DNA-Based Single-Molecule Electronics: From Concept to Function

Science.gov (United States)

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

DNA-Based Single-Molecule Electronics: From Concept to Function.

Science.gov (United States)

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

International Nuclear Information System (INIS)

Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

2009-01-01

We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

Science.gov (United States)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

Vesicle Encapsulation Studies Reveal that Single Molecule Ribozyme Heterogeneities Are Intrinsic

Science.gov (United States)

Okumus, Burak; Wilson, Timothy J.; Lilley, David M. J.; Ha, Taekjip

2004-01-01

Single-molecule measurements have revealed that what were assumed to be identical molecules can differ significantly in their static and dynamic properties. One of the most striking examples is the hairpin ribozyme, which was shown to exhibit two to three orders of magnitude variation in folding kinetics between molecules. Although averaged behavior of single molecules matched the bulk solution data, it was not possible to exclude rigorously the possibility that the variations around the mean values arose from different ways of interacting with the surface environment. To test this, we minimized the molecules' interaction with the surface by encapsulating DNA or RNA molecules inside 100- to 200-nm diameter unilamellar vesicles, following the procedures described by Haran and coworkers. Vesicles were immobilized on a supported lipid bilayer via biotin-streptavidin linkages. We observed no direct binding of DNA or RNA on the supported bilayer even at concentrations exceeding 100 nM, indicating that these molecules do not bind stably on the membrane. Since the vesicle diameter is smaller than the resolution of optical microscopy, the lateral mobility of the molecules is severely constrained, allowing long observation periods. We used fluorescence correlation spectroscopy, nuclease digestion, and external buffer exchange to show that the molecules were indeed encapsulated within the vesicles. When contained within vesicles, the natural form of the hairpin ribozyme exhibited 50-fold variation in both folding and unfolding rates in 0.5 mM Mg2+, which is identical to what was observed from the molecules tethered directly on the surface. This strongly indicates that the observed heterogeneity in dynamic properties does not arise as an artifact of surface attachment, but is intrinsic to the nature of the molecules. PMID:15454471

Long-range charge transport in single G-quadruplex DNA molecules

DEFF Research Database (Denmark)

Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

2014-01-01

DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

Single Molecule Screening of Disease DNA Without Amplification

Energy Technology Data Exchange (ETDEWEB)

Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

2006-01-01

The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

[Single-molecule detection and characterization of DNA replication based on DNA origami].

Science.gov (United States)

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

DNA analysis by single molecule stretching in nanofluidic biochips

DEFF Research Database (Denmark)

Abad, E.; Juarros, A.; Retolaza, A.

2011-01-01

Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

Science.gov (United States)

Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

2016-01-01

Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

DEFF Research Database (Denmark)

Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

2017-01-01

Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

Electron microscope autoradiography of isolated DNA molecules

International Nuclear Information System (INIS)

Delain, Etienne; Bouteille, Michel

1980-01-01

Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

Science.gov (United States)

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Thermophoretic forces on DNA measured with a single-molecule spring balance

DEFF Research Database (Denmark)

Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

2014-01-01

We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

Single-molecule studies of DNA transcription using atomic force microscopy

International Nuclear Information System (INIS)

Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

2012-01-01

Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

Science.gov (United States)

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

Science.gov (United States)

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Highly parallel translation of DNA sequences into small molecules.

Directory of Open Access Journals (Sweden)

Rebecca M Weisinger

Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

Developing DNA nanotechnology using single-molecule fluorescence.

Science.gov (United States)

Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

2014-06-17

CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

Science.gov (United States)

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

Science.gov (United States)

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

International Nuclear Information System (INIS)

Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

2007-01-01

Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

How to read and write mechanical information in DNA molecules

Science.gov (United States)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

Science.gov (United States)

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

NARCIS (Netherlands)

Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

2009-01-01

We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

Science.gov (United States)

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

DNA molecules and human therapeutics | Danquah | African Journal ...

African Journals Online (AJOL)

Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

Science.gov (United States)

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Automation of a single-DNA molecule stretching device

DEFF Research Database (Denmark)

Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

2015-01-01

We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

Science.gov (United States)

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Studying DNA looping by single-molecule FRET.

Science.gov (United States)

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

[The effect of spermine on acid-base equilibrium in DNA molecule].

Science.gov (United States)

Slonitskiĭ, S V; Kuptsov, V Iu

1990-01-01

The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

OpenAIRE

Buyukdagli, Sahin

2016-01-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

Quantifying DNA melting transitions using single-molecule force spectroscopy

International Nuclear Information System (INIS)

Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

2009-01-01

We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

Quantifying DNA melting transitions using single-molecule force spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

2009-01-21

We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

A 3D-DNA Molecule Made of PlayMais

Science.gov (United States)

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

DEFF Research Database (Denmark)

Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

2017-01-01

Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

Science.gov (United States)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

A single molecule DNA flow stretching microscope for undergraduates

NARCIS (Netherlands)

Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

2011-01-01

The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

Data.gov (United States)

National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

KAUST Repository

Hussain, Tanveer

2017-09-14

Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

Science.gov (United States)

Friedrich, Sarah; Wang, Tza-Huei

Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

Directory of Open Access Journals (Sweden)

Marijn T J van Loenhout

Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

Science.gov (United States)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

Science.gov (United States)

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

DNA replication at the single-molecule level

NARCIS (Netherlands)

Stratmann, S.A.; Oijen, A.M. van

2014-01-01

A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

International Nuclear Information System (INIS)

Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

2008-01-01

Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

Directory of Open Access Journals (Sweden)

Hsiu-Fang Fan

2018-05-01

Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

Single-molecule analysis of DNA replication in Xenopus egg extracts

NARCIS (Netherlands)

Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

Science.gov (United States)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Inhibition of DNA glycosylases via small molecule purine analogs.

Directory of Open Access Journals (Sweden)

Aaron C Jacobs

Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

Real-time single-molecule observation of rolling-circle DNA replication

NARCIS (Netherlands)

Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

2009-01-01

We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

Single-strand DNA molecule translocation through nanoelectrode gaps

International Nuclear Information System (INIS)

Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

2007-01-01

Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

Science.gov (United States)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

Science.gov (United States)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression.

Science.gov (United States)

Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

2016-06-01

Half of the human genome is made up of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using bacterial artificial chromosomes in Xenopus laevis egg extract. Using this approach we characterized the chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication-dependent enrichment of a network of DNA repair factors including the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR-dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to the inability of the single-stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of topoisomerase I-dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications for our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions.

Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

Directory of Open Access Journals (Sweden)

Scott S Walker

Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

Science.gov (United States)

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

Science.gov (United States)

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

Science.gov (United States)

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

Science.gov (United States)

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

Science.gov (United States)

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

OpenAIRE

Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

2018-01-01

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

Modes of Escherichia coli Dps Interaction with DNA as Revealed by Atomic Force Microscopy.

Directory of Open Access Journals (Sweden)

Vladislav V Melekhov

Full Text Available Multifunctional protein Dps plays an important role in iron assimilation and a crucial role in bacterial genome packaging. Its monomers form dodecameric spherical particles accumulating ~400 molecules of oxidized iron ions within the protein cavity and applying a flexible N-terminal ends of each subunit for interaction with DNA. Deposition of iron is a well-studied process by which cells remove toxic Fe2+ ions from the genetic material and store them in an easily accessible form. However, the mode of interaction with linear DNA remained mysterious and binary complexes with Dps have not been characterized so far. It is widely believed that Dps binds DNA without any sequence or structural preferences but several lines of evidence have demonstrated its ability to differentiate gene expression, which assumes certain specificity. Here we show that Dps has a different affinity for the two DNA fragments taken from the dps gene regulatory region. We found by atomic force microscopy that Dps predominantly occupies thermodynamically unstable ends of linear double-stranded DNA fragments and has high affinity to the central part of the branched DNA molecule self-assembled from three single-stranded oligonucleotides. It was proposed that Dps prefers binding to those regions in DNA that provide more contact pads for the triad of its DNA-binding bundle associated with one vertex of the protein globule. To our knowledge, this is the first study revealed the nucleoid protein with an affinity to branched DNA typical for genomic regions with direct and inverted repeats. As a ubiquitous feature of bacterial and eukaryotic genomes, such structural elements should be of particular care, but the protein system evolutionarily adapted for this function is not yet known, and we suggest Dps as a putative component of this system.

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

Science.gov (United States)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

Analysis of DNA interactions using single-molecule force spectroscopy.

Science.gov (United States)

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

DEFF Research Database (Denmark)

Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

2011-01-01

We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

Energy Technology Data Exchange (ETDEWEB)

Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

2009-07-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

International Nuclear Information System (INIS)

Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

2009-01-01

When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

Science.gov (United States)

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

DEFF Research Database (Denmark)

Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

2010-01-01

DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

Science.gov (United States)

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single-molecule denaturation mapping of DNA in nanofluidic channels

DEFF Research Database (Denmark)

Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

2010-01-01

Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

Science.gov (United States)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

Science.gov (United States)

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

Science.gov (United States)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

Science.gov (United States)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

Mechanistic Studies with DNA Polymerases Reveal Complex Outcomes following Bypass of DNA Damage

Directory of Open Access Journals (Sweden)

Robert L. Eoff

2010-01-01

Full Text Available DNA is a chemically reactive molecule that is subject to many different covalent modifications from sources that are both endogenous and exogenous in origin. The inherent instability of DNA is a major obstacle to genomic maintenance and contributes in varying degrees to cellular dysfunction and disease in multi-cellular organisms. Investigations into the chemical and biological aspects of DNA damage have identified multi-tiered and overlapping cellular systems that have evolved as a means of stabilizing the genome. One of these pathways supports DNA replication events by in a sense adopting the mantra that one must “make the best of a bad situation” and tolerating covalent modification to DNA through less accurate copying of the damaged region. Part of this so-called DNA damage tolerance pathway involves the recruitment of specialized DNA polymerases to sites of stalled or collapsed replication forks. These enzymes have unique structural and functional attributes that often allow bypass of adducted template DNA and successful completion of genomic replication. What follows is a selective description of the salient structural features and bypass properties of specialized DNA polymerases with an emphasis on Y-family members.

Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

Directory of Open Access Journals (Sweden)

Greta Zubaite

2017-02-01

Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

NARCIS (Netherlands)

Moayed, F.; Mashaghi, A.; Tans, S.J.

2013-01-01

Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

Single molecule DNA detection with an atomic vapor notch filter

Energy Technology Data Exchange (ETDEWEB)

Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

2015-12-01

The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

CERN Document Server

Williams, Mark C

2011-01-01

This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

NARCIS (Netherlands)

Hohlbein, J.; Kapanidis, A.N.

2016-01-01

Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

Energy Technology Data Exchange (ETDEWEB)

Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

Single Molecule Study of DNA Organization and Recombination

Science.gov (United States)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

Directory of Open Access Journals (Sweden)

Mária Džunková

Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

Directory of Open Access Journals (Sweden)

Toshitsugu Fujita

2015-09-01

Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

Science.gov (United States)

Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

2018-04-18

Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

Czech Academy of Sciences Publication Activity Database

Hanzálek, Petr; Kypr, Jaroslav

2001-01-01

Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

Science.gov (United States)

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Biofunctionalization of zinc oxide nanowires for DNA sensory applications

Directory of Open Access Journals (Sweden)

Rudolph Bettina

2011-01-01

Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

Energy Technology Data Exchange (ETDEWEB)

Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

2009-05-11

The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

NARCIS (Netherlands)

Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

1999-01-01

By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

DEFF Research Database (Denmark)

Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

2012-01-01

Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

How to determine local stretching and tension in a flow-stretched DNA molecule

DEFF Research Database (Denmark)

Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

2016-01-01

We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

On the identification techniques for ionizing radiation structure breaks in the DNA molecule

International Nuclear Information System (INIS)

Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

2012-01-01

In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

Interplay of protein and DNA structure revealed in simulations of the lac operon.

Directory of Open Access Journals (Sweden)

Luke Czapla

Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Interplay of protein and DNA structure revealed in simulations of the lac operon.

Science.gov (United States)

Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

2013-01-01

The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

Loading dynamics of a sliding DNA clamp.

KAUST Repository

Cho, Won-Ki

2014-05-22

Sliding DNA clamps are loaded at a ss/dsDNA junction by a clamp loader that depends on ATP binding for clamp opening. Sequential ATP hydrolysis results in closure of the clamp so that it completely encircles and diffuses on dsDNA. We followed events during loading of an E. coli β clamp in real time by using single-molecule FRET (smFRET). Three successive FRET states were retained for 0.3 s, 0.7 s, and 9 min: Hydrolysis of the first ATP molecule by the γ clamp loader resulted in closure of the clamp in 0.3 s, and after 0.7 s in the closed conformation, the clamp was released to diffuse on the dsDNA for at least 9 min. An additional single-molecule polarization study revealed that the interfacial domain of the clamp rotated in plane by approximately 8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.

Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

International Nuclear Information System (INIS)

Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

1979-01-01

The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

Science.gov (United States)

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

Science.gov (United States)

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

Science.gov (United States)

Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

2017-01-01

During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

Mixed infection of Sida jamaicensis in Jamaica reveals the presence of three recombinant begomovirus DNA A components.

Science.gov (United States)

Stewart, Cheryl; Kon, Tatsuya; Rojas, Maria; Graham, André; Martin, Darren; Gilbertson, Robert; Roye, Marcia

2014-09-01

Begomoviruses impose serious constraints on agriculture throughout the temperate, tropical and subtropical regions. Previously, we characterised a sida golden yellow vein virus isolate, SiGYVV-[JM:Lig2:08] (HQ009519-20) from a symptomatic Sida jamaicensis plant. With the aim of establishing whether it was hosting a mixed infection that could facilitate recombination, PCR-RFLP was done on DNA extracted from this plant, and the results suggested the presence of two additional genetically distinct DNA-A molecules. Sequence analysis of these two DNA-A molecules (relying on BLAST searches and the CLUSTAL V algorithm within the DNASTAR MegAlign module) revealed that they belonged to novel species, and we have tentatively named these viruses sida golden mosaic Braco virus-[Jamaica:Liguanea:2008] and sida golden mosaic Liguanea virus-[Jamaica:1:2008]. Using RDP4 (recombination detection program), we determined that all three viruses were recombinant, with bases ~10 to ~440 of both SiGMLigV-[JM:Lig:08] and SiGYVV-[JM:Lig2:08] having been derived from a relative of SiGMBV-[JM:Lig:08] (P<2.070×10(-7) for all seven of the recombination detection methods). SiGMBV-[JM:Lig:08] was itself a product of recombination, deriving bases ~490-1195 from a virus that was ~92% similar to malvastrum yellow mosaic Helshire virus. Phylogenetically, these DNA-A components are most closely related to those of malvaceous weed-infecting begomoviruses from Jamaica, Cuba, Florida and Mexico. The SiGMBV DNA-A was able to elicit symptomatic infection in N. benthamiana.

Single molecule analysis of c-myb alternative splicing reveals novel classifiers for precursor B-ALL.

Directory of Open Access Journals (Sweden)

Ye E Zhou

Full Text Available The c-Myb transcription factor, a key regulator of proliferation and differentiation in hematopoietic and other cell types, has an N-terminal DNA binding domain and a large C-terminal domain responsible for transcriptional activation, negative regulation and determining target gene specificity. Overexpression and rearrangement of the c-myb gene (MYB has been reported in some patients with leukemias and other types of cancers, implicating activated alleles of c-myb in the development of human tumors. Alternative RNA splicing can produce variants of c-myb with qualitatively distinct transcriptional activities that may be involved in transformation and leukemogenesis. Here, by performing a detailed, single molecule assay we found that c-myb alternative RNA splicing was elevated and much more complex in leukemia samples than in cell lines or CD34+ hematopoietic progenitor cells from normal donors. The results revealed that leukemia samples express more than 60 different c-myb splice variants, most of which have multiple alternative splicing events and were not detectable by conventional microarray or PCR approaches. For example, the single molecule assay detected 21 and 22 splice variants containing the 9B and 9S exons, respectively, most of which encoded unexpected variant forms of c-Myb protein. Furthermore, the detailed analysis identified some splice variants whose expression correlated with poor survival in a small cohort of precursor B-ALL samples. Our findings indicate that single molecule assays can reveal complexities in c-myb alternative splicing that have potential as novel biomarkers and could help explain the role of c-Myb variants in the development of human leukemia.

Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

International Nuclear Information System (INIS)

Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

2014-01-01

The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

Science.gov (United States)

Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

2017-01-01

The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

Directory of Open Access Journals (Sweden)

Fatemeh Moayed

Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

DNA expressions - A formal notation for DNA

NARCIS (Netherlands)

Vliet, Rudy van

2015-01-01

We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA

Science.gov (United States)

Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev

2012-01-01

B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

Science.gov (United States)

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

DNA binding and aggregation by carbon nanoparticles

International Nuclear Information System (INIS)

An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo

2010-01-01

Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

Science.gov (United States)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

International Nuclear Information System (INIS)

Pham, Quang Trung

2014-01-01

The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

Science.gov (United States)

Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

2014-10-21

Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

Science.gov (United States)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

DNA damage, homology-directed repair, and DNA methylation.

Directory of Open Access Journals (Sweden)

Concetta Cuozzo

2007-07-01

Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

cGAS Conducts Micronuclei DNA Surveillance.

Science.gov (United States)

de Oliveira Mann, Carina C; Kranzusch, Philip J

2017-10-01

DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

International Nuclear Information System (INIS)

Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

1976-01-01

Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

NARCIS (Netherlands)

van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

2008-01-01

Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

Science.gov (United States)

Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

2012-03-14

We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

Science.gov (United States)

Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

2017-12-14

Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

Science.gov (United States)

Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

2007-12-15

The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

International Nuclear Information System (INIS)

Waters, R.

1980-01-01

The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

NARCIS (Netherlands)

Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

2016-01-01

We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

Science.gov (United States)

Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

2003-10-01

Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

Counterion effects on nano-confined metal–drug–DNA complexes

Directory of Open Access Journals (Sweden)

Nupur Biswas

2016-01-01

Full Text Available We have explored morphology of DNA molecules bound with Cu complexes of piroxicam (a non-steroidal anti-inflammatory drug molecules under one-dimensional confinement of thin films and have studied the effect of counterions present in a buffer. X-ray reflectivity at and away from the Cu K absorption edge and atomic force microscopy studies reveal that confinement segregates the drug molecules preferentially in a top layer of the DNA film, and counterions enhance this segregation.

A general approach to break the concentration barrier in single-molecule imaging

KAUST Repository

Loveland, Anna B.

2012-09-09

Single-molecule fluorescence imaging is often incompatible with physiological protein concentrations, as fluorescence background overwhelms an individual molecule\\'s signal. We solve this problem with a new imaging approach called PhADE (PhotoActivation, Diffusion and Excitation). A protein of interest is fused to a photoactivatable protein (mKikGR) and introduced to its surface-immobilized substrate. After photoactivation of mKikGR near the surface, rapid diffusion of the unbound mKikGR fusion out of the detection volume eliminates background fluorescence, whereupon the bound molecules are imaged. We labeled the eukaryotic DNA replication protein flap endonuclease 1 with mKikGR and added it to replication-competent Xenopus laevis egg extracts. PhADE imaging of high concentrations of the fusion construct revealed its dynamics and micrometer-scale movements on individual, replicating DNA molecules. Because PhADE imaging is in principle compatible with any photoactivatable fluorophore, it should have broad applicability in revealing single-molecule dynamics and stoichiometry of macromolecular protein complexes at previously inaccessible fluorophore concentrations. © 2012 Nature America, Inc. All rights reserved.

Conserved linear dynamics of single-molecule Brownian motion

KAUST Repository

Serag, Maged F.

2017-06-06

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

Science.gov (United States)

Serag, Maged F.; Habuchi, Satoshi

2017-06-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

KAUST Repository

Serag, Maged F.; Habuchi, Satoshi

2017-01-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

Science.gov (United States)

Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

2018-01-01

Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

Science.gov (United States)

Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

2017-11-01

The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

Multiplex single-molecule interaction profiling of DNA barcoded proteins

Science.gov (United States)

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

Science.gov (United States)

Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

2017-08-04

Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

Directory of Open Access Journals (Sweden)

Ilko Bald

2014-09-01

Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

DEFF Research Database (Denmark)

Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

2016-01-01

A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

Molecules and morphology reveal cryptic variation among digeneans infecting sympatric mullets in the Mediterranean

Czech Academy of Sciences Publication Activity Database

Blasco-Costa, I.; Balbuena, J. A.; Raga, J. A.; Kostadinova, Aneta; Olson, P. D.

2010-01-01

Roč. 137, č. 2 (2010), s. 287-302 ISSN 0031-1820 R&D Projects: GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Digenea * Haploporidae * Saccocoelium * Mugilidae * cryptic species * molecules * morphology * rDNA Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 2.522, year: 2010

Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

Science.gov (United States)

Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

2018-01-01

Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

Supercoiled circular DNA of an insect granulosis virus.

Science.gov (United States)

Tweeten, K A; Bulla, L A; Consigli, R A

1977-08-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

A screening-corrected additivity rule for the calculation of electron scattering from macro-molecules

International Nuclear Information System (INIS)

Blanco, F; Garcia, G

2009-01-01

A simplified form of the well-known screening-corrected additivity rule procedure for the calculation of electron-molecule cross sections is proposed for the treatment of some very large macro-molecules. While the comparison of the standard and simplified treatments for a DNA dodecamer reveals very similar results, the new treatment presents some important advantages for large molecules.

Size distribution of DNA molecules recovered from non-denaturing filter elution

International Nuclear Information System (INIS)

Bloecher, D.; Iliakis, G.

1991-01-01

DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

Revealing time bunching effect in single-molecule enzyme conformational dynamics.

Science.gov (United States)

Lu, H Peter

2011-04-21

In this perspective, we focus our discussion on how the single-molecule spectroscopy and statistical analysis are able to reveal enzyme hidden properties, taking the study of T4 lysozyme as an example. Protein conformational fluctuations and dynamics play a crucial role in biomolecular functions, such as in enzymatic reactions. Single-molecule spectroscopy is a powerful approach to analyze protein conformational dynamics under physiological conditions, providing dynamic perspectives on a molecular-level understanding of protein structure-function mechanisms. Using single-molecule fluorescence spectroscopy, we have probed T4 lysozyme conformational motions under the hydrolysis reaction of a polysaccharide of E. coli B cell walls by monitoring the fluorescence resonant energy transfer (FRET) between a donor-acceptor probe pair tethered to T4 lysozyme domains involving open-close hinge-bending motions. Based on the single-molecule spectroscopic results, molecular dynamics simulation, a random walk model analysis, and a novel 2D statistical correlation analysis, we have revealed a time bunching effect in protein conformational motion dynamics that is critical to enzymatic functions. Bunching effect implies that conformational motion times tend to bunch in a finite and narrow time window. We show that convoluted multiple Poisson rate processes give rise to the bunching effect in the enzymatic reaction dynamics. Evidently, the bunching effect is likely common in protein conformational dynamics involving in conformation-gated protein functions. In this perspective, we will also discuss a new approach of 2D regional correlation analysis capable of analyzing fluctuation dynamics of complex multiple correlated and anti-correlated fluctuations under a non-correlated noise background. Using this new method, we are able to map out any defined segments along the fluctuation trajectories and determine whether they are correlated, anti-correlated, or non-correlated; after which, a

Structure of DNA-Cationic Surfactant Complexes at Hydrophobically Modified and Hydrophilic Silica Surfaces as Revealed by Neutron Reflectometry

DEFF Research Database (Denmark)

Cardenas Gomez, Marite; Wacklin, Hanna; Campbell, Richard A.

2011-01-01

with dodecyltrimethylammonium bromide (DTAB) and hexadecyltrimethylammonium bromide (CTAB) on hydrophobic surfaces, where we show that DNA molecules are located on top of a self-assembled surfactant monolayer, with the thickness of the DNA layer and the surfactant DNA ratio determined by the surface coverage of the underlying...... interfacial structures, a higher concentration in relation to its cmc is required for the more soluble DTAB surfactant with a shorter alkyl chain than for CTAB. Our results suggest that the DNA Molecules Will spontaneously form a relatively dense, thin layer on top of a surfactant monolayer (hydrophobic...... surface) or a layer of admicelles (hydrophilic surface) as long as the surface concentration of surfactant is great enough to ensure a high interfacial-charge density. These findings have implications for bioanalytical and nanotechnology applications, which require the deposition of DNA layers with well...

DNA nanochannels [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Dianming Wang

2017-04-01

Full Text Available Transmembrane proteins are mostly nanochannels playing a highly important role in metabolism. Understanding their structures and functions is vital for revealing life processes. It is of fundamental interest to develop chemical devices to mimic biological channels. Structural DNA nanotechnology has been proven to be a promising method for the preparation of fine DNA nanochannels as a result of the excellent properties of DNA molecules. This review presents the development history and current situation of three different types of DNA nanochannel: tile-based nanotube, DNA origami nanochannel, and DNA bundle nanochannel.

Electronic properties and assambly of DNA-based molecules on gold surfaces

DEFF Research Database (Denmark)

Salvatore, Princia

, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

KAUST Repository

Shirbini, Afnan

2017-05-01

Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

Energy Technology Data Exchange (ETDEWEB)

Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

2016-10-12

Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

Science.gov (United States)

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

KAUST Repository

Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

2017-01-01

Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

Science.gov (United States)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

Charge transport properties of a twisted DNA molecule: A renormalization approach

Energy Technology Data Exchange (ETDEWEB)

Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

2016-10-20

In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

DNA exit ramps are revealed in the binding landscapes obtained from simulations in helical coordinates.

Directory of Open Access Journals (Sweden)

Ignacia Echeverria

2015-02-01

Full Text Available DNA molecules are highly charged semi-flexible polymers that are involved in a wide variety of dynamical processes such as transcription and replication. Characterizing the binding landscapes around DNA molecules is essential to understanding the energetics and kinetics of various biological processes. We present a curvilinear coordinate system that fully takes into account the helical symmetry of a DNA segment. The latter naturally allows to characterize the spatial organization and motions of ligands tracking the minor or major grooves, in a motion reminiscent of sliding. Using this approach, we performed umbrella sampling (US molecular dynamics (MD simulations to calculate the three-dimensional potentials of mean force (3D-PMFs for a Na+ cation and for methyl guanidinium, an arginine analog. The computed PMFs show that, even for small ligands, the free energy landscapes are complex. In general, energy barriers of up to ~5 kcal/mol were measured for removing the ligands from the minor groove, and of ~1.5 kcal/mol for sliding along the minor groove. We shed light on the way the minor groove geometry, defined mainly by the DNA sequence, shapes the binding landscape around DNA, providing heterogeneous environments for recognition by various ligands. For example, we identified the presence of dissociation points or "exit ramps" that naturally would terminate sliding. We discuss how our findings have important implications for understanding how proteins and ligands associate and slide along DNA.

Radiation damage of DNA. Model for direct ionization of DNA

International Nuclear Information System (INIS)

Kobayashi, Kazuo; Tagawa, Seiichi

2004-01-01

Current aspects of radiation damage of DNA, particularly induced by the direct effect of radiation, and author's method of pulse radiolysis are described in relation to behavior of ions formed by radiation and active principles to induce the strand break. In irradiation of DNA solution in water, the direct effect of radiation is derived from ionization of DNA itself and indirect one, from the reaction between DNA and radicals generated from water molecules and the former direct one has been scarcely investigated due to difficulty of experimental approach. Radicals generated in sugar moiety of DNA are shown important in the strand break by recent studies on crystalline DNA irradiated by X-ray, DNA solution by electron and photon beams, hydrated DNA by γ-ray and by high linear energy transfer (LET) ion. Author's pulse radiolysis studies have revealed behaviors of guanine and adenine radical cations in dynamics of DNA oxidation. Since reactions described are the model, the experimental approach is thought necessary for elucidation of the actually occurring DNA damage in living cells. (N.I.)

Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

Science.gov (United States)

Kühnemund, M; Nilsson, M

2015-05-15

Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

Real-time monitoring and manipulation of single bio-molecules in free solution

Energy Technology Data Exchange (ETDEWEB)

Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)

2005-01-01

The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored

Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

Directory of Open Access Journals (Sweden)

Haowei Wang

Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

Science.gov (United States)

Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

2018-01-01

Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

Science.gov (United States)

Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

2018-01-10

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

Science.gov (United States)

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-10-30

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

DNA barcoding reveals a cryptic nemertean invasion in Atlantic and Mediterranean waters

Science.gov (United States)

Fernández-Álvarez, Fernando Ángel; Machordom, Annie

2013-09-01

For several groups, like nemerteans, morphology-based identification is a hard discipline, but DNA barcoding may help non-experts in the identification process. In this study, DNA barcoding is used to reveal the cryptic invasion of Pacific Cephalothrix cf. simula into Atlantic and Mediterranean coasts. Although DNA barcoding is a promising method for the identification of Nemertea, only 6 % of the known number of nemertean species is currently associated with a correct DNA barcode. Therefore, additional morphological and molecular studies are necessary to advance the utility of DNA barcoding in the characterisation of possible nemertean alien invasions.

The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

International Nuclear Information System (INIS)

Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

2008-01-01

We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease

Energy Technology Data Exchange (ETDEWEB)

Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki

1980-09-19

Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.

Studying DNA Looping by Single-Molecule FRET

OpenAIRE

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives

Science.gov (United States)

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-01

The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.

Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

KAUST Repository

Raducanu, Vlad-Stefan

2016-05-01

Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices

Science.gov (United States)

Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.

2013-01-01

In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

Science.gov (United States)

Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

2015-04-01

DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

Directory of Open Access Journals (Sweden)

T Banerjee

Full Text Available DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM and spectroscopy (AFS. The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

Science.gov (United States)

Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

Conformational changes in DNA gyrase revealed by limited proteolysis

DEFF Research Database (Denmark)

Kampranis, S C; Maxwell, A

1998-01-01

We have used limited proteolysis to identify conformational changes in DNA gyrase. Gyrase exhibits a proteolytic fingerprint dominated by two fragments, one of approximately 62 kDa, deriving from the A protein, and another of approximately 25 kDa from the B protein. Quinolone binding to the enzyme......-DNA intermediate by calcium ions does not reveal any protection, suggesting that the quinolone-induced conformational change is different from an "open-gate" state of the enzyme. A quinolone-resistant mutant of gyrase fails to give the characteristic quinolone-associated proteolytic signature. The ATP...... does not prevent dimerization since incubation of the enzyme-DNA complex with both ADPNP and quinolones gives rise to a complex whose proteolytic pattern retains the characteristic signature of dimerization but has lost the quinolone-induced protection. As a result, the quinolone-gyrase complex can...

Loading dynamics of a sliding DNA clamp.

KAUST Repository

Cho, Won-Ki; Jergic, Slobodan; Kim, Daehyung; Dixon, Nicholas E; Lee, Jong-Bong

2014-01-01

8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.

Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

Science.gov (United States)

Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

2014-05-01

Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

1989-07-11

Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

Hysteresis in pressure-driven DNA denaturation.

Directory of Open Access Journals (Sweden)

Enrique Hernández-Lemus

Full Text Available In the past, a great deal of attention has been drawn to thermal driven denaturation processes. In recent years, however, the discovery of stress-induced denaturation, observed at the one-molecule level, has revealed new insights into the complex phenomena involved in the thermo-mechanics of DNA function. Understanding the effect of local pressure variations in DNA stability is thus an appealing topic. Such processes as cellular stress, dehydration, and changes in the ionic strength of the medium could explain local pressure changes that will affect the molecular mechanics of DNA and hence its stability. In this work, a theory that accounts for hysteresis in pressure-driven DNA denaturation is proposed. We here combine an irreversible thermodynamic approach with an equation of state based on the Poisson-Boltzmann cell model. The latter one provides a good description of the osmotic pressure over a wide range of DNA concentrations. The resulting theoretical framework predicts, in general, the process of denaturation and, in particular, hysteresis curves for a DNA sequence in terms of system parameters such as salt concentration, density of DNA molecules and temperature in addition to structural and configurational states of DNA. Furthermore, this formalism can be naturally extended to more complex situations, for example, in cases where the host medium is made up of asymmetric salts or in the description of the (helical-like charge distribution along the DNA molecule. Moreover, since this study incorporates the effect of pressure through a thermodynamic analysis, much of what is known from temperature-driven experiments will shed light on the pressure-induced melting issue.

Radiation-induced DNA damage as a function of DNA hydration

International Nuclear Information System (INIS)

Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.

1995-01-01

Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage

Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

International Nuclear Information System (INIS)

Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

2004-01-01

Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives.

Science.gov (United States)

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-15

The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

Science.gov (United States)

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

Science.gov (United States)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

International Nuclear Information System (INIS)

Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

2011-01-01

To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

In silico single-molecule manipulation of DNA with rigid body dynamics.

Directory of Open Access Journals (Sweden)

Pascal Carrivain

2014-02-01

Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

PDB4DNA: Implementation of DNA geometry from the Protein Data Bank (PDB) description for Geant4-DNA Monte-Carlo simulations

Science.gov (United States)

Delage, E.; Pham, Q. T.; Karamitros, M.; Payno, H.; Stepan, V.; Incerti, S.; Maigne, L.; Perrot, Y.

2015-07-01

This paper describes PDB4DNA, a new Geant4 user application, based on an independent, cross-platform, free and open source C++ library, so-called PDBlib, which enables use of atomic level description of DNA molecule in Geant4 Monte Carlo particle transport simulations. For the evaluation of direct damage induced on the DNA molecule by ionizing particles, the application makes use of an algorithm able to determine the closest atom in the DNA molecule to energy depositions. Both the PDB4DNA application and the PDBlib library are available as free and open source under the Geant4 license.

Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

Science.gov (United States)

Hatlo, Marius M.; Panja, Debabrata; van Roij, René

2011-08-01

Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

Science.gov (United States)

Yonetani, Yoshiteru; Kono, Hidetoshi

2009-01-01

Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

Energy Technology Data Exchange (ETDEWEB)

Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2015-01-07

Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

Spectroscopic study of site selective DNA damage induced by intense soft X-rays

CERN Document Server

Fujii, K

2003-01-01

To investigate the mechanisms of DNA damage induced by direct photon impact, we observed the near edge X-ray absorption fine structures (NEXAFS) of DNA nucleobases using monochromatic synchrotron soft X-rays around nitrogen and oxygen K-shell excitation regions. Each spectrum obtained has unique structure corresponding to pi* excitation of oxygen or nitrogen 1s electron. These aspects open a way of nucleobase-selective photo-excitation in a DNA molecule using high resolution monochromatized soft X-rays. From the analysis of polarization-dependent intensities of the pi* resonance peak, it is clarified that adenine, guanine an uracil form orientated surface structure. Furthermore from the direct measurement of positive ions desorbed from photon irradiated DNA components, it is revealed that the sugar moiety is a fragile site in a DNA molecule. (author)

DNA-binding activity of TNF-α inducing protein from Helicobacter pylori

International Nuclear Information System (INIS)

Kuzuhara, T.; Suganuma, M.; Oka, K.; Fujiki, H.

2007-01-01

Tumor necrosis factor-α (TNF-α) inducing protein (Tipα) is a carcinogenic factor secreted from Helicobacter pylori (H. pylori), mediated through both enhanced expression of TNF-α and chemokine genes and activation of nuclear factor-κB. Since Tipα enters gastric cancer cells, the Tipα binding molecules in the cells should be investigated. The direct DNA-binding activity of Tipα was observed by pull down assay using single- and double-stranded genomic DNA cellulose. The surface plasmon resonance assay, indicating an association between Tipα and DNA, revealed that the affinity of Tipα for (dGdC)10 is 2400 times stronger than that of del-Tipα, an inactive Tipα. This suggests a strong correlation between DNA-binding activity and carcinogenic activity of Tipα. And the DNA-binding activity of Tipα was first demonstrated with a molecule secreted from H. pylori

Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors

Science.gov (United States)

Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.

2011-09-01

DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.

Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

DEFF Research Database (Denmark)

Olsen, Eva Maria

2012-01-01

Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.

Science.gov (United States)

Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro

2017-10-03

Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Synthesis and DNA-binding study of imidazole linked thiazolidinone derivatives.

Science.gov (United States)

War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

2017-02-01

A novel series of imidazole-linked thiazolidinone hybrid molecules were designed and synthesized through a feasible synthetic protocol. The molecules were characterized with Fourier transform infrared (FT-IR), 1 H nuclear magnetic resonance (NMR), 13 C NMR and high-resolution mass spectrometry (HRMS) techniques. In vitro susceptibility tests against Gram-positive (S. aureus and B. subtilis) and Gram-negative bacteria (E. coli and P. aeruginosa) gave highly promising results. The most active molecule (3e) gave a minimal inhibitory concentration (MIC) value of 3.125 μg/mL which is on par with the reference drug streptomycin. Structure-activity relationships revealed activity enhancement by nitro and chloro groups when they occupied meta position of the arylidene ring in 2-((3-(imidazol-1-yl)propyl)amino)-5-benzylidenethiazolidin-4-ones. DNA-binding study of the most potent molecule 3e with salmon milt DNA (sm-DNA) under simulated physiological pH was probed with UV-visible absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. These studies established that compound 3e has a strong affinity towards DNA and binds at DNA minor groove with a binding constant (K b ) 0.18 × 10 2  L mol -1 . Molecular docking simulations predicted strong affinity of 3e towards DNA with a binding affinity (ΔG) -8.5 kcal/mol. Van der Waals forces, hydrogen bonding and hydrophobic interactions were predicted as the main forces of interaction. The molecule 3e exhibited specific affinity towards adenine-thiamine base pairs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Cooperative assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: a molecular dynamics simulation study.

Directory of Open Access Journals (Sweden)

Guihong Wang

Full Text Available Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far.In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4 models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4 with DNA molecule.The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus.

Quantitative measurement of water diffusion lifetimes at a protein/DNA interface by NMR

International Nuclear Information System (INIS)

Gruschus, James M.; Ferretti, James A.

2001-01-01

Hydration site lifetimes of slowly diffusing water molecules at the protein/DNA interface of the vnd/NK-2 homeodomain DNA complex were determined using novel three-dimensional NMR techniques. The lifetimes were calculated using the ratios of ROE and NOE cross-relaxation rates between the water and the protein backbone and side chain amides. This calculation of the lifetimes is based on a model of the spectral density function of the water-protein interaction consisting of three timescales of motion: fast vibrational/rotational motion, diffusion into/out of the hydration site, and overall macromolecular tumbling. The lifetimes measured ranged from approximately 400 ps to more than 5 ns, and nearly all the slowly diffusing water molecules detected lie at the protein/DNA interface. A quantitative analysis of relayed water cross-relaxation indicated that even at very short mixing times, 5 ms for ROESY and 12 ms for NOESY, relay of magnetization can make a small but detectable contribution to the measured rates. The temperature dependences of the NOE rates were measured to help discriminate direct dipolar cross-relaxation from chemical exchange. Comparison with several X-ray structures of homeodomain/DNA complexes reveals a strong correspondence between water molecules in conserved locations and the slowly diffusing water molecules detected by NMR. A homology model based on the X-ray structures was created to visualize the conserved water molecules detected at the vnd/NK-2 homeodomain DNA interface. Two chains of water molecules are seen at the right and left sides of the major groove, adjacent to the third helix of the homeodomain. Two water-mediated hydrogen bond bridges spanning the protein/DNA interface are present in the model, one between the backbone of Phe8 and a DNA phosphate, and one between the side chain of Asn51 and a DNA phosphate. The hydrogen bond bridge between Asn51 and the DNA might be especially important since the DNA contact made by the invariant

Ancient DNA Reveals Late Pleistocene Existence of Ostriches in Indian Sub-Continent.

Directory of Open Access Journals (Sweden)

Sonal Jain

Full Text Available Ancient DNA (aDNA analysis of extinct ratite species is of considerable interest as it provides important insights into their origin, evolution, paleogeographical distribution and vicariant speciation in congruence with continental drift theory. In this study, DNA hotspots were detected in fossilized eggshell fragments of ratites (dated ≥25000 years B.P. by radiocarbon dating using confocal laser scanning microscopy (CLSM. DNA was isolated from five eggshell fragments and a 43 base pair (bp sequence of a 16S rRNA mitochondrial-conserved region was successfully amplified and sequenced from one of the samples. Phylogenetic analysis of the DNA sequence revealed a 92% identity of the fossil eggshells to Struthio camelus and their position basal to other palaeognaths, consistent with the vicariant speciation model. Our study provides the first molecular evidence for the presence of ostriches in India, complementing the continental drift theory of biogeographical movement of ostriches in India, and opening up a new window into the evolutionary history of ratites.

DNA nanotechnology-enabled biosensors.

Science.gov (United States)

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

Science.gov (United States)

Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

2018-01-23

Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

Science.gov (United States)

Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

2015-03-01

Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

DNA Open states and DNA hydratation

International Nuclear Information System (INIS)

Lema-Larre, B. de; Martin-Landrove, M

1995-01-01

It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

A programmable DNA origami nanospring that reveals force-induced adjacent binding of myosin VI heads.

Science.gov (United States)

Iwaki, M; Wickham, S F; Ikezaki, K; Yanagida, T; Shih, W M

2016-12-12

Mechanosensitive biological nanomachines such as motor proteins and ion channels regulate diverse cellular behaviour. Combined optical trapping with single-molecule fluorescence imaging provides a powerful methodology to clearly characterize the mechanoresponse, structural dynamics and stability of such nanomachines. However, this system requires complicated experimental geometry, preparation and optics, and is limited by low data-acquisition efficiency. Here we develop a programmable DNA origami nanospring that overcomes these issues. We apply our nanospring to human myosin VI, a mechanosensory motor protein, and demonstrate nanometre-precision single-molecule fluorescence imaging of the individual motor domains (heads) under force. We observe force-induced transitions of myosin VI heads from non-adjacent to adjacent binding, which correspond to adapted roles for low-load and high-load transport, respectively. Our technique extends single-molecule studies under force and clarifies the effect of force on biological processes.

A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

Science.gov (United States)

Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario

2018-06-01

A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

Directory of Open Access Journals (Sweden)

Yaru Wang

Full Text Available BACKGROUND: It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. METHODOLOGY/PRINCIPAL FINDINGS: In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. CONCLUSIONS/SIGNIFICANCE: We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

Science.gov (United States)

Eernisse, D J

1992-04-01

DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

Fluorescence Microscopy of Nanochannel-Confined DNA.

Science.gov (United States)

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

International Nuclear Information System (INIS)

Yamamoto, Takatoki; Fujii, Teruo

2010-01-01

Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores.

Science.gov (United States)

Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit

2010-11-17

The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

Detection of urea-induced internal denaturation of dsDNA using solid-state nanopores

International Nuclear Information System (INIS)

Singer, Alon; Kuhn, Heiko; Frank-Kamenetskii, Maxim; Meller, Amit

2010-01-01

The ability to detect and measure dsDNA thermal fluctuations is of immense importance in understanding the underlying mechanisms responsible for transcription and replication regulation. We describe here the ability of solid-state nanopores to detect sub-nanometer changes in DNA structure as a result of chemically enhanced thermal fluctuations. In this study, we investigate the subtle changes in the mean effective diameter of a dsDNA molecule with 3-5 nm solid-state nanopores as a function of urea concentration and the DNA's AT content. Our studies reveal an increase in the mean effective diameter of a DNA molecule of approximately 0.6 nm at 8.7 M urea. In agreement with the mechanism of DNA local denaturation, we observe a sigmoid dependence of these effects on urea concentration. We find that the translocation times in urea are markedly slower than would be expected if the dynamics were governed primarily by viscous effects. Furthermore, we find that the sensitivity of the nanopore is sufficient to statistically differentiate between DNA molecules of nearly identical lengths differing only in sequence and AT content when placed in 3.5 M urea. Our results demonstrate that nanopores can detect subtle structural changes and are thus a valuable tool for detecting differences in biomolecules' environment.

The cytosolic DNA sensor cGAS forms an oligomeric complex with DNA and undergoes switch-like conformational changes in the activation loop.

Science.gov (United States)

Zhang, Xu; Wu, Jiaxi; Du, Fenghe; Xu, Hui; Sun, Lijun; Chen, Zhe; Brautigam, Chad A; Zhang, Xuewu; Chen, Zhijian J

2014-02-13

The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP) synthase (cGAS), which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

The Cytosolic DNA Sensor cGAS Forms an Oligomeric Complex with DNA and Undergoes Switch-like Conformational Changes in the Activation Loop

Directory of Open Access Journals (Sweden)

Xu Zhang

2014-02-01

Full Text Available The presence of DNA in the cytoplasm is a danger signal that triggers immune and inflammatory responses. Cytosolic DNA binds to and activates cyclic GMP-AMP (cGAMP synthase (cGAS, which produces the second messenger cGAMP. cGAMP binds to the adaptor protein STING and activates a signaling cascade that leads to the production of type I interferons and other cytokines. Here, we report the crystal structures of human cGAS in its apo form, representing its autoinhibited conformation as well as in its cGAMP- and sulfate-bound forms. These structures reveal switch-like conformational changes of an activation loop that result in the rearrangement of the catalytic site. The structure of DNA-bound cGAS reveals a complex composed of dimeric cGAS bound to two molecules of DNA. Functional analyses of cGAS mutants demonstrate that both the protein-protein interface and the two DNA binding surfaces are critical for cGAS activation. These results provide insights into the mechanism of DNA sensing by cGAS.

Close encounters with DNA

Science.gov (United States)

Maffeo, C.; Yoo, J.; Comer, J.; Wells, D. B.; Luan, B.; Aksimentiev, A.

2014-01-01

Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena and we review the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field. PMID:25238560

Close encounters with DNA.

Science.gov (United States)

Maffeo, C; Yoo, J; Comer, J; Wells, D B; Luan, B; Aksimentiev, A

2014-10-15

Over the past ten years, the all-atom molecular dynamics method has grown in the scale of both systems and processes amenable to it and in its ability to make quantitative predictions about the behavior of experimental systems. The field of computational DNA research is no exception, witnessing a dramatic increase in the size of systems simulated with atomic resolution, the duration of individual simulations and the realism of the simulation outcomes. In this topical review, we describe the hallmark physical properties of DNA from the perspective of all-atom simulations. We demonstrate the amazing ability of such simulations to reveal the microscopic physical origins of experimentally observed phenomena. We also discuss the frustrating limitations associated with imperfections of present atomic force fields and inadequate sampling. The review is focused on the following four physical properties of DNA: effective electric charge, response to an external mechanical force, interaction with other DNA molecules and behavior in an external electric field.

Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

KAUST Repository

Shirbini, Afnan

2017-01-01

and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

DNA interaction with platinum-based cytostatics revealed by DNA sequencing.

Science.gov (United States)

Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech

2017-12-15

The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors.

Science.gov (United States)

Adalsteinsson, Viktor A; Ha, Gavin; Freeman, Samuel S; Choudhury, Atish D; Stover, Daniel G; Parsons, Heather A; Gydush, Gregory; Reed, Sarah C; Rotem, Denisse; Rhoades, Justin; Loginov, Denis; Livitz, Dimitri; Rosebrock, Daniel; Leshchiner, Ignaty; Kim, Jaegil; Stewart, Chip; Rosenberg, Mara; Francis, Joshua M; Zhang, Cheng-Zhong; Cohen, Ofir; Oh, Coyin; Ding, Huiming; Polak, Paz; Lloyd, Max; Mahmud, Sairah; Helvie, Karla; Merrill, Margaret S; Santiago, Rebecca A; O'Connor, Edward P; Jeong, Seong H; Leeson, Rachel; Barry, Rachel M; Kramkowski, Joseph F; Zhang, Zhenwei; Polacek, Laura; Lohr, Jens G; Schleicher, Molly; Lipscomb, Emily; Saltzman, Andrea; Oliver, Nelly M; Marini, Lori; Waks, Adrienne G; Harshman, Lauren C; Tolaney, Sara M; Van Allen, Eliezer M; Winer, Eric P; Lin, Nancy U; Nakabayashi, Mari; Taplin, Mary-Ellen; Johannessen, Cory M; Garraway, Levi A; Golub, Todd R; Boehm, Jesse S; Wagle, Nikhil; Getz, Gad; Love, J Christopher; Meyerson, Matthew

2017-11-06

Whole-exome sequencing of cell-free DNA (cfDNA) could enable comprehensive profiling of tumors from blood but the genome-wide concordance between cfDNA and tumor biopsies is uncertain. Here we report ichorCNA, software that quantifies tumor content in cfDNA from 0.1× coverage whole-genome sequencing data without prior knowledge of tumor mutations. We apply ichorCNA to 1439 blood samples from 520 patients with metastatic prostate or breast cancers. In the earliest tested sample for each patient, 34% of patients have ≥10% tumor-derived cfDNA, sufficient for standard coverage whole-exome sequencing. Using whole-exome sequencing, we validate the concordance of clonal somatic mutations (88%), copy number alterations (80%), mutational signatures, and neoantigens between cfDNA and matched tumor biopsies from 41 patients with ≥10% cfDNA tumor content. In summary, we provide methods to identify patients eligible for comprehensive cfDNA profiling, revealing its applicability to many patients, and demonstrate high concordance of cfDNA and metastatic tumor whole-exome sequencing.

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

Science.gov (United States)

Nayak, Alpana; Suresh, K. A.

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

Energy Technology Data Exchange (ETDEWEB)

Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

2015-06-01

Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation

Science.gov (United States)

Zelensky, Alex N.; Sanchez, Humberto; Ristic, Dejan; Vidic, Iztok; van Rossum-Fikkert, Sari E.; Essers, Jeroen; Wyman, Claire; Kanaar, Roland

2013-01-01

Caffeine is a widely used inhibitor of the protein kinases that play a central role in the DNA damage response. We used chemical inhibitors and genetically deficient mouse embryonic stem cell lines to study the role of DNA damage response in stable integration of the transfected DNA and found that caffeine rapidly, efficiently and reversibly inhibited homologous integration of the transfected DNA as measured by several homologous recombination-mediated gene-targeting assays. Biochemical and structural biology experiments revealed that caffeine interfered with a pivotal step in homologous recombination, homologous joint molecule formation, through increasing interactions of the RAD51 nucleoprotein filament with non-homologous DNA. Our results suggest that recombination pathways dependent on extensive homology search are caffeine-sensitive and stress the importance of considering direct checkpoint-independent mechanisms in the interpretation of the effects of caffeine on DNA repair. PMID:23666627

A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

Science.gov (United States)

Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

2017-11-17

The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

Going Vertical To Improve the Accuracy of Atomic Force Microscopy Based Single-Molecule Force Spectroscopy.

Science.gov (United States)

Walder, Robert; Van Patten, William J; Adhikari, Ayush; Perkins, Thomas T

2018-01-23

Single-molecule force spectroscopy (SMFS) is a powerful technique to characterize the energy landscape of individual proteins, the mechanical properties of nucleic acids, and the strength of receptor-ligand interactions. Atomic force microscopy (AFM)-based SMFS benefits from ongoing progress in improving the precision and stability of cantilevers and the AFM itself. Underappreciated is that the accuracy of such AFM studies remains hindered by inadvertently stretching molecules at an angle while measuring only the vertical component of the force and extension, degrading both measurements. This inaccuracy is particularly problematic in AFM studies using double-stranded DNA and RNA due to their large persistence length (p ≈ 50 nm), often limiting such studies to other SMFS platforms (e.g., custom-built optical and magnetic tweezers). Here, we developed an automated algorithm that aligns the AFM tip above the DNA's attachment point to a coverslip. Importantly, this algorithm was performed at low force (10-20 pN) and relatively fast (15-25 s), preserving the connection between the tip and the target molecule. Our data revealed large uncorrected lateral offsets for 100 and 650 nm DNA molecules [24 ± 18 nm (mean ± standard deviation) and 180 ± 110 nm, respectively]. Correcting this offset yielded a 3-fold improvement in accuracy and precision when characterizing DNA's overstretching transition. We also demonstrated high throughput by acquiring 88 geometrically corrected force-extension curves of a single individual 100 nm DNA molecule in ∼40 min and versatility by aligning polyprotein- and PEG-based protein-ligand assays. Importantly, our software-based algorithm was implemented on a commercial AFM, so it can be broadly adopted. More generally, this work illustrates how to enhance AFM-based SMFS by developing more sophisticated data-acquisition protocols.

Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

International Nuclear Information System (INIS)

Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

1999-01-01

The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

Controlling the surface density of DNA on gold by electrically induced desorption.

Science.gov (United States)

Arinaga, Kenji; Rant, Ulrich; Knezević, Jelena; Pringsheim, Erika; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

2007-10-31

We report on a method to control the packing density of sulfur-bound oligonucleotide layers on metal electrodes by electrical means. In a first step, a dense nucleic acid layer is deposited by self-assembly from solution; in a second step, defined fractions of DNA molecules are released from the surface by applying a series of negative voltage cycles. Systematic investigations of the influence of the applied electrode potentials and oligonucleotide length allow us to identify a sharp desorption onset at -0.65 V versus Ag/AgCl, which is independent of the DNA length. Moreover, our results clearly show the pronounced influence of competitive adsorbents in solution on the desorption behavior, which can prevent the re-adsorption of released DNA molecules, thereby enhancing the desorption efficiency. The method is fully bio-compatible and can be employed to improve the functionality of DNA layers. This is demonstrated in hybridization experiments revealing almost perfect yields for electrically "diluted" DNA layers. The proposed control method is extremely beneficial to the field of DNA-based sensors.

Localized surface plasmon resonance (LSPR) study of DNA hybridization at single nanoparticle transducers

International Nuclear Information System (INIS)

Schneider, T.; Jahr, N.; Jatschka, J.; Csaki, A.; Stranik, O.; Fritzsche, W.

2013-01-01

The effect of DNA–DNA interaction on the localized surface plasmon resonance of single 80 nm gold nanoparticles is studied. Therefore, both the attachment of the capture DNA strands at the particle surface and the sequence-specific DNA binding (hybridization) of analyte DNA to the immobilized capture DNA is subject of investigations. The influence of substrate attachment chemistry, the packing density of DNA as controlled by an assisting layer of smaller molecules, and the distance as increased by a linker on the LSPR efficiency is investigated. The resulting changes in signal can be related to a higher hybridization efficiency of the analyte DNA to the immobilized capture DNA. The subsequent attachment of additional DNA strands to this system is studied, which allows for a multiple step detection of binding and an elucidation of the resulting resonance shifts. The detection limit was determined for the utilized DNA system by incubation with various concentration of analyte DNA. Although the method allows for a marker-free detection, we show that additional markers such as 20 nm gold particle labels increase the signal and thereby the sensitivity significantly. The study of resonance shift for various DNA lengths revealed that the resonance shift per base is stronger for shorter DNA molecules (20 bases) as compared to longer ones (46 bases).

Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

Directory of Open Access Journals (Sweden)

Zach Hensel

Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

International Nuclear Information System (INIS)

Gareev, F.A.; Gareeva, G.F.

2001-01-01

Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

International Nuclear Information System (INIS)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

2017-01-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

Science.gov (United States)

Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

2017-03-01

In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

Science.gov (United States)

Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

2005-01-01

Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

Limitations of superfluid helium droplets as host system revealed by electronic spectroscopy of embedded molecules

Energy Technology Data Exchange (ETDEWEB)

Premke, Tobias

2016-02-19

Superfluid helium nanodroplets serve a unique cryogenic host system ideal to prepare cold molecules and clusters. Structures as well as dynamic processes can be examined by means of high resolution spectroscopy. Dopant spectra are accompanied by helium-induced spectroscopic features which reveal information on the dopant to helium interaction. For this reason the experimental research focuses on the investigation of such helium-induced effects in order to provide new information on the microsolvation inside the droplets. Since the quantitative understanding of helium-induced spectral features is essential to interpret molecular spectra recorded in helium droplets, this study contributes further experimental details on microsolvation in superfluid helium droplets. For this purpose two contrary systems were examined by means of high resolution electronic spectroscopy. The first one, phthalocyanine (Pc), is a planar organic molecule offering a huge and planar surface to the helium atoms and thus, the non-superfluid helium solvation layer can form different structures. The second system is iodine and in contrast to Pc it is of simple molecular shape. That means that in this case different complex structures of the non-superfluid helium solvation layer and the dopant can be expected to be avoided. Thus, both molecules should show clear differences in their microsolvation behavior. In this work a detailed examination of different spectroscopic properties of phthalocyanine is given by means of fluorescence excitation and dispersed emission spectroscopy. It raises legitimate doubts about the assignment of experimentally observed signals to features predicted by the model of the microsolvation. Even though there are no experimental observations which disprove the empirical model for the solvation in helium droplets, an unambiguous assignment of the helium-induced spectroscopic structures is often not possible. In the second part of this work, the investigation of the

DNA residence time is a regulatory factor of transcription repression

Science.gov (United States)

Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette

2017-01-01

Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492

Sequence specificity of alkali-labile DNA damage photosensitized by suprofen.

Science.gov (United States)

Starrs, S M; Davies, R J

2000-09-01

On irradiation at UVB wavelengths, in aerated neutral aqueous solution, the anti-inflammatory drug suprofen (SP) photosensitizes the production of alkali-labile cleavage sites in DNA much more efficiently than direct strand breaks. It is active at submillimolar concentrations despite having no significant binding affinity for DNA. Gel sequencing studies utilizing 32P-end-labeled oligonucleotides have revealed that piperidine-sensitive lesions are formed predominantly at the positions of guanine (G) bases, with the extent of modification being UV dose- and SP concentration-dependent. Quite distinct patterns of G-specific damage are observed in single-stranded and duplex DNA molecules. The uniform attack at all G residues in single-stranded DNA, which is enhanced in D2O, is compatible with a Type-II mechanism. SP is a known generator of singlet oxygen whose participation in the reaction is supported by the effects of quenchers and scavengers. In duplex DNA, piperidine-induced cleavage occurs with high selectivity at the 5'-G of GG and (less prominently) GA doublets. This behavior is characteristic of a Type-I process involving electron transfer from DNA to photoexcited SP molecules. The ability of SP to sensitize the formation of Type-I and Type-II photo-oxidation products from 2'-deoxyguanosine attests to the feasibility of competing mechanisms in DNA.

Quantitive DNA Fiber Mapping

Energy Technology Data Exchange (ETDEWEB)

Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

2008-01-28

Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

DNA nanotechnology

Science.gov (United States)

Seeman, Nadrian C.; Sleiman, Hanadi F.

2018-01-01

DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

DNA maintenance in plastids and mitochondria of plants

Directory of Open Access Journals (Sweden)

Delene J Oldenburg

2015-10-01

Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.

Parental diabetes status reveals association of mitochondrial DNA haplogroup J1 with type 2 diabetes

Directory of Open Access Journals (Sweden)

Wainstein Julio

2009-06-01

Full Text Available Abstract Background Although mitochondrial dysfunction is consistently manifested in patients with Type 2 Diabetes mellitus (T2DM, the association of mitochondrial DNA (mtDNA sequence variants with T2DM varies among populations. These differences might stem from differing environmental influences among populations. However, other potentially important considerations emanate from the very nature of mitochondrial genetics, namely the notable high degree of partitioning in the distribution of human mtDNA variants among populations, as well as the interaction of mtDNA and nuclear DNA-encoded factors working in concert to govern mitochondrial function. We hypothesized that association of mtDNA genetic variants with T2DM could be revealed while controlling for the effect of additional inherited factors, reflected in family history information. Methods To test this hypothesis we set out to investigate whether mtDNA genetic variants will be differentially associated with T2DM depending on the diabetes status of the parents. To this end, association of mtDNA genetic backgrounds (haplogroups with T2DM was assessed in 1055 Jewish patients with and without T2DM parents ('DP' and 'HP', respectively. Results Haplogroup J1 was found to be 2.4 fold under-represented in the 'HP' patients (p = 0.0035. These results are consistent with a previous observation made in Finnish T2DM patients. Moreover, assessing the haplogroup distribution in 'DP' versus 'HP' patients having diabetic siblings revealed that haplogroup J1 was virtually absent in the 'HP' group. Conclusion These results imply the involvement of inherited factors, which modulate the susceptibility of haplogroup J1 to T2DM.

DNA polymorphisms revealed by the RAPD technique show differences between radionuclide-contaminated and uncontaminated mosquitofish populations

International Nuclear Information System (INIS)

Theodorakis, C.W.; Shugart, L.R.

1993-01-01

In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations

Single Molecule Nano-Metronome

Science.gov (United States)

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2008-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

Science.gov (United States)

Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

2017-10-01

We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA

Structure of the hDmc1-ssDNA filament reveals the principles of its architecture.

Directory of Open Access Journals (Sweden)

Andrei L Okorokov

Full Text Available In eukaryotes, meiotic recombination is a major source of genetic diversity, but its defects in humans lead to abnormalities such as Down's, Klinefelter's and other syndromes. Human Dmc1 (hDmc1, a RecA/Rad51 homologue, is a recombinase that plays a crucial role in faithful chromosome segregation during meiosis. The initial step of homologous recombination occurs when hDmc1 forms a filament on single-stranded (ss DNA. However the structure of this presynaptic complex filament for hDmc1 remains unknown. To compare hDmc1-ssDNA complexes to those known for the RecA/Rad51 family we have obtained electron microscopy (EM structures of hDmc1-ssDNA nucleoprotein filaments using single particle approach. The EM maps were analysed by docking crystal structures of Dmc1, Rad51, RadA, RecA and DNA. To fully characterise hDmc1-DNA complexes we have analysed their organisation in the presence of Ca2+, Mg2+, ATP, AMP-PNP, ssDNA and dsDNA. The 3D EM structures of the hDmc1-ssDNA filaments allowed us to elucidate the principles of their internal architecture. Similar to the RecA/Rad51 family, hDmc1 forms helical filaments on ssDNA in two states: extended (active and compressed (inactive. However, in contrast to the RecA/Rad51 family, and the recently reported structure of hDmc1-double stranded (ds DNA nucleoprotein filaments, the extended (active state of the hDmc1 filament formed on ssDNA has nine protomers per helical turn, instead of the conventional six, resulting in one protomer covering two nucleotides instead of three. The control reconstruction of the hDmc1-dsDNA filament revealed 6.4 protein subunits per helical turn indicating that the filament organisation varies depending on the DNA templates. Our structural analysis has also revealed that the N-terminal domain of hDmc1 accomplishes its important role in complex formation through domain swapping between adjacent protomers, thus providing a mechanistic basis for coordinated action of hDmc1 protomers

Function of the UVR marker in dark repair of DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

1975-01-01

It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.

DNA Repair Systems

Indian Academy of Sciences (India)

DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

Polymorphism and mutation analysis of genomic DNA on cancer

International Nuclear Information System (INIS)

Ohta, Tsutomu

2003-01-01

DNA repair is a universal process in living cells that maintains the structural integrity of chromosomal DNA molecules in face of damage. A deficiency in DNA damage repair is associated with an increased cancer risk by increasing a mutation frequency of cancer-related genes. Variation in DNA repair capacity may be genetically determined. Therefore, we searched single-nucleotide polymorphisms (SNPs) in major DNA repair genes. This led to the finding of 600 SNPs and mutations including many novel SNPs in Japanese population. Case-control studies to explore the contribution of the SNPs in DNA repair genes to the risk of lung cancer revealed that five SNPs are associated with lung carcinogenesis. One of these SNPs is found in RAD54L gene, which is involved in double-strand DNA repair. We analyzed and reported activities of Rad54L protein with SNP and mutations. (authors)

Next-generation sequencing offers new insights into DNA degradation

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Orlando, Ludovic Antoine Alexandre; Willerslev, Eske

2012-01-01

The processes underlying DNA degradation are central to various disciplines, including cancer research, forensics and archaeology. The sequencing of ancient DNA molecules on next-generation sequencing platforms provides direct measurements of cytosine deamination, depurination and fragmentation...... rates that previously were obtained only from extrapolations of results from in vitro kinetic experiments performed over short timescales. For example, recent next-generation sequencing of ancient DNA reveals purine bases as one of the main targets of postmortem hydrolytic damage, through base...... elimination and strand breakage. It also shows substantially increased rates of DNA base-loss at guanosine. In this review, we argue that the latter results from an electron resonance structure unique to guanosine rather than adenosine having an extra resonance structure over guanosine as previously suggested....

High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

Science.gov (United States)

Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

2015-08-01

Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

Science.gov (United States)

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

International Nuclear Information System (INIS)

Gareev, F.A.; Gareeva, G.F.

2001-01-01

Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

Science.gov (United States)

Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

2013-06-25

A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

Structural Transitions in Supercoiled Stretched DNA

Science.gov (United States)

v, Croquette

1998-03-01

Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

Single-molecule FRET unveils induced-fit mechanism for substrate selectivity in flap endonuclease 1

KAUST Repository

Rashid, Fahad

2017-02-23

Human flap endonuclease 1 (FEN1) and related structure-specific 5\\'nucleases precisely identify and incise aberrant DNA structures during replication, repair and recombination to avoid genomic instability. Yet, it is unclear how the 5\\'nuclease mechanisms of DNA distortion and protein ordering robustly mediate efficient and accurate substrate recognition and catalytic selectivity. Here, single-molecule sub-millisecond and millisecond analyses of FEN1 reveal a protein-DNA induced-fit mechanism that efficiently verifies substrate and suppresses off-target cleavage. FEN1 sculpts DNA with diffusion-limited kinetics to test DNA substrate. This DNA distortion mutually \\'locks\\' protein and DNA conformation and enables substrate verification with extreme precision. Strikingly, FEN1 never misses cleavage of its cognate substrate while blocking probable formation of catalytically competent interactions with noncognate substrates and fostering their pre-incision dissociation. These findings establish FEN1 has practically perfect precision and that separate control of induced-fit substrate recognition sets up the catalytic selectivity of the nuclease active site for genome stability.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

Science.gov (United States)

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Single Molecule Nano-Metronome

OpenAIRE

Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

2006-01-01

We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

Influence of amino acids Shiff bases on irradiated DNA stability in vivo.

Science.gov (United States)

Karapetyan, N H; Malakyan, M H; Bajinyan, S A; Torosyan, A L; Grigoryan, I E; Haroutiunian, S G

2013-01-01

To reveal protective role of the new Mn(II) complexes with Nicotinyl-L-Tyrosinate and Nicotinyl-L-Tryptophanate Schiff Bases against ionizing radiation. The DNA of the rats liver was isolated on 7, 14, and 30 days after X-ray irradiation. The differences between the DNA of irradiated rats and rats pre-treated with Mn(II) complexes were studied using the melting, microcalorimetry, and electrophoresis methods. The melting parameters and the melting enthalpy of rats livers DNA were changed after the X-ray irradiation: melting temperature and melting enthalpy were decreased and melting interval was increased. These results can be explained by destruction of DNA molecules. It was shown that pre-treatment of rats with Mn(II) complexes approximates the melting parameters to norm. Agarose gel electrophoresis data confirmed the results of melting studies. The separate DNA fragments were revealed in DNA samples isolated from irradiated animals. The DNA isolated from animals pre-treated with the Mn(II) chelates had better electrophoretic characteristics, which correspond to healthy DNA. Pre-treatment of the irradiated rats with Mn(II)(Nicotinil-L-Tyrosinate) and Mn(II)(Nicotinil-L-Tryptophanate)2 improves the DNA characteristics.

Modeling DNA

Science.gov (United States)

Robertson, Carol

2016-01-01

Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

Real-time single-molecule tethered particle motion experiments reveal the kinetics and mechanisms of Cre-mediated site-specific recombination

Science.gov (United States)

Fan, Hsiu-Fang

2012-01-01

Tyrosine family recombinases (YRs) are widely utilized in genome engineering systems because they can easily direct DNA rearrangement. Cre recombinases, one of the most commonly used types of YRs, catalyze site-specific recombination between two loxP sites without the need for high-energy cofactors, other accessory proteins or a specific DNA target sequence between the loxP sites. Previous structural, analytical ultracentrifuge and electrophoretic analyses have provided details of the reaction kinetics and mechanisms of Cre recombinase activity; whether there are reaction intermediates or side pathways involved has been left unaddressed. Using tethered particle motion (TPM), the Cre-mediated site-specific recombination process has been delineated, from beginning to end, at the single-molecule level, including the formation of abortive complexes and wayward complexes blocking inactive nucleoprotein complexes from entering the recombination process. Reversibility in the strand-cleavage/-ligation process and the formation of a thermally stable Holliday junction intermediate were observed within the Cre-mediated site-specific recombination process. Rate constants for each elementary step, which explain the overall reaction outcomes under various conditions, were determined. Taking the findings of this study together, they demonstrate the potential of single-molecule methodology as an alternative approach for exploring reaction mechanisms in detail. PMID:22467208

The elastic theory of a single DNA molecule

Indian Academy of Sciences (India)

methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

Concentrating and labeling genomic DNA in a nanofluidic array

DEFF Research Database (Denmark)

Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

2018-01-01

, however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-01-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

Science.gov (United States)

Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

2015-05-14

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

Science.gov (United States)

Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

2015-05-01

Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.

Science.gov (United States)

Rubinovich, Leonid; Polak, Micha

2013-05-08

Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.

Detection of DNA hybridizations using solid-state nanopores

International Nuclear Information System (INIS)

Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng

2010-01-01

We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

Detection of DNA hybridizations using solid-state nanopores

Energy Technology Data Exchange (ETDEWEB)

Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)

2010-08-20

We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

Directory of Open Access Journals (Sweden)

Francesco Gentile

2018-04-01

Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

Directory of Open Access Journals (Sweden)

Lindy L. Esterhuizen

2012-09-01

Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

3D DNA Crystals and Nanotechnology

Directory of Open Access Journals (Sweden)

Paul J. Paukstelis

2016-08-01

Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

Agarose gel electrophoresis for the separation of DNA fragments.

Science.gov (United States)

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

International Nuclear Information System (INIS)

An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

2007-01-01

We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

The structure of DNA by direct imaging

KAUST Repository

Marini, Monica

2015-08-28

The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

The structure of DNA by direct imaging

KAUST Repository

Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo M.

2015-01-01

The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

Design and Assembly of DNA Nano-Objects and 2D DNA Origami Arrays

Science.gov (United States)

Liu, Wenyan

DNA, which plays a central role in biology as the carrier of genetic information, is also an excellent candidate for structural nanotechnology. Researches have proven that a variety of complicated DNA assemblies, such as objects, 2D & 3D crystals, and nanomechanical devices, can be fabricated through the combination of robust branched DNA motifs and sticky ends. This dissertation focuses on the design and construction of DNA nano--objects and 2D DNA origami arrays. In this dissertation, we first describe the formation of a triangular species that has four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can combine a partial triangle with other strands to form a robust four--stranded molecule. By combining them with a novel three--domain molecule, we also demonstrate by AFM that these triangles can be self--assembled into a linear array. Second, we demonstrate our attempts to design and self--assemble 2D DNA origami arrays using several different strategies. Specifically, we introduce the self--assembly of 2D DNA origami lattices using a symmetric cross--like design. This design strategy resulted in a well--ordered woven latticework array with edge dimensions of 2--3 mum. This size is likely to be large enough to connect bottom-up methods of patterning with top--down approaches. Third, we illustrate the design and construction of DNA nano--objects for exploring the substrate preferences of topoisomerase (topo) II. We designed and fabricated four double rhombus--like DNA molecules, each of which contains a different conformation of crossover in the middle, as possible substrates to establish the structural preferences for topo II. We characterized the formation of each substrate molecule by gel electrophoresis. Finally, we study the effect of M13 DNA knotting on the formation of the DNA origami tiles. We demonstrate by atomic force microscopy (AFM) that knotted M13

An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

Science.gov (United States)

Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

2006-10-01

In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

Revealing −1 Programmed Ribosomal Frameshifting Mechanisms by Single-Molecule Techniques and Computational Methods

Directory of Open Access Journals (Sweden)

Kai-Chun Chang

2012-01-01

Full Text Available Programmed ribosomal frameshifting (PRF serves as an intrinsic translational regulation mechanism employed by some viruses to control the ratio between structural and enzymatic proteins. Most viral mRNAs which use PRF adapt an H-type pseudoknot to stimulate −1 PRF. The relationship between the thermodynamic stability and the frameshifting efficiency of pseudoknots has not been fully understood. Recently, single-molecule force spectroscopy has revealed that the frequency of −1 PRF correlates with the unwinding forces required for disrupting pseudoknots, and that some of the unwinding work dissipates irreversibly due to the torsional restraint of pseudoknots. Complementary to single-molecule techniques, computational modeling provides insights into global motions of the ribosome, whose structural transitions during frameshifting have not yet been elucidated in atomic detail. Taken together, recent advances in biophysical tools may help to develop antiviral therapies that target the ubiquitous −1 PRF mechanism among viruses.

Single-molecule visualization of Saccharomyces cerevisiae leading-strand synthesis reveals dynamic interaction between MTC and the replisome.

Science.gov (United States)

Lewis, Jacob S; Spenkelink, Lisanne M; Schauer, Grant D; Hill, Flynn R; Georgescu, Roxanna E; O'Donnell, Michael E; van Oijen, Antoine M

2017-10-03

The replisome, the multiprotein system responsible for genome duplication, is a highly dynamic complex displaying a large number of different enzyme activities. Recently, the Saccharomyces cerevisiae minimal replication reaction has been successfully reconstituted in vitro. This provided an opportunity to uncover the enzymatic activities of many of the components in a eukaryotic system. Their dynamic behavior and interactions in the context of the replisome, however, remain unclear. We use a tethered-bead assay to provide real-time visualization of leading-strand synthesis by the S. cerevisiae replisome at the single-molecule level. The minimal reconstituted leading-strand replisome requires 24 proteins, forming the CMG helicase, the Pol ε DNA polymerase, the RFC clamp loader, the PCNA sliding clamp, and the RPA single-stranded DNA binding protein. We observe rates and product lengths similar to those obtained from ensemble biochemical experiments. At the single-molecule level, we probe the behavior of two components of the replication progression complex and characterize their interaction with active leading-strand replisomes. The Minichromosome maintenance protein 10 (Mcm10), an important player in CMG activation, increases the number of productive replication events in our assay. Furthermore, we show that the fork protection complex Mrc1-Tof1-Csm3 (MTC) enhances the rate of the leading-strand replisome threefold. The introduction of periods of fast replication by MTC leads to an average rate enhancement of a factor of 2, similar to observations in cellular studies. We observe that the MTC complex acts in a dynamic fashion with the moving replisome, leading to alternating phases of slow and fast replication.

Mechanism of SOS PR-domain autoinhibition revealed by single-molecule assays on native protein from lysate.

Science.gov (United States)

Lee, Young Kwang; Low-Nam, Shalini T; Chung, Jean K; Hansen, Scott D; Lam, Hiu Yue Monatrice; Alvarez, Steven; Groves, Jay T

2017-04-28

The guanine nucleotide exchange factor (GEF) Son of Sevenless (SOS) plays a critical role in signal transduction by activating Ras. Here we introduce a single-molecule assay in which individual SOS molecules are captured from raw cell lysate using Ras-functionalized supported membrane microarrays. This enables characterization of the full-length SOS protein, which has not previously been studied in reconstitution due to difficulties in purification. Our measurements on the full-length protein reveal a distinct role of the C-terminal proline-rich (PR) domain to obstruct the engagement of allosteric Ras independently of the well-known N-terminal domain autoinhibition. This inhibitory role of the PR domain limits Grb2-independent recruitment of SOS to the membrane through binding of Ras·GTP in the SOS allosteric binding site. More generally, this assay strategy enables characterization of the functional behaviour of GEFs with single-molecule precision but without the need for purification.

Structure of DNA-Functionalized Dendrimer Nanoparticles

OpenAIRE

Kumar, Mattaparthi Venkata Satish; Maiti, Prabal K

2012-01-01

Atomistic molecular dynamics simulations have been carried out to reveal the characteristic features of ethylenediamine (EDA) cored protonated poly amido amine (PAMAM) dendrimers of generation 3 (G3) and 4 (G4) that are functionalized with single stranded DNAs (ssDNAs). The four ssDNA strands that are attached via alkythiolate [-S (CH2)6-] linker molecule to the free amine groups on the surface of the PAMAM dendrimers observed to undergo a rapid conformational change during the 25 ns long sim...

DNA-Based Applications in Nanobiotechnology

Directory of Open Access Journals (Sweden)

Khalid M. Abu-Salah

2010-01-01

Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

Characterizing DNA condensation and conformational changes in organic solvents.

Directory of Open Access Journals (Sweden)

Fuyou Ke

Full Text Available Organic solvents offer a new approach to formulate DNA into novel structures suitable for gene delivery. In this study, we examined the in situ behavior of DNA in N, N-dimethylformamide (DMF at low concentration via laser light scattering (LLS, TEM, UV absorbance and Zeta potential analysis. Results revealed that, in DMF, a 21bp oligonucleotide remained intact, while calf thymus DNA and supercoiled plasmid DNA were condensed and denatured. During condensation and denaturation, the size was decreased by a factor of 8-10, with calf thymus DNA forming spherical globules while plasmid DNA exhibited a toroid-like conformation. In the condensed state, DNA molecules were still able to release the counterions to be negatively charged, indicating that the condensation was mainly driven by the excluded volume interactions. The condensation induced by DMF was reversible for plasmid DNA but not for calf thymus DNA. When plasmid DNA was removed from DMF and resuspended in an aqueous solution, the DNA was quickly regained a double stranded configuration. These findings provide further insight into the behavior and condensation mechanism of DNA in an organic solvent and may aid in developing more efficient non-viral gene delivery systems.

Bacterial natural transformation by highly fragmented and damaged DNA

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

2013-01-01

for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

NARCIS (Netherlands)

Geertsema, Hylkje

2014-01-01

De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

The re-entrant cholesteric phase of DNA

Science.gov (United States)

Yevdokimov, Yu. M.; Skuridin, S. G.; Salyanov, V. I.; Semenov, S. V.; Shtykova, E. V.; Dadinova, L. A.; Kompanets, O. N.; Kats, E. I.

2017-07-01

The character of packing of double-stranded DNA molecules in particles of liquid-crystal dispersions formed as a result of the phase exclusion of DNA molecules from aqueous salt polyethylene glycol solutions has been estimated by comparing the circular dichroism (CD) spectra of these dispersions recorded at different osmotic pressures and temperatures. It is shown that the first cycle of heating of dispersion particles with hexagonally packed double-stranded DNA molecules leads to the occurrence of abnormal optical activity of these particles, which manifests itself in the form of a strong negative CD band, characteristic of DNA cholesterics. Moreover, subsequent cooling is accompanied by a further increase in the abnormal optical activity, which indicates the existence of the "hexagonal → cholesteric packing" phase transition, controlled by both the osmotic pressure of the solution and its temperature. The result obtained can be described in terms of "quasi-nematic" layers composed of orientationally ordered DNA molecules in the structure of dispersion particles. There are two possible ways of packing for these layers, which determine their hexagonal or cholesteric spatial structure. The second heating → cooling cycle confirms these results and is indicative of possible differences in the packing of double-stranded DNA molecules in the hexagonal phase, which depend on the osmotic pressure of the solution.

Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

Energy Technology Data Exchange (ETDEWEB)

Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

2003-01-01

Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

Conformation-dependent DNA attraction

Science.gov (United States)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

Single-molecule imaging reveals topological isomer-dependent diffusion by 4-armed star and dicyclic 8-shaped polymers

KAUST Repository

Habuchi, Satoshi

2015-04-21

Diffusion dynamics of topological isomers of polymer molecules was investigated at the single-molecule level in a melt state by employing the fluorophore-incorporated 4-armed star and the corresponding doubly-cyclized, 8-shaped poly(THF) chains. While the single-molecule fluorescence imaging experiment revealed that the diffusion of the 4-armed star polymer was described by a single Gaussian distribution, the diffusion of the 8-shaped polymer exhibited a double Gaussian distribution behaviour. We reasoned that the two 8-shaped polymeric isomers have distinct diffusion modes in the melt state, although ensemble-averaged experimental methods cannot detect differences in overall conformational state of the isomers. The single-molecule experiments suggested that one of the 8-shaped polymeric isomer, having the horizontally oriented form, causes an efficient threading with the linear matrix chains which leads to the slower diffusion compared with the corresponding 4-armed star polymer, while the other 8-shaped polymeric isomer, having the vertically oriented form, displayed faster diffusion by the suppression of effective threading with the linear matrix chains due to its contracted chain conformation.

Escherichia coli DNA polymerase I can disrupt G-quadruplex structures during DNA replication.

Science.gov (United States)

Teng, Fang-Yuan; Hou, Xi-Miao; Fan, San-Hong; Rety, Stephane; Dou, Shuo-Xing; Xi, Xu-Guang

2017-12-01

Non-canonical four-stranded G-quadruplex (G4) DNA structures can form in G-rich sequences that are widely distributed throughout the genome. The presence of G4 structures can impair DNA replication by hindering the progress of replicative polymerases (Pols), and failure to resolve these structures can lead to genetic instability. In the present study, we combined different approaches to address the question of whether and how Escherichia coli Pol I resolves G4 obstacles during DNA replication and/or repair. We found that E. coli Pol I-catalyzed DNA synthesis could be arrested by G4 structures at low protein concentrations and the degree of inhibition was strongly dependent on the stability of the G4 structures. Interestingly, at high protein concentrations, E. coli Pol I was able to overcome some kinds of G4 obstacles without the involvement of other molecules and could achieve complete replication of G4 DNA. Mechanistic studies suggested that multiple Pol I proteins might be implicated in G4 unfolding, and the disruption of G4 structures requires energy derived from dNTP hydrolysis. The present work not only reveals an unrealized function of E. coli Pol I, but also presents a possible mechanism by which G4 structures can be resolved during DNA replication and/or repair in E. coli. © 2017 Federation of European Biochemical Societies.

Radioprotection of DNA molecule by oxido-reduction's coenzymes

International Nuclear Information System (INIS)

Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

1978-01-01

The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

Phosphate vibrations as reporters of DNA hydration

Science.gov (United States)

Corcelli, Steven

The asymmetric phosphate stretch vibrational frequency is extraordinarily sensitive to its local solvent environment. Using density functional theory calculations on the model compound dimethyl phosphate, the asymmetric phosphate stretch vibrational frequency was found to shift linearly with the magnitude of an electric field along the symmetry axis of the PO2 moiety (i.e. the asymmetric phosphate stretch is an excellent linear vibrational Stark effect probe). With this linear relationship established, asymmetric phosphate stretch vibrational frequencies were computed during the course of a molecular dynamics simulation of fully hydrated DNA. Moreover, contributions to shifts in the frequencies from subpopulations of water molecules (e.g. backbone, minor groove, major groove, etc.) were calculated to reveal how phosphate vibrations report the onset of DNA hydration in experiments that vary the relative humidity of non-condensing (dry) DNA samples.

DNA adsorption and desorption on mica surface studied by atomic force microscopy

Energy Technology Data Exchange (ETDEWEB)

Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)

2011-05-15

The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

DNA adsorption and desorption on mica surface studied by atomic force microscopy

International Nuclear Information System (INIS)

Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang

2011-01-01

The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.

Phylogeny and patterns of diversity of goat mtDNA haplogroup A revealed by resequencing complete mitogenomes.

Directory of Open Access Journals (Sweden)

Maria Grazia Doro

Full Text Available We sequenced to near completion the entire mtDNA of 28 Sardinian goats, selected to represent the widest possible diversity of the most widespread mitochondrial evolutionary lineage, haplogroup (Hg A. These specimens were reporters of the diversity in the island but also elsewhere, as inferred from their affiliation to each of 11 clades defined by D-loop variation. Two reference sequences completed the dataset. Overall, 206 variations were found in the full set of 30 sequences, of which 23 were protein-coding non-synonymous single nucleotide substitutions. Many polymorphic sites within Hg A were informative for the reconstruction of its internal phylogeny. Bayesian and network clustering revealed a general similarity over the entire molecule of sequences previously assigned to the same D-loop clade, indicating evolutionarily meaningful lineages. Two major sister groupings emerged within Hg A, which parallel distinct geographical distributions of D-loop clades in extant stocks. The pattern of variation in protein-coding genes revealed an overwhelming role of purifying selection, with the quota of surviving variants approaching neutrality. However, a simple model of relaxation of selection for the bulk of variants here reported should be rejected. Non-synonymous diversity of Hg's A, B and C denoted that a proportion of variants not greater than that allowed in the wild was given the opportunity to spread into domesticated stocks. Our results also confirmed that a remarkable proportion of pre-existing Hg A diversity became incorporated into domestic stocks. Our results confirm clade A11 as a well differentiated and ancient lineage peculiar of Sardinia.

Preparation and self-folding of amphiphilic DNA origami.

Science.gov (United States)

Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

2015-03-01

Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA-polymerase induced by Herpesvirus papio (HVP) in cells of lymphoblastoid cultures derived from lymphomatous baboons. Report V.

Science.gov (United States)

Djachenko, A G; Lapin, B A

1981-01-01

A new DNA-polymerase was found in the cells of suspension lymphoblastoid cultures which produce lymphotropic baboon herpesvirus (HVP). This enzyme was isolated in a partially purified form. Some of its properties vary from those of other cellular DNA-polymerases. HVP-induced DNA-polymerase has a molecule weight of 160,000 and sedimentation coefficient of about 8 S. The enzyme is resistant to high salt concentration and N-ethylmaleimide, but it is very sensitive to phosphonoacetate. It effectively copies "activated" DNA and synthetic deoxyribohomopolymers. Attempts to reveal the DNA-polymerase activity in HVP virions were unsuccessful.

DNA under Force: Mechanics, Electrostatics, and Hydration

Directory of Open Access Journals (Sweden)

Jingqiang Li

2015-02-01

Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

Crystal Structure of the VapBC Toxin–Antitoxin Complex from Shigella flexneri Reveals a Hetero-Octameric DNA-Binding Assembly

DEFF Research Database (Denmark)

Dienemann, Christian; Bøggild, Andreas; Winther, Kristoffer S.

2011-01-01

the crystal structure of the intact Shigella flexneri VapBC TA complex, determined to 2.7 Å resolution. Both in solution and in the crystal structure, four molecules of each protein combine to form a large and globular hetero-octameric assembly with SpoVT/AbrB-type DNA-binding domains at each end and a total...

The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

NARCIS (Netherlands)

van den Berg, A.A.

2017-01-01

During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

Electrical conduction in 7 nm wires constructed on λ-DNA

International Nuclear Information System (INIS)

Lund, John; Dong Jianchun; Deng Zhaoxiang; Mao Chengde; Parviz, Babak A

2006-01-01

We examine the morphological and electrical characteristics of nanowires fabricated on DNA templates via palladium (Pd) reduction. λ-DNA molecules were stretched and aligned on a mica surface using a molecular combing technique, followed by an electroless deposition of palladium, resulting in formation of nanowires with nominal width of 7 nm. We investigated the size distribution of nanowires with atomic force microscopy and made electrical connections to the wires by metal evaporation through multiple shadow masks. Electrical characterization of the nanowires under various bias conditions, variable temperature, and with different contact metal work functions revealed a conduction mechanism resembling that of granular metals

Rapid purification of circular DNA by triplex-mediated affinity capture

Science.gov (United States)

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Genetic variation in Phoca vitulina (the harbour seal) revealed by DNA fingerprinting and RAPDs

NARCIS (Netherlands)

Kappe, A.L.; van de Zande, L.; Vedder, E.J.; Bijlsma, R.; van Delden, Wilke

Genetic variation in two harbour seal (Phoca vitulina) populations from the Dutch Wadden Sea and Scotland was examined by RAPD analysis and DNA fingerprinting. For comparison a population of grey seals (Halichoerus grypus) was studied. The RAPD method revealed a very low number of polymorphic bands.

Binding and thermodynamics of REV peptide-ctDNA interaction.

Science.gov (United States)

Upadhyay, Santosh Kumar

2017-03-01

The thermodynamics of DNA-ligand binding is important as it provides useful information to understand the details of binding processes. HIV-1 REV response element (RRE) located in the env coding region of the viral genome is reported to be well conserved across different HIV-1 isolates. In this study, the binding characteristics of Calf thymus DNA (ctDNA) and REV peptide from HIV-1 were investigated using spectroscopic (UV-visible, fluorescence, and circular dichroism (CD)) and isothermal titration calorimetric (ITC) techniques. Thermal stability and ligand binding properties of the ctDNA revealed that native ctDNA had a T m of 75.5 °C, whereas the ctDNA-REV peptide complex exhibited an incremental shift in the T m by 8 °C, indicating thermal stability of the complex. CD data indicated increased ellipticity due to large conformational changes in ctDNA molecule upon binding with REV peptide and two binding stoichiometric modes are apparent. The ctDNA experienced condensation due to large conformational changes in the presence of REV peptide and positive B→Ψ transition was observed at higher molar charge ratios. Fluorescence studies performed at several ligand concentrations revealed a gradual decrease in the fluorescence intensity of EtBr-bound ctDNA in response to increasing ligand concentrations. The fluorescence data further confirmed two stoichiometric modes of binding for ctDNA-REV peptide complex as previously observed with CD studies. The binding enthalpies were determined using ITC in the temperature range of 293 K-308 K. The ITC binding isotherm was exothermic at all temperatures examined, with low ΔH values indicating that the ctDNA-REV peptide interaction is driven largely by entropy. The heat capacity change (ΔC p ) was insignificant, an unusual finding in the area of DNA-peptide interaction studies. The variation in the values obtained for ΔH, ΔS, and ΔG with temperature further suggests that ctDNA-REV peptide interaction is entropically

Adult mitochondrial DNA depletion syndrome with mild manifestations

Directory of Open Access Journals (Sweden)

Josef Finsterer

2013-06-01

Full Text Available Mitochondrial DNA depletion syndrome (MDS is usually a severe disorder of infancy or childhood, due to a reduced copy number of mtDNA molecules. MDS with only mild, non-specific clinical manifestations and onset in adulthood has not been reported. A 47-year-old Caucasian female with short stature and a history of migraine, endometriosis, Crohn’s disease, C-cell carcinoma of the thyroid gland, and a family history positive for mitochondrial disorder (2 sisters, aunt, niece, developed day-time sleepiness, exercise intolerance, and myalgias in the lower-limb muscles since age 46y. She slept 9-10 hours during the night and 2 hours after lunch daily. Clinical exam revealed sore neck muscles, bilateral ptosis, and reduced Achilles tendon reflexes exclusively. Blood tests revealed hyperlipidemia exclusively. Nerve conduction studies, needle electromyography, and cerebral and spinal magnetic resonance imaging were non-informative. Muscle biopsy revealed detached lobulated fibers with subsarcolemmal accentuation of the NADH and SDH staining. Real-time polymerase chain reaction revealed depletion of the mtDNA down to 9% of normal. MDS may be associated with a mild phenotype in adults and may not significantly progress during the first year after onset. In an adult with hypersomnia, severe tiredness, exercise intolerance, and a family history positive for mitochondrial disorder, a MDS should be considered.

Mitochondrial DNA copy number threshold in mtDNA depletion myopathy.

Science.gov (United States)

Durham, S E; Bonilla, E; Samuels, D C; DiMauro, S; Chinnery, P F

2005-08-09

The authors measured the absolute amount of mitochondrial DNA (mtDNA) within single muscle fibers from two patients with thymidine kinase 2 (TK2) deficiency and two healthy controls. TK2 deficient fibers containing more than 0.01 mtDNA/microm3 had residual cytochrome c oxidase (COX) activity. This defines the minimum amount of wild-type mtDNA molecules required to maintain COX activity in skeletal muscle and provides an explanation for the mosaic histochemical pattern seen in patients with mtDNA depletion syndrome.

DNA-FET using carbon nanotube electrodes

International Nuclear Information System (INIS)

Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y

2006-01-01

We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages

Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

Energy Technology Data Exchange (ETDEWEB)

Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

2005-01-01

Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

Large branched self-assembled DNA complexes

International Nuclear Information System (INIS)

Tosch, Paul; Waelti, Christoph; Middelberg, Anton P J; Davies, A Giles

2007-01-01

Many biological molecules have been demonstrated to self-assemble into complex structures and networks by using their very efficient and selective molecular recognition processes. The use of biological molecules as scaffolds for the construction of functional devices by self-assembling nanoscale complexes onto the scaffolds has recently attracted significant attention and many different applications in this field have emerged. In particular DNA, owing to its inherent sophisticated self-organization and molecular recognition properties, has served widely as a scaffold for various nanotechnological self-assembly applications, with metallic and semiconducting nanoparticles, proteins, macromolecular complexes, inter alia, being assembled onto designed DNA scaffolds. Such scaffolds may typically contain multiple branch-points and comprise a number of DNA molecules selfassembled into the desired configuration. Previously, several studies have used synthetic methods to produce the constituent DNA of the scaffolds, but this typically constrains the size of the complexes. For applications that require larger self-assembling DNA complexes, several tens of nanometers or more, other techniques need to be employed. In this article, we discuss a generic technique to generate large branched DNA macromolecular complexes

Solvated protein–DNA docking using HADDOCK

International Nuclear Information System (INIS)

Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J.

2013-01-01

Interfacial water molecules play an important role in many aspects of protein–DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein–DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein–DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein–DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein–DNA complexes.

Solvated protein-DNA docking using HADDOCK

Energy Technology Data Exchange (ETDEWEB)

Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J., E-mail: a.m.j.j.bonvin@uu.nl [Utrecht University, Bijvoet Center for Biomolecular Research, Faculty of Science-Chemistry (Netherlands)

2013-05-15

Interfacial water molecules play an important role in many aspects of protein-DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein-DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein-DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein-DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein-DNA complexes.

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

International Nuclear Information System (INIS)

Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

2011-01-01

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

Science.gov (United States)

Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

2018-03-01

DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

DNA: Structure and function

DEFF Research Database (Denmark)

Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

1998-01-01

This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

Helical chirality: a link between local interactions and global topology in DNA.

Directory of Open Access Journals (Sweden)

Youri Timsit

Full Text Available DNA supercoiling plays a major role in many cellular functions. The global DNA conformation is however intimately linked to local DNA-DNA interactions influencing both the physical properties and the biological functions of the supercoiled molecule. Juxtaposition of DNA double helices in ubiquitous crossover arrangements participates in multiple functions such as recombination, gene regulation and DNA packaging. However, little is currently known about how the structure and stability of direct DNA-DNA interactions influence the topological state of DNA. Here, a crystallographic analysis shows that due to the intrinsic helical chirality of DNA, crossovers of opposite handedness exhibit markedly different geometries. While right-handed crossovers are self-fitted by sequence-specific groove-backbone interaction and bridging Mg(2+ sites, left-handed crossovers are juxtaposed by groove-groove interaction. Our previous calculations have shown that the different geometries result in differential stabilisation in solution, in the presence of divalent cations. The present study reveals that the various topological states of the cell are associated with different inter-segmental interactions. While the unstable left-handed crossovers are exclusively formed in negatively supercoiled DNA, stable right-handed crossovers constitute the local signature of an unusual topological state in the cell, such as the positively supercoiled or relaxed DNA. These findings not only provide a simple mechanism for locally sensing the DNA topology but also lead to the prediction that, due to their different tertiary intra-molecular interactions, supercoiled molecules of opposite signs must display markedly different physical properties. Sticky inter-segmental interactions in positively supercoiled or relaxed DNA are expected to greatly slow down the slithering dynamics of DNA. We therefore suggest that the intrinsic helical chirality of DNA may have oriented the early

The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

Science.gov (United States)

Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

2011-01-25

DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

Science.gov (United States)

Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

2016-01-01

In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

Conformation-dependent DNA attraction.

Science.gov (United States)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-06-21

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

Supercoil Formation During DNA Melting

Science.gov (United States)

Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

2009-03-01

Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

Live-cell microscopy reveals small molecule inhibitor effects on MAPK pathway dynamics.

Directory of Open Access Journals (Sweden)

Daniel J Anderson

Full Text Available Oncogenic mutations in the mitogen activated protein kinase (MAPK pathway are prevalent in human tumors, making this pathway a target of drug development efforts. Recently, ATP-competitive Raf inhibitors were shown to cause MAPK pathway activation via Raf kinase priming in wild-type BRaf cells and tumors, highlighting the need for a thorough understanding of signaling in the context of small molecule kinase inhibitors. Here, we present critical improvements in cell-line engineering and image analysis coupled with automated image acquisition that allow for the simultaneous identification of cellular localization of multiple MAPK pathway components (KRas, CRaf, Mek1 and Erk2. We use these assays in a systematic study of the effect of small molecule inhibitors across the MAPK cascade either as single agents or in combination. Both Raf inhibitor priming as well as the release from negative feedback induced by Mek and Erk inhibitors cause translocation of CRaf to the plasma membrane via mechanisms that are additive in pathway activation. Analysis of Erk activation and sub-cellular localization upon inhibitor treatments reveals differential inhibition and activation with the Raf inhibitors AZD628 and GDC0879 respectively. Since both single agent and combination studies of Raf and Mek inhibitors are currently in the clinic, our assays provide valuable insight into their effects on MAPK signaling in live cells.

Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

International Nuclear Information System (INIS)

Dusinska, Maria; Staruchova, Marta; Horska, Alexandra; Smolkova, Bozena; Collins, Andrew; Bonassi, Stefano; Volkovova, Katarina

2012-01-01

Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

Energy Technology Data Exchange (ETDEWEB)

Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

2012-08-01

Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

DNA confinement in nanochannels: physics and biological applications

DEFF Research Database (Denmark)

Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H

2012-01-01

in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...

Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

Directory of Open Access Journals (Sweden)

Kazuo Umemura

2016-10-01

Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

Control of electrical conduction in DNA using hole doping

Science.gov (United States)

Lee, Hea-Yeon; Taniguchi, Masateru; Yoo, K. H.; Otsuka, Youichi; Tanaka, Hidekazu; Kawai, Tomoji

2002-03-01

Control of electrical conduction in DNA using hole doping H.Y.Lee1, M.Taniguchi1, K.H.Yoo2, Y.Otsuka1 H.Tanaka1 and T.Kawai1 1The Institute of Scientific and Industrial Research(ISIR), Osaka University, Osaka, Japan. 2Department of Physics, Younsei University, Seoul, Korea Possible applications of DNA molecules in electronic devices and biosensors were suggested almost ten years ago A DNA structure containing a single type of base pair appears to be a good candidate for conduction along the \\x81E-electron clouds of the stacked bases. There have been lots of investigations on conduction mechanisms of the DNA molecules. However, it is not still clear whether the observed conductions of some DNA molecules come from motions of either ionic charges or other carriers. Although the basic mechanism for DNA-mediated charge transport should be understood for electronic applications, there have been divergent reports on its nature. And I will be present the research for the charge carrier conduction of DNA film under oxygen and iodine gas by using 10¡V100 nm gap. The doping studies using oxygen and iodine gas can provide a definite answer for the carrier conduction mechanism and also a possible method to control the carrier concentration in DNA molecules. Using oxygen and iodine adsorption experiments on the poly (dG)-poly (dC) DNA molecules, we will show that their conductance becomes increased easily by several orders of magnitudes due to the hole doping, which is a characteristic behavior of a p-type semiconductor. On the other hand, we will also show that the poly (dA) - poly (dT) DNA molecules behave as an n-type semiconductor. Our works indicate that the concentration and the type of carriers in the DNA molecules could be controlled using proper doping methods. We expect that this would be a major breakthrough in DNA-based nano-electronics, similar to the fact that the doped conductive has polyacetylene opened up a new field of electronics with exciting implications

Micropatterning stretched and aligned DNA for sequence-specific nanolithography

Science.gov (United States)

Petit, Cecilia Anna Paulette

Techniques for fabricating nanostructured materials can be categorized as either "top-down" or "bottom-up". Top-down techniques use lithography and contact printing to create patterned surfaces and microfluidic channels that can corral and organize nanoscale structures, such as molecules and nanorods in contrast; bottom-up techniques use self-assembly or molecular recognition to direct the organization of materials. A central goal in nanotechnology is the integration of bottom-up and top-down assembly strategies for materials development, device design; and process integration. With this goal in mind, we have developed strategies that will allow this integration by using DNA as a template for nanofabrication; two top-down approaches allow the placement of these templates, while the bottom-up technique uses the specific sequence of bases to pattern materials along each strand of DNA. Our first top-down approach, termed combing of molecules in microchannels (COMMIC), produces microscopic patterns of stretched and aligned molecules of DNA on surfaces. This process consists of passing an air-water interface over end adsorbed molecules inside microfabricated channels. The geometry of the microchannel directs the placement of the DNA molecules, while the geometry of the airwater interface directs the local orientation and curvature of the molecules. We developed another top-down strategy for creating micropatterns of stretched and aligned DNA using surface chemistry. Because DNA stretching occurs on hydrophobic surfaces, this technique uses photolithography to pattern vinyl-terminated silanes on glass When these surface-, are immersed in DNA solution, molecules adhere preferentially to the silanized areas. This approach has also proven useful in patterning protein for cell adhesion studies. Finally, we describe the use of these stretched and aligned molecules of DNA as templates for the subsequent bottom-up construction of hetero-structures through hybridization

On the electrostatics of DNA in chromatin

Directory of Open Access Journals (Sweden)

Klemen Bohinc

2016-02-01

Full Text Available We examine the interaction between DNA molecules immersed in an aqueous solution of oppositely charged, trivalent spermidine molecules. The DNA molecules are modeled as planar, likecharged surfaces immersed in an aqueous solution of multivalent, rod-like ions consisting of rigidly bonded point charges. An approximate field theory is used to determine the properties of this system from the weak to the intermediate through to the strong coupling regimes. In the weak coupling limit, the interaction between the charged surfaces is only repulsive, whereas in the intermediate coupling regime, the rod-like ions with spatial charge distribution can induce attractive force between the charged surfaces. In the strong coupling limit, the inter-ionic charge correlations induce attractive interaction at short separations between the surfaces. This theoretical study can give new insights in the problem of interaction between DNA molecules mediated by trivalent spermidine molecules.

Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.

Science.gov (United States)

Yang, Darren; Wong, Wesley P

2018-01-01

We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.

Counting molecules in cell-free DNA and single cells RNA

OpenAIRE

Karlsson, Kasper

2016-01-01

The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

Ionic conductivity, structural deformation, and programmable anisotropy of DNA origami in electric field.

Science.gov (United States)

Li, Chen-Yu; Hemmig, Elisa A; Kong, Jinglin; Yoo, Jejoong; Hernández-Ainsa, Silvia; Keyser, Ulrich F; Aksimentiev, Aleksei

2015-02-24

The DNA origami technique can enable functionalization of inorganic structures for single-molecule electric current recordings. Experiments have shown that several layers of DNA molecules, a DNA origami plate, placed on top of a solid-state nanopore is permeable to ions. Here, we report a comprehensive characterization of the ionic conductivity of DNA origami plates by means of all-atom molecular dynamics (MD) simulations and nanocapillary electric current recordings. Using the MD method, we characterize the ionic conductivity of several origami constructs, revealing the local distribution of ions, the distribution of the electrostatic potential and contribution of different molecular species to the current. The simulations determine the dependence of the ionic conductivity on the applied voltage, the number of DNA layers, the nucleotide content and the lattice type of the plates. We demonstrate that increasing the concentration of Mg(2+) ions makes the origami plates more compact, reducing their conductivity. The conductance of a DNA origami plate on top of a solid-state nanopore is determined by the two competing effects: bending of the DNA origami plate that reduces the current and separation of the DNA origami layers that increases the current. The latter is produced by the electro-osmotic flow and is reversible at the time scale of a hundred nanoseconds. The conductance of a DNA origami object is found to depend on its orientation, reaching maximum when the electric field aligns with the direction of the DNA helices. Our work demonstrates feasibility of programming the electrical properties of a self-assembled nanoscale object using DNA.

DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

Science.gov (United States)

Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

2017-01-11

DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

Biofouling-resilient nanoporous gold electrodes for DNA sensing.

Science.gov (United States)

Daggumati, Pallavi; Matharu, Zimple; Wang, Ling; Seker, Erkin

2015-09-01

Electrochemical nucleic acid sensors are promising tools for point-of-care diagnostic platforms with their facile integration with electronics and scalability. However, nucleic acid detection in complex biological fluids is challenging as biomolecules nonspecifically adsorb on the electrode surface and adversely affect the sensor performance by obscuring the transport of analytes and redox species to the electrode. We report that nanoporous gold (np-Au) electrodes, prepared by a microfabrication-compatible self-assembly process and functionalized with DNA probes, enabled detection of target DNA molecules (10-200 nM) in physiologically relevant complex media (bovine serum albumin and fetal bovine serum). In contrast, the sensor performance was compromised for planar gold electrodes in the same conditions. Hybridization efficiency decreased by 10% for np-Au with coarser pores revealing a pore-size dependence of sensor performance in biofouling conditions. This nanostructure-dependent functionality in complex media suggests that the pores with the optimal size and geometry act as sieves for blocking the biomolecules from inhibiting the surfaces within the porous volume while allowing the transport of nucleic acid analytes and redox molecules.

Identity of active methanotrophs in landfill cover soil as revealed by DNA-stable isotope probing.

Science.gov (United States)

Cébron, Aurélie; Bodrossy, Levente; Chen, Yin; Singer, Andrew C; Thompson, Ian P; Prosser, James I; Murrell, J Colin

2007-10-01

A considerable amount of methane produced during decomposition of landfill waste can be oxidized in landfill cover soil by methane-oxidizing bacteria (methanotrophs) thus reducing greenhouse gas emissions to the atmosphere. The identity of active methanotrophs in Roscommon landfill cover soil, a slightly acidic peat soil, was assessed by DNA-stable isotope probing (SIP). Landfill cover soil slurries were incubated with (13)C-labelled methane and under either nutrient-rich nitrate mineral salt medium or water. The identity of active methanotrophs was revealed by analysis of (13)C-labelled DNA fractions. The diversity of functional genes (pmoA and mmoX) and 16S rRNA genes was analyzed using clone libraries, microarrays and denaturing gradient gel electrophoresis. 16S rRNA gene analysis revealed that the cover soil was mainly dominated by Type II methanotrophs closely related to the genera Methylocella and Methylocapsa and to Methylocystis species. These results were supported by analysis of mmoX genes in (13)C-DNA. Analysis of pmoA gene diversity indicated that a significant proportion of active bacteria were also closely related to the Type I methanotrophs, Methylobacter and Methylomonas species. Environmental conditions in the slightly acidic peat soil from Roscommon landfill cover allow establishment of both Type I and Type II methanotrophs.

Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2011-01-24

An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

Procedure for normalization of cDNA libraries

Science.gov (United States)

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

DEFF Research Database (Denmark)

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

Water versus DNA A new deal for proton transport modeling in biological matter

International Nuclear Information System (INIS)

Champion, C; Quinto, M A; Monti, J M; Galassi, M E; Fojón, O A; Hanssen, J; Rivarola, R D; Week, P F

2015-01-01

Water vapor is a common surrogate of DNA for modeling the proton-induced ionizing processes in living tissue exposed to radiations. The present study aims at scrutinizing the validity of this approximation and then revealing new insights into proton-induced energy transfers by a comparative analysis between water and realistic biological medium. In this context, self-consistent quantum mechanical modeling of the ionization and electron capture processes is reported within the continuum distorted wave-eikonal initial state framework for both isolated water molecules and DNA components impacted by proton beams. (paper)

DNA conformation on surfaces measured by fluorescence self-interference.

Science.gov (United States)

Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

2006-02-21

The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

Studies of G-quadruplex DNA structures at the single molecule level

DEFF Research Database (Denmark)

Kragh, Sofie Louise

2015-01-01

Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

Anchoring cationic amphiphiles for nucleotide delivery: significance of DNA release from cationic liposomes for transfection.

Science.gov (United States)

Hirashima, Naohide; Minatani, Kazuhiro; Hattori, Yoshifumi; Ohwada, Tomohiko; Nakanishi, Mamoru

2007-06-01

We have designed and synthesized lithocholic acid-based cationic amphiphile molecules as components of cationic liposomes for gene transfection (lipofection). To study the relationship between the molecular structures of those amphiphilic molecules, particularly the extended hydrophobic appendant (anchor) at the 3-hydroxyl group, and transfection efficiency, we synthesized several lithocholic and isolithocholic acid derivatives, and examined their transfection efficiency. We also compared the physico-chemical properties of cationic liposomes prepared from these derivatives. We found that isolithocholic acid derivatives exhibit higher transfection efficiency than the corresponding lithocholic acid derivatives. This result indicates that the orientation and extension of hydrophobic regions influence the gene transfection process. Isolithocholic acid derivatives showed a high ability to encapsulate DNA in a compact liposome-DNA complex and to protect it from enzymatic degradation. Isolithocholic acid derivatives also facilitated the release of DNA from the liposome-DNA complex, which is a crucial step for DNA entry into the nucleus. Our results show that the transfection efficiency is directly influenced by the ability of the liposome complex to release DNA, rather than by the DNA-encapsulating ability. Molecular modeling revealed that isolithocholic acid derivatives take relatively extended conformations, while the lithocholic acid derivatives take folded structures. Thus, the efficiency of release of DNA from cationic liposomes in the cytoplasm, which contributes to high transfection efficiency, appears to be dependent upon the molecular shape of the cationic amphiphiles.

Alternative end-joining of DNA breaks

NARCIS (Netherlands)

Schendel, Robin van

2016-01-01

DNA is arguably the most important molecule found in any organism, as it contains all information to perform cellular functions and enables continuity of species. It is continuously exposed to DNA-damaging agents both from endogenous and exogenous sources. To protect DNA against these sources of DNA

Second-strand cDNA synthesis: classical method

International Nuclear Information System (INIS)

Gubler, U.

1987-01-01

The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

Development of novel vaccines using DNA shuffling and screening strategies.

Science.gov (United States)

Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

2004-02-01

DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

A novel small molecule inhibitor of the DNA repair protein Ku70/80.

Science.gov (United States)

Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

2016-07-01

Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

Single DNA denaturation and bubble dynamics

International Nuclear Information System (INIS)

Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C

2009-01-01

While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.

Single DNA denaturation and bubble dynamics

DEFF Research Database (Denmark)

Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas

2009-01-01

While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...... for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation...

Crystal structure of Mycobacterium tuberculosis O6-methylguanine-DNA methyltransferase protein clusters assembled on to damaged DNA.

Science.gov (United States)

Miggiano, Riccardo; Perugino, Giuseppe; Ciaramella, Maria; Serpe, Mario; Rejman, Dominik; Páv, Ondřej; Pohl, Radek; Garavaglia, Silvia; Lahiri, Samarpita; Rizzi, Menico; Rossi, Franca

2016-01-15

Mycobacterium tuberculosis O(6)-methylguanine-DNA methyltransferase (MtOGT) contributes to protect the bacterial GC-rich genome against the pro-mutagenic potential of O(6)-methylated guanine in DNA. Several strains of M. tuberculosis found worldwide encode a point-mutated O(6)-methylguanine-DNA methyltransferase (OGT) variant (MtOGT-R37L), which displays an arginine-to-leucine substitution at position 37 of the poorly functionally characterized N-terminal domain of the protein. Although the impact of this mutation on the MtOGT activity has not yet been proved in vivo, we previously demonstrated that a recombinant MtOGT-R37L variant performs a suboptimal alkylated-DNA repair in vitro, suggesting a direct role for the Arg(37)-bearing region in catalysis. The crystal structure of MtOGT complexed with modified DNA solved in the present study reveals details of the protein-protein and protein-DNA interactions occurring during alkylated-DNA binding, and the protein capability also to host unmodified bases inside the active site, in a fully extrahelical conformation. Our data provide the first experimental picture at the atomic level of a possible mode of assembling three adjacent MtOGT monomers on the same monoalkylated dsDNA molecule, and disclose the conformational flexibility of discrete regions of MtOGT, including the Arg(37)-bearing random coil. This peculiar structural plasticity of MtOGT could be instrumental to proper protein clustering at damaged DNA sites, as well as to protein-DNA complexes disassembling on repair. © 2016 Authors; published by Portland Press Limited.

Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

International Nuclear Information System (INIS)

Tabet, J.

2007-11-01

The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

Energy Technology Data Exchange (ETDEWEB)

Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli

2008-12-16

Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA

Energy Technology Data Exchange (ETDEWEB)

Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.

2008-12-04

Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.

G-quadruplex and G-rich sequence stimulate Pif1p-catalyzed downstream duplex DNA unwinding through reducing waiting time at ss/dsDNA junction

Science.gov (United States)

Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang

2016-01-01

Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032

Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA

Science.gov (United States)

Altiparmak, Melek; Nakiboglu Tezer, Mahmure

2009-01-01

Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

Early models of DNA damage formation

International Nuclear Information System (INIS)

Śmiałek, Małgorzata A

2012-01-01

Quantification of DNA damage, induced by various types of incident radiation as well as chemical agents, has been the subject of many theoretical and experimental studies, supporting the development of modern cancer therapy. The primary observations showed that many factors can lead to damage of DNA molecules. It became clear that the development of experimental techniques for exploring this phenomenon is required. Another problem was simultaneously dealt with, anticipating on how the damage is distributed within the double helix of the DNA molecule and how the single strand break formation and accumulation can influence the lethal double strand break formation. In this work the most important probabilistic models for DNA strand breakage and damage propagation are summarized and compared.

The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

Science.gov (United States)

Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

2018-01-01

The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

Transition-state destabilization reveals how human DNA polymerase β proceeds across the chemically unstable lesion N7-methylguanine

Science.gov (United States)

Ouzon-Shubeita, Hala; Lee, Seongmin

2014-01-01

N7-Methyl-2′-deoxyguanosine (m7dG) is the predominant lesion formed by methylating agents. A systematic investigation on the effect of m7dG on DNA replication has been difficult due to the chemical instability of m7dG. To gain insights into the m7dG effect, we employed a 2′-fluorine-mediated transition-state destabilzation strategy. Specifically, we determined kinetic parameters for dCTP insertion opposite a chemically stable m7dG analogue, 2′-fluoro-m7dG (Fm7dG), by human DNA polymerase β (polβ) and solved three X-ray structures of polβ in complex with the templating Fm7dG paired with incoming dCTP or dTTP analogues. The kinetic studies reveal that the templating Fm7dG slows polβ catalysis ∼300-fold, suggesting that m7dG in genomic DNA may impede replication by some DNA polymerases. The structural analysis reveals that Fm7dG forms a canonical Watson–Crick base pair with dCTP, but metal ion coordination is suboptimal for catalysis in the polβ-Fm7dG:dCTP complex, which partially explains the slow insertion of dCTP opposite Fm7dG by polβ. In addition, the polβ-Fm7dG:dTTP structure shows open protein conformations and staggered base pair conformations, indicating that N7-methylation of dG does not promote a promutagenic replication. Overall, the first systematic studies on the effect of m7dG on DNA replication reveal that polβ catalysis across m7dG is slow, yet highly accurate. PMID:24966350

Model of biological quantum logic in DNA.