EPCs) induces a DNA damage response and cell cycle arrest at late S phase, which facilitates viral DNA replication. However, it is not clear exactly which cellular factors are employed by this single-stranded DNA virus. Here, we used microarrays to systematically analyze the dynamic transcriptome of EPCs infected with B19V. We found that DNA metabolism, DNA replication, DNA repair, DNA damage response, cell cycle, and cell cycle arrest pathways were significantly regulated after B19V infection. Confocal microscopy analyses revealed that most cellular DNA replication proteins were recruited to the centers of viral DNA replication, but not the DNA repair DNA polymerases. Our results suggest that DNA replication polymerase δ and polymerase α are responsible for B19V DNA replication by knocking down its expression in EPCs. We further showed that although RPA32 is essential for B19V DNA replication and the phosphorylated forms of RPA32 colocalized with the replicating viral genomes, RPA32 phosphorylation was not necessary for B19V DNA replication. Thus, this report provides evidence that B19V uses the cellular DNA replication machinery for viral DNA replication. IMPORTANCE Human parvovirus B19 (B19V) infection can cause transient aplastic crisis, persistent viremia, and pure red cell aplasia. In fetuses, B19V infection can result in nonimmune hydrops fetalis and fetal death. These clinical manifestations of B19V infection are a direct outcome of the death of human erythroid progenitors that host B19V replication. B19V infection induces a DNA damage response that is important for cell cycle arrest at late S phase. Here, we analyzed dynamic changes in cellular gene expression and found that DNA metabolic processes are tightly regulated during B19V infection. Although genes involved in cellular DNA replication were downregulated overall, the cellular DNA replication machinery was tightly
Modulation of trinucleotide repeat instability by DNA polymerase β polymorphic variant R137Q.
Directory of Open Access Journals (Sweden)
Yaou Ren
Full Text Available Trinucleotide repeat (TNR instability is associated with human neurodegenerative diseases and cancer. Recent studies have pointed out that DNA base excision repair (BER mediated by DNA polymerase β (pol β plays a crucial role in governing somatic TNR instability in a damage-location dependent manner. It has been shown that the activities and function of BER enzymes and cofactors can be modulated by their polymorphic variations. This could alter the function of BER in regulating TNR instability. However, the roles of BER polymorphism in modulating TNR instability remain to be elucidated. A previous study has shown that a pol β polymorphic variant, polβR137Q is associated with cancer due to its impaired polymerase activity and its deficiency in interacting with a BER cofactor, proliferating cell nuclear antigen (PCNA. In this study, we have studied the effect of the pol βR137Q variant on TNR instability. We showed that pol βR137Q exhibited weak DNA synthesis activity to cause TNR deletion during BER. We demonstrated that similar to wild-type pol β, the weak DNA synthesis activity of pol βR137Q allowed it to skip over a small loop formed on the template strand, thereby facilitating TNR deletion during BER. Our results further suggest that carriers with pol βR137Q polymorphic variant may not exhibit an elevated risk of developing human diseases that are associated with TNR instability.
DNA polymerase iota (Pol ι) promotes invasion and metastasis of esophageal squamous cell carcinoma.
Zou, Shitao; Shang, Zeng-Fu; Liu, Biao; Zhang, Shuyu; Wu, Jinchang; Huang, Min; Ding, Wei-Qun; Zhou, Jundong
2016-05-31
DNA polymerase iota (Pol ι) is an error-prone DNA polymerase involved in translesion DNA synthesis (TLS) that contributes to the accumulation of DNA mutations. We recently showed that Pol ι is overexpressed in human esophageal squamous cell cancer (ESCC) tissues which promotes ESCC' progression. The present study was aimed at investigating the molecular mechanisms by which Pol ι enhances the invasiveness and metastasis of ESCC cells. We found that the expression of Pol ι is significantly higher in ESCCs with lymph node metastasis compared to those without lymph node metastasis. Kaplan-Meier analysis revealed an inverse correlation between Pol ι expression and patient prognosis. The expression levels of matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9), two essential regulators of cells' invasiveness, were positively associated with Pol ι expression in ESCC tissues. Ectopic expression of Pol ι enhanced the motility and invasiveness of ESCC cells as evaluated by wound-healing and transwell assays, respectively. A xenograft nude mouse model showed that Pol ι promotes the colonization of ESCC cells in the liver, lung and kidney. Signaling pathway analysis identified the JNK-AP-1 cascade as a mediator of the Pol ι-induced increase in the expression of MMP-2/9 and enhancement of ESCC progression. These data demonstrate the underlying mechanism by which Pol ι promotes ESCC progression, suggesting that Pol ι is a potential novel prognostic biomarker and therapeutic target for ESCC.
Energy Technology Data Exchange (ETDEWEB)
Yamada, Koichi; Inoue, Shuji [National Inst. of Health and Nutrition, Tokyo (Japan)
1997-02-01
Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase {alpha}, {delta} and {epsilon} were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 {mu}M inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense {delta}, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)
International Nuclear Information System (INIS)
Yamada, Koichi; Inoue, Shuji
1997-01-01
Aiming at prevention and treatment of radiation damages, the authors have been investigating DNA damages by X-ray and its repairing mechanism, however, the molecular species of DNA polymerase which mediate the repairing could not been identified by biochemical methods using various inhibitors because of their low specificity. Therefore, in this study, anti-sense oligonucleotides for DNA polymerase α, δ and ε were obtained by chemical synthesis and transduced into human fibroblast cell, NB1RGB by three methods; endocytotic method, electroporation method and lipofection method. For the first method, the addition of those peptides into the cell culture at 5 μM inhibited the polymerase activity by up to 30% and it was economically difficult to use at higher concentrations than it. For the electroporation method, different conditions were tested in the respects of initial potential, time constant and buffer, but the uptake of thimidine was scarcely decreased in the surviving cells, suggesting that the surviving rate would be short in the cells electroporated with those anti-sense peptides. For the lipofection method, among several cationic lipids tested, lipofectamine significantly enlarged the decrease of thymidine uptake by anti-sense δ, however it was considered that its application to DNA repairing is difficult because lipofectamine is strongly cytotoxic. Therefore, construction of a vector which allows to express anti-sense RNA in those cells is undertaken. (M.N.)
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Moro, Sean L; Cocco, Melanie J
2015-10-01
The dinB homolog (Dbh) is a member of the Y-family of translesion DNA polymerases, which are specialized to accurately replicate DNA across from a wide variety of lesions in living cells. Lesioned bases block the progression of high-fidelity polymerases and cause detrimental replication fork stalling; Y-family polymerases can bypass these lesions. The active site of the translesion synthesis polymerase is more open than that of a replicative polymerase; consequently Dbh polymerizes with low fidelity. Bypass polymerases also have low processivity. Short extension past the lesion allows the high-fidelity polymerase to switch back onto the site of replication. Dbh and the other Y-family polymerases have been used as structural models to investigate the mechanisms of DNA polymerization and lesion bypass. Many high-resolution crystal structures of Y-family polymerases have been reported. NMR dynamics studies can complement these structures by providing a measure of protein motions. Here we report the (15)N, (1)H, and (13)C backbone resonance assignments at two temperatures (35 and 50 °C) for Sulfolobus acidocaldarius Dbh polymerase. Backbone resonance assignments have been obtained for 86 % of the residues. The polymerase active site is assigned as well as the majority of residues in each of the four domains.
Error-prone bypass of O6-methylguanine by DNA polymerase of Pseudomonas aeruginosa phage PaP1.
Gu, Shiling; Xiong, Jingyuan; Shi, Ying; You, Jia; Zou, Zhenyu; Liu, Xiaoying; Zhang, Huidong
2017-09-01
O 6 -Methylguanine (O 6 -MeG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, generally leads to G:C to A:T mutagenesis. To study DNA replication encountering O 6 -MeG by the DNA polymerase (gp90) of P. aeruginosa phage PaP1, we analyzed steady-state and pre-steady-state kinetics of nucleotide incorporation opposite O 6 -MeG by gp90 exo - . O 6 -MeG partially inhibited full-length extension by gp90 exo - . O 6 -MeG greatly reduces dNTP incorporation efficiency, resulting in 67-fold preferential error-prone incorporation of dTTP than dCTP. Gp90 exo - extends beyond T:O 6 -MeG 2-fold more efficiently than C:O 6 -MeG. Incorporation of dCTP opposite G and incorporation of dCTP or dTTP opposite O 6 -MeG show fast burst phases. The pre-steady-state incorporation efficiency (k pol /K d,dNTP ) is decreased in the order of dCTP:G>dTTP:O 6 -MeG>dCTP:O 6 -MeG. The presence of O 6 -MeG at template does not affect the binding affinity of polymerase to DNA but it weakened their binding in the presence of dCTP and Mg 2+ . Misincorporation of dTTP opposite O 6 -MeG further weakens the binding affinity of polymerase to DNA. The priority of dTTP incorporation opposite O 6 -MeG is originated from the fact that dTTP can induce a faster conformational change step and a faster chemical step than dCTP. This study reveals that gp90 bypasses O 6 -MeG in an error-prone manner and provides further understanding in DNA replication encountering mutagenic alkylation DNA damage for P. aeruginosa phage PaP1. Copyright © 2017 Elsevier B.V. All rights reserved.
Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier
2016-01-01
The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Fox, Raymond; Kim, Hyung-Suk; Reddick, Robert L; Kujoth, Gregory C; Prolla, Tomas A; Tsutsumi, Shuichi; Wada, Youichiro; Smithies, Oliver; Maeda, Nobuyo
2011-05-24
Diabetes and the development of its complications have been associated with mitochondrial DNA (mtDNA) dysfunction, but causal relationships remain undetermined. With the objective of testing whether increased mtDNA mutations exacerbate the diabetic phenotype, we have compared mice heterozygous for the Akita diabetogenic mutation (Akita) with mice homozygous for the D257A mutation in mitochondrial DNA polymerase gamma (Polg) or with mice having both mutations (Polg-Akita). The Polg-D257A protein is defective in proofreading and increases mtDNA mutations. At 3 mo of age, the Polg-Akita and Akita male mice were equally hyperglycemic. Unexpectedly, as the Polg-Akita males aged to 9 mo, their diabetic symptoms decreased. Thus, their hyperglycemia, hyperphagia and urine output declined significantly. The decrease in their food intake was accompanied by increased plasma leptin and decreased plasma ghrelin, while hypothalamic expression of the orexic gene, neuropeptide Y, was lower and expression of the anorexic gene, proopiomelanocortin, was higher. Testis function progressively worsened with age in the double mutants, and plasma testosterone levels in 9-mo-old Polg-Akita males were significantly reduced compared with Akita males. The hyperglycemia and hyperphagia returned in aged Polg-Akita males after testosterone administration. Hyperglycemia-associated distal tubular damage in the kidney also returned, and Polg-D257A-associated proximal tubular damage was enhanced. The mild diabetes of female Akita mice was not affected by the Polg-D257A mutation. We conclude that reduced diabetic symptoms of aging Polg-Akita males results from appetite suppression triggered by decreased testosterone associated with damage to the Leydig cells of the testis.
Energy Technology Data Exchange (ETDEWEB)
Ley, R D; Sedita, B A; Boye, E [Argonne National Lab., Ill. (USA)
1978-03-01
Irradiation of closed circular phage lambda DNA in vivo at 365 nm results in the induction of single-strand breaks and alkali-labile lesions at rates of 1.1 x 10/sup -14/ and 0.2 x 10/sup -14//dalton/J/m/sup 2/, respectively. The sum of the induction rates is similar to the rate of induction of single-strand breaks plus alkali-labile lesions (1 x 10/sup -14//dalton/J/m/sup 2/) observed in the E. coli genome. Postirradiation incubation of wild-type cells in buffer results in rapid repair of the breaks (up to 80% repaired in 10 min). No repair was observed in a DNA polymerase I-deficient mutant of E.coli.
Bertram, Jeffrey G.; Oertell, Keriann; Petruska, John; Goodman, Myron F.
2009-01-01
DNA polymerase fidelity is defined as the ratio of right (R) to wrong (W) nucleotide incorporations when dRTP and dWTP substrates compete at equal concentrations for primer extension at the same site in the polymerase-primer-template DNA complex. Typically, R incorporation is favored over W by 103 – 105, even in the absence of 3′-exonuclease proofreading. Straightforward in principal, a direct competition fidelity measurement is difficult to perform in practice because detection of a small amount of W is masked by a large amount of R. As an alternative, enzyme kinetics measurements to evaluate kcat/Km for R and W in separate reactions are widely used to measure polymerase fidelity indirectly, based on a steady-state derivation by Fersht. A systematic comparison between direct competition and kinetics has not been made until now. By separating R and W products using electrophoresis, we have successfully made accurate fidelity measurements for directly competing R and W dNTP substrates for 9 of the 12 natural base mispairs. We compare our direct competition results with steady state and presteady state kinetic measurements of fidelity at the same template site, using the proofreading-deficient mutant of Klenow Fragment (KF−) DNA polymerase. All the data are in quantitative agreement. PMID:20000359
Czech Academy of Sciences Publication Activity Database
Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal
2012-01-01
Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry
Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F
2009-07-01
XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.
International Nuclear Information System (INIS)
Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.
1994-01-01
A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs
Expression of DNA repair genes in burned skin exposed to low-level red laser.
Trajano, Eduardo Tavares Lima; Mencalha, Andre Luiz; Monte-Alto-Costa, Andréa; Pôrto, Luís Cristóvão; de Souza da Fonseca, Adenilson
2014-11-01
Although red laser lights lie in the region of non-ionizing radiations in the electromagnetic spectrum, there are doubts whether absorption of these radiations causes lesions in the DNA molecule. Our aim was to investigate the expression of the genes involved with base excision and nucleotide excision repair pathways in skin tissue submitted to burn injury and exposed to low-level red laser. Wistar rats were divided as follows: control group-rats burned and not irradiated, laser group-rats burned and irradiated 1 day after injury for five consecutive days, and later laser group-rats injured and treated 4 days after injury for five consecutive days. Irradiation was performed according to a clinical protocol (20 J/cm(2), 100 mW, continuous wave emission mode). The animals were sacrificed on day 10, and scarred tissue samples were withdrawn for total RNA extraction, complementary DNA (cDNA) synthesis, and evaluation of gene expression by quantitative polymerase chain reaction. Low-level red laser exposure (1) reduces the expression of APE1 messenger (mRNA), (2) increases the expression of OGG1 mRNA, (3) reduces the expression of XPC mRNA, and (4) increases the expression of XPA mRNA both in laser and later laser groups. Red laser exposure at therapeutic fluences alters the expression of genes related to base excision and nucleotide excision pathways of DNA repair during wound healing of burned skin.
Directory of Open Access Journals (Sweden)
Janelle M Hare
Full Text Available The SOS response to DNA damage that induces up to 10% of the prokaryotic genome requires RecA action to relieve LexA transcriptional repression. In Acinetobacter species, which lack LexA, the error-prone polymerase accessory UmuDAb is instead required for ddrR induction after DNA damage, suggesting it might be a LexA analog. RNA-Seq experiments defined the DNA damage transcriptome (mitomycin C-induced of wild type, recA and umuDAb mutant strains of both A. baylyi ADP1 and A. baumannii ATCC 17978. Of the typical SOS response genes, few were differentially regulated in these species; many were repressed or absent. A striking 38.4% of all ADP1 genes, and 11.4% of all 17978 genes, were repressed under these conditions. In A. baylyi ADP1, 66 genes (2.0% of the genome, including a CRISPR/Cas system, were DNA damage-induced, and belonged to four regulons defined by differential use of recA and umuDAb. In A. baumannii ATCC 17978, however, induction of 99% of the 152 mitomycin C-induced genes depended on recA, and only 28 of these genes required umuDAb for their induction. 90% of the induced A. baumannii genes were clustered in three prophage regions, and bacteriophage particles were observed after mitomycin C treatment. These prophages encoded esvI, esvK1, and esvK2, ethanol-stimulated virulence genes previously identified in a Caenorhabditis elegans model, as well as error-prone polymerase alleles. The induction of all 17978 error-prone polymerase alleles, whether prophage-encoded or not, was recA dependent, but only these DNA polymerase V-related genes were de-repressed in the umuDAb mutant in the absence of DNA damage. These results suggest that both species possess a robust and complex DNA damage response involving both recA-dependent and recA-independent regulons, and further demonstrates that although umuDAb has a specialized role in repressing error-prone polymerases, additional regulators likely participate in these species' transcriptional
Detection and phylogenetic analysis of a new adenoviral polymerase gene in reptiles in Korea.
Bak, Eun-Jung; Jho, Yeonsook; Woo, Gye-Hyeong
2018-06-01
Over a period of 7 years (2004-2011), samples from 34 diseased reptiles provided by local governments, zoos, and pet shops were tested for viral infection. Animals were diagnosed based on clinical signs, including loss of appetite, diarrhea, rhinorrhea, and unexpected sudden death. Most of the exotic animals had gastrointestinal problems, such as mucosal redness and ulcers, while the native animals had no clinical symptoms. Viral sequences were found in seven animals. Retroviral genes were amplified from samples from five Burmese pythons (Python molurus bivittatus), an adenovirus was detected in a panther chameleon (Furcifer pardalis), and an adenovirus and a paramyxovirus were detected in a tropical girdled lizard (Cordylus tropidosternum). Phylogenetic analysis of retroviruses and paramyxoviruses showed the highest sequence identity to both a Python molurus endogenous retrovirus and a Python curtus endogenous retrovirus and to a lizard isolate, respectively. Partial sequencing of an adenoviral DNA polymerase gene from the lizard isolate suggested that the corresponding virus was a novel isolate different from the reference strain (accession no. AY576677.1). The virus was not isolated but was detected, using molecular genetic techniques, in a lizard raised in a pet shop. This animal was also coinfected with a paramyxovirus.
RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.
NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina
2016-12-27
Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.
Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai
2014-01-01
The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase
Directory of Open Access Journals (Sweden)
Amit Sharma
2012-01-01
Full Text Available Error-prone DNA synthesis in prokaryotes imparts plasticity to the genome to allow for evolution in unfavorable environmental conditions, and this phenomenon is termed adaptive mutagenesis. At a molecular level, adaptive mutagenesis is mediated by upregulating the expression of specialized error-prone DNA polymerases that generally belong to the Y-family, such as the polypeptide product of the dinB gene in case of E. coli. However, unlike E. coli, it has been seen that expression of the homologs of dinB in Mycobacterium tuberculosis are not upregulated under conditions of stress. These studies suggest that DinB homologs in Mycobacteria might not be able to promote mismatches and participate in adaptive mutagenesis. We show that a representative homolog from Mycobacterium smegmatis (MsDpo4 can carry out template-dependent nucleotide incorporation and therefore is a DNA polymerase. In addition, it is seen that MsDpo4 is also capable of misincorporation with a significant ability to promote G:T and T:G mismatches. The frequency of misincorporation for these two mismatches is similar to that exhibited by archaeal and prokaryotic homologs. Overall, our data show that MsDpo4 has the capacity to facilitate transition mutations and can potentially impart plasticity to the genome.
International Nuclear Information System (INIS)
Mirzayans, R.; Enns, L.; Dietrich, K.; Barley, R.D.C.; Paterson, M.C.; Alberta Univ., Edmonton, AB; Alberta Univ., Edmonton, AB
1996-01-01
Dermal fibroblast strains cultured from affected members of a cancer-prone family with Li-Fraumeni syndrome (LFS) harbor a point mutation in one allele of the p53 tumor suppressor gene, resulting in loss of normal p53-deficient strains to carry out the long-patch mode of excision repair, mediated by DNA polymerases delta and epsilon, after exposure to Co-60 gamma radiation or far ultraviolet (UV) (chiefly 254 mm) light. Repair was monitored by incubation of the irradiated cultures in the presence of aphidicolin (ape) or 1-beta-D-arabinofuranosylcytosine (araC), each a specific inhibitor of long-patch repair, followed by measurement of drug-induced DNA strand breaks (reflecting non-ligated strand incision events) by alkaline surcrose velocity sedimentation. The LFS strains displayed deficient repair capacity in response to both gamma rays and UV light. The repair anomaly in UV-irradiated LFS cultures was manifested not only in the overall genome, but also in the transcriptionally active, preferentially repaired c-myc gene. Using autoradiography we also assessed unscheduled DNA synthesis (UDS) after UV irradiation and found this conventional measure of repair replication to be deficient in LFS strains. Moreover, both ape and araC decreased the level of UV-induced UDS by similar to 75% in normal cells, but each had only a marginal effect on LFS cells. We further demonstrated that the LFS strains are impaired in the recovery of both RNA and replicative DNA syntheses after UV treatment, two molecular anomalies of the DNA repair deficiency disorders xeroderma pigmentosum and Cockayne's syndrome. Together these results imply a critical role for wild-type p53 protein in DNA polymerase delta/epsilon-mediated excision repair, both the mechanism operating on the entire genome and that acting on expressed genes. (Author)
Energy Technology Data Exchange (ETDEWEB)
Baril, E F; Owen, M W; Vishwanatha, J K; Zamecnik, P C
1984-06-01
In previous studies, it was shown that Ap/sub 4/A can function as a primer for in vitro DNA synthesis by the multiprotein form of DNA polymerase ..cap alpha.. with single-stranded DNA and an octadecamer double-stranded DNA template. In these studies, the authors show that Ap/sub 4/A that is greater than 99% pure by high performance liquid chromatography also stimulates the incorporation of (..cap alpha../sup 32/P)ATP into the 10-15 oligoribonucleotide primer with poly(dT) template by the primase that is resolved from the polymerase ..cap alpha.. core enzyme. Other dinucleotides or dinucleotide polyphosphates (e.g. ApA, Ap/sub 2/A or Ap/sub 3/A) do not enhance the incorporation of (..cap alpha../sup 32/P)ATP in this reaction. The results from phosphate transfer experiments demonstrate a covalent linkage between (/sup 3/H)Ap/sub 4/A and the /sup 32/P-labeled oligoriboadenylate that is synthesized by the primase.
DEFF Research Database (Denmark)
Issinger, O G; Hausmann, R
1973-01-01
During nonpermissive infection by a T7 amber mutant in gene 1 (phage RNA polymerase-deficient), synthesis of the products of the phage genes 3 (endonuclease), 3, 5 (lysozyme), 5 (DNA polymerase), and 17 (serum blocking power) was shown to occur at about half the rate as during wild-type infection...
International Nuclear Information System (INIS)
Fonseca, A S; Magalhães, L A G; Mencalha, A L; Geller, M; Paoli, F
2014-01-01
Practical properties and physical characteristics of low intensity lasers have made possible their application to treat soft tissue diseases. Excitation of intracellular chromophores by red and infrared radiation at low energy fluences with increase of mitochondrial metabolism is the basis of the biostimulation effect but free radicals can be produced. DNA lesions induced by free radicals are repaired by the base excision repair pathway. In this work, we evaluate the expression of POLγ and APEX2 genes related to repair of mitochondrial and nuclear DNA, respectively. Skin and muscle tissue of Wistar rats were exposed to low intensity infrared laser at different fluences. One hour and 24 hours after laser exposure, tissue samples were withdrawn for total RNA extraction, cDNA synthesis, and evaluation of POLγ and APEX2 mRNA expression by real time quantitative polymerase chain reaction. Skin and muscle tissue of Wistar rats exposed to laser radiation show different expression of POLγ and APEX2 mRNA depending of the fluence and time after exposure. Our study suggests that a low intensity infrared laser affects expression of genes involved in repair of oxidative lesions in mitochondrial and nuclear DNA. (paper)
RPO41-independent maintenance of [rho-] mitochondrial DNA in Saccharomyces cerevisiae.
Fangman, W L; Henly, J W; Brewer, B J
1990-01-01
A subset of promoters in the mitochondrial DNA (mtDNA) of the yeast Saccharomyces cerevisiae has been proposed to participate in replication initiation, giving rise to a primer through site-specific cleavage of an RNA transcript. To test whether transcription is essential for mtDNA maintenance, we examined two simple mtDNA deletion ([rho-]) genomes in yeast cells. One genome (HS3324) contains a consensus promoter (ATATAAGTA) for the mitochondrial RNA polymerase encoded by the nuclear gene RPO41, and the other genome (4a) does not. As anticipated, in RPO41 cells transcripts from the HS3324 genome were more abundant than were transcripts from the 4a genome. When the RPO41 gene was disrupted, both [rho-] genomes were efficiently maintained. The level of transcripts from HS3324 mtDNA was decreased greater than 400-fold in cells carrying the RPO41 disrupted gene; however, the low-level transcripts from 4a mtDNA were undiminished. These results indicate that replication of [rho-] genomes can be initiated in the absence of wild-type levels of the RPO41-encoded RNA polymerase.
Cloning human DNA repair genes
International Nuclear Information System (INIS)
Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.
1994-01-01
Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)
International Nuclear Information System (INIS)
Freeman-Wittig, M.J.B.
1986-01-01
The DNA pol I polymerase activity is known to be inhibited by captan. When captan was tested for its ability to alter the exonuclease activity of DNA pol I, degradation was enhanced at high substrate concentrations. At low concentrations of DNA, captan was inhibitory. By assaying the two exonuclease activities separately it was shown that the differential effect by captan was the result of a combined inhibition of the 3' → 5' exonuclease and enhancement of the 5' → 3' exonuclease. Studies employing [ 14 C] captan showed that the alterations in DNA pol I activities were a result of the irreversible binding of captan to the enzyme in a ratio of 1:1. The effect of captan on AMV reverse transcriptase RNase H activity was also studied. RNase H activity appeared to be more sensitive to captan than was the polymerase activity. Inhibition of the polymerase activity could be prevented by deoxynucleotide triphosphate and was increased by templateprimer. RNase H activity, which showed a sigmoidal relationship between activity and substrate concentration, decreased in V/sub max/ with no change in the Hill coefficient in the presence of captan
Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan
2015-09-01
5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.; Doublié, Sylvie (Vermont)
2012-06-27
Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase at the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.
Energy Technology Data Exchange (ETDEWEB)
Kleinert, H.; Benecke, B.J.
1988-02-25
The authors have analyzed the transcription of a recently isolated human 7S K RNA gene in vitro and in vivo. In contrast to hitherto characterized class III genes (genes transcribed by RNA polymerase III), the coding sequence of this gene is not required for faithful and efficient transcription by RNA polymerase III. In fact, a procaryotic vector DNA sequence was efficiently transcribed by RNA polymerase III under the control of the 7S K RNA gene upstream sequence in vitro and in vivo. S/sub 1/-nuclease protection analyses confirmed that the 7S K 5'flanking sequence was sufficient for accurate transcription initiation. These data demonstrate that 7S K DNA represents a novel class III gene, the promoter elements of which are located outside the coding sequence.
Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz
2018-04-15
Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.
A new building block for DNA network formation by self-assembly and polymerase chain reaction.
Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas
2014-01-01
The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.
Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis
National Research Council Canada - National Science Library
Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W
2005-01-01
A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...
International Nuclear Information System (INIS)
Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong
2012-01-01
Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.
Kamenova, Ivanka; Warfield, Linda; Hahn, Steven
2014-08-01
Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.
Directory of Open Access Journals (Sweden)
De-Tao Yin
Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.
A Major Role of DNA Polymerase δ in Replication of Both the Leading and Lagging DNA Strands.
Johnson, Robert E; Klassen, Roland; Prakash, Louise; Prakash, Satya
2015-07-16
Genetic studies with S. cerevisiae Polδ (pol3-L612M) and Polε (pol2-M644G) mutant alleles, each of which display a higher rate for the generation of a specific mismatch, have led to the conclusion that Polε is the primary leading strand replicase and that Polδ is restricted to replicating the lagging strand template. Contrary to this widely accepted view, here we show that Polδ plays a major role in the replication of both DNA strands, and that the paucity of pol3-L612M-generated errors on the leading strand results from their more proficient removal. Thus, the apparent lack of Polδ contribution to leading strand replication is due to differential mismatch removal rather than differential mismatch generation. Altogether, our genetic studies with Pol3 and Pol2 mutator alleles support the conclusion that Polδ, and not Polε, is the major DNA polymerase for carrying out both leading and lagging DNA synthesis. Copyright © 2015 Elsevier Inc. All rights reserved.
Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels
2011-12-01
Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.
Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I; Marini, Monica; Das, Gobind; Elshenawy, Mohamed M; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed A; Stingl, Ulrich; Merzaban, Jasmeen S; Di Fabrizio, Enzo; Hamdan, Samir M
2018-01-24
The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein's surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.-Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.
Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I.; Marini, Monica; Das, Gobind; Elshenawy, Mohamed; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed Abdelmaboud; Stingl, Ulrich; Merzaban, Jasmeen; Di Fabrizio, Enzo M.; Hamdan, Samir
2018-01-01
The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.
Takahashi, Masateru
2018-01-24
The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.
Replicating animal mitochondrial DNA
Directory of Open Access Journals (Sweden)
Emily A. McKinney
2013-01-01
Full Text Available The field of mitochondrial DNA (mtDNA replication has been experiencing incredible progress in recent years, and yet little is certain about the mechanism(s used by animal cells to replicate this plasmid-like genome. The long-standing strand-displacement model of mammalian mtDNA replication (for which single-stranded DNA intermediates are a hallmark has been intensively challenged by a new set of data, which suggests that replication proceeds via coupled leading-and lagging-strand synthesis (resembling bacterial genome replication and/or via long stretches of RNA intermediates laid on the mtDNA lagging-strand (the so called RITOLS. The set of proteins required for mtDNA replication is small and includes the catalytic and accessory subunits of DNA polymerase y, the mtDNA helicase Twinkle, the mitochondrial single-stranded DNA-binding protein, and the mitochondrial RNA polymerase (which most likely functions as the mtDNA primase. Mutations in the genes coding for the first three proteins are associated with human diseases and premature aging, justifying the research interest in the genetic, biochemical and structural properties of the mtDNA replication machinery. Here we summarize these properties and discuss the current models of mtDNA replication in animal cells.
Genomic DNA-based absolute quantification of gene expression in Vitis.
Gambetta, Gregory A; McElrone, Andrew J; Matthews, Mark A
2013-07-01
Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., and that reaction efficiencies of the GOI and RG are equal; assumptions which are often faulty. The true variability in RG expression and actual reaction efficiencies are seldom determined experimentally. Here we present a rapid and robust method for absolute quantification of expression in Vitis where varying concentrations of genomic DNA were used to construct GOI standard curves. This methodology was utilized to absolutely quantify and determine the variability of the previously validated RG ubiquitin (VvUbi) across three test studies in three different tissues (roots, leaves and berries). In addition, in each study a GOI was absolutely quantified. Data sets resulting from relative and absolute methods of quantification were compared and the differences were striking. VvUbi expression was significantly different in magnitude between test studies and variable among individual samples. Absolute quantification consistently reduced the coefficients of variation of the GOIs by more than half, often resulting in differences in statistical significance and in some cases even changing the fundamental nature of the result. Utilizing genomic DNA-based absolute quantification is fast and efficient. Through eliminating error introduced by assuming RG stability and equal reaction efficiencies between the RG and GOI this methodology produces less variation, increased accuracy and greater statistical power. © 2012 Scandinavian Plant Physiology Society.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Modes of DNA repair and replication
International Nuclear Information System (INIS)
Hanawalt, P.; Kondo, S.
1979-01-01
Modes of DNA repair and replication require close coordination as well as some overlap of enzyme functions. Some classes of recovery deficient mutants may have defects in replication rather than repair modes. Lesions such as the pyrimidine dimers produced by ultraviolet light irradiation are the blocks to normal DNA replication in vivo and in vitro. The DNA synthesis by the DNA polymerase 1 of E. coli is blocked at one nucleotide away from the dimerized pyrimidines in template strands. Thus, some DNA polymerases seem to be unable to incorporate nucleotides opposite to the non-pairing lesions in template DNA strands. The lesions in template DNA strands may block the sequential addition of nucleotides in the synthesis of daughter strands. Normal replication utilizes a constitutive ''error-free'' mode that copies DNA templates with high fidelity, but which may be totally blocked at a lesion that obscures the appropriate base pairing specificity. It might be expected that modified replication system exhibits generally high error frequency. The error rate of DNA polymerases may be controlled by the degree of phosphorylation of the enzyme. Inducible SOS system is controlled by recA genes that also control the pathways for recombination. It is possible that SOS system involves some process other than the modification of a blocked replication apparatus to permit error-prone transdimer synthesis. (Yamashita, S.)
Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai
2015-11-24
Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.
Ono, Takeshi; Kaneda, Toshio; Muto, Akihiro; Yoshida, Tadashi
2009-07-24
Micro opioid receptor (MOR) agonists such as morphine are applied widely in clinical practice as pain therapy. The effects of morphine through MOR, such as analgesia and development of tolerance and dependence, are influenced by individual specificity. Recently, we analyzed single nucleotide polymorphisms on the human MOR gene to investigate the factors that contribute to individual specificity. In process of single nucleotide polymorphisms analysis, we found that specific nuclear proteins bound to G(-172) --> T region in exon 1 in MOR gene, and its affinity to DNA was increased by base substitution from G(-172) to T(-172). The isolated protein was identified by mass spectrometry and was confirmed by Western blotting to be poly(ADP-ribose) polymerase-1 (PARP-1). The overexpressed PARP-1 bound to G(-172) --> T and enhanced the transcription of reporter vectors containing G(-172) and T(-172). Furthermore, PARP-1 inhibitor (benzamide) decreased PARP-1 binding to G(-172) --> T without affecting mRNA or protein expression level of PARP-1 and down-regulated the subsequent MOR gene expression in SH-SY5Y cells. Moreover, we found that tumor necrosis factor-alpha enhanced MOR gene expression as well as increased PARP-1 binding to the G(-172) --> T region and G(-172) --> T-dependent transcription in SH-SY5Y cells. These effects were also inhibited by benzamide. In this study, our data suggest that PARP-1 positively regulates MOR gene transcription via G(-172) --> T, which might influence individual specificity in therapeutic opioid effects.
Directory of Open Access Journals (Sweden)
Zhentao Zhang
Full Text Available The mechanisms leading to dopaminergic neuronal loss in the substantia nigra of patients with Parkinson disease (PD remain poorly understood. We recently reported that aberrant DNA replication mediated by DNA polymerase-β (DNA pol-β plays a causal role in the death of postmitotic neurons in an in vitro model of PD. In the present study, we show that both proliferating cell nuclear antigen (PCNA and DNA pol-β are required for MPP(+-induced neuronal death. PCNA binds to the catalytic domain of DNA pol-β in MPP(+-treated neurons and in post-mortem brain tissues of PD patients. The PCNA-DNA pol-β complex is loaded into DNA replication forks and mediates DNA replication in postmitotic neurons. The aberrant DNA replication mediated by the PCNA-DNA pol-β complex induces p53-dependent neuronal cell death. Our results indicate that the interaction of PCNA and DNA pol-β contributes to neuronal death in PD.
Energy Technology Data Exchange (ETDEWEB)
Baltz, Jennifer L.; Filman, David J.; Ciustea, Mihai; Silverman, Janice Elaine Y.; Lautenschlager, Catherine L.; Coen, Donald M.; Ricciardi, Robert P.; Hogle, James M.; (UPENN)
2009-12-01
Kaposi's sarcoma-associated herpesvirus is an emerging pathogen whose mechanism of replication is poorly understood. PF-8, the presumed processivity factor of Kaposi's sarcoma-associated herpesvirus DNA polymerase, acts in combination with the catalytic subunit, Pol-8, to synthesize viral DNA. We have solved the crystal structure of residues 1 to 304 of PF-8 at a resolution of 2.8 {angstrom}. This structure reveals that each monomer of PF-8 shares a fold common to processivity factors. Like human cytomegalovirus UL44, PF-8 forms a head-to-head dimer in the form of a C clamp, with its concave face containing a number of basic residues that are predicted to be important for DNA binding. However, there are several differences with related proteins, especially in loops that extend from each monomer into the center of the C clamp and in the loops that connect the two subdomains of each protein, which may be important for determining PF-8's mode of binding to DNA and to Pol-8. Using the crystal structures of PF-8, the herpes simplex virus catalytic subunit, and RB69 bacteriophage DNA polymerase in complex with DNA and initial experiments testing the effects of inhibition of PF-8-stimulated DNA synthesis by peptides derived from Pol-8, we suggest a model for how PF-8 might form a ternary complex with Pol-8 and DNA. The structure and the model suggest interesting similarities and differences in how PF-8 functions relative to structurally similar proteins.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Pence, Matthew G; Choi, Jeong-Yun; Egli, Martin; Guengerich, F Peter
2010-12-24
O(6)-methylguanine (O(6)-methylG) is highly mutagenic and is commonly found in DNA exposed to methylating agents, even physiological ones (e.g. S-adenosylmethionine). The efficiency of a truncated, catalytic DNA polymerase ι core enzyme was determined for nucleoside triphosphate incorporation opposite O(6)-methylG, using steady-state kinetic analyses. The results presented here corroborate previous work from this laboratory using full-length pol ι, which showed that dTTP incorporation occurs with high efficiency opposite O(6)-methylG. Misincorporation of dTTP opposite O(6)-methylG occurred with ∼6-fold higher efficiency than incorporation of dCTP. Crystal structures of the truncated form of pol ι with O(6)-methylG as the template base and incoming dCTP or dTTP were solved and showed that O(6)-methylG is rotated into the syn conformation in the pol ι active site and that dTTP misincorporation by pol ι is the result of Hoogsteen base pairing with the adduct. Both dCTP and dTTP base paired with the Hoogsteen edge of O(6)-methylG. A single, short hydrogen bond formed between the N3 atom of dTTP and the N7 atom of O(6)-methylG. Protonation of the N3 atom of dCTP and bifurcation of the N3 hydrogen between the N7 and O(6) atoms of O(6)-methylG allow base pairing of the lesion with dCTP. We conclude that differences in the Hoogsteen hydrogen bonding between nucleotides is the main factor in the preferential selectivity of dTTP opposite O(6)-methylG by human pol ι, in contrast to the mispairing modes observed previously for O(6)-methylG in the structures of the model DNA polymerases Sulfolobus solfataricus Dpo4 and Bacillus stearothermophilus DNA polymerase I.
Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K
2014-01-01
Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.
How to switch the motor on: RNA polymerase initiation steps at the single-molecule level
Marchetti, M.; Malinowska, A.; Heller, I.; Wuite, G. J. L.
RNA polymerase (RNAP) is the central motor of gene expression since it governs the process of transcription. In prokaryotes, this holoenzyme is formed by the RNAP core and a sigma factor. After approaching and binding the specific promoter site on the DNA, the holoenzyme-promoter complex undergoes
Energy Technology Data Exchange (ETDEWEB)
Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin (Yale)
2011-08-29
Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templating dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.
Isolation of proteins involved in the replication of adenoviral DNA in vitro
International Nuclear Information System (INIS)
Lichy, J.H.; Nagata, K.; Friefeld, B.R.; Enomoto, T.; Field, J.; Guggenheimer, R.A.; Ikeda, J.E.; Horwitz, M.S.; Hurwitz, J.
1983-01-01
The simple mechanism of replication of adenoviral DNA has made adenovirus an especially useful model system for studies of eukaryotic replication mechanisms. The availability of this in vitro system that replicates exogenously added Ad DNA-pro has made it possible to characterize the factors involved in replication. The results presented in this paper summarize our further fractionation of the in vitro system. First, the properties of two factors purified from the uninfected nuclear extract are described. Second, the separation of the pTP/Ad Pol complex into subunits and the properties of the isolated subunits are presented. The 140K protein is shown to possess the Ad DNA polymerase activity. The results suggest that the only DNA polymerase required for adenoviral DNA replication in vitro is the 140K Ad DNA polymerase and that this enzyme is probably a viral gene product. 50 references, 10 figures, 3 tables
Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom
2017-07-01
Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin
Directory of Open Access Journals (Sweden)
Chelsea Herdman
2017-07-01
Full Text Available Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state
Vyas, Rajan; Reed, Andrew J.; Tokarsky, E. John; Suo, Zucai
2015-01-01
One common oxidative DNA lesion, 8-oxo-7,8-dihydro-2′-deoxyguanine (8-oxoG), is highly mutagenic in vivo due to its anti-conformation forming a Watson–Crick base pair with correct deoxycytidine 5′-triphosphate (dCTP) and its syn-conformation forming a Hoogsteen base pair with incorrect deoxyadenosine 5′-triphosphate (dATP). Here, we utilized time-resolved X-ray crystallography to follow 8-oxoG bypass by human DNA polymerase β (hPolβ). In the 12 solved structures, both Watson–Crick (anti-8-oxoG:anti-dCTP) and Hoogsteen (syn-8-oxoG:anti-dATP) base pairing were clearly visible and were maintained throughout the chemical reaction. Additionally, a third Mg2+ appeared during the process of phosphodiester bond formation and was located between the reacting α- and β-phosphates of the dNTP, suggesting its role in stabilizing reaction intermediates. After phosphodiester bond formation, hPolβ reopened its conformation, pyrophosphate was released, and the newly incorporated primer 3′-terminal nucleotide stacked, rather than base paired, with 8-oxoG. These structures provide the first real-time pictures, to our knowledge, of how a polymerase correctly and incorrectly bypasses a DNA lesion. PMID:25825995
Human DNA repair and recombination genes
International Nuclear Information System (INIS)
Thompson, L.H.; Weber, C.A.; Jones, N.J.
1988-09-01
Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs
A Novel Low Temperature PCR Assured High-Fidelity DNA Amplification
Directory of Open Access Journals (Sweden)
Shaoxia Zhou
2013-06-01
Full Text Available As previously reported, a novel low temperature (LoTemp polymerase chain reaction (PCR catalyzed by a moderately heat-resistant (MHR DNA polymerase with a chemical-assisted denaturation temperature set at 85 °C instead of the conventional 94–96 °C can achieve high-fidelity DNA amplification of a target DNA, even after up to 120 PCR thermal cycles. Furthermore, such accurate amplification is not achievable with conventional PCR. Now, using a well-recognized L1 gene segment of the human papillomavirus (HPV type 52 (HPV-52 as the template for experiments, we demonstrate that the LoTemp high-fidelity DNA amplification is attributed to an unusually high processivity and stability of the MHR DNA polymerase whose high fidelity in template-directed DNA synthesis is independent of non-existent 3'–5' exonuclease activity. Further studies and understanding of the characteristics of the LoTemp PCR technology may facilitate implementation of DNA sequencing-based diagnostics at the point of care in community hospital laboratories.
Energy Technology Data Exchange (ETDEWEB)
Romac, S; Leong, P; Sockett, H; Hutchinson, F [Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry
1989-09-20
The DNA base sequence changes induced by mutagenesis with ultraviolet light have been determined in a gene on a chromosome of cultured Chinese hamster ovary (CHO) cells. The gene was the Excherichia coli gpt gene, of which a single copy was stably incorporated and expressed in the CHO cell genome. The cells were irradiated with ultraviolet light and gpt{sup -} colonies were selected by resistance to 6-thioguanine. The gpt gene was amplified from chromosomal DNA by use of the polymerase chain reaction (PCR) and the amplified DNA sequenced directly by the dideoxy method. Of the 58 sequenced mutants of independent origin 53 were base change mutations. Forty-one base substitutions were single base changes, ten had two adjacent (or tandem) base changes, and one had two base changes separated by a single base-pair. Only one mutant had a multiple base change mutation with two or more well separated base changes. In contrast much higher levels of such mutations were reported in ultraviolet mutagenesis of genes on a shuttle vector in primate cells. Two deletions of a single base-pair were observed and three deletions ranging from 6 to 37 base-pairs. The mutation spectrum in the gpt gene had similarities to the ultraviolet mutation spectra for several genes in prokaryotes, which suggests similarities in mutational mechanisms in prokaryotes and eukaryotes. (author).
Sasaki, Ryohei; Suzuki, Yoko; Yonezawa, Yuko; Ota, Yosuke; Okamoto, Yoshiaki; Demizu, Yusuke; Huang, Peng; Yoshida, Hiromi; Sugimura, Kazuro; Mizushina, Yoshiyuki
2008-05-01
Among the vitamin K (VK) compounds, VK3 exhibits distinct cytotoxic activity in cancer cells and is thought to affect redox cycling; however, the underlying mechanisms remain unclear. Here we demonstrate that VK3 selectively inhibits DNA polymerase (pol) gamma, the key enzyme responsible for mitochondrial DNA replication and repair. VK3 at 30 microM inhibited pol gamma by more than 80%, caused impairment of mitochondrial DNA replication and repair, and induced a significant increase in reactive oxygen species (ROS), leading to apoptosis. At a lower concentration (3 microM), VK3 did not cause a significant increase in ROS, but was able to effectively inhibit cell proliferation, which could be reversed by supplementing glycolytic substrates. The cytotoxic action of VK3 was independent of p53 tumor suppressor gene status. Interestingly, VK3 only inhibited pol gamma but did not affect other pol including human pol alpha, pol beta, pol delta, and pol epsilon. VK1 and VK2 exhibited no inhibitory effect on any of the pol tested. These data together suggest that the inhibition of pol gamma by VK3 is relatively specific, and that this compound seems to exert its anticancer activity by two possible mechanisms in a concentration-dependent manner: (1) induction of ROS-mediated cell death at high concentrations; and (2) inhibition of cell proliferation at lower concentrations likely through the suppression of mitochondrial respiratory function. These findings may explain various cytotoxic actions induced by VK3, and may pave the way for the further use of VK3.
DNA-mediated gene transfer into ataxia-telangiectasia cells
International Nuclear Information System (INIS)
Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.
1986-01-01
The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA
Cell cycle regulation of DNA polymerase beta in rotenone-based Parkinson's disease models.
Directory of Open Access Journals (Sweden)
Hongcai Wang
Full Text Available In Parkinson's disease (PD, neuronal cells undergo mitotic catastrophe and endoreduplication prior to cell death; however, the regulatory mechanisms remain to be defined. In this study, we investigated cell cycle regulation of DNA polymerase β (poly β in rotenone-based dopaminergic cellular and animal models. Incubation with a low concentration (0.25 µM of rotenone for 1.5 to 7 days resulted in a flattened cell body and decreased DNA replication during S phase, whereas a high concentration (2 µM of rotenone exposure resulted in enlarged, multi-nucleated cells and converted the mitotic cycle into endoreduplication. Consistently, DNA poly β, which is mainly involved in DNA repair synthesis, was upregulated to a high level following exposure to 2 µM rotenone. The abrogation of DNA poly β by siRNA transfection or dideoxycytidine (DDC treatment attenuated the rotenone-induced endoreduplication. The cell cycle was reactivated in cyclin D-expressing dopaminergic neurons from the substantia nigra (SN of rats following stereotactic (ST infusion of rotenone. Increased DNA poly β expression was observed in the substantia nigra pars compacta (SNc and the substantia nigra pars reticulate (SNr of rotenone-treated rats. Collectively, in the in vitro model of rotenone-induced mitotic catastrophe, the overexpression of DNA poly β promotes endoreduplication; in the in vivo model, the upregulation of DNA poly β and cell cycle reentry were also observed in the adult rat substantia nigra. Therefore, the cell cycle regulation of DNA poly β may be involved in the pathological processes of PD, which results in the induction of endoreduplication.
Cruz, Aline Fernanda; de Resende, Renata Gonçalves; de Lacerda, Júlio César Tanos; Pereira, Núbia Braga; Melo, Leonardo Augusto; Diniz, Marina Gonçalves; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago
2018-01-01
The oral lichen planus is a chronic inflammatory disease. Although its aetiology is not well understood, the role of T lymphocytes in its inflammatory events is recognised. Identifying the epigenetic mechanisms involved in the pathogenesis of this immune-mediated condition is fundamental for understanding the inflammatory reaction that occurs in the disease. The purpose of this work was to evaluate the methylation pattern of 21 immune response-related genes in the different clinical forms of oral lichen planus. A cross-sectional study was performed to analyse the DNA methylation patterns in three distinct groups of oral lichen planus: (i) reticular/plaque lesions; (ii) erosive lesions; (iii) normal oral mucosa (control group). After DNA extraction from biopsies, the samples were submitted to digestions by methylation-sensitive and methylation-dependent enzymes and double digestion. The relative percentage of methylated DNA for each gene was provided using real-time polymerase chain reaction arrays. Hypermethylation of the STAT5A gene was observed only in the control group (59.0%). A higher hypermethylation of the ELANE gene was found in reticular/plaque lesions (72.1%) compared to the erosive lesions (50.0%). Our results show variations in the methylation profile of immune response-related genes, according to the clinical type of oral lichen planus after comparing with the normal oral mucosa. Further studies are necessary to validate these findings using gene expression analysis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos
2018-01-01
Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486
A critical role for topoisomerase IIb and DNA double strand breaks in transcription.
Calderwood, Stuart K
2016-05-26
Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-03-01
A 3-year (FY 1999-FY 2002) research plan titled 'The basic research on a high-sensitivity gene diagnosis system for cancer by free DNA in blood' was worked out and the study was started. The plan is as follows. It is confirmed that the quantitative study of peripheral blood free DNA becomes the information useful for early finding-out of cancer carriers, and the reliability and limits are made clear. By widely searching for gene anomaly of cancer itself, it is confirmed that it is possible to diagnose anomaly in quality of genes in peripheral blood free DNA. For those purposes, technology is developed for high-sensitively detecting/quantifying free DNA of peripheral blood, etc. and further detecting anomaly of the genes comprehensively, and the medical/engineering joint research is conducted to realize the early diagnosis of cancer. In FY 1999, the following studies were started using detection/analysis technology mainly by polymerase chain reaction (PCR): development of high-sensitivity detection technology of free DNA, development of high-sensitivity detection technology of gene anomaly, study of the cancer-origin gene anomaly, etc. (NEDO)
Directory of Open Access Journals (Sweden)
Pooja H. Gupta
2015-05-01
Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.
Directory of Open Access Journals (Sweden)
Shyamal G
2005-01-01
Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Dahl, Joseph M; Wang, Hongyun; Lázaro, José M; Salas, Margarita; Lieberman, Kate R
2014-03-07
The Φ29 DNA polymerase (DNAP) is a processive B-family replicative DNAP. Fluctuations between the pre-translocation and post-translocation states can be quantified from ionic current traces, when individual Φ29 DNAP-DNA complexes are held atop a nanopore in an electric field. Based upon crystal structures of the Φ29 DNAP-DNA binary complex and the Φ29 DNAP-DNA-dNTP ternary complex, residues Tyr-226 and Tyr-390 in the polymerase active site were implicated in the structural basis of translocation. Here, we have examined the dynamics of translocation and substrate binding in complexes formed with the Y226F and Y390F mutants. The Y226F mutation diminished the forward and reverse rates of translocation, increased the affinity for dNTP in the post-translocation state by decreasing the dNTP dissociation rate, and increased the affinity for pyrophosphate in the pre-translocation state. The Y390F mutation significantly decreased the affinity for dNTP in the post-translocation state by decreasing the association rate ∼2-fold and increasing the dissociation rate ∼10-fold, implicating this as a mechanism by which this mutation impedes DNA synthesis. The Y390F dissociation rate increase is suppressed when complexes are examined in the presence of Mn(2+) rather than Mg(2+). The same effects of the Y226F or Y390F mutations were observed in the background of the D12A/D66A mutations, located in the exonuclease active site, ∼30 Å from the polymerase active site. Although translocation rates were unaffected in the D12A/D66A mutant, these exonuclease site mutations caused a decrease in the dNTP dissociation rate, suggesting that they perturb Φ29 DNAP interdomain architecture.
Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene
Directory of Open Access Journals (Sweden)
Lewin Astrid
2008-12-01
Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.
Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.
McIntosh, Linda Y; Lal, Janella E; Qin, Dahui
2018-01-01
One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Stepchenkova, E I; Tarakhovskaya, E R; Siebler, H M; Pavlov, Y I
2017-01-01
Eukaryotic genomes are duplicated by a complex machinery, utilizing high fidelity replicative B-family DNA polymerases (pols) α, δ and ε. Specialized error-prone pol ζ, the fourth B-family member, is recruited when DNA synthesis by the accurate trio is impeded by replication stress or DNA damage. The damage tolerance mechanism dependent on pol ζ prevents DNA/genome instability and cell death at the expense of increased mutation rates. The pol switches occurring during this specialized replication are not fully understood. The loss of pol ζ results in the absence of induced mutagenesis and suppression of spontaneous mutagenesis. Disruption of the Fe-S cluster motif that abolish the interaction of the C-terminal domain (CTD) of the catalytic subunit of pol ζ with its accessory subunits, which are shared with pol δ, leads to a similar defect in induced mutagenesis. Intriguingly, the pol3-13 mutation that affects the Fe-S cluster in the CTD of the catalytic subunit of pol δ also leads to defective induced mutagenesis, suggesting the possibility that Fe-S clusters are essential for the pol switches during replication of damaged DNA. We confirmed that yeast strains with the pol3-13 mutation are UV-sensitive and defective in UV-induced mutagenesis. However, they have increased spontaneous mutation rates. We found that this increase is dependent on functional pol ζ. In the pol3-13 mutant strain with defective pol δ, there is a sharp increase in transversions and complex mutations, which require functional pol ζ, and an increase in the occurrence of large deletions, whose size is controlled by pol ζ. Therefore, the pol3-13 mutation abrogates pol ζ-dependent induced mutagenesis, but allows for pol ζ recruitment for the generation of spontaneous mutations and prevention of larger deletions. These results reveal differential control of the two major types of pol ζ-dependent mutagenesis by the Fe-S cluster present in replicative pol δ. Copyright © 2016
International Nuclear Information System (INIS)
Janion, C.; Grzesiuk, E.; Fabisiewicz, A.; Tudek, B.; Ciesla, J.; Graziewicz, M.; Wojcik, A.; Speina, E.
1998-01-01
Full text. The discovery that the mfd gene codes for a transcription-coupling repair factor (TRCF) prompted us to re-investigate the MFD (mutation frequency decline) phenomenon in E.coli K-12 strain when mutations were induced by ultraviolet light, halogen light or MMS-treatment. These studies revealed that: (i) the process of MFD involves the proofreading activity of DNA pol III and the mismatch repair system, as well as, TRCF and the UvrABC-excinuclease (ii) a semi-rich plate test may be replaced by a rich liquid medium, (iii) the T-T pyrimidine dimers are the lesions excised with the highest activity, and (iv) overproduction of UmuD(D'C) proteins leads to a great increase in mutant frequency in irradiated and MMS-treated cells. The role of mismatch repair (MR) in MMS-induced mutagenesis is obscured by the fact that the spectra of mutational specificity are different in bacteria proficient and deficient in MR. It has been found that transposons Tn10 (and Tn5) when inserted into chromosomal DNA of E. coli influence the phenotype lowering the survival and frequency of mutations induced by UV or halogen light irradiation. This is connected with a deficiency of UmuD(D') and UmuC proteins. Transformation of bacteria with plasmids bearing the umuD(D')C genes, suppresses the effects of the transposon insertion, a phenomenon which has not been described before. Single-stranded DNA of M13mp18 phage was oxidized in vitro by a hydroxyl radical generating system including hypoxanthine/xanthine oxidase/Fe3+/EDTA, and it was found that Fapy-Ade, Fapy-Gua, 8-oxyAde and thymine glycol were the main products formed. Replication of the oxidized template by T7 phage DNA polymerase, Klenow fragment of polymerase I, or polymerase beta from bovine thymus has revealed that oxidized pyrimidines are stronger blockers than oxidized purines for T7 phage and Klenow fragment polymerases and the blocking potency depends on the neighboring bases and on the type of polymerase. Studies of
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Hussien, Yousry Mostafa; Gharib, Amal F; Awad, Hanan A; Karam, Rehab A; Elsawy, Wael H
2012-02-01
The genes involved in DNA repair system play a crucial role in the protection against mutations. It has been hypothesized that functional deficiencies in highly conserved DNA repair processes resulting from polymorphic variation may increase genetic susceptibility to breast cancer (BC). The aim of the present study was to evaluate the association of genetic polymorphisms in 2 DNA repair genes, XPD (Asp312Asn) and XRCC1 (A399G), with BC susceptibility. We further investigated the potential combined effect of these DNA repair variants on BC risk. Both XPD (xeroderma pigmentosum group D) and XRCC1 (X-ray repair cross-complementing group 1) polymorphisms were characterized in 100 BC Egyptian females and 100 healthy women who had no history of any malignancy by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) method and PCR with confronting two-pair primers (PCR-CTPP), using DNA from peripheral blood in a case control study. Our results revealed that the frequencies of AA genotype of XPD codon 312 polymorphism were significantly higher in the BC patients than in the normal individuals (P ≤ 0.003), and did not observe any association between the XRCC1 Arg399Gln polymorphism and risk of developing BC. Also, no association between both XPD Asp312Asn and XRCC1 A399G polymorphisms and the clinical characteristics of disease. Finally, the combination of AA(XPD) + AG(XRCC1) were significantly associated with BC risk. Our results suggested that, XPD gene is an important candidate gene for susceptibility to BC. Also, gene-gene interaction between XPD(AA) + XRCC1(AG) polymorphism may be associated with increased risk of BC in Egyptian women.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Rosser, A; Rollinson, D; Forrest, M; Webster, B L
2015-09-04
Accurate diagnosis of urogenital schistosomiasis is vital for surveillance/control programs. Amplification of schistosome DNA in urine by PCR is sensitive and specific but requires infrastructure, financial resources and skilled personnel, often not available in endemic areas. Recombinase Polymerase Amplification (RPA) is an isothermal DNA amplification/detection technology that is simple, rapid, portable and needs few resources. Here a Schistosoma haematobium RPA assay was developed and adapted so that DNA amplicons could be detected using oligochromatographic Lateral Flow (LF) strips. The assay successfully amplified S. haematobium DNA at 30-45 °C in 10 mins and was sensitive to a lower limit of 100 fg of DNA. The assay was also successful with the addition of crude urine, up to 5% of the total reaction volume. Cross amplification occurred with other schistosome species but not with other common urine microorganisms. The LF-RPA assay developed here can amplify and detect low levels of S. haematobium DNA. Reactions are rapid, require low temperatures and positive reactions are interpreted using lateral flow strips, reducing the need for infrastructure and resources. This together with an ability to withstand inhibitors within urine makes RPA a promising technology for further development as a molecular diagnostic tool for urogenital schistosomiasis.
Cloning and identification of the gene coding for the 140-kd subunit of Drosophila RNA polymerase II
Faust, Daniela M.; Renkawitz-Pohl, Renate; Falkenburg, Dieter; Gasch, Alexander; Bialojan, Siegfried; Young, Richard A.; Bautz, Ekkehard K. F.
1986-01-01
Genomic clones of Drosophila melanogaster were isolated from a λ library by cross-hybridization with the yeast gene coding for the 150-kd subunit of RNA polymerase II. Clones containing a region of ∼2.0 kb with strong homology to the yeast gene were shown to code for a 3.9-kb poly(A)+-RNA. Part of the coding region was cloned into an expression vector. A fusion protein was obtained which reacted with an antibody directed against RNA polymerase II of Drosophila. Peptide mapping of the fusion p...
Role of polymerase η in mitochondrial mutagenesis of Saccharomyces cerevisiae
Energy Technology Data Exchange (ETDEWEB)
Chatterjee, Nimrat; Pabla, Ritu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States); Siede, Wolfram, E-mail: wolfram.siede@unthsc.edu [Dept. of Cell Biology and Anatomy, University of North Texas Health Science Center, 3500 Camp Bowie Blvd., Fort Worth, TX 76107 (United States)
2013-02-08
Highlights: ► DNA polymerase η is detectable in mitochondria of budding yeast. ► Pol η reduces UV-induced mitochondrial base pair substitutions and frameshifts. ► For UV-induced base pair substitutions, Pol η and Pol ζ interact epistatically. -- Abstract: DNA polymerase η mostly catalyzes an error-free bypass of the most frequent UV lesions, pyrimidine dimers of the cyclobutane-type. In addition to its nuclear localization, we show here for the first time its mitochondrial localization in budding yeast. In mitochondria, this polymerase improves bypass replication fidelity opposite UV damage as shown in base pair substitution and frameshift assays. For base pair substitutions, polymerase η appears to be related in function and epistatic to DNA polymerase ζ which, however, plays the opposite role in the nucleus.
Langston, Lance D; Zhang, Dan; Yurieva, Olga; Georgescu, Roxana E; Finkelstein, Jeff; Yao, Nina Y; Indiani, Chiara; O'Donnell, Mike E
2014-10-28
DNA replication in eukaryotes is asymmetric, with separate DNA polymerases (Pol) dedicated to bulk synthesis of the leading and lagging strands. Pol α/primase initiates primers on both strands that are extended by Pol ε on the leading strand and by Pol δ on the lagging strand. The CMG (Cdc45-MCM-GINS) helicase surrounds the leading strand and is proposed to recruit Pol ε for leading-strand synthesis, but to date a direct interaction between CMG and Pol ε has not been demonstrated. While purifying CMG helicase overexpressed in yeast, we detected a functional complex between CMG and native Pol ε. Using pure CMG and Pol ε, we reconstituted a stable 15-subunit CMG-Pol ε complex and showed that it is a functional polymerase-helicase on a model replication fork in vitro. On its own, the Pol2 catalytic subunit of Pol ε is inefficient in CMG-dependent replication, but addition of the Dpb2 protein subunit of Pol ε, known to bind the Psf1 protein subunit of CMG, allows stable synthesis with CMG. Dpb2 does not affect Pol δ function with CMG, and thus we propose that the connection between Dpb2 and CMG helps to stabilize Pol ε on the leading strand as part of a 15-subunit leading-strand holoenzyme we refer to as CMGE. Direct binding between Pol ε and CMG provides an explanation for specific targeting of Pol ε to the leading strand and provides clear mechanistic evidence for how strand asymmetry is maintained in eukaryotes.
Evolving a polymerase for hydrophobic base analogues.
Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp
2009-10-21
Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.
Decreased uv mutagenesis in cdc8, a DNA replication mutant of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Prakash, L.; Hinkle, D.; Prakash, S.
1978-01-01
A DNA replication mutant of yeast, cdc8, was found to decrease uv-induced reversion of lys2-1, arg4-17, tryl and ural. This effect was observed with all three alleles of cdc8 tested. Survival curves obtained following uv irradiation in cdc8 rad double mutants show that cdc8 is epistatic to rad6, as well as to rad1; cdc8 rad51 double mutants seem to be more sensitive than the single mutants. Since uv-induced reversion in cdc8 rad1 and cdc8 rad51 double mutants is like that of the cdc8 single mutants, we conclude that CDC8 plays a direct role in error-prone repair. To test whether CDC8 codes for a DNA polymerase, we have purified both DNA polymerase I and DNA polymerase II from cdc8 and CDC+ cells. The purified DNA polymerases from cdc8 were no more heat labile than those from CDC+, suggesting that CDC8 is not a structural gene for either enzyme
Common changes in global gene expression induced by RNA polymerase inhibitors in Shigella flexneri.
Directory of Open Access Journals (Sweden)
Hua Fu
Full Text Available Characterization of expression profile of organisms in response to antimicrobials provides important information on the potential mechanism of action of the drugs. The special expression signature can be used to predict whether other drugs act on the same target. Here, the common response of Shigella flexneri to two inhibitors of RNA polymerase was examined using gene expression profiling. Consistent with similar effects of the two drugs, the gene expression profiles indicated that responses of the bacteria to these drugs were roughly the same, with 225 genes affected commonly. Of them, 88 were induced and 137 were repressed. Real-time PCR was performed for selected genes to verify the microarray results. Analysis of the expression data revealed that more than 30% of the plasmid-encoded genes on the array were up-regulated by the antibiotics including virF regulon, other virulence-related genes, and genes responsible for plasmid replication, maintenance, and transfer. In addition, some chromosome-encoded genes involved in virulence and genes acquired from horizontal transfer were also significantly up-regulated. However, the expression of genes encoding the beta-subunit of RNA polymerase was increased moderately. The repressed genes include those that code for products associated with the ribosome, citrate cycle, glycolysis, thiamine biosynthesis, purine metabolism, fructose metabolism, mannose metabolism, and cold shock proteins. This study demonstrates that the two antibiotics induce rapid cessation of RNA synthesis resulting in inhibition of translation components. It also indicates that the production of virulence factors involved in intercellular dissemination, tissue invasion and inflammatory destruction may be enhanced through derepressing horizontal transfer genes by the drugs.
Poly(ADP-ribose) polymerase-1 inhibits ATM kinase activity in DNA damage response
International Nuclear Information System (INIS)
Watanabe, Fumiaki; Fukazawa, Hidesuke; Masutani, Mitsuko; Suzuki, Hiroshi; Teraoka, Hirobumi; Mizutani, Shuki; Uehara, Yoshimasa
2004-01-01
DNA double-strand breaks (DSB) mobilize DNA-repair machinery and cell cycle checkpoint by activating the ataxia-telangiectasia (A-T) mutated (ATM). Here we show that ATM kinase activity is inhibited by poly(ADP-ribose) polymerase-1 (PARP-1) in vitro. It was shown by biochemical fractionation procedure that PARP-1 as well as ATM increases at chromatin level after induction of DSB with neocarzinostatin (NCS). Phosphorylation of histone H2AX on serine 139 and p53 on serine 15 in Parp-1 knockout (Parp-1 -/- ) mouse embryonic fibroblasts (MEF) was significantly induced by NCS treatment compared with MEF derived from wild-type (Parp-1 +/+ ) mouse. NCS-induced phosphorylation of histone H2AX on serine 139 in Parp-1 -/- embryonic stem cell (ES) clones was also higher than that in Parp-1 +/+ ES clone. Furthermore, in vitro, PARP-1 inhibited phosphorylation of p53 on serine 15 and 32 P-incorporation into p53 by ATM in a DNA-dependent manner. These results suggest that PARP-1 negatively regulates ATM kinase activity in response to DSB
Lawler, Jessica L; Mukherjee, Purba; Coen, Donald M
2018-03-01
The catalytic subunit (Pol) of herpes simplex virus 1 (HSV-1) DNA polymerase has been extensively studied both as a model for other family B DNA polymerases and for its differences from these enzymes as an antiviral target. Among the activities of HSV-1 Pol is an intrinsic RNase H activity that cleaves RNA from RNA-DNA hybrids. There has long been a controversy regarding whether this activity is due to the 3'-to-5' exonuclease of Pol or whether it is a separate activity, possibly acting on 5' RNA termini. To investigate this issue, we compared wild-type HSV-1 Pol and a 3'-to-5' exonuclease-deficient mutant, D368A Pol, for DNA polymerase activity, 3'-to-5' exonuclease activity, and RNase H activity in vitro Additionally, we assessed the RNase H activity using differentially end-labeled templates with 5' or 3' RNA termini. The mutant enzyme was at most modestly impaired for DNA polymerase activity but was drastically impaired for 3'-to-5' exonuclease activity, with no activity detected even at high enzyme-to-DNA substrate ratios. Importantly, the mutant showed no detectable ability to excise RNA with either a 3' or 5' terminus, while the wild-type HSV-1 Pol was able to cleave RNA from the annealed RNA-DNA hairpin template, but only detectably with a 3' RNA terminus in a 3'-to-5' direction and at a rate lower than that of the exonuclease activity. These results suggest that HSV-1 Pol does not have an RNase H separable from its 3'-to-5' exonuclease activity and that this activity prefers DNA degradation over degradation of RNA from RNA-DNA hybrids. IMPORTANCE Herpes simplex virus 1 (HSV-1) is a member of the Herpesviridae family of DNA viruses, several of which cause morbidity and mortality in humans. Although the HSV-1 DNA polymerase has been studied for decades and is a crucial target for antivirals against HSV-1 infection, several of its functions remain to be elucidated. A hypothesis suggesting the existence of a 5'-to-3' RNase H activity intrinsic to this enzyme
Isolation and characterization of the dnaA gene of Rickettsia prowazekii
International Nuclear Information System (INIS)
Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.
1998-01-01
The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)
Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan
2014-01-01
Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.
Effects of heat stress on gene expression in eggplant ( Solanum ...
African Journals Online (AJOL)
In order to identify differentially expressed genes involved in heat shock response, cDNA amplified fragment length polymorphism (cDNA-AFLP) and quantitative real-time polymerase chain reaction (QPCR) were used to study gene expression of eggplant seedlings subjected to 0, 6 and 12 h at 43°C. A total of 53 of over ...
DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.
Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao
2016-04-01
RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.
International Nuclear Information System (INIS)
Ide, H.; Melamede, R.J.; Wallace, S.S.
1987-01-01
5,6-Dihydrothymidine 5'-triphosphate (DHdTTP) was synthesized by catalytic hydrogenation of thymidine 5'-triphosphate (dTTP). Thymidine glycol 5'-triphosphate (dTTP-GLY) was prepared by bromination of dTTP followed by treatment with Ag 2 O. The modified nucleotides were extensively purified by anion-exchange high-performance liquid chromatography (HPLC). Alkaline phosphatase digestion of DHdTTP and dTTP-GLY gave the expected products (5,6-dihydrothymidine and cis-thymidine glycol), the identities of which were confirmed by reverse-phase HPLC using authentic markers. HPLC analysis of the alkaline phosphatase digested DHdTTP revealed that DHdTTP was a mixture of C5 diastereoisomers [(5S)- and (5R)-DHdTTP]. Despite the significant distortion of the pyrimidine ring in DHdTTP, it was incorporated in place of dTTP during primer elongation catalyzed by Escherichia coli DNA polymerase I Klenow fragment. The rate of incorporation of DHdTTP was about 10-25-fold lower than that of dTTP. On the other hand, dTTP-GLY, which also has a distorted pyrimidine ring, did not replace dTTP, and no elongation of the primer was observed. In order to study the preference of incorporation of the diastereoisomers of DHdTTP into DNA, salmon testes DNA, activated by exonuclease III, was used as a template for DNA polymerase I Klenow fragment in the presence of [ 3 H]DHdTTP (S and R mixture) and normal nucleotides. After enzymatic digestion of the DNA to nucleosides, the products were analyzed by HPLC. The result suggests that Escherichia coli DNA polymerase I uses both isomers of DHdTTP as substrates and that the overall efficiency of incorporation is primarily determined by the concentration of the isomers in the nucleotide pool
Davis, L; Barbera, M; McDonnell, A; McIntyre, K; Sternglanz, R; Jin , Q; Loidl, J; Engebrecht, J
2001-01-01
The Saccharomyces cerevisiae MUM2 gene is essential for meiotic, but not mitotic, DNA replication and thus sporulation. Genetic interactions between MUM2 and a component of the origin recognition complex and polymerase alpha-primase suggest that MUM2 influences the function of the DNA replication machinery. Early meiotic gene expression is induced to a much greater extent in mum2 cells than in meiotic cells treated with the DNA synthesis inhibitor hydroxyurea. This result indicates that the mum2 meiotic arrest is downstream of the arrest induced by hydroxyurea and suggests that DNA synthesis is initiated in the mutant. Genetic analyses indicate that the recombination that occurs in mum2 mutants is dependent on the normal recombination machinery and on synaptonemal complex components and therefore is not a consequence of lesions created by incompletely replicated DNA. Both meiotic ectopic and allelic recombination are similarly reduced in the mum2 mutant, and the levels are consistent with the levels of meiosis-specific DSBs that are generated. Cytological analyses of mum2 mutants show that chromosome pairing and synapsis occur, although at reduced levels compared to wild type. Given the near-wild-type levels of meiotic gene expression, pairing, and synapsis, we suggest that the reduction in DNA replication is directly responsible for the reduced level of DSBs and meiotic recombination. PMID:11238403
DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...
African Journals Online (AJOL)
We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...
Directory of Open Access Journals (Sweden)
Saroj K. Dangi
2014-10-01
Full Text Available Aim: The present study was aimed at polymerase chain reaction (PCR amplification and cloning of NAD-dependent betahydroxybutyryl coenzyme A dehydrogenase (BHBD gene of Clostridium chauvoei. Materials and Methods: C. chauvoei was cultured and confirmed by 16-23S rDNA spacer region primers. The primers for nad-bhbd gene of C. chauvoei were designed to aid in cloning into pRham-N-His SUMO-Kan vector, and nad-bhbd gene was amplified by PCR. The amplified nad-bhbd gene was purified and cloned into pRham-N-His SUMO-Kan expression vector. The recombinant plasmid was transformed into E. cloni 10 G cells and the clone was confirmed by colony PCR using the pRham-SUMO-NAD-For and pRham-SUMO-NAD-Rev primers and also by sequencing. Results: PCR amplification of nad-bhbd gene yielded a product length of 844 base pairs which was cloned into pRham-NHis SUMO-Kan vector followed by transformation into E. cloni 10G chemically competent cells. The recombinant clones were characterized by colony PCR, sequencing, followed by basic local alignment search tool (BLAST analysis to confirm the insert. Conclusions: Immunogenic protein NAD- dependent BHBD of C. chauvoei was cloned and the recombinant clones were confirmed by colony PCR and sequencing analysis.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Multi-subunit RNA polymerases (RNAP) are ornate molecular machines that translocate on a DNA template as they generate a complementary RNA chain. RNAPs are highly conserved in evolution among eukarya, eubacteria, archaea, and some viruses. As such, multi-subunit RNAPs appear to be an irreplaceable advance in the evolution of complex life on earth. Because of their stepwise movement on DNA, RNAPs are considered to be molecular motors, and because RNAPs catalyze a templated polymerization reaction, they are central to biological information flow.
In vitro fluorescence studies of transcription factor IIB-DNA interaction.
Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta
2015-01-01
General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.
Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli.
Kato , J; Katayama, T
2001-08-01
The bacterial DnaA protein binds to the chromosomal origin of replication to trigger a series of initiation reactions, which leads to the loading of DNA polymerase III. In Escherichia coli, once this polymerase initiates DNA synthesis, ATP bound to DnaA is efficiently hydrolyzed to yield the ADP-bound inactivated form. This negative regulation of DnaA, which occurs through interaction with the beta-subunit sliding clamp configuration of the polymerase, functions in the temporal blocking of re-initiation. Here we show that the novel DnaA-related protein, Hda, from E.coli is essential for this regulatory inactivation of DnaA in vitro and in vivo. Our results indicate that the hda gene is required to prevent over-initiation of chromosomal replication and for cell viability. Hda belongs to the chaperone-like ATPase family, AAA(+), as do DnaA and certain eukaryotic proteins essential for the initiation of DNA replication. We propose that the once-per-cell-cycle rule of replication depends on the timely interaction of AAA(+) proteins that comprise the apparatus regulating the activity of the initiator of replication.
Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier
2016-10-15
The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Gene assembly via one-pot chemical ligation of DNA promoted by DNA nanostructures
DEFF Research Database (Denmark)
Manuguerra, Ilenia; Croce, Stefano; El-Sagheer, Afaf H.
2018-01-01
Current gene synthesis methods are driven by enzymatic reactions. Here we report the one-pot synthesis of a chemically-ligated gene from 14 oligonucleotides. The chemical ligation benefits from the highly efficient click chemistry approach templated by DNA nanostructures, and produces modified DNA...
Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J
2016-06-11
Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.
Directory of Open Access Journals (Sweden)
Leili Moezzi
2016-05-01
Full Text Available Background: Maternal-fetal RhD antigen incompatibility causes approximately 50% of clinically significant alloimmunization cases. The routine use of prophylactic anti-D immunoglobulin has dramatically reduced hemolytic disease of the fetus and newborn. Recently, fetal RHD genotyping in RhD negative pregnant women has been suggested for appropriate use of anti-D immunoglobulin antenatal prophylaxis and decrease unnecessary prenatal interventions. Materials and Methods: In this prospective cohort study, in order to develop a reliable and non-invasive method for fetal RHD genotyping, cell free fetal DNA (cffDNA was extracted from maternal plasma. Real-time quantitative polymerase chain reaction (qPCR for detection of RHD exons 7, 5, 10 and intron 4 was performed and the results were compared to the serological results of cord blood cells as the gold standard method. SRY gene and hypermethylated Ras-association domain family member 1 (RASSF1A gene were used to confirm the presence of fetal DNA in male and female fetuses, respectively. Results: Out of 48 fetuses between 8 and 32 weeks (wks of gestational age (GA, we correctly diagnosed 45 cases (93.75% of RHD positive fetuses and 2 cases (4.16% of the RHD negative one. Exon 7 was amplified in one sample, while three other RHD gene sequences were not detected; the sample was classified as inconclusive, and the RhD serology result after birth showed that the fetus was RhD-negative. Conclusion: Our results showed high accuracy of the qPCR method using cffDNA for fetal RHD genotyping and implicate on the efficiency of this technique to predict the competence of anti-D immunoglobulin administration.
International Nuclear Information System (INIS)
Link, G.; Bogorad, L.; Kidd, G.H.; Richter, G.
1978-01-01
DNA-dependent RNA polymerase II (or B) was purified from cultured parsley cells, and its molecular structure was examined in detail. Upon centrifugation through glycerol gradients, RNA polymerase II sediments as a single band with an apparent sedimentation constant of 15S. No contamination with RNA polymerases I or III could be detected when the activity of purified RNA polymerase II was assayed in the presence of high concentrations of α-amanitin. Analysis of purified RNA polymerase II be nondenaturing and denaturing polyacrylamide gel electrophoresis revealed that this enzyme exists in multiple forms. They were designated II(O), II(A), and II(B). It is suggested that each form has a subunit of Mr = 140000 as well as smaller polypeptides in common. They differ, however, in the molecular weights of their largest subunits which is 220000 in form II(O), 200000 in form II(A), and 180000 in form II(B). These large subunits were labelled with 125 I, digested with trypsin, and tryptic digests were compared by two-dimensional analysis on thin-layer plates (Elder et al. (1977) J. Biol. Chem. 252, 6510-6515). Fingerprints of tryptic digests from the polypeptides with Mr = 220000, Mr = 200000, and Mr = 180000 were similar. It is, therefore, suggested that these subunits are stucturally related. A tryptic digest was also produced from the subunit with Mr = 140000. Its fingerprint was found to yield a considerably different distribution of peptides as compared to those from the three large subunits. (orig.) [de
Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T
1997-12-01
A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.
dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.
Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J
2015-05-12
Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.
Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System
Szeberényi, József
2013-01-01
Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…
Mechanisms of mutagenesis: DNA replication in the presence of DNA damage.
Liu, Binyan; Xue, Qizhen; Tang, Yong; Cao, Jia; Guengerich, F Peter; Zhang, Huidong
2016-01-01
Environmental mutagens cause DNA damage that disturbs replication and produces mutations, leading to cancer and other diseases. We discuss mechanisms of mutagenesis resulting from DNA damage, from the level of DNA replication by a single polymerase to the complex DNA replisome of some typical model organisms (including bacteriophage T7, T4, Sulfolobus solfataricus, Escherichia coli, yeast and human). For a single DNA polymerase, DNA damage can affect replication in three major ways: reducing replication fidelity, causing frameshift mutations, and blocking replication. For the DNA replisome, protein interactions and the functions of accessory proteins can yield rather different results even with a single DNA polymerase. The mechanism of mutation during replication performed by the DNA replisome is a long-standing question. Using new methods and techniques, the replisomes of certain organisms and human cell extracts can now be investigated with regard to the bypass of DNA damage. In this review, we consider the molecular mechanism of mutagenesis resulting from DNA damage in replication at the levels of single DNA polymerases and complex DNA replisomes, including translesion DNA synthesis. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Hamed Rezaeejam
2015-01-01
Full Text Available Understanding of cellular responses to ionizing radiation (IR is essential for the development of predictive markers useful for assessing human exposure. Biological markers of exposure to IR in human populations are of great interest for assessing normal tissue injury in radiation oncology and for biodosimetry in nuclear incidents and accidental radiation exposures. Traditional radiation exposure biomarkers based on cytogenetic assays (biodosimetry, are time-consuming and do not provide results fast enough and requires highly trained personnel for scoring. Hence, the development of rapid biodosimetry methods is one of the highest priorities. Exposure of cells to IR activates multiple signal transduction pathways, which result in complex alterations in gene-expression. Real-time quantitative reverse transcription-polymerase chain reaction (RT-qPCR has become the benchmark for the detection and quantification of RNA targets and is being utilized increasingly in monitoring the specific genes with more accurately and sensitively. This review evaluates the RT-qPCR as a biodosimetry method and we investigated the papers from 2000 up to now, which identified the genes-expression related the DNA repair, cell cycle checkpoint, and apoptosis induced by ionization radiation in peripheral blood and determined as biodosimeters. In conclusion, it could be say that RT-qPCR technique for determining the specific genes as biodosimeters could be a fully quantitative reliable and sensitive method. Furthermore, the results of the current review will help the researchers to recognize the most expressed genes induced by ionization radiation.
International Nuclear Information System (INIS)
Boreham, D.R.; Trivedi, A.; Weinberger, P.; Mitchel, R.E.
1990-01-01
Either an ionizing radiation exposure or a heat shock is capable of inducing both thermal tolerance and radiation resistance in yeast. Yeast mutants, deficient in topoisomerase I, in topoisomerase II, or in DNA polymerase I, were used to investigate the mechanism of these inducible resistances. The absence of either or both topoisomerase activities did not prevent induction of either heat or radiation resistance. However, if both topoisomerase I and II activities were absent, the sensitivity of yeast to become thermally tolerant (in response to a heat stress) was markedly increased. The absence of only topoisomerase I activity (top1) resulted in the constitutive expression of increased radiation resistance equivalent to that induced by a heat shock in wild-type cells, and the topoisomerase I-deficient cells were not further inducible by heat. This heat-inducible component of radiation resistance (or its equivalent constitutive expression in top1 cells) was, in turn, only a portion of the full response inducible by radiation. The absence of polymerase I activity had no detectable effect on either response. Our results indicate that the actual systems that confer resistance to heat or radiation are independent of either topoisomerase activity or DNA polymerase function, but suggest that topoisomerases may have a regulatory role during the signaling of these mechanisms. The results of our experiments imply that maintenance of correct DNA topology prevents induction of the heat-shock response, and that heat-shock induction of a component of the full radiation resistance in yeast may be the consequence of topoisomerase I inactivation
Mycobacterium tuberculosis DNA repair in response to subinhibitory concentrations of ciprofloxacin.
O'Sullivan, D M; Hinds, J; Butcher, P D; Gillespie, S H; McHugh, T D
2008-12-01
To investigate how the SOS response, an error-prone DNA repair pathway, is expressed following subinhibitory quinolone treatment of Mycobacterium tuberculosis. Genome-wide expression profiling followed by quantitative RT (qRT)-PCR was used to study the effect of ciprofloxacin on M. tuberculosis gene expression. Microarray analysis showed that 16/110 genes involved in DNA protection, repair and recombination were up-regulated. There appeared to be a lack of downstream genes involved in the SOS response. qRT-PCR detected an induction of lexA and recA after 4 h and of dnaE2 after 24 h of subinhibitory treatment. The pattern of gene expression observed following subinhibitory quinolone treatment differed from that induced after other DNA-damaging agents (e.g. mitomycin C). The expression of the DnaE2 polymerase response was significantly delayed following subinhibitory quinolone exposure.