WorldWideScience

Sample records for dna molecules manipulated

  1. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  2. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  3. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  4. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    Science.gov (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  6. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain

    2014-02-01

    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  7. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

    2008-01-01

    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  8. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  9. Fiscal 1999 project for research and development of industrial and scientific technologies. Report on the achievements on the 'research and development of an ultimate atom and molecule manipulation technology' (Development of a technology to analyze and manipulate DNAs at high efficiency); 1999 nendo genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho. DNA nado kokoritsu kaiseki sosa gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    In the 'research and development of an ultimate atom and molecule manipulation technology', research has been made on an organic atom and molecule identification and manipulation technology and a dynamic organic molecule simulation technology. This paper summarizes the achievements in fiscal 1999. In the magnetic force controlling AFM for the force spectroscopy aimed at non-destructive atom and molecule identification, a prototype cantilever was fabricated that can excite and detect displacement in lateral direction and is suitable for friction measurement. The SrO surface and TiO2 surface of SrTiO{sub 3}. A carbon nano-tube was employed as a probe. In addition, the molecule inserting SAM technology was used to have developed a technology to measure electric conductivity inside and between molecules. With an aim at realizing a high-speed DNA base arrangement analyzing method, research is being performed upon noticing the single molecule method based on the light measuring method using the single molecule imaging as the base and the scanning probe microscope method. For the dynamic organic molecule simulation technology, theoretical analysis was advanced on synthesis of methanol on copper surface. (NEDO)

  10. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  11. Fiscal 1997 R an D project on industrial science and technology under a consignment from NEDO. R and D of the ultimate manipulation technology of atoms and molecules (high-efficiency and analysis and manipulation technology for DNA); 1997 nendo sangyo kagaku gijutsu kenkyu kaihatsu jigyo Shin energy Sangyo gijutsu Sogo Kaihatsu Kiko itaku. Genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho (DNA nado kokoritsu kaiseki sosa gijutsu kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This paper describes R and D of the ultimate manipulation technology of atoms and molecules (atom technology). Through the observation of super spiral DNA fixed on a spermin or spermidine treated mica substrate by AFM (atomic force microscope), fixation of DNA without any deformation in solution was clarified, and visualization of the spiral structure of DNA were successfully achieved. Manipulation of Xe atoms adsorbed on an Si(111) surface was certainly possible by using STM (scanning tunneling microscope)/atom probe equipment. A nucleation mechanism in crystal growth was studied for various organic source-molecules/GaAs(001) surface systems, and formation of high-density nuclei on the GaAs surface was achieved by accelerating the translational energy of Ga material molecules up to 6eV or more. Ziegler- Natta catalysis important for industrial polymerization of olefin molecules was precisely analyzed by first-principle dynamic simulation. A large-scale simulation of zeolite catalyst is also in promotion for methanol to gasoline conversion. 51 refs., 87 figs., 7 tabs.

  12. Imaging and manipulation of a polar molecule on Ag(111)

    DEFF Research Database (Denmark)

    Lin, R.; Braun, K.F.; Tang, H.

    2001-01-01

    A scanning tunneling microscope (STM) was applied to image and laterally manipulate isolated phosphangulene molecules on Ag(111) at 6 K. Atomic-resolution images clearly revealed three characteristic types of appearances (three-lobed, fish and bump shape) for the adsorbed molecules, which could...

  13. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  14. Massively Parallel Single-Molecule Manipulation Using Centrifugal Force

    Science.gov (United States)

    Wong, Wesley; Halvorsen, Ken

    2011-03-01

    Precise manipulation of single molecules has led to remarkable insights in physics, chemistry, biology, and medicine. However, two issues that have impeded the widespread adoption of these techniques are equipment cost and the laborious nature of making measurements one molecule at a time. To meet these challenges, we have developed an approach that enables massively parallel single- molecule force measurements using centrifugal force. This approach is realized in the centrifuge force microscope, an instrument in which objects in an orbiting sample are subjected to a calibration-free, macroscopically uniform force- field while their micro-to-nanoscopic motions are observed. We demonstrate high- throughput single-molecule force spectroscopy with this technique by performing thousands of rupture experiments in parallel, characterizing force-dependent unbinding kinetics of an antibody-antigen pair in minutes rather than days. Currently, we are taking steps to integrate high-resolution detection, fluorescence, temperature control and a greater dynamic range in force. With significant benefits in efficiency, cost, simplicity, and versatility, single-molecule centrifugation has the potential to expand single-molecule experimentation to a wider range of researchers and experimental systems.

  15. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  16. Real-time monitoring and manipulation of single bio-molecules in free solution

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored

  17. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  18. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  19. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  20. Light-Induced Local Heating for Thermophoretic Manipulation of DNA in Polymer Micro- and Nanochannels

    DEFF Research Database (Denmark)

    Thamdrup, Lasse Højlund; Larsen, Niels Bent; Kristensen, Anders

    2010-01-01

    We present a method for making polymer chips with a narrow-band near-infrared absorber layer that enables light-induced local heating of liquids inside fluidic micro- and nanochannels fabricated by thermal imprint in polymethyl methacrylate. We have characterized the resulting liquid temperature...... profiles in microchannels using the temperature dependent fluorescence of the complex [Ru(bpy)3]2+. We demonstrate thermophoretic manipulation of individual YOYO-1 stained T4 DNA molecules inside micro- and nanochannels....

  1. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  2. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  3. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  4. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  5. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  6. Production, Manipulation, and Applications of Ultracold Polar Molecules

    Science.gov (United States)

    2015-04-30

    were added to the MURI, and in some cases , the experiments were carried out on different molecules than originally stated (e.g., laser cooling and...interactions between like homonuclear alkali metal diatoms. J. Chem. Phys., 135:244307, 2011. [21] Jason N. Byrd, H. Harvey Michels, Jr. John A. Montgomery...111:1, 2013. [35] M. I. Fabrikant, Tian Li, N. J. Fitch, N. Farrow, Jonathan D. Weinstein , and H. J. Lewandowski. Method for traveling-wave

  7. Manipulating molecule-substrate exchange interactions via graphene

    Science.gov (United States)

    Bhandary, Sumanta; Eriksson, Olle; Sanyal, Biplab

    2013-03-01

    Organometallic molecules with a 3d metal center carrying a spin offers many interesting properties, e.g., existence of multiple spin states. A recent interest has been in understanding the magnetic exchange interaction between these organometallic molecules and magnetic substrates both from experiments and theory. In this work, we will show by calculations based on density functional theory how the exchange interaction is mediated via graphene in a geometry containing iron porphyrin(FeP)/graphene/Ni(111). The exchange interaction varies from a ferromagnetic to an antiferromagnetic one depending on the lattice site and type of defect in the graphene lattice along with the switching of spin state of Fe in FeP between S=1 and S=2, which should be detectable by x-ray magnetic circular dichroism experiments. This scenario of complex magnetic couplings with large magnetic moments may offer a unique spintronic logic device. We acknowledge financial support from the Swedish Research Council, KAW foundation and the ERC(project 247062 - ASD).

  8. Virtual reality visual feedback for hand-controlled scanning probe microscopy manipulation of single molecules

    Directory of Open Access Journals (Sweden)

    Philipp Leinen

    2015-11-01

    Full Text Available Controlled manipulation of single molecules is an important step towards the fabrication of single molecule devices and nanoscale molecular machines. Currently, scanning probe microscopy (SPM is the only technique that facilitates direct imaging and manipulations of nanometer-sized molecular compounds on surfaces. The technique of hand-controlled manipulation (HCM introduced recently in Beilstein J. Nanotechnol. 2014, 5, 1926–1932 simplifies the identification of successful manipulation protocols in situations when the interaction pattern of the manipulated molecule with its environment is not fully known. Here we present a further technical development that substantially improves the effectiveness of HCM. By adding Oculus Rift virtual reality goggles to our HCM set-up we provide the experimentalist with 3D visual feedback that displays the currently executed trajectory and the position of the SPM tip during manipulation in real time, while simultaneously plotting the experimentally measured frequency shift (Δf of the non-contact atomic force microscope (NC-AFM tuning fork sensor as well as the magnitude of the electric current (I flowing between the tip and the surface. The advantages of the set-up are demonstrated by applying it to the model problem of the extraction of an individual PTCDA molecule from its hydrogen-bonded monolayer grown on Ag(111 surface.

  9. Virtual reality visual feedback for hand-controlled scanning probe microscopy manipulation of single molecules.

    Science.gov (United States)

    Leinen, Philipp; Green, Matthew F B; Esat, Taner; Wagner, Christian; Tautz, F Stefan; Temirov, Ruslan

    2015-01-01

    Controlled manipulation of single molecules is an important step towards the fabrication of single molecule devices and nanoscale molecular machines. Currently, scanning probe microscopy (SPM) is the only technique that facilitates direct imaging and manipulations of nanometer-sized molecular compounds on surfaces. The technique of hand-controlled manipulation (HCM) introduced recently in Beilstein J. Nanotechnol. 2014, 5, 1926-1932 simplifies the identification of successful manipulation protocols in situations when the interaction pattern of the manipulated molecule with its environment is not fully known. Here we present a further technical development that substantially improves the effectiveness of HCM. By adding Oculus Rift virtual reality goggles to our HCM set-up we provide the experimentalist with 3D visual feedback that displays the currently executed trajectory and the position of the SPM tip during manipulation in real time, while simultaneously plotting the experimentally measured frequency shift (Δf) of the non-contact atomic force microscope (NC-AFM) tuning fork sensor as well as the magnitude of the electric current (I) flowing between the tip and the surface. The advantages of the set-up are demonstrated by applying it to the model problem of the extraction of an individual PTCDA molecule from its hydrogen-bonded monolayer grown on Ag(111) surface.

  10. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  11. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  12. Manipulating individual dichlorotin phthalocyanine molecules on Cu(100) surface at room temperature by scanning tunneling microscopy

    International Nuclear Information System (INIS)

    Li, Chao; Xiang, Feifei; Wang, Zhongping; Liu, Xiaoqing; Jiang, Danfeng; Wang, Li; Wang, Guang; Zhang, Xueao; Chen, Wei

    2014-01-01

    Single molecule manipulations have been achieved on dichlorotin phthalocyanine(SnCl 2 Pc) molecules adsorbed on Cu (100) at room temperature. Scanning tunneling microscopy observations directly demonstrate that the individual SnCl 2 Pc molecules can be moved along the [100] direction on Cu(100) surface by employing a scanning tunneling microscope tip fixed at the special position of the molecules. The orientation of the molecule can be switched between two angles of ±28° with respect to the [011] surface direction in the same way. Dependences of the probability of molecular motion on the distances between the tip and the molecules reveal that the mechanism for such manipulation of a SnCl 2 Pc molecule is dominated by the repulsive interactions between the tip and the molecules. With the assistance of this manipulation process, a prototype molecular storage array with molecular orientation as information carrier and an artificial hydrogen bonded supramolecular structure have been constructed on the surface. (paper)

  13. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  14. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  15. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  16. In-Situ Single DNA Manipulation with phi 20nm Electron-Beam-Deposited Probe

    National Research Council Canada - National Science Library

    Fujioka, Sota

    2001-01-01

    .... In this method full-time observation of the manipulation is provided for the purpose of keeping the information about where the isolated DNA fragment used to he located in the original DNA fiber...

  17. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  18. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  19. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  20. Engineering and control of cold molecules. Making manipulating and exploiting ultra-cold polar molecules

    International Nuclear Information System (INIS)

    Bigelow, N.P.; Haimberger, C.; Kleinert, J.; Tscherneck, M.; Holmes, M.E.

    2005-01-01

    In the last 12 months several groups have demonstrated the use of photo association to create cold heteronuclear (polar) molecules. We report on the formation of translationally cold NaCs molecules starting from a laser-cooled atomic vapor of Na and Cs atoms. Colliding atoms are transferred into bound molecular states in a two-step photoactivated process. We find a translational temperature of T ≅ 260 mK. To increase the density and number of trapped atoms, dark-spot techniques are used on the MOT and a Zeeman slowed sodium beam is used to load the sodium atoms into the trap. Spectroscopy of these molecules is underway using time-of-flight ion detection and trap-loss. Initial REMPI measurements indicate that both singlet and triplet states are being populated by the spontaneous-decay driven process. We measure a rate constant for molecule formation of K NaCs = 7.43 · 10 15 cm 3 s -1 . (author)

  1. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  2. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  3. Manipulation and Motion of Organelles and Single Molecules in Living Cells

    DEFF Research Database (Denmark)

    Norregaard, Kamilla; Metzler, Ralf; Ritter, Christine M.

    2017-01-01

    used force spectroscopy techniques, namely optical tweezers, magnetic tweezers, and atomic force microscopy, are described in detail, and their strength and limitations related to in vivo experiments are discussed. Finally, recent exciting discoveries within the field of in vivo manipulation...... driving many cellular processes. The forces on a molecular scale are exactly in the range that can be manipulated and probed with single molecule force spectroscopy. The natural environment of a biomolecule is inside a living cell, hence, this is the most relevant environment for probing their function...

  4. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  5. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  6. Manipulation and Motion of Organelles and Single Molecules in Living Cells

    DEFF Research Database (Denmark)

    Norregaard, Kamilla; Metzler, Ralf; Ritter, Christine M.

    2017-01-01

    used force spectroscopy techniques, namely optical tweezers, magnetic tweezers, and atomic force microscopy, are described in detail, and their strength and limitations related to in vivo experiments are discussed. Finally, recent exciting discoveries within the field of in vivo manipulation...... driving many cellular processes. The forces on a molecular scale are exactly in the range that can be manipulated and probed with single molecule force spectroscopy. The natural environment of a biomolecule is inside a living cell, hence, this is the most relevant environment for probing their function....... In vivo studies are, however, challenged by the complexity of the cell. In this review, we start with presenting relevant theoretical tools for analyzing single molecule data obtained in intracellular environments followed by a description of state-of-the art visualization techniques. The most commonly...

  7. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  8. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  9. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  10. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  11. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  12. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  13. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  14. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  15. Manipulators

    International Nuclear Information System (INIS)

    Wilcock, P.D.

    1984-01-01

    The patent concerns a manipulator, which enables operations to be carried out remotely from the operator. The device is suitable for use in handling of radioactive materials and other hazardous liquids or gases. The specifications are given, and the movements of the manipulator arm described. (U.K.)

  16. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  17. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  18. Single-molecule imaging and manipulation of biomolecular machines and systems.

    Science.gov (United States)

    Iino, Ryota; Iida, Tatsuya; Nakamura, Akihiko; Saita, Ei-Ichiro; You, Huijuan; Sako, Yasushi

    2018-02-01

    Biological molecular machines support various activities and behaviors of cells, such as energy production, signal transduction, growth, differentiation, and migration. We provide an overview of single-molecule imaging methods involving both small and large probes used to monitor the dynamic motions of molecular machines in vitro (purified proteins) and in living cells, and single-molecule manipulation methods used to measure the forces, mechanical properties and responses of biomolecules. We also introduce several examples of single-molecule analysis, focusing primarily on motor proteins and signal transduction systems. Single-molecule analysis is a powerful approach to unveil the operational mechanisms both of individual molecular machines and of systems consisting of many molecular machines. Quantitative, high-resolution single-molecule analyses of biomolecular systems at the various hierarchies of life will help to answer our fundamental question: "What is life?" This article is part of a Special Issue entitled "Biophysical Exploration of Dynamical Ordering of Biomolecular Systems" edited by Dr. Koichi Kato. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  20. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  1. Approaches to Validate and Manipulate RNA Targets with Small Molecules in Cells.

    Science.gov (United States)

    Childs-Disney, Jessica L; Disney, Matthew D

    2016-01-01

    RNA has become an increasingly important target for therapeutic interventions and for chemical probes that dissect and manipulate its cellular function. Emerging targets include human RNAs that have been shown to directly cause cancer, metabolic disorders, and genetic disease. In this review, we describe various routes to obtain bioactive compounds that target RNA, with a particular emphasis on the development of small molecules. We use these cases to describe approaches that are being developed for target validation, which include target-directed cleavage, classic pull-down experiments, and covalent cross-linking. Thus, tools are available to design small molecules to target RNA and to identify the cellular RNAs that are their targets.

  2. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  3. Pharmacogenomic identification of small molecules for lineage specific manipulation of subventricular zone germinal activity.

    Directory of Open Access Journals (Sweden)

    Kasum Azim

    2017-03-01

    Full Text Available Strategies for promoting neural regeneration are hindered by the difficulty of manipulating desired neural fates in the brain without complex genetic methods. The subventricular zone (SVZ is the largest germinal zone of the forebrain and is responsible for the lifelong generation of interneuron subtypes and oligodendrocytes. Here, we have performed a bioinformatics analysis of the transcriptome of dorsal and lateral SVZ in early postnatal mice, including neural stem cells (NSCs and their immediate progenies, which generate distinct neural lineages. We identified multiple signaling pathways that trigger distinct downstream transcriptional networks to regulate the diversity of neural cells originating from the SVZ. Next, we used a novel in silico genomic analysis, searchable platform-independent expression database/connectivity map (SPIED/CMAP, to generate a catalogue of small molecules that can be used to manipulate SVZ microdomain-specific lineages. Finally, we demonstrate that compounds identified in this analysis promote the generation of specific cell lineages from NSCs in vivo, during postnatal life and adulthood, as well as in regenerative contexts. This study unravels new strategies for using small bioactive molecules to direct germinal activity in the SVZ, which has therapeutic potential in neurodegenerative diseases.

  4. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  5. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  6. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Manipulating molecular quantum states with classical metal atom inputs: demonstration of a single molecule NOR logic gate.

    Science.gov (United States)

    Soe, We-Hyo; Manzano, Carlos; Renaud, Nicolas; de Mendoza, Paula; De Sarkar, Abir; Ample, Francisco; Hliwa, Mohamed; Echavarren, Antonio M; Chandrasekhar, Natarajan; Joachim, Christian

    2011-02-22

    Quantum states of a trinaphthylene molecule were manipulated by putting its naphthyl branches in contact with single Au atoms. One Au atom carries 1-bit of classical information input that is converted into quantum information throughout the molecule. The Au-trinaphthylene electronic interactions give rise to measurable energy shifts of the molecular electronic states demonstrating a NOR logic gate functionality. The NOR truth table of the single molecule logic gate was characterized by means of scanning tunnelling spectroscopy.

  8. Single-Molecule Tribology: Force Microscopy Manipulation of a Porphyrin Derivative on a Copper Surface.

    Science.gov (United States)

    Pawlak, Rémy; Ouyang, Wengen; Filippov, Alexander E; Kalikhman-Razvozov, Lena; Kawai, Shigeki; Glatzel, Thilo; Gnecco, Enrico; Baratoff, Alexis; Zheng, Quanshui; Hod, Oded; Urbakh, Michael; Meyer, Ernst

    2016-01-26

    The low-temperature mechanical response of a single porphyrin molecule attached to the apex of an atomic force microscope (AFM) tip during vertical and lateral manipulations is studied. We find that approach-retraction cycles as well as surface scanning with the terminated tip result in atomic-scale friction patterns induced by the internal reorientations of the molecule. With a joint experimental and computational effort, we identify the dicyanophenyl side groups of the molecule interacting with the surface as the dominant factor determining the observed frictional behavior. To this end, we developed a generalized Prandtl-Tomlinson model parametrized using density functional theory calculations that includes the internal degrees of freedom of the side group with respect to the core and its interactions with the underlying surface. We demonstrate that the friction pattern results from the variations of the bond length and bond angles between the dicyanophenyl side group and the porphyrin backbone as well as those of the CN group facing the surface during the lateral and vertical motion of the AFM tip.

  9. Manipulators

    International Nuclear Information System (INIS)

    Andre, Y.; Routelous, F.; Spina, G.; Perpina, J.; Suquet, J.; Rossi, M.; Zanca, M.; Billiet, A.; Madec, L.; Lemoine, T.; Gaboriaud, G.; Aubert, B.; Rosenwald, J.C.; Neuenschwander, S.; Brisse, H.; Rehel, J.L.; Rebibo, G.; Bensimon, J.L.; Kulski, A.; Serhal, M.; Nguyen, K.V.; Lescure, R.; Cymbalista, M.

    2005-01-01

    Three articles have for purpose the radiation doses optimization in medical imaging. The first one concerns the radiation protection of manipulators working at a PET scan post, the second one concerns more particularly the optimization of doses delivered in pediatric computerized tomography, the third one is devoted to a comparison between radiation dose and image quality through scanners of adult temporal bone. (N.C.)

  10. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo

    2010-01-01

    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  11. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  12. Towards Controlled Single-Molecule Manipulation Using “Real-Time” Molecular Dynamics Simulation: A GPU Implementation

    Directory of Open Access Journals (Sweden)

    Dyon van Vreumingen

    2018-05-01

    Full Text Available Molecular electronics saw its birth with the idea to build electronic circuitry with single molecules as individual components. Even though commercial applications are still modest, it has served an important part in the study of fundamental physics at the scale of single atoms and molecules. It is now a routine procedure in many research groups around the world to connect a single molecule between two metallic leads. What is unknown is the nature of this coupling between the molecule and the leads. We have demonstrated recently (Tewari, 2018, Ph.D. Thesis our new setup based on a scanning tunneling microscope, which can be used to controllably manipulate single molecules and atomic chains. In this article, we will present the extension of our molecular dynamic simulator attached to this system for the manipulation of single molecules in real time using a graphics processing unit (GPU. This will not only aid in controlled lift-off of single molecules, but will also provide details about changes in the molecular conformations during the manipulation. This information could serve as important input for theoretical models and for bridging the gap between the theory and experiments.

  13. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  14. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  15. A tapeworm molecule manipulates vitellogenin expression in the beetle Tenebrio molitor

    Science.gov (United States)

    Warr, E.; Meredith, J. M.; Nimmo, D. D.; Basu, S.; Hurd, H.; Eggleston, P.

    2006-01-01

    Metacestodes of Hymenolepis diminuta secrete a molecule that decreases vitellogenin (Vg) synthesis in the beetle host, Tenebrio molitor. The 5608 bp T. molitor Vg cDNA represents a single-copy gene encoding a single open reading frame of 1821 amino acids with a predicted molecular mass of 206 kDa. Northern blot analysis revealed detectable levels of transcripts only in adult females. In vivo, Vg mRNA abundance was significantly higher in fat bodies from infected females compared with control females at all but the earliest time point. In vitro, Vg mRNA abundance was significantly increased in fat bodies incubated with live stage I–II parasites. The apparent conflict between increased Vg mRNA abundance and decreased Vg protein in fat bodies from infected females is discussed. PMID:16907836

  16. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  17. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  18. Single-cell manipulation and DNA delivery technology using atomic force microscopy and nanoneedle.

    Science.gov (United States)

    Han, Sung-Woong; Nakamura, Chikashi; Miyake, Jun; Chang, Sang-Mok; Adachi, Taiji

    2014-01-01

    The recent single-cell manipulation technology using atomic force microscopy (AFM) not only allows high-resolution visualization and probing of biomolecules and cells but also provides spatial and temporal access to the interior of living cells via the nanoneedle technology. Here we review the development and application of single-cell manipulations and the DNA delivery technology using a nanoneedle. We briefly describe various DNA delivery methods and discuss their advantages and disadvantages. Fabrication of the nanoneedle, visualization of nanoneedle insertion into living cells, DNA modification on the nanoneedle surface, and the invasiveness of nanoneedle insertion into living cells are described. Different methods of DNA delivery into a living cell, such as lipofection, microinjection, and nanoneedles, are then compared. Finally, single-cell diagnostics using the nanoneedle and the perspectives of the nanoneedle technology are outlined. The nanoneedle-based DNA delivery technology provides new opportunities for efficient and specific introduction of DNA and other biomolecules into precious living cells with a high spatial resolution within a desired time frame. This technology has the potential to be applied for many basic cellular studies and for clinical studies such as single-cell diagnostics.

  19. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  20. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  1. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  2. Studying DNA Looping by Single-Molecule FRET

    OpenAIRE

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  3. Counting molecules in cell-free DNA and single cells RNA

    OpenAIRE

    Karlsson, Kasper

    2016-01-01

    The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

  4. Single molecule manipulation at low temperature and laser scanning tunnelling photo-induced processes analysis through time-resolved studies

    International Nuclear Information System (INIS)

    Riedel, Damien

    2010-01-01

    This paper describes, firstly, the statistical analysis used to determine the processes that occur during the manipulation of a single molecule through electronically induced excitations with a low temperature (5 K) scanning tunnelling microscope (STM). Various molecular operation examples are described and the ability to probe the ensuing molecular manipulation dynamics is discussed within the excitation context. It is, in particular, shown that such studies can reveal reversible manipulation for tuning dynamics through variation of the excitation energy. Secondly, the photo-induced process arising from the irradiation of the STM junction is also studied through feedback loop dynamics analysis, allowing us to distinguish between photo-thermally and photo-electronically induced signals.

  5. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  6. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

    2014-01-01

    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  7. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  8. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    Science.gov (United States)

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  10. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    OpenAIRE

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  11. Manipulating ultracold polar molecules with microwave radiation: The influence of hyperfine structure

    International Nuclear Information System (INIS)

    Aldegunde, J.; Hutson, Jeremy M.; Ran Hong

    2009-01-01

    We calculate the microwave spectra of ultracold 40 K 87 Rb alkali-metal dimers, including hyperfine interactions and in the presence of electric and magnetic fields. We show that microwave transitions may be used to transfer molecules between different hyperfine states, but only because of the presence of nuclear quadrupole interactions. Hyperfine splittings may also complicate the use of ultracold molecules for quantum computing. The spectrum of molecules oriented in electric fields may be simplified dramatically by applying a simultaneous magnetic field.

  12. Manipulation of Origin of Life Molecules: Recognizing Single-Molecule Conformations in β-Carotene and Chlorophyll-a/β-Carotene Clusters

    Energy Technology Data Exchange (ETDEWEB)

    Ngo, Anh T.; Skeini, Timur [Nanoscale; amp, Quantum Phenomena Institute and Physics & amp, Astronomy Department, Ohio University, Athens, Ohio 45701, United States; Iancu, Violeta [Nanoscale; amp, Quantum Phenomena Institute and Physics & amp, Astronomy Department, Ohio University, Athens, Ohio 45701, United States; Redfern, Paul C.; Curtiss, Larry A.; Hla, Saw Wai [Nanoscale; amp, Quantum Phenomena Institute and Physics & amp, Astronomy Department, Ohio University, Athens, Ohio 45701, United States

    2018-01-11

    Carotenoids and chlorophyll are essential parts of plant leaves and are involved in photosynthesis, a vital biological process responsible for the origin of life on Earth. Here, we investigate how beta-carotene and chlorophyll-a form mixed molecular phases On a Au(111) surface using low-temperature scanning tunneling microscopy and molecular manipulation at the single-molecule level supported by density functional theory calculations. By isolating individual molecules from nanoscale molecular clusters with a scanning tunneling microscope tip, we are able to identify five beta-carotene conformations including a structure exhibiting a three-dimensional conformation. Furthermore, molecular resolution images enable direct visualization of beta-carotene/chlorophyll-a clsuters, with intimate structural details highlighting how they pair: beta-carotene preferentially positions next to chlorophyll-a and induces switching of chlorophyll-a from straight to several bent tail conformations in the molecular clusters.

  13. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  14. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  15. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  16. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  17. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  18. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

    2016-01-01

    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  19. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Science.gov (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  20. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    Science.gov (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  1. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  2. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  3. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  4. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  5. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  6. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura

    2016-10-01

    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  7. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  8. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  9. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  10. Spectroscopy, Manipulation and Trapping of Neutral Atoms, Molecules, and Other Particles Using Optical Nanofibers: A Review

    Science.gov (United States)

    Morrissey, Michael J.; Deasy, Kieran; Frawley, Mary; Kumar, Ravi; Prel, Eugen; Russell, Laura; Truong, Viet Giang; Chormaic, Síle Nic

    2013-01-01

    The use of tapered optical fibers, i.e., optical nanofibers, for spectroscopy and the detection of small numbers of particles, such as neutral atoms or molecules, has been gaining interest in recent years. In this review, we briefly introduce the optical nanofiber, its fabrication, and optical mode propagation within. We discuss recent progress on the integration of optical nanofibers into laser-cooled atom and vapor systems, paying particular attention to spectroscopy, cold atom cloud characterization, and optical trapping schemes. Next, a natural extension of this work to molecules is introduced. Finally, we consider several alternatives to optical nanofibers that display some advantages for specific applications. PMID:23945738

  11. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  12. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

    1979-01-01

    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  13. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

    2012-01-01

    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  14. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  15. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  16. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  17. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  18. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    Science.gov (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  19. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  20. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  1. Near-Infrared-Light-Responsive Magnetic DNA Microgels for Photon- and Magneto-Manipulated Cancer Therapy.

    Science.gov (United States)

    Wang, Yitong; Wang, Ling; Yan, Miaomiao; Dong, Shuli; Hao, Jingcheng

    2017-08-30

    Functional DNA molecules have been introduced into polymer-based nanocarrier systems to incorporate chemotherapy drugs for cancer therapy. Here is the first report of dual-responsive microgels composed of a core of Au nanorods and a shell of magnetic ionic liquid and DNA moieties in the cross-linking network simultaneously, as effective drug delivery vectors. TEM images indicated a magnetic polymer shell has an analogous "doughnut" shape which loosely surround the AuNRs core. When irradiated with a near-infrared-light (near-IR) laser, Au nanorods are the motors which convert the light to heat, leading to the release of the encapsulated payloads with high controllability. DNA acts not only as a cross-linker agent, but also as a gatekeeper to regulate the release of drugs. The internalization study and MTT assay confirm that these core-shell DNA microgels are excellent candidates which can enhance the cytotoxicity of cancer cells controlled by near-IR laser and shield the high toxicity of chemotherapeutic agents to improve the killing efficacy of chemotherapeutic agents efficiently in due course.

  2. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Science.gov (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

    Science.gov (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  4. Hybrid magnet devices for molecule manipulation and small scale high gradient-field applications

    Science.gov (United States)

    Humphries, David E [El Cerrito, CA; Hong, Seok-Cheol [Seoul, KR; Cozzarelli, legal representative, Linda A.; Pollard, Martin J [El Cerrito, CA; Cozzarelli, Nicholas R [Berkeley, CA

    2009-01-06

    The present disclosure provides a high performance hybrid magnetic structure made from a combination of permanent magnets and ferromagnetic pole materials which are assembled in a predetermined array. The hybrid magnetic structure provides means for separation and other biotechnology applications involving holding, manipulation, or separation of magnetizable molecular structures and targets. Also disclosed are hybrid magnetic tweezers able to exert approximately 1 nN of force to 4.5 .mu.m magnetic bead. The maximum force was experimentally measured to be .about.900 pN which is in good agreement with theoretical estimations and other measurements. In addition, a new analysis scheme that permits fast real-time position measurement in typical geometry of magnetic tweezers has been developed and described in detail.

  5. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  6. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  7. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

    1978-01-01

    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  8. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)

    2012-07-27

    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  9. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria

    2012-01-01

    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  10. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  11. Manipulation of the spin in single molecule magnets via Landau-Zener transitions

    Science.gov (United States)

    Palii, Andrew; Tsukerblat, Boris; Clemente-Juan, Juan M.; Gaita-Ariño, Alejandro; Coronado, Eugenio

    2011-11-01

    We theoretically investigate the effects of a magnetic pulse on a single-molecule magnet (SMM) initially magnetized by a dc field along the easy axis of magnetization. In the Landau-Zener (LZ) scheme, it is shown that the final spin state is a function of the shape and duration of the pulse, conditioned by the decoherence time of the SMM. In the case of coherent tunneling, the asymmetric pulses are shown to reverse the direction of the magnetization, while the symmetric pulses can only decrease the value of the initial magnetization. It is also demonstrated that the application of an external variable dc field in the hard plane of magnetization provides the possibility to tune the resulting magnetization due to quantum interference effects. The results and the conditions for the observation of the pulse-triggered LZ transitions are illustrated by the application of the proposed scheme to the well-studied single-molecule magnet Fe8. To put the results into perspective, some potential applications of SMMs experiencing pulse-induced LZ transitions, such as switching devices and qubits, are discussed.

  12. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  13. Realization of a four-step molecular switch in scanning tunneling microscope manipulation of single chlorophyll-a molecules

    Science.gov (United States)

    Iancu, Violeta; Hla, Saw-Wai

    2006-01-01

    Single chlorophyll-a molecules, a vital resource for the sustenance of life on Earth, have been investigated by using scanning tunneling microscope manipulation and spectroscopy on a gold substrate at 4.6 K. Chlorophyll-a binds on Au(111) via its porphyrin unit while the phytyl-chain is elevated from the surface by the support of four CH3 groups. By injecting tunneling electrons from the scanning tunneling microscope tip, we are able to bend the phytyl-chain, which enables the switching of four molecular conformations in a controlled manner. Statistical analyses and structural calculations reveal that all reversible switching mechanisms are initiated by a single tunneling-electron energy-transfer process, which induces bond rotation within the phytyl-chain. PMID:16954201

  14. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.

    2013-01-01

    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  15. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  16. Manipulating the dipole layer of polar organic molecules on metal surfaces via different charge-transfer channels

    Science.gov (United States)

    Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.

    The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.

  17. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  18. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    OpenAIRE

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  19. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  20. Coherent control of atoms and diatomic molecules with shaped ultrashort pulses; Manipulation coherente d'atomes et de molecules diatomiques avec des impulsions mises en forme

    Energy Technology Data Exchange (ETDEWEB)

    Degert, J

    2002-12-15

    This thesis deals with the theoretical and experimental study of coherent control of atomic and molecular systems with shaped pulses. At first, we present several experiments of control of coherent transients in rubidium. These transients appear when a two-level system is excited by a perturbative chirped pulse, and are characterized by oscillations in the excited state population. For a strong chirp, we show that a phase step in the spectrum modifies the phase of the oscillations. Then, by direct analogy with Fresnel zone lens, we conceive a chirped pulse with a highly modulated amplitude, allowing to suppress destructive contributions to the population transfer. In a second set of experiments, we focus on quantum path interferences in two-photon transitions excited by linearly chirped pulses. Owing to the broad bandwidth of ultrashort pulses, sequential and direct excitation paths contribute to the excited state population. Oscillations resulting from interferences between these two paths are observed in atomic sodium. Moreover, we show that they are observable whatever the sign of chirp. Theoretically, we study the control of the predissociation of a benchmark diatomic molecule: NaI. Predissociation leads to matter wave interferences in the fragments distribution. First, we show that a suitably chosen probe pulse allows the observation of theses interferences. Next, using a sequence of control pulse inducing electronic transition, we demonstrate the possibility to manipulate fragment energy distribution. (author)

  1. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  2. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  3. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  4. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

    2016-01-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  5. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  6. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  7. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  8. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  9. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  10. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  11. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  12. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. A device for extraction, manipulation and stretching of DNA from single human chromosomes

    DEFF Research Database (Denmark)

    Rasmussen, Kristian Hagsted; Marie, Rodolphe; Moresco, Jacob Lange

    2011-01-01

    by time-lapse imaging; pressure-driven flow was then used to shunt the chromosomal DNA package into a nanoslit. A long linear DNA strand (>1.3 Mbp) was seen to stretch out from the DNA package and along the length of the nanoslit. Delivery of DNA in its native metaphase chromosome package as well...

  14. Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

    Science.gov (United States)

    Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

    2015-04-01

    DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

  15. Solvent-molecule-mediated manipulation of crystalline grains for efficient planar binary lead and tin triiodide perovskite solar cells

    Science.gov (United States)

    Zhu, Leize; Yuh, Brian; Schoen, Stefan; Li, Xinpei; Aldighaithir, Mohammed; Richardson, Beau J.; Alamer, Ahmed; Yu, Qiuming

    2016-03-01

    Binary lead and tin perovskites offer the benefits of narrower band gaps for broader adsorption of solar spectrum and better charge transport for higher photocurrent density. Here, we report the growth of large, smooth crystalline grains of bianry lead and tin triiodide perovskite films via a two-step solution process with thermal plus solvent vapor-assisted thermal annealing. The crystalline SnxPb1-xI2 films formed in the first step served as the templates for the formation of crystalline CH3NH3SnxPb1-xI3 films during the second step interdiffusion of methylammonium iodide (MAI). Followed by dimethylsulfoxide (DMSO) vapor-assisted thermal annealing, small, faceted perovskite grains grew into large, smooth grains via the possible mechanism involving bond breaking and reforming mediated by DMSO solvent molecules. The absorption onset was extended to 950 and 1010 nm for the CH3NH3SnxPb1-xI3 perovskites with x = 0.1 and 0.25, respectively. The highest PCE of 10.25% was achieved from the planar perovskite solar cell with the CH3NH3Sn0.1Pb0.9I3 layer prepared via the thermal plus DMSO vapor-assisted thermal annealing. This research provides a way to control and manipulate film morphology, grain size, and especially the distribution of metal cations in binary metal perovskite layers, which opens an avenue to grow perovskite materials with desired properties to enhance device performance.Binary lead and tin perovskites offer the benefits of narrower band gaps for broader adsorption of solar spectrum and better charge transport for higher photocurrent density. Here, we report the growth of large, smooth crystalline grains of bianry lead and tin triiodide perovskite films via a two-step solution process with thermal plus solvent vapor-assisted thermal annealing. The crystalline SnxPb1-xI2 films formed in the first step served as the templates for the formation of crystalline CH3NH3SnxPb1-xI3 films during the second step interdiffusion of methylammonium iodide (MAI

  16. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  17. Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    Science.gov (United States)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

    2017-03-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

  18. Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    International Nuclear Information System (INIS)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

    2017-01-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

  19. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  20. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  1. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    Science.gov (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  2. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  3. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  4. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  5. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  6. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  7. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  8. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  9. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  10. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  11. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  12. Mapping of histone modifications in episomal HBV cccDNA uncovers an unusual chromatin organization amenable to epigenetic manipulation

    Science.gov (United States)

    Tropberger, Philipp; Mercier, Alexandre; Robinson, Margaret; Zhong, Weidong; Ganem, Don E.; Holdorf, Meghan

    2015-01-01

    Chronic hepatitis B virus (HBV) infection affects 240 million people worldwide and is a major risk factor for liver failure and hepatocellular carcinoma. Current antiviral therapy inhibits cytoplasmic HBV genomic replication, but is not curative because it does not directly affect nuclear HBV closed circular DNA (cccDNA), the genomic form that templates viral transcription and sustains viral persistence. Novel approaches that directly target cccDNA regulation would therefore be highly desirable. cccDNA is assembled with cellular histone proteins into chromatin, but little is known about the regulation of HBV chromatin by histone posttranslational modifications (PTMs). Here, using a new cccDNA ChIP-Seq approach, we report, to our knowledge, the first genome-wide maps of PTMs in cccDNA-containing chromatin from de novo infected HepG2 cells, primary human hepatocytes, and from HBV-infected liver tissue. We find high levels of PTMs associated with active transcription enriched at specific sites within the HBV genome and, surprisingly, very low levels of PTMs linked to transcriptional repression even at silent HBV promoters. We show that transcription and active PTMs in HBV chromatin are reduced by the activation of an innate immunity pathway, and that this effect can be recapitulated with a small molecule epigenetic modifying agent, opening the possibility that chromatin-based regulation of cccDNA transcription could be a new therapeutic approach to chronic HBV infection. PMID:26438841

  13. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang

    2018-01-01

    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  14. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  15. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  16. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  17. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  18. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  19. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  20. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  1. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    Science.gov (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  2. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    Science.gov (United States)

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  3. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  4. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  5. Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes

    DEFF Research Database (Denmark)

    Zhang, Changyi; Tian, Bin; Li, Suming

    2013-01-01

    Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...

  6. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    Science.gov (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  8. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  9. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  10. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  11. Fiscal 1997 R and D project on industrial science and technology under a consignment from NEDO. R and D of the ultimate manipulation technology of atoms and molecules; 1997 nendo sangyo kagaku gijutsu kenkyu kaihatsu jigyo Shin energy Sangyo gijutsu Sogo Kaihatsu Kiko itaku. Genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho (genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This paper describes R and D of the ultimate manipulation technology of atoms and molecules (atom technology). The R and D aims at establishment of observation/manipulation technology of atoms and molecules as common basic technology in various industrial fields such as new material, electronics, bio-technology and chemistry. The R and D thus aims at establishment of observation/manipulation of solid surfaces and DNA organic molecules, formation of fine structures of atomic surface arrangement, and calculation/ simulation for predicting a reaction theorem of atom and molecule surfaces. In fiscal 1997, research was made on improvement and development of computer simulation environment, and description of an excited state of electrons by Green function. Establishment of a construction method and computation code is under investigation for pseudo- potential dependent on excitation energy. Survey was made on research trends of the atom technology by visiting overseas academic societies and institutions. International Symposium on Atom Technology was also held in Tokyo in Nov. 1997

  12. Atomic force microscopy for cellular level manipulation: imaging intracellular structures and DNA delivery through a membrane hole.

    Science.gov (United States)

    Afrin, Rehana; Zohora, Umme Salma; Uehara, Hironori; Watanabe-Nakayama, Takahiro; Ikai, Atsushi

    2009-01-01

    The atomic force microscope (AFM) is a versatile tool for imaging, force measurement and manipulation of proteins, DNA, and living cells basically at the single molecular level. In the cellular level manipulation, extraction, and identification of mRNA's from defined loci of a cell, insertion of plasmid DNA and pulling of membrane proteins, for example, have been reported. In this study, AFM was used to create holes at defined loci on the cell membrane for the investigation of viability of the cells after hole creation, visualization of intracellular structure through the hole and for targeted gene delivery into living cells. To create large holes with an approximate diameter of 5-10 microm, a phospholipase A(2) coated bead was added to the AFM cantilever and the bead was allowed to touch the cell surface for approximately 5-10 min. The evidence of hole creation was obtained mainly from fluorescent image of Vybrant DiO labeled cell before and after the contact with the bead and the AFM imaging of the contact area. In parallel, cells with a hole were imaged by AFM to reveal intracellular structures such as filamentous structures presumably actin fibers and mitochondria which were identified with fluorescent labeling with rhodamine 123. Targeted gene delivery was also attempted by inserting an AFM probe that was coated with the Monster Green Fluorescent Protein phMGFP Vector for transfection of the cell. Following targeted transfection, the gene expression of green fluorescent protein (GFP) was observed and confirmed by the fluorescence microscope. Copyright (c) 2009 John Wiley & Sons, Ltd.

  13. Point-of-Care Determination of Acetaminophen Levels with Multi-Hydrogen Bond Manipulated Single-Molecule Recognition (eMuHSiR).

    Science.gov (United States)

    Zhang, Yan; Huang, Zhongyuan; Wang, Letao; Wang, Chunming; Zhang, Changde; Wiese, Tomas; Wang, Guangdi; Riley, Kevin; Wang, Zhe

    2018-04-03

    This work aims to face the challenge of monitoring small molecule drugs accurately and rapidly for point-of-care (POC) diagnosis in current clinical settings. Overdose of acetaminophen (AP), a commonly used over the counter (OTC) analgesic drug, has been determined to be a major cause of acute liver failure in the US and the UK. However, there is no rapid and accurate detection method available for this drug in the emergency room. The present study examined an AP sensing strategy that relies on a previously unexplored strong interaction between AP and the arginine (Arg) molecule. It was found that as many as 4 hydrogen bonds can be formed between one Arg molecule and one AP molecule. By taking advantages of this structural selectivity and high tenability of hydrogen bonds, Arg, immobilized on a graphene surface via electrostatic interactions, was utilized to structurally capture AP. Interestingly, bonded AP still remained the perfect electrochemical activities. The extent of Arg-AP bonds was quantified using a newly designed electrochemical (EC) sensor. To verify the feasibility of this novel assay, based on multihydrogen bond manipulated single-molecule recognition (eMuHSiR), both pharmaceutical and serum sample were examined. In commercial tablet measurement, no significant difference was seen between the results of eMuHSiR and other standard methods. For measuring AP concentration in the mice blood, the substances in serum, such as sugars and fats, would not bring any interference to the eMuHSiR in a wide concentration range. This eMuHSiR method opens the way for future development of small molecule detection for the POC testing.

  14. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  15. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

    Science.gov (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

    2014-10-21

    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  16. Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

    Directory of Open Access Journals (Sweden)

    Haowei Wang

    Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

  17. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  18. A novel small molecule inhibitor of the DNA repair protein Ku70/80.

    Science.gov (United States)

    Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

    2016-07-01

    Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

  19. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    Science.gov (United States)

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Science.gov (United States)

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  1. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  2. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  3. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  4. Magnetic field manipulation of spin current in a single-molecule magnet tunnel junction with two-electron Coulomb interaction

    Science.gov (United States)

    Zhang, Chao; Yao, Hui; Nie, Yi-Hang; Liang, Jiu-Qing; Niu, Peng-Bin

    2018-04-01

    In this work, we study the generation of spin-current in a single-molecule magnet (SMM) tunnel junction with Coulomb interaction of transport electrons and external magnetic field. In the absence of field the spin-up and -down currents are symmetric with respect to the initial polarizations of molecule. The existence of magnetic field breaks the time-reversal symmetry, which leads to unsymmetrical spin currents of parallel and antiparallel polarizations. Both the amplitude and polarization direction of spin current can be controlled by the applied magnetic field. Particularly when the magnetic field increases to a certain value the spin-current with antiparallel polarization is reversed along with the magnetization reversal of the SMM. The two-electron occupation indeed enhances the transport current compared with the single-electron process. However the increase of Coulomb interaction results in the suppression of spin-current amplitude at the electron-hole symmetry point. We propose a scheme to compensate the suppression with the magnetic field.

  5. Achievement report for fiscal 1998. Research and development of ultimate atom/molecule manipulating technologies (Development of technology for formation of advanced function materials for use under power generation environment); 1998 nendo genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho. Hatsuden kankyoyo kokino sozai keisei gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The aim is to establish atom/molecule observing and manipulating technologies commonly applicable as basic technologies to industrial fields of new materials, electronics, biotechnology, chemistry, etc. The technologies to be established involve atom level observation and manipulation by mechanically probing into organic molecules such as those of solid surface DNA, microstructure formation with atoms arbitrarily arranged by use of a microfine electron beam and surface chemical properties, simulation by the first principle calculation for the theoretical prediction atom/mole surface application in a process, and new materials to replace semiconductors. The subjects of research and development selected for this fiscal year are the study of silicon nanostructure formation and physical properties, study of nanostructure formation technology based on cluster manipulation, study of nanostructure formation processes using chemical reaction control and local structure analysis, study of new properties of correlation-intensive electron based new materials, study of spin measuring technology, and the study of theoretical analysis of atom/molecule dynamic processes. (NEDO)

  6. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  7. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    Science.gov (United States)

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  8. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

  9. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    Science.gov (United States)

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  10. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    Science.gov (United States)

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  11. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  12. Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA

    Science.gov (United States)

    Altiparmak, Melek; Nakiboglu Tezer, Mahmure

    2009-01-01

    Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…

  13. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  14. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    Science.gov (United States)

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  15. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  16. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  18. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  19. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  20. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  1. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  2. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  3. Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

    International Nuclear Information System (INIS)

    Pham, Quang Trung

    2014-01-01

    The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

  4. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  5. Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level

    OpenAIRE

    Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik

    2012-01-01

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...

  6. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  7. Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.

    Science.gov (United States)

    Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik

    2012-06-27

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.

  8. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  9. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    Energy Technology Data Exchange (ETDEWEB)

    Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

  10. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  11. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  12. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  13. FY 1998 annual summary report on manipulation of atomic and molecular extremes. Development of technologies for high-efficiency analysis/manipulation of DNA and the like; 1998 nendo genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho. DNA nado kokoritsu kaiseki sosa gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-03-01

    The objectives are set to establish the techniques for observation/manipulation of atoms and molecules, as the common basic techniques for various industrial areas, e.g., new materials, electronics, biotechnology and chemical. Development of atomic field and scanning tunneling microscopes working under extreme conditions has been pursued, in order to manipulate complex systems, such as living body. For identification of molecular species, laser-excited fluorescence is combined with scanning mechanical probing to further refine the single molecule detection/identification techniques, and the objectives are set to develop a new method for evaluating molecules in a living body using a scanning probe microscope, and also to develop a novel scanning probe microscope for molecules in a living body. The other efforts were directed to R and D of the techniques for observing structures of organic molecules and the like through the measurements of adsorption process of organic molecules and clusters on semiconductor substrates and their surface reactions, and precision measurements of vibrational conditions of adsorbed molecular species reacting in the solid-liquid interfaces by high-sensitivity Raman spectroscopy to elucidate the catalysis mechanisms at the molecular level. (NEDO)

  14. 77 FR 54584 - Final Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH...

    Science.gov (United States)

    2012-09-05

    ... changes. Human gene transfer also raises scientific, medical, social, and ethical considerations that... currently reviewed under Section III-B-1, Experiments Involving the Cloning of Toxin Molecules with LD50 of...

  15. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-01-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners

  16. Size and number of DNA molecules from Chinese hamster ovary cells determined by molecular autoradiography

    International Nuclear Information System (INIS)

    Todd, M.B.

    1980-06-01

    A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome

  17. Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

    Science.gov (United States)

    Hatlo, Marius M.; Panja, Debabrata; van Roij, René

    2011-08-01

    Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

  18. Atomic and molecular manipulation

    CERN Document Server

    Mayne, Andrew J

    2011-01-01

    Work with individual atoms and molecules aims to demonstrate that miniaturized electronic, optical, magnetic, and mechanical devices can operate ultimately even at the level of a single atom or molecule. As such, atomic and molecular manipulation has played an emblematic role in the development of the field of nanoscience. New methods based on the use of the scanning tunnelling microscope (STM) have been developed to characterize and manipulate all the degrees of freedom of individual atoms and molecules with an unprecedented precision. In the meantime, new concepts have emerged to design molecules and substrates having specific optical, mechanical and electronic functions, thus opening the way to the fabrication of real nano-machines. Manipulation of individual atoms and molecules has also opened up completely new areas of research and knowledge, raising fundamental questions of "Optics at the atomic scale", "Mechanics at the atomic scale", Electronics at the atomic scale", "Quantum physics at the atomic sca...

  19. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  20. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  1. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  2. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  3. A new fast algorithm for solving the minimum spanning tree problem based on DNA molecules computation.

    Science.gov (United States)

    Wang, Zhaocai; Huang, Dongmei; Meng, Huajun; Tang, Chengpei

    2013-10-01

    The minimum spanning tree (MST) problem is to find minimum edge connected subsets containing all the vertex of a given undirected graph. It is a vitally important NP-complete problem in graph theory and applied mathematics, having numerous real life applications. Moreover in previous studies, DNA molecular operations usually were used to solve NP-complete head-to-tail path search problems, rarely for NP-hard problems with multi-lateral path solutions result, such as the minimum spanning tree problem. In this paper, we present a new fast DNA algorithm for solving the MST problem using DNA molecular operations. For an undirected graph with n vertex and m edges, we reasonably design flexible length DNA strands representing the vertex and edges, take appropriate steps and get the solutions of the MST problem in proper length range and O(3m+n) time complexity. We extend the application of DNA molecular operations and simultaneity simplify the complexity of the computation. Results of computer simulative experiments show that the proposed method updates some of the best known values with very short time and that the proposed method provides a better performance with solution accuracy over existing algorithms. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  4. Nanoconfinement-enhanced conformational response of single DNA molecules to changes in ionic environment

    DEFF Research Database (Denmark)

    Reisner, Walter; Beech, J. P.; Larsen, Niels Bent

    2007-01-01

    100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....

  5. DNA Knots: Theory and Experiments

    Science.gov (United States)

    Sumners, D. W.

    Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.

  6. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.

    1983-01-01

    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  7. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David

    2013-01-01

    as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....

  8. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    Science.gov (United States)

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  9. DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].

    Science.gov (United States)

    2001

    This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…

  10. True single-molecule DNA sequencing of a pleistocene horse bone

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa

    2011-01-01

    -preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...

  11. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  12. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    Science.gov (United States)

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  13. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    Science.gov (United States)

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  14. Interactive measurement and characterization of DNA molecules by analysis of AFM images

    Czech Academy of Sciences Publication Activity Database

    Marek, J.; Demjénová, E.; Tomori, Z.; Janáček, Jiří; Zolotová, I.; Valle, F.; Favre, M.; Dietler, G.

    2005-01-01

    Roč. 63, č. 2 (2005), s. 87-93 ISSN 1552-4922 Grant - others:VEGA(SK) 5048; VEGA(SK) 2185; CZ-SK(CZ) KONTAKT 139; Swiss National Science Foundation(CH) 2100-063746.00/1 Institutional research plan: CEZ:AV0Z5011922 Keywords : DNA * atomic force microscopy * interactive image analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.115, year: 2005

  15. Function of the UVR marker in dark repair of DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

    1975-01-01

    It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.

  16. Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

    Science.gov (United States)

    Gopinath, Ashwin; Rothemund, Paul W K

    2014-12-23

    Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

  17. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules

    Science.gov (United States)

    Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung

    2018-03-01

    Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.

  18. The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

    International Nuclear Information System (INIS)

    Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

    2008-01-01

    We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

  19. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  20. A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

    DEFF Research Database (Denmark)

    Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

    2014-01-01

    . The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

  1. Fiscal 1998 project for research and development of industrial and scientific technologies. Report on the achievements of the 'research and development of an ultimate atom and molecule manipulation technology' (Research and development of an ultimate atom and molecule manipulation technology); 1998 nendo genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho. Genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    This paper reports the achievements in fiscal 1998 on the 'research and development of an ultimate atom and molecule manipulation technology' having been performed by the concentrated research institution established jointly with the National Institute for Advanced Inter-disciplinary Research of the Agency of Industrial Science and Technology, referred to as the 'atom-technology research body'. In improving the calculation methods, development has been launched on a method capable of executing calculations in more realistic time period, substituting the Green function method that consumes a huge amount of time. The research trend survey was performed by visiting and participating with various organizations and academic societies in America and Britain. Development was attempted on a small spin detector for use in a spin polarization scanning electron microscope for high-resolution magnetized section observation. In the development, investigation was made on the relationship between accelerated voltage and the spin detector to obtain the detection efficiency equivalent to or better than that of the conventional mott-spin detector, while aiming at reducing the operation voltage and reducing the dimensions. As a result, it was disclosed that sufficient efficiency may be obtained if such a condition as thickness of the thin gold film is adjusted even at low accelerated voltage. In addition, with an objective to reduce the operation voltage of the small spin detector, an MCP was employed in the detector. (NEDO)

  2. Thermodynamics on Soluble Carbon Nanotubes: How Do DNA Molecules Replace Surfactants on Carbon Nanotubes?

    Science.gov (United States)

    Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi

    2012-01-01

    Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502

  3. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  4. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  5. Xeroderma pigmentosum and other diseases of human premature aging and DNA repair: Molecules to patients

    Science.gov (United States)

    Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.

    2012-01-01

    A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183

  6. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  7. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  8. Comparison of DNA Extraction Methods in Terms of Yield, Purity, Long-Term Storage, and Downstream Manipulation with Brewer's Yeast Chromosomal DNA

    Czech Academy of Sciences Publication Activity Database

    Kopecká, J.; Matoulková, D.; Němec, M.; Jelínková, Markéta; Felsberg, Jürgen

    2014-01-01

    Roč. 72, č. 1 (2014), s. 1-5 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Brewer's yeast * Isolation of DNA * Phenol/chloroform extraction Subject RIV: EE - Microbiology, Virology Impact factor: 0.886, year: 2014

  9. Observing dynamics of chromatin fibers in Xenopus egg extracts by single DNA manipulation using a transverse magnetic tweezer setup

    Science.gov (United States)

    Yan, Jie; Skoko, Dunja; Marko, John; Maresca, Tom; Heald, Rebecca

    2005-03-01

    We have studied assembly of chromatin on single DNAs using Xenopus egg extracts and a specially designed magnetic tweezer setup which generates controlled force in the focal plane of the objective, allowing us to visualize and measure DNA extension under a wide range of constant tensions. We found, in the absence of ATP, interphase extracts assembled nucleosomes against DNA tensions of up to 3.5 piconewtons (pN). We observed force-induced disassembly and opening-closing fluctuations indicating our experiments were in mechano-chemical equilibrium. We found that the ATP-depleted reaction can do mechanical work of 27 kcal/mol per nucleosome, providing a measurement of the free energy difference between core histone octamers on and off DNA. Addition of ATP leads to highly dynamic behavior: time courses show processive runs of assembly and disassembly of not observed in the -ATP case, with forces of 2 pN leading to nearly complete fiber disassembly. Our study shows that ATP hydrolysis plays a major role in nucleosome rearrangement and removal, and suggests that chromatin in vivo may be subject to continual assembly and disassembly.

  10. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  11. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  12. Manipulation of polyatomic molecules with the scanning tunnelling microscope at room temperature: chlorobenzene adsorption and desorption from Si(111)-(7 x 7)

    International Nuclear Information System (INIS)

    Sloan, P A; Palmer, R E

    2006-01-01

    We report the imaging of chlorobenzene molecules chemisorbed on the Si(111)-(7 x 7) surface at room temperature with the scanning tunnelling microscope, and the desorption of the molecules by the tunnelling current. Detailed voltage-dependent imaging (at positive bias) allows the elucidation of the number and orientation of all the adsorbate configurations in the 7 x 7 unit cell. At negative bias the adsorbate was observed to affect the imaging properties of neighbouring half unit cells. The threshold voltage required for desorption of the chlorobenzene molecules was invariant to small changes in the tip-state, the adsorption site (corner adatom, middle adatom, faulted or unfaulted half of the unit cell) and the kind of doping of the substrate (n or p type)

  13. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  14. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  15. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    Directory of Open Access Journals (Sweden)

    Lindy L. Esterhuizen

    2012-09-01

    Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

  16. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    Science.gov (United States)

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  19. A manipulator

    International Nuclear Information System (INIS)

    Cole, G.V.; Hofmann, D.A.; Ashby, R.

    1984-01-01

    A manipulator is described, for remote handling of objects within an enclosure, by an operator outside the enclosure. The manipulator consists of a telescopically extensible arm member, the action of which is controlled by a motor-driven lead screw. (U.K.)

  20. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  1. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  2. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

    Science.gov (United States)

    Nayak, Alpana; Suresh, K. A.

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  3. Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.

    Science.gov (United States)

    Yang, Darren; Wong, Wesley P

    2018-01-01

    We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.

  4. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  5. Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

    International Nuclear Information System (INIS)

    Tabet, J.

    2007-11-01

    The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

  6. Solid-state nanopores for scanning single molecules and mimicking biology

    NARCIS (Netherlands)

    Kowalczyk, S.W.

    2011-01-01

    Solid-state nanopores, nanometer-size holes in a thin synthetic membrane, are a versatile tool for the detection and manipulation of charged biomolecules. This thesis describes mostly experimental work on DNA translocation through solid-state nanopores, which we study at the single-molecule level.

  7. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  8. Electrical manipulation of oligonucleotides grafted to charged surfaces.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard; Tornow, Marc

    2006-09-21

    The electrical manipulation of short DNA molecules on surfaces offers novel functionalities with fascinating possibilities in the field of bio-interfaces. Here we present systematic investigations of the electrical interactions which govern the structure of oligonucleotides on charged gold surfaces. Successively, we address influences of the applied field strength, the role of DC electrode potentials, in particular for polycrystalline surfaces, as well as screening effects of the surrounding electrolyte solution. Data obtained for single and double stranded DNA exhibit differences which can be attributed to the dissimilar flexibility of the different molecular conformations. A comparison of the experimental results with a basic model shows how the alignment of the molecules adjusts according to a balance between electrically induced ordering and stochastic thermal motions. The presented conclusions are expected to be of general relevance for the behaviour of polyelectrolytes exposed to localized electric fields at interfaces.

  9. Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

  10. Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers.

    Science.gov (United States)

    Eguchi, Asuka; Lee, Garrett O; Wan, Fang; Erwin, Graham S; Ansari, Aseem Z

    2014-09-15

    Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate.

  11. Manipulatives Work!

    Science.gov (United States)

    Moch, Peggy L.

    2001-01-01

    Fifth graders (n=16) engaged in manipulative activities to improve their grasp of math concepts; one-third were identified as exceptional children. Posttest results after 12 lessons showed the overall class average increased from 49% to 59% and all areas improved compared to pretest scores. Attitude changes were also apparent. (Contains 24…

  12. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  13. A polarized view on DNA under tension

    Science.gov (United States)

    van Mameren, Joost; Vermeulen, Karen; Wuite, Gijs J. L.; Peterman, Erwin J. G.

    2018-03-01

    In the past decades, sensitive fluorescence microscopy techniques have contributed significantly to our understanding of the dynamics of DNA. The specific labeling of DNA using intercalating dyes has allowed for quantitative measurement of the thermal fluctuations the polymers undergo. On the other hand, recent advances in single-molecule manipulation techniques have unraveled the mechanical and elastic properties of this intricate polymer. Here, we have combined these two approaches to study the conformational dynamics of DNA under a wide range of tensions. Using polarized fluorescence microscopy in conjunction with optical-tweezers-based manipulation of YOYO-intercalated DNA, we controllably align the YOYO dyes using DNA tension, enabling us to disentangle the rapid dynamics of the dyes from that of the DNA itself. With unprecedented control of the DNA alignment, we resolve an inconsistency in reports about the tilted orientation of intercalated dyes. We find that intercalated dyes are on average oriented perpendicular to the long axis of the DNA, yet undergo fast dynamics on the time scale of absorption and fluorescence emission. In the overstretching transition of double-stranded DNA, we do not observe changes in orientation or orientational dynamics of the dyes. Only beyond the overstretching transition, a considerable depolarization is observed, presumably caused by an average tilting of the DNA base pairs. Our combined approach thus contributes to the elucidation of unique features of the molecular dynamics of DNA.

  14. MAGNETIC TWEEZERS FOR THE STUDY OF DNA TRACKING MOTORS

    Science.gov (United States)

    Manosas, Maria; Meglio, Adrien; Spiering, Michelle M.; Ding, Fangyuan; Benkovic, Stephen J.; Barre, François-Xavier; Saleh, Omar A.; Allemand, Jean François; Bensimon, David; Croquette, Vincent

    2011-01-01

    Single-molecule manipulation methods have opened a new vista on the study of molecular motors. Here we describe the use of magnetic traps for the investigation of the mechanism of DNA based motors, in particular helicases and translocases. PMID:20627163

  15. A prototype storage ring for neutral molecules

    NARCIS (Netherlands)

    Crompvoets, F. M. H.; Bethlem, H. L.; Jongma, R.T.; Meijer, G.

    2001-01-01

    The ability to cool and manipulate atoms with light has yielded atom interferometry, precision spectroscopy, Bose-Einstein condensates and atom lasers. The extension of controlled manipulation to molecules is expected to be similarly rewarding, but molecules are not as amenable to manipulation by

  16. Periodically arranged benzene-linker molecules on boron-doped single-crystalline diamond films for DNA

    Czech Academy of Sciences Publication Activity Database

    Shin, D.; Tokuda, N.; Rezek, Bohuslav; Nebel, C.E.

    2006-01-01

    Roč. 8, - (2006), s. 844-850 ISSN 1388-2481 Institutional research plan: CEZ:AV0Z10100521 Keywords : electrochemical surface modification * single-crystalline CVD diamond * covalent DNA Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.484, year: 2006

  17. On-chip Detection of Rolling Circle Amplified DNA Molecules from Bacillus Globigii spores and Vibrio Cholerae

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Donolato, Marco

    2014-01-01

    For the first time DNA coils formed by rolling circle amplification are quantified on-chip by Brownian relaxation measurements on magnetic nanobeads using a magnetoresistive sensor. No external magnetic fields are required besides the magnetic field arising from the current through the sensor...

  18. Currency Manipulation

    OpenAIRE

    Weithing Zhang; Thomas Mertens; Tarek Hassan

    2014-01-01

    Many central banks manage the stochastic behavior of their currencies' exchange rates by imposing pegs relative to a target currency. We study the effects of such currency manipulation in a multi-country model of exchange rate determination with endogenous capital accumulation. We find that the imposition of an exchange rate peg relative to a given target currency increases the volatility of consumption in the target country and decreases the volatility of the target currency's exchange rate ...

  19. Hydraulic manipulator

    International Nuclear Information System (INIS)

    Sinha, A.K.; Srikrishnamurty, G.

    1990-01-01

    Successful operation of nuclear plant is largely dependent on safe handling of radio-active material. In order to reduce this handling problem and minimise the exposure of radiation, various handling equipment and manipulators have been developed according to the requirements. Manufacture of nuclear fuel, which is the most important part of the nuclear industry, involves handling of uranium ingots weighing approximately 250 kg. This paper describes a specially designed hydraulic manipulator for handling of the ingots in a limited space. It was designed to grab and handle the ingots in any position. This has following drive motions: (1)gripping and releasing, (2)lifting and lowering (z-motion), (3)rotation about the horizontal axis (azimuth drive), (4)rotation about the job axis, and (5)rotation about the vertical axis. For horizontal motion (X and Y axis motion) this equipment is mounted on a motorised trolley, so that it can move inside the workshop. For all drives except the rotation about the job axis, hydraulic cylinders have been used with a battery operated power pack. Trolley drive is also given power from same battery. This paper describes the design aspects of this manipulator. (author). 4 figs

  20. Small molecule inhibitors uncover synthetic genetic interactions of human flap endonuclease 1 (FEN1 with DNA damage response genes.

    Directory of Open Access Journals (Sweden)

    Thomas A Ward

    Full Text Available Flap endonuclease 1 (FEN1 is a structure selective endonuclease required for proficient DNA replication and the repair of DNA damage. Cellularly active inhibitors of this enzyme have previously been shown to induce a DNA damage response and, ultimately, cell death. High-throughput screens of human cancer cell-lines identify colorectal and gastric cell-lines with microsatellite instability (MSI as enriched for cellular sensitivity to N-hydroxyurea series inhibitors of FEN1, but not the PARP inhibitor olaparib or other inhibitors of the DNA damage response. This sensitivity is due to a synthetic lethal interaction between FEN1 and MRE11A, which is often mutated in MSI cancers through instabilities at a poly(T microsatellite repeat. Disruption of ATM is similarly synthetic lethal with FEN1 inhibition, suggesting that disruption of FEN1 function leads to the accumulation of DNA double-strand breaks. These are likely a result of the accumulation of aberrant replication forks, that accumulate as a consequence of a failure in Okazaki fragment maturation, as inhibition of FEN1 is toxic in cells disrupted for the Fanconi anemia pathway and post-replication repair. Furthermore, RAD51 foci accumulate as a consequence of FEN1 inhibition and the toxicity of FEN1 inhibitors increases in cells disrupted for the homologous recombination pathway, suggesting a role for homologous recombination in the resolution of damage induced by FEN1 inhibition. Finally, FEN1 appears to be required for the repair of damage induced by olaparib and cisplatin within the Fanconi anemia pathway, and may play a role in the repair of damage associated with its own disruption.

  1. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

    Science.gov (United States)

    Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

    2018-04-18

    Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

  3. Construction of a Holliday Junction in Small Circular DNA Molecules for Stable Motifs and Two-Dimensional Lattices.

    Science.gov (United States)

    Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun

    2018-04-12

    Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Vingt ans après (Twenty years after). Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    Science.gov (United States)

    Grosberg, Alexander Y.

    2016-09-01

    The effect of DNA topology simplification by type II topoisomerase enzymes was discovered experimentally by Rybenkov et al. [1] 20 years ago - which motivates me to borrow the title for this comment from Alexandre Dumas [2]. Ever since the original discovery, the effect keeps entertaining theorists - but the most surprising fact is that the original experiment was never repeated, let alone improved. I do not understand why it is so. In my opinion, there is an acute need of new experiments, not only repeating the original measurements, but also examining numerous other aspects of the phenomenon. In this sense, the review [3] by Vologodskii, one of the original discoverers, is both timely and important. In his review, Vologodskii concentrates on what I would call mechanical aspect of the problem - how bent are T- and G-segments, what kinds of juxtaposition are relevant, etc. The importance of these issues notwithstanding, I want to complement this approach, and to consider in greater detail the thermodynamics of the process. My main points are as follows: action of topo II enzyme violates detailed balance for DNA, leading to circular currents and dissipation (which is indeed quite a common occurrence in many living systems). These currents are potentially observable, and dissipation measurable, which should challenge experimenters. The main goal of this comment is to show how general phenomenological point of view allows to formulate theoretical prediction for the energy dissipation rate.

  5. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  6. Mechanistic study of DNA damage and radioprotection of small molecule treatment in the irradiated proliferating and quiescent human lung fibroblast cells

    International Nuclear Information System (INIS)

    Dai, Jiawen; Baskar, Rajamanickam

    2014-01-01

    Ionizing radiation is an invaluable diagnostic and treatment tool used in various clinical applications and also in cancer control. However, assessing normal tissue injury is of a great interest. Since radiation sensitivity varies with different phases of cell cycle, understanding how these cells differ in their sensitivity will help to prevent or reduce the radiation injury. We have used both proliferating and quiescent human normal lung fibroblast cells and investigated key proteins involved in the cell cycle, DNA damage and death, further the radioprotective role of small molecule after low doses (d ≤1Gy) of radiation exposure. Among the cell cycle/death proteins investigated, p53 and phosphorylation of p53 (Ser-15) were induced in both the proliferating and quiescent phases of cells when studied at different time intervals. In the proliferating cells after irradiation along with p53, cyclin dependent kinase (CDK) inhibitors p21, p27 were induced. However, similarly in the quiescent cells along with the p53, p21 and p27 were also induced. The DNA damage assessed by phosphorylation of histone H2AX expression showed an increase even in the non-dividing quiescent cells after 1 Gy of radiation exposure. Whereas cell cycle proteins Cyclin A and E and cell death proteins Bax and cytochrome-c did not show any increase in the quiescent cells. In conclusion, human normal lung fibroblast cells that are not actively dividing are also showed similar radiation response as of proliferating cells. Furthermore, proliferating and quiescent cells treated with small molecules attenuate p53 and its downstream target protein p21 indicating radioprotection of the cells. The specific activation of p53, phosphorylation of p53 (Ser-15), p21 and phosphorylation of histone H2AX following radiation doses of d ≤ 1 Gy in the quiescent cells demonstrated in this study may give us a better understanding about the radiation response of non-dividing fibroblast cells, which is present in many

  7. Single-Molecule Stochastic Resonance

    Directory of Open Access Journals (Sweden)

    K. Hayashi

    2012-08-01

    Full Text Available Stochastic resonance (SR is a well-known phenomenon in dynamical systems. It consists of the amplification and optimization of the response of a system assisted by stochastic (random or probabilistic noise. Here we carry out the first experimental study of SR in single DNA hairpins which exhibit cooperatively transitions from folded to unfolded configurations under the action of an oscillating mechanical force applied with optical tweezers. By varying the frequency of the force oscillation, we investigate the folding and unfolding kinetics of DNA hairpins in a periodically driven bistable free-energy potential. We measure several SR quantifiers under varied conditions of the experimental setup such as trap stiffness and length of the molecular handles used for single-molecule manipulation. We find that a good quantifier of the SR is the signal-to-noise ratio (SNR of the spectral density of measured fluctuations in molecular extension of the DNA hairpins. The frequency dependence of the SNR exhibits a peak at a frequency value given by the resonance-matching condition. Finally, we carry out experiments on short hairpins that show how SR might be useful for enhancing the detection of conformational molecular transitions of low SNR.

  8. Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices

    Science.gov (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.

    2013-01-01

    In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

  9. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  10. Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. I. Construction of single chromosomal DNA libraries.

    Science.gov (United States)

    Huang, D; Wu, W; Zhou, Y; Hu, Z; Lu, L

    2004-05-01

    Construction of single chromosomal DNA libraries by means of chromosome microdissection and microcloning will be useful for genomic research, especially for those species that have not been extensively studied genetically. Application of the technology of microdissection and microcloning to woody fruit plants has not been reported hitherto, largely due to the generally small sizes of metaphase chromosomes and the difficulty of chromosome preparation. The present study was performed to establish a method for single chromosome microdissection and microcloning in woody fruit species using pomelo as a model. The standard karyotype of a pomelo cultivar ( Citrus grandis cv. Guanxi) was established based on 20 prometaphase photomicrographs. According to the standard karyotype, chromosome 1 was identified and isolated with fine glass microneedles controlled by a micromanipulator. DNA fragments ranging from 0.3 kb to 2 kb were acquired from the isolated single chromosome 1 via two rounds of PCR mediated by Sau3A linker adaptors and then cloned into T-easy vectors to generate a DNA library of chromosome 1. Approximately 30,000 recombinant clones were obtained. Evaluation based on 108 randomly selected clones showed that the sizes of the cloned inserts varied from 0.5 kb to 1.5 kb with an average of 860 bp. Our research suggests that microdissection and microcloning of single small chromosomes in woody plants is feasible.

  11. DNA Repair Systems

    Indian Academy of Sciences (India)

    DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

  12. Purification of functionalized DNA origami nanostructures.

    Science.gov (United States)

    Shaw, Alan; Benson, Erik; Högberg, Björn

    2015-05-26

    The high programmability of DNA origami has provided tools for precise manipulation of matter at the nanoscale. This manipulation of matter opens up the possibility to arrange functional elements for a diverse range of applications that utilize the nanometer precision provided by these structures. However, the realization of functionalized DNA origami still suffers from imperfect production methods, in particular in the purification step, where excess material is separated from the desired functionalized DNA origami. In this article we demonstrate and optimize two purification methods that have not previously been applied to DNA origami. In addition, we provide a systematic study comparing the purification efficacy of these and five other commonly used purification methods. Three types of functionalized DNA origami were used as model systems in this study. DNA origami was patterned with either small molecules, antibodies, or larger proteins. With the results of our work we aim to provide a guideline in quality fabrication of various types of functionalized DNA origami and to provide a route for scalable production of these promising tools.

  13. DNA molecules and human therapeutics

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-29

    Dec 29, 2009 ... vectors, display non-toxicity and are simpler to develop. This review ... technology as well as a staged delivery mechanism for the introduction of plasmid-borne gene to target cells via the ... pathogen's gene to provide immunity against diseases by ... human cytomegalovirus, simian virus, human elongation.

  14. Expression of DNA Damage Response Molecules PARP1, γH2AX, BRCA1, and BRCA2 Predicts Poor Survival of Breast Carcinoma Patients

    Directory of Open Access Journals (Sweden)

    See-Hyoung Park

    2015-08-01

    Full Text Available BACKGROUND: Poly(ADP-ribose polymerase 1 (PARP1, γH2AX, BRCA1, and BRCA2 are conventional molecular indicators of DNA damage in cells and are often overexpressed in various cancers. In this study, we aimed, using immunohistochemical detection, whether the co-expression of PARP1, γH2AX, BRCA1, and BRCA2 in breast carcinoma (BCA tissue can provide more reliable prediction of survival of BCA patients. MATERIALS AND METHODS: We investigated immunohistochemical expression and prognostic significance of the expression of PARP1, γH2AX, BRCA1, and BRCA2 in 192 cases of BCAs. RESULTS: The expression of these four molecules predicted earlier distant metastatic relapse, shorter overall survival (OS, and relapse-free survival (RFS by univariate analysis. Multivariate analysis revealed the expression of PARP1, γH2AX, and BRCA2 as independent poor prognostic indicators of OS and RFS. In addition, the combined expressional pattern of BRCA1, BRCA2, PARP1, and γH2AX (CSbbph was an additional independent prognostic predictor for OS (P < .001 and RFS (P < .001. The 10-year OS rate was 95% in the CSbbph-low (CSbbph scores 0 and 1 subgroup, but that was only 35% in the CSbbph-high (CSbbph score 4 subgroup. CONCLUSION: This study has demonstrated that the individual and combined expression patterns of PARP1, γH2AX, BRCA1, and BRCA2 could be helpful in determining an accurate prognosis for BCA patients and for the selection of BCA patients who could potentially benefit from anti-PARP1 therapy with a combination of genotoxic chemotherapeutic agents.

  15. Currency Manipulation versus Current Account Manipulation

    OpenAIRE

    Junning Cai

    2005-01-01

    It is said that a country’s currency peg can become currency manipulation representing protracted government intervention in the foreign exchange market that gives it unfair competitive advantage in international trade yet prevents effective balance of payments in its trade partners. Regarding this widespread fallacy, this paper explains why currency peg is not currency manipulation even when it keeps a country’s currency undervalued. We clarify that 1) government is inherently a major player...

  16. Serogroup-level resolution of the “Super-7” Shiga toxin-producing Escherichia coli using nanopore single-molecule DNA sequencing

    Science.gov (United States)

    DNA sequencing and other DNA-based methods, such as PCR, are now broadly used for detection and identification of bacterial foodborne pathogens. For the identification of foodborne bacterial pathogens, it is important to make taxonomic assignments to the species, or even subspecies level. Long-read ...

  17. Paramagnetic decoration of DNA origami nanostructures by Eu³⁺ coordination.

    Science.gov (United States)

    Opherden, Lars; Oertel, Jana; Barkleit, Astrid; Fahmy, Karim; Keller, Adrian

    2014-07-15

    The folding of DNA into arbitrary two- and three-dimensional shapes, called DNA origami, represents a powerful tool for the synthesis of functional nanostructures. Here, we present the first approach toward the paramagnetic functionalization of DNA origami nanostructures by utilizing postassembly coordination with Eu(3+) ions. In contrast to the usual formation of toroidal dsDNA condensates in the presence of trivalent cations, planar as well as rod-like DNA origami maintain their shape and monomeric state even under high loading with the trivalent lanthanide. Europium coordination was demonstrated by the change in Eu(3+) luminescence upon binding to the two DNA origami. Their natural circular dichroism in the Mg(2+)- and Eu(3+)-bound state was found to be very similar to that of genomic DNA, evidencing little influence of the DNA origami superstructure on the local chirality of the stacked base pairs. In contrast, the magnetic circular dichroism of the Mg(2+)-bound DNA origami deviates from that of genomic DNA. Furthermore, the lanthanide affects the magnetic properties of DNA in a superstructure-dependent fashion, indicative of the existence of superstructure-specific geometry of Eu(3+) binding sites in the DNA origami that are not formed in genomic DNA. This simple approach lays the foundation for the generation of magneto-responsive DNA origami nanostructures. Such systems do not require covalent modifications and can be used for the magnetic manipulation of DNA nanostructures or for the paramagnetic alignment of molecules in NMR spectroscopy.

  18. Atomic and Molecular Manipulation of Chemical Interactions

    National Research Council Canada - National Science Library

    Ho, Wilson

    2007-01-01

    .... In effect, the goal is to carry out chemical changes by manipulating individual atoms and molecules to induce different bonding geometry and to create new interactions with their environment. These studies provide the scientific basis for the advancement of technology in catalysis, molecular electronics, optics, chemical and biological sensing, and magnetic storage.

  19. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  20. Single-molecule experiments in biological physics: methods and applications.

    Science.gov (United States)

    Ritort, F

    2006-08-16

    I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives.

  1. Single-molecule experiments in biological physics: methods and applications

    International Nuclear Information System (INIS)

    Ritort, F

    2006-01-01

    I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives. (topical review)

  2. Manipulating early pig embryos.

    Science.gov (United States)

    Niemann, H; Reichelt, B

    1993-01-01

    On the basis of established surgical procedures for embryo recovery and transfer, the early pig embryo can be subjected to various manipulations aimed at a long-term preservation of genetic material, the generation of identical multiplets, the early determination of sex or the alteration of the genetic make-up. Most of these procedures are still at an experimental stage and despite recent considerable progress are far from practical application. Normal piglets have been obtained after cryopreservation of pig blastocysts hatched in vitro, whereas all attempts to freeze embryos with intact zona pellucida have been unsuccessful. Pig embryos at the morula and blastocyst stage can be bisected microsurgically and the resulting demi-embryos possess a high developmental potential in vitro, whereas their development in vivo is impaired. Pregnancy rates are similar (80%) but litter size is reduced compared with intact embryos and twinning rate is approximately 2%. Pig blastomeres isolated from embryos up to the 16-cell stage can be grown in culture and result in normal blastocysts. Normal piglets have been born upon transfer of blastocysts derived from isolated eight-cell blastomeres, clearly underlining the totipotency of this developmental stage. Upon nuclear transfer the developmental capacity of reconstituted pig embryos is low and culture. Sex determination can be achieved either by separation of X and Y chromosome bearing spermatozoa by flow cytometry or by analysing the expression of the HY antigen in pig embryos from the eight-cell to morula stage. Microinjection of foreign DNA has been successfully used to alter growth and development of transgenic pigs, and to produce foreign proteins in the mammary gland or in the bloodstream, indicating that pigs can be used as donors for valuable human pharmaceutical proteins. Another promising area of gene transfer is the increase of disease resistance in transgenic lines of pigs. Approximately 30% of pig spermatozoa bind

  3. Getting Manipulative about Math.

    Science.gov (United States)

    Scheer, Janet K.; And Others

    1984-01-01

    Math manipulatives that are made from inexpensive, common items help students understand basic mathematics concepts. Learning activities using Cheerios, jellybeans, and clay as teaching materials are suggested. (DF)

  4. Manipulators in teleoperation

    International Nuclear Information System (INIS)

    Hamel, W.R.

    1985-01-01

    Teleoperated manipulators represent a mature technology which has evolved over nearly 40 years of applications experience. The wide range of manipulator concepts developed thus far reflect differing applications, priorities, and philosophies. The technology of teleoperated manipulators is in a rapid state of change (just as are industrial robotics) fueled by microelectronics and materials advances. Large strides in performance and dexterity are now practical and advantageous. Even though improved controls and sensory feedback will increase functionality, overall costs should be reduced as manipulator fabrication and assembly labor costs are reduced through improved manufacturing technology. As these advances begin to materialize, broader applications in nonnuclear areas should occur

  5. Direction of Intercalation of a bis-Ru(II) Complex to DNA Probed by a Minor Groove Binding Molecule 4',6-Diamidino-2-phenylindole

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)

    2013-10-15

    Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.

  6. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  7. Master-slave manipulator

    International Nuclear Information System (INIS)

    Haaker, L.W.; Jelatis, D.G.

    1981-01-01

    A remote control master-slave manipulator for performing work on the opposite side of a barrier wall, is described. The manipulator consists of a rotatable horizontal support adapted to extend through the wall and two longitudinally extensible arms, a master and a slave, pivotally connected one to each end of the support. (U.K.)

  8. In Praise of Manipulation

    NARCIS (Netherlands)

    Dowding, Keith; Van Hees, Martin

    Many theorists believe that the manipulation of voting procedures is a serious problem. Accordingly, much of social choice theory examines the conditions under which strategy-proofness can be ensured, and what kind of procedures do a better job of preventing manipulation. This article argues that

  9. Cell manipulation in microfluidics

    International Nuclear Information System (INIS)

    Yun, Hoyoung; Kim, Kisoo; Lee, Won Gu

    2013-01-01

    Recent advances in the lab-on-a-chip field in association with nano/microfluidics have been made for new applications and functionalities to the fields of molecular biology, genetic analysis and proteomics, enabling the expansion of the cell biology field. Specifically, microfluidics has provided promising tools for enhancing cell biological research, since it has the ability to precisely control the cellular environment, to easily mimic heterogeneous cellular environment by multiplexing, and to analyze sub-cellular information by high-contents screening assays at the single-cell level. Various cell manipulation techniques in microfluidics have been developed in accordance with specific objectives and applications. In this review, we examine the latest achievements of cell manipulation techniques in microfluidics by categorizing externally applied forces for manipulation: (i) optical, (ii) magnetic, (iii) electrical, (iv) mechanical and (v) other manipulations. We furthermore focus on history where the manipulation techniques originate and also discuss future perspectives with key examples where available. (topical review)

  10. Manipulator comparative testing program

    International Nuclear Information System (INIS)

    Draper, J.V.; Handel, S.J.; Sundstrom, E.; Herndon, J.N.; Fujita, Y.; Maeda, M.

    1986-01-01

    The Manipulator Comparative Testing Program examined differences among manipulator systems from the United States and Japan. The manipulator systems included the Meidensha BILARM 83A, the Model M-2 of Central Research Laboratories Division of Sargent Industries (CRL), and the GCA Corporation PaR Systems Model 6000. The site of testing was the Remote Operations Maintenance Demonstration (ROMD) facility, operated by the Fuel Recycle Division in the Consolidated Fuel Reprocessing Program at the Oak Ridge National Laboratory (ORNL). In all stages of testing, operators using the CRL Model M-2 manipulator had consistently lower times to completion and error rates than they did using other machines. Performance was second best with the Meidensha BILARM 83A in master-slave mode. Performance with the BILARM in switchbox mode and the PaR 6000 manipulator was approximately equivalent in terms of criteria recorded in testing. These data show no impact of force reflection on task performance

  11. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

    1988-01-01

    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  12. Towards characterization of DNA structure under physiological conditions in vivo at the single-molecule level using single-pair FRET

    Czech Academy of Sciences Publication Activity Database

    Fessl, Tomáš; Adamec, František; Polívka, Tomáš; Foldynová-Trantírková, Silvie; Vácha, František; Trantírek, L.

    2012-01-01

    Roč. 40, č. 16 (2012), s. 10 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z60220518 Keywords : in-cell FRET * fluorescence * DNA * nucleic acid * ATTO * in vivo Subject RIV: BO - Biophysics Impact factor: 8.278, year: 2012

  13. Site-directed mutational analysis of structural interactions of low molecule compounds binding to the N-terminal 8 kDa domain of DNA polymerase β

    International Nuclear Information System (INIS)

    Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo

    2006-01-01

    We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA

  14. DNA origami based Au–Ag-core–shell nanoparticle dimers with single-molecule SERS sensitivity† †Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA bands, SEM images, additional AFM images, FDTD simulations, additional reference spectra for Cy3 and detailed description of EF estimation, simulated absorption and scattering spectra. See DOI: 10.1039/c5nr08674d Click here for additional data file.

    Science.gov (United States)

    Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.

    2016-01-01

    DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. PMID:26892770

  15. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  16. Manipulation, salience, and nudges.

    Science.gov (United States)

    Noggle, Robert

    2018-03-01

    Cass Sunstein and Richard Thaler recommend helping people make better decisions by employing 'nudges', which they define as noncoercive methods of influencing choice for the better. Not surprisingly, healthcare practitioners and public policy professionals have become interested in whether nudges might be a promising method of improving health-related behaviors without resorting to heavy-handed methods such as coercion, deception, or government regulation. Many nudges seem unobjectionable as they merely improve the quality and quantity available for the decision-maker. However, other nudges influence decision-making in ways that do not involve providing more and better information. Nudges of this sort raise concerns about manipulation. This paper will focus on noninformational nudges that operate by changing the salience of various options. It will survey two approaches to understanding manipulation, one which sees manipulation as a kind of pressure, and one that sees it as a kind of trickery. On the pressure view, salience nudges do not appear to be manipulative. However, on the trickery view (which the author favors), salience nudges will be manipulative if they increase the salience so that it is disproportionate to that fact's true relevance and importance for the decision at hand. By contrast, salience nudges will not be manipulative if they merely highlight some fact that is true and important for the decision at hand. The paper concludes by providing examples of both manipulative and nonmanipulative salience nudges. © 2017 John Wiley & Sons Ltd.

  17. Radical Chemistry and Charge Manipulation with an Atomic Force Microscope

    Science.gov (United States)

    Gross, Leo

    The fuctionalization of tips by atomic manipulation dramatically increased the resolution of atomic force microscopy (AFM). The combination of high-resolution AFM with atomic manipulation now offers the unprecedented possibility to custom-design individual molecules by making and breaking bonds with the tip of the microscope and directly characterizing the products on the atomic scale. We recently applied this technique to generate and study reaction intermediates and to investigate chemical reactions trigged by atomic manipulation. We formed diradicals by dissociating halogen atoms and then reversibly triggered ring-opening and -closing reactions via atomic manipulation, allowing us to switch and control the molecule's reactivity, magnetic and optical properties. Additional information about charge states and charge distributions can be obtained by Kelvin probe force spectroscopy. On multilayer insulating films we investigated single-electron attachment, detachment and transfer between individual molecules. EU ERC AMSEL (682144), EU project PAMS (610446).

  18. Optical Pushing: A Tool for Parallelized Biomolecule Manipulation

    NARCIS (Netherlands)

    Sitters, G.; Laurens, N.; de Rijk, E.J.; Kress, H.; Peterman, E.J.G.; Wuite, G.J.L.

    2016-01-01

    The ability to measure and manipulate single molecules has greatly advanced the field of biophysics. Yet, the addition of more single-molecule tools that enable one to measure in a parallel fashion is important to diversify the questions that can be addressed. Here we present optical pushing (OP), a

  19. Manipulators for production and research

    International Nuclear Information System (INIS)

    Munro, Ian

    1987-01-01

    The development of caves or cells and master-slave manipulators to handle radioactive materials is discussed. Some of the most recent advances are described. A manipulator arm, a master-slave manipulator and a servomanipulator mounted on a manipulator are illustrated. Future developments are discussed - these include resolved tip control for the manipulator. (UK)

  20. Powered manipulator control arm

    International Nuclear Information System (INIS)

    Le Mouee, Theodore; Vertut, Jean; Marchal, Paul; Germon, J.C.; Petit, Michel

    1975-01-01

    A remote operated control arm for powered manipulators is described. It includes an assembly allowing several movements with position sensors for each movement. The number of possible arm movements equals the number of possible manipulator movements. The control systems may be interrupted as required. One part of the arm is fitted with a system to lock it with respect to another part of the arm without affecting the other movements, so long as the positions of the manipulator and the arm have not been brought into complete coincidence. With this system the locking can be ended when complete concordance is achieved [fr

  1. Simulation of robot manipulators

    International Nuclear Information System (INIS)

    Kress, R.L.; Babcock, S.M.; Bills, K.C.; Kwon, D.S.; Schoenwald, D.A.

    1995-01-01

    This paper describes Oak Ridge National Laboratory's development of an environment for the simulation of robotic manipulators. Simulation includes the modeling of kinematics, dynamics, sensors, actuators, control systems, operators, and environments. Models will be used for manipulator design, proposal evaluation, control system design and analysis, graphical preview of proposed motions, safety system development, and training. Of particular interest is the development of models for robotic manipulators having at least one flexible link. As a first application, models have been developed for the Pacific Northwest Laboratories' Flexible Beam Testbed which is a one-Degree-Of-Freedom, flexible arm with a hydraulic base actuator. Initial results show good agreement between model and experiment

  2. The direct manipulation shell

    International Nuclear Information System (INIS)

    Allen, M.E.; Christiansen, M.

    1992-01-01

    Accelerator controls systems provide parameter display pages which allow the operator to monitor and manipulate selected control points in the system. Display pages are generally implemented as either hand-crafted, purpose-built programs; or by using a specialized display page layout tool. These two methods of display page development exhibit the classic trade-off between functionality vs. ease of implementation. In the Direct Manipulation Shell we approach the process of developing a display page in a manifestly object-oriented manner. This is done by providing a general framework for interactively instantiating and manipulating display objects. (author)

  3. Single-Molecule Nanomagnets

    Science.gov (United States)

    Friedman, Jonathan R.; Sarachik, Myriam P.

    2010-04-01

    Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

  4. Organizing and addressing magnetic molecules.

    Science.gov (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta

    2009-04-20

    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  5. A storage ring for neutral molecules

    NARCIS (Netherlands)

    Crompvoets, F.M.H.

    2005-01-01

    Time-varying inhomogeneous electric fields can be used to manipulate the motion of neutral molecules in phase-space, i.e., position-momentum space, via their electric dipole moment. A theoretical background is given on the motion of the molecules in phase-space. As the forces exerted on the

  6. Relevance of extracellular DNA in rhizosphere

    Science.gov (United States)

    Pietramellara, Giacomo; Ascher, Judith; Baraniya, Divyashri; Arfaioli, Paola; Ceccherini, Maria Teresa; Hawes, Martha

    2013-04-01

    One of the most promising areas for future development is the manipulation of the rhizosphere to produce sustainable and efficient agriculture production systems. Using Omics approaches, to define the distinctive features of eDNA systems and structures, will facilitate progress in rhizo-enforcement and biocontrol studies. The relevance of these studies results clear when we consider the plethora of ecological functions in which eDNA is involved. This fraction can be actively extruded by living cells or discharged during cellular lysis and may exert a key role in the stability and variability of the soil bacterial genome, resulting also a source of nitrogen and phosphorus for plants due to the root's capacity to directly uptake short DNA fragments. The adhesive properties of the DNA molecule confer to eDNA the capacity to inhibit or kill pathogenic bacteria by cation limitation induction, and to facilitate formation of biofilm and extracellular traps (ETs), that may protect microorganisms inhabiting biofilm and plant roots against pathogens and allelopathic substances. The ETs are actively extruded by root border cells when they are dispersed in the rhizosphere, conferring to plants the capacity to extend an endogenous pathogen defence system outside the organism. Moreover, eDNA could be involved in rhizoremediation in heavy metal polluted soil acting as a bioflotation reagent.

  7. Fabrication of birefringent nanocylinders for single-molecule force and torque measurement

    Science.gov (United States)

    Li, Ping-Chun; Chang, Jen-Chien; La Porta, Arthur; Yu, Edward T.

    2014-06-01

    Optically anisotropic subwavelength scale dielectric particles have been shown to enable studies of the mechanical properties of bio-molecules via optical trapping and manipulation. However, techniques emphasized to date for fabrication of such particles generally suffer from limited uniformity and control over particle dimensions, or low throughput and high cost. Here, an approach for rapid, low-cost, fabrication of large quantities of birefringent quartz nanocylinders with dimensions optimized for optical torque wrench experiments is described. For a typical process, 108 or more quartz cylinders with diameters of 500 nm and heights of 800 nm, with uniformity of ±5% in each dimension, can be fabricated over ˜10 cm2 areas, for binding to a single bio-molecule, and harvested for use in optical trapping experiments. Use of these structures to measure extensional and torsional dynamics of single DNA molecules is demonstrated with measured forces and torques shown to be in very good agreement with previously reported results.

  8. Fabrication of birefringent nanocylinders for single-molecule force and torque measurement

    International Nuclear Information System (INIS)

    Li, Ping-Chun; T Yu, Edward; Chang, Jen-Chien; La Porta, Arthur

    2014-01-01

    Optically anisotropic subwavelength scale dielectric particles have been shown to enable studies of the mechanical properties of bio-molecules via optical trapping and manipulation. However, techniques emphasized to date for fabrication of such particles generally suffer from limited uniformity and control over particle dimensions, or low throughput and high cost. Here, an approach for rapid, low-cost, fabrication of large quantities of birefringent quartz nanocylinders with dimensions optimized for optical torque wrench experiments is described. For a typical process, 10 8 or more quartz cylinders with diameters of 500 nm and heights of 800 nm, with uniformity of ±5% in each dimension, can be fabricated over ∼10 cm 2 areas, for binding to a single bio-molecule, and harvested for use in optical trapping experiments. Use of these structures to measure extensional and torsional dynamics of single DNA molecules is demonstrated with measured forces and torques shown to be in very good agreement with previously reported results. (papers)

  9. Reverse engineering of an affinity-switchable molecular interaction characterized by atomic force microscopy single-molecule force spectroscopy.

    Science.gov (United States)

    Anselmetti, Dario; Bartels, Frank Wilco; Becker, Anke; Decker, Björn; Eckel, Rainer; McIntosh, Matthew; Mattay, Jochen; Plattner, Patrik; Ros, Robert; Schäfer, Christian; Sewald, Norbert

    2008-02-19

    Tunable and switchable interaction between molecules is a key for regulation and control of cellular processes. The translation of the underlying physicochemical principles to synthetic and switchable functional entities and molecules that can mimic the corresponding molecular functions is called reverse molecular engineering. We quantitatively investigated autoinducer-regulated DNA-protein interaction in bacterial gene regulation processes with single atomic force microscopy (AFM) molecule force spectroscopy in vitro, and developed an artificial bistable molecular host-guest system that can be controlled and regulated by external signals (UV light exposure and thermal energy). The intermolecular binding functionality (affinity) and its reproducible and reversible switching has been proven by AFM force spectroscopy at the single-molecule level. This affinity-tunable optomechanical switch will allow novel applications with respect to molecular manipulation, nanoscale rewritable molecular memories, and/or artificial ion channels, which will serve for the controlled transport and release of ions and neutral compounds in the future.

  10. Geometric control of manipulators

    International Nuclear Information System (INIS)

    Thiruarooran, C.

    1996-01-01

    Resolved motion control enables the end effector to be moved as a rigid body in space without having to work out manually the joint combinations needed. Since a rigid body in space has three independent translational and three independent rotational movements, a manipulator with at least six joints can be controlled in this way. Normally the manipulator has more than six joints providing an infinite number of ways of moving the tip in the desired direction and this redundancy can be exploited in a variety of ways. Resolved motion tests performed on a hydraulically operated heavy duty manipulator at the Dungeness nuclear power plant are described. The results have shown that manipulators with as many as ten joints can be controlled under resolved tip motion and the areas which are critical to the performance of this type of control have been identified. (UK)

  11. MATHEMATICAL MODEL MANIPULATOR ROBOTS

    Directory of Open Access Journals (Sweden)

    O. N. Krakhmalev

    2015-12-01

    Full Text Available A mathematical model to describe the dynamics of manipulator robots. Mathematical model are the implementation of the method based on the Lagrange equation and using the transformation matrices of elastic coordinates. Mathematical model make it possible to determine the elastic deviations of manipulator robots from programmed motion trajectories caused by elastic deformations in hinges, which are taken into account in directions of change of the corresponding generalized coordinates. Mathematical model is approximated and makes it possible to determine small elastic quasi-static deviations and elastic vibrations. The results of modeling the dynamics by model are compared to the example of a two-link manipulator system. The considered model can be used when performing investigations of the mathematical accuracy of the manipulator robots.

  12. Compliant Aerial Manipulators

    DEFF Research Database (Denmark)

    Bartelds, T.; Capra, A.; Hamaza, S.

    2016-01-01

    joints. The approach aims at limiting the influence of impacts on the controlled attitude dynamics in order to allow the aerial manipulator to remain stable during and after impact. The developed concept is intended to convert kinetic energy into potential energy, which is permanently stored into elastic...... elements by means of directional locking mechanisms. The proposed approach has been tested on a 2 d.o.f. manipulator mounted on a quadrotor UAV. The manipulation system has one active rotational d.o.f. compensating for pitch movements of the UAV and one passive linear joint which is in charge of absorbing...... the impact energy. The device has been used to validate the method through experiments, in comparison with a rigid manipulator. The results show that the proposed approach and the developed mechanical system achieve stable impact absorption without bouncing away from the interacting environment. Our work has...

  13. Manipulating Strings in Python

    Directory of Open Access Journals (Sweden)

    William J. Turkel

    2012-07-01

    Full Text Available This lesson is a brief introduction to string manipulation techniques in Python. Knowing how to manipulate strings plays a crucial role in most text processing tasks. If you’d like to experiment with the following lessons, you can write and execute short programs as we’ve been doing, or you can open up a Python shell / Terminal to try them out on the command line.

  14. Single Molecule Nano-Metronome

    Science.gov (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  15. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  16. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  17. SINGLE MOLECULE APPROACHES TO BIOLOGY, 2010 GORDON RESEARCH CONFERENCE, JUNE 27-JULY 2, 2010, ITALY

    Energy Technology Data Exchange (ETDEWEB)

    Professor William Moerner

    2010-07-09

    The 2010 Gordon Conference on Single-Molecule Approaches to Biology focuses on cutting-edge research in single-molecule science. Tremendous technical developments have made it possible to detect, identify, track, and manipulate single biomolecules in an ambient environment or even in a live cell. Single-molecule approaches have changed the way many biological problems are addressed, and new knowledge derived from these approaches continues to emerge. The ability of single-molecule approaches to avoid ensemble averaging and to capture transient intermediates and heterogeneous behavior renders them particularly powerful in elucidating mechanisms of biomolecular machines: what they do, how they work individually, how they work together, and finally, how they work inside live cells. The burgeoning use of single-molecule methods to elucidate biological problems is a highly multidisciplinary pursuit, involving both force- and fluorescence-based methods, the most up-to-date advances in microscopy, innovative biological and chemical approaches, and nanotechnology tools. This conference seeks to bring together top experts in molecular and cell biology with innovators in the measurement and manipulation of single molecules, and will provide opportunities for junior scientists and graduate students to present their work in poster format and to exchange ideas with leaders in the field. A number of excellent poster presenters will be selected for short oral talks. Topics as diverse as single-molecule sequencing, DNA/RNA/protein interactions, folding machines, cellular biophysics, synthetic biology and bioengineering, force spectroscopy, new method developments, superresolution imaging in cells, and novel probes for single-molecule imaging will be on the program. Additionally, the collegial atmosphere of this Conference, with programmed discussion sessions as well as opportunities for informal gatherings in the afternoons and evenings in the beauty of the Il Ciocco site in

  18. Fluorescence Microscopy of Nanochannel-Confined DNA.

    Science.gov (United States)

    Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

    2018-01-01

    Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

  19. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  20. Vibrational, structural and electronic properties investigation by DFT calculations and molecular docking studies with DNA topoisomerase II of strychnobrasiline type alkaloids: A theoretical approach for potentially bioactive molecules

    Science.gov (United States)

    Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.

    2017-10-01

    A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.

  1. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  2. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  3. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  4. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  5. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  6. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  7. Balanced articulated manipulator

    International Nuclear Information System (INIS)

    Francois, Daniel; Germond, J.-C.; Marchal, Paul; Vertut, Jean.

    1976-01-01

    The description is given of a manipulator of the type comprising a master arm and a slave arm, capable of working in a containment restricted by a wall fitted with an aperture to introduce the slave arm into the containment. According to the invention this manipulator is permanently balanced irrespective of its distortions when it is secured to the wall of the containment in which it is desired to work. The entire manipulator is also balanced when being set up and when moved outside the containment, in relation to a supporting axle. This result is achieved in a simplified manner by giving homothetic shapes to the various component parts of the slave and master arms, the master arm having at least one balancing weight [fr

  8. Stainless steel decontamination manipulators

    International Nuclear Information System (INIS)

    Sullivan, R.J.

    1986-01-01

    Three, large-volume coverage manipulator systems were designed and built for the Defense Water Processing Facility at the Savannah River Laboratory. These stainless steel systems will be used for high-pressure spray decontamination of waste containers and large process equipment modules. Each system has a manipulator arm, folding boom, and vertical drive and guide structure. Handling capacity is 45 kg, horizontal reach is 4.6 m with a 180-deg swing motion, and the vertical travel is 6 m. The system is remotely removable and replaceable in modules using an overhead crane and an impact wrench. The manipulator arm has seven motions: Shoulder rotation and pivot, elbow pivot, wrist pivot and rotation, and grip open-close. All motions are variable speed and are slip-clutch protected to prevent overloading from external forces (collisions)

  9. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  10. Data manipulation with R

    CERN Document Server

    Abedin, Jaynal

    2014-01-01

    This book is a step-by step, example-oriented tutorial that will show both intermediate and advanced users how data manipulation is facilitated smoothly using R.This book is aimed at intermediate to advanced level users of R who want to perform data manipulation with R, and those who want to clean and aggregate data effectively. Readers are expected to have at least an introductory knowledge of R and some basic administration work in R, such as installing packages and calling them when required.

  11. Some Aspects of Nonlinearity and Self-Organization In Biosystems on Examples of Localized Excitations in the DNA Molecule and Generalized Fisher–KPP Model

    Directory of Open Access Journals (Sweden)

    A. V. Shapovalov

    2018-02-01

    Full Text Available This review deals with ideas and approaches to nonlinear phenomena, based on different branches of physics and related to biological systems, that focus on how small impacts can significantly change the state of the system at large spatial scales. This problem is very extensive, and it cannot be fully resolved in this paper. Instead, some selected physical effects are briefly reviewed. We consider sine-Gordon solitons and nonlinear Schrodinger solitons in some models of DNA as examples of self-organization at the molecular level, as well as examine features of their formation and dynamics under the influence of external influences. In addition, the formation of patterns in the generalized Fisher–KPP model is viewed as a simple example of self-organization in a system with nonlocal interaction at the cellular level. Symmetries of model equations are employed to analyze the considered nonlinear phenomena. In this context the possible relations between phenomena considered and released activity effect, which is assessed differently in the literature, are discussed.

  12. A novel small molecule inhibits STAT3 phosphorylation and DNA binding activity and exhibits potent growth suppressive activity in human cancer cells

    Directory of Open Access Journals (Sweden)

    Lin Li

    2010-08-01

    Full Text Available Abstract Background Targeting Signal Transducer and Activator of Transcription 3 (STAT3 signaling is an attractive therapeutic approach for most types of human cancers with constitutively activated STAT3. A novel small molecular STAT3 inhibitor, FLLL32 was specifically designed from dietary agent, curcumin to inhibit constitutive STAT3 signaling in multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells. Results FLLL32 was found to be a potent inhibitor of STAT3 phosphorylation, STAT3 DNA binding activity, and the expression of STAT3 downstream target genes in vitro, leading to the inhibition of cell proliferation as well as the induction of Caspase-3 and PARP cleavages in human multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cell lines. However, FLLL32 exhibited little inhibition on some tyrosine kinases containing SH2 or both SH2 and SH3 domains, and other protein and lipid kinases using a kinase profile assay. FLLL32 was also more potent than four previously reported JAK2 and STAT3 inhibitors as well as curcumin to inhibit cell viability in these cancer cells. Furthermore, FLLL32 selectively inhibited the induction of STAT3 phosphorylation by Interleukin-6 but not STAT1 phosphorylation by IFN-γ. Conclusion Our findings indicate that FLLL32 exhibits potent inhibitory activity to STAT3 and has potential for targeting multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells expressing constitutive STAT3 signaling.

  13. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  14. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  15. MANIPULATING CONSUMERS THROUGH ADVERTISING

    Directory of Open Access Journals (Sweden)

    Nicoleta -Andreea Neacşu

    2012-12-01

    Full Text Available Marketing communication has evolved steadily in the direction of increasing complexity and increasing volume of funds needed to run their own actions. More than ever, consumers are exposed to an overwhelming variety of sources and communication tehniques, the information received being numerous, diverse and polyvalent. The desire to make more efficient the marketing communication activity urges the broadcasters to encode messages, to use effective means of propagation in order to obtain a high degree of control on receptors and to influence the consumption attitudes. Between the means used for this purpose, manipulation tehniques are well known. This paper highlights the main conclusions drawn as a result of a quantitative marketing research on the adult population from Braşov in order to identify the attitudes and opinions of consumers from Braşov regarding the manipulation techniques used by commercial practices and advertising.The results of the research have shown that 82% of the respondents buy products in promotional offers, and 18% choose not to buy these products and 61% of the respondents consider that they have not been manipulated not even once, while only 39% believe that they have been manipulated at least once through advertising or commercial practices. Advertisements on TV have a strong influence on consumers, 81% of the respondents considering that at least once they have bought a product because of a TV commercial.

  16. Manipulating the Gradient

    Science.gov (United States)

    Gaze, Eric C.

    2005-01-01

    We introduce a cooperative learning, group lab for a Calculus III course to facilitate comprehension of the gradient vector and directional derivative concepts. The lab is a hands-on experience allowing students to manipulate a tangent plane and empirically measure the effect of partial derivatives on the direction of optimal ascent. (Contains 7…

  17. Microrobots to Manipulate Cells

    DEFF Research Database (Denmark)

    Glückstad, Jesper

    At DTU Fotonik we developed and harnessed the new and emerging research area of so-called Light Robotics including the 3D-printed micro-tools coined Wave-guided Optical Waveguides that can be real-time laser-manipulated in a 3D-volume with six-degrees-of-freedom. To be exploring the full potentia...

  18. Automated visual attention manipulation

    NARCIS (Netherlands)

    Bosse, T.; Lambalgen, R. van; Maanen, P.P. van; Treur, J.

    2009-01-01

    In this paper a system for visual attention manipulation is introduced and formally described. This system is part of the design of a software agent that supports naval crew in her task to compile a tactical picture of the situation in the field. A case study is described in hich the system is used

  19. Data manipulation with R

    CERN Document Server

    Abedin, Jaynal

    2015-01-01

    This book is for all those who wish to learn about data manipulation from scratch and excel at aggregating data effectively. It is expected that you have basic knowledge of R and have previously done some basic administration work with R.

  20. The TFTR maintenance manipulator

    International Nuclear Information System (INIS)

    Kungl, D.; Loesser, D.; Heitzenroeder, P.; Cerdan, G.

    1989-01-01

    TFTR plans to begin D-T experiments in mid 1990. The D-T experimental program will produce approximately one hundred shots, with a neutron generation rate of 10 19 neutrons per shot. This will result in high levels of activation in TFTR, especially in the vacuum vessel. The primary purpose of the Maintenance Manipulator is to provide a means of remotely performing certain defined maintenance and inspection tasks inside the vacuum torus so as to minimize personnel exposure to radiation. The manipulator consists of a six-link folding boom connected to a fixed boom on a movable carriage. The entire manipulator is housed in a vacuum antechamber connected to the vacuum torus, through a port formerly used for a vacuum pumping duct. The configuration extends 180 0 in either direction to provide complete coverage of the torus. The four 3500 l/s turbopumps which were formerly used in the pumping duct will be mounted on the antechamber. The manipulator will utilize two end effectors. The first, called a General Inspection Arm (GIA) provides a movable platform to an inspection camera and an in-vacuum leak detector. The second is a bilateral, force-reflecting pair of slave arms which utilize specially developed tools to perform several maintenance functions. All components except the slave arms are capable of operating in TFTR's vacuum environment and during 150 0 C bakeout of the torus. (orig.)

  1. Manipulating Combinatorial Structures.

    Science.gov (United States)

    Labelle, Gilbert

    This set of transparencies shows how the manipulation of combinatorial structures in the context of modern combinatorics can easily lead to interesting teaching and learning activities at every level of education from elementary school to university. The transparencies describe: (1) the importance and relations of combinatorics to science and…

  2. Manipulating localized molecular orbitals by single-atom contacts.

    Science.gov (United States)

    Wang, Weihua; Shi, Xingqiang; Lin, Chensheng; Zhang, Rui Qin; Minot, Christian; Van Hove, Michel A; Hong, Yuning; Tang, Ben Zhong; Lin, Nian

    2010-09-17

    We have fabricated atom-molecule contacts by attachment of single Cu atoms to terpyridine side groups of bis-terpyridine tetra-phenyl ethylene molecules on a Cu(111) surface. By means of scanning tunneling microscopy, spectroscopy, and density functional calculations, we have found that, due to the localization characteristics of molecular orbitals, the Cu-atom contact modifies the state localized at the terpyridine side group which is in contact with the Cu atom but does not affect the states localized at other parts of the molecule. These results illustrate the contact effects at individual orbitals and offer possibilities to manipulate orbital alignments within molecules.

  3. Single Molecule Nano-Metronome

    OpenAIRE

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2006-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

  4. Nucleic Acids as Information Molecules.

    Science.gov (United States)

    McInerney, Joseph D.

    1996-01-01

    Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)

  5. A universal microscope manipulator

    Directory of Open Access Journals (Sweden)

    Peter S. Boyadzhiev

    2012-03-01

    Full Text Available A modified and improved model of a mechanical manipulator for observation of pinned and mounted insects is described. This device allows movement of the observed object around three perpendicular axes in the field of vision at all magnifications of stereomicroscopes. The main improvement of this new model is positioning of the guiding knobs for rotating around two of the axes next to each other, allowing faster and easier manipulation of the studied object. Thus, one of the main advantages of this device is the possibility to rotate the specimen without the need to refocus. The device enables easily reaching a precession deviation in the intersection point of axes up to 0.5 mm in the process of assembling.

  6. Microradiographic microsphere manipulator

    International Nuclear Information System (INIS)

    Singleton, R.M.

    1980-01-01

    A method and apparatus are provided for radiographic characterization of small hollow spherical members (microspheres), constructed of either optically transparent or opaque materials. The apparatus involves a microsphere manipulator which holds a batch of microspheres between two parallel thin plastic films for contact microradiographic characterization or projection microradiography thereof. One plastic film is translated to relative to and parallel to the other to roll the microspheres through any desired angle to allow different views of the microspheres

  7. Manipulation of quantum evolution

    Science.gov (United States)

    Cabera, David Jose Fernandez; Mielnik, Bogdan

    1994-01-01

    The free evolution of a non-relativistic charged particle is manipulated using time-dependent magnetic fields. It is shown that the application of a programmed sequence of magnetic pulses can invert the free evolution process, forcing an arbitrary wave packet to 'go back in time' to recover its past shape. The possibility of more general operations upon the Schrodinger wave packet is discussed.

  8. Manipulating atoms with photons

    International Nuclear Information System (INIS)

    Cohen-Tannoudji, C.N.

    1998-01-01

    The article is a translation of the lecture delivered on the occasion of the 1997 Nobel Prize awarding ceremony. The physical mechanisms which allow manipulating of neutral atoms with laser photons are described. A remark is also made concerning several possible applications of ultra-cool atoms and streams of future research. The article is completed by Prof. Cohen-Tannoudji's autobiography. (Z.J.)

  9. Protozoa manipulation by ultrasound

    Directory of Open Access Journals (Sweden)

    Yancy Milena Porras Rodríguez

    2004-01-01

    Full Text Available Microorganism manipulation, considered as controlled motion and positioning, is one of the most important activities in microbiology and medicine. To achieve this goal there are some techniques such as those which and optical forces, among others. These techniques are usually sophisticated, and some of them can induce irreversible alterations on the microorganisms which prevents their use in another tests. Thus, there is justified the study of technological alternatives to manipulate microorganisms in an easy and cost-effective way. This work shows the interaction between protozoa and air microbubbles when they are under the influence of an ultrasonic field of 5.8 mW. At the microbubbles resonant frequencies, microorganisms were attracted toward the bubbles' frontier remaining there while the ultrasonic field was applied. Once the ultrasound disappears, protozoa recover their freedom of movement. The observed effects could be used as the actuation principle of devices capable to trap, hold and release microorganisms of high mobility without any apparent damage. Microbubbles are generated by electrolysis which take place on the surface of an electrode array, while the ultrasound is originated by means of a piezoelectric transducer. As microorganisms there were employed those present in stagnated water, and were observed through an stereomicroscope. Key words: manipulator; protozoa; ultrasonic; transducer; piezoelectric.

  10. Pose Space Surface Manipulation

    Directory of Open Access Journals (Sweden)

    Yusuke Yoshiyasu

    2012-01-01

    Full Text Available Example-based mesh deformation techniques produce natural and realistic shapes by learning the space of deformations from examples. However, skeleton-based methods cannot manipulate a global mesh structure naturally, whereas the mesh-based approaches based on a translational control do not allow the user to edit a local mesh structure intuitively. This paper presents an example-driven mesh editing framework that achieves both global and local pose manipulations. The proposed system is built with a surface deformation method based on a two-step linear optimization technique and achieves direct manipulations of a model surface using translational and rotational controls. With the translational control, the user can create a model in natural poses easily. The rotational control can adjust the local pose intuitively by bending and twisting. We encode example deformations with a rotation-invariant mesh representation which handles large rotations in examples. To incorporate example deformations, we infer a pose from the handle translations/rotations and perform pose space interpolation, thereby avoiding involved nonlinear optimization. With the two-step linear approach combined with the proposed multiresolution deformation method, we can edit models at interactive rates without losing important deformation effects such as muscle bulging.

  11. Biological mechanisms, one molecule at a time

    Science.gov (United States)

    Tinoco, Ignacio; Gonzalez, Ruben L.

    2011-01-01

    The last 15 years have witnessed the development of tools that allow the observation and manipulation of single molecules. The rapidly expanding application of these technologies for investigating biological systems of ever-increasing complexity is revolutionizing our ability to probe the mechanisms of biological reactions. Here, we compare the mechanistic information available from single-molecule experiments with the information typically obtained from ensemble studies and show how these two experimental approaches interface with each other. We next present a basic overview of the toolkit for observing and manipulating biology one molecule at a time. We close by presenting a case study demonstrating the impact that single-molecule approaches have had on our understanding of one of life's most fundamental biochemical reactions: the translation of a messenger RNA into its encoded protein by the ribosome. PMID:21685361

  12. DNA Open states and DNA hydratation

    International Nuclear Information System (INIS)

    Lema-Larre, B. de; Martin-Landrove, M

    1995-01-01

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

  13. Using Manipulatives in Math Instruction.

    Science.gov (United States)

    Marzola, Eileen S.

    1987-01-01

    Guidelines for teachers to better use manipulatives in the teaching of mathematics to learning disabled learners are offered including a rationale for manipulatives, selection crteria, principles underlying productive use of manipulatives, and making the transition from the concrete to the symbolic. Suggested materials and distributors are listed.…

  14. TOPICAL REVIEW: Single-molecule experiments in biological physics: methods and applications

    Science.gov (United States)

    Ritort, F.

    2006-08-01

    I review single-molecule experiments (SMEs) in biological physics. Recent technological developments have provided the tools to design and build scientific instruments of high enough sensitivity and precision to manipulate and visualize individual molecules and measure microscopic forces. Using SMEs it is possible to manipulate molecules one at a time and measure distributions describing molecular properties, characterize the kinetics of biomolecular reactions and detect molecular intermediates. SMEs provide additional information about thermodynamics and kinetics of biomolecular processes. This complements information obtained in traditional bulk assays. In SMEs it is also possible to measure small energies and detect large Brownian deviations in biomolecular reactions, thereby offering new methods and systems to scrutinize the basic foundations of statistical mechanics. This review is written at a very introductory level, emphasizing the importance of SMEs to scientists interested in knowing the common playground of ideas and the interdisciplinary topics accessible by these techniques. The review discusses SMEs from an experimental perspective, first exposing the most common experimental methodologies and later presenting various molecular systems where such techniques have been applied. I briefly discuss experimental techniques such as atomic-force microscopy (AFM), laser optical tweezers (LOTs), magnetic tweezers (MTs), biomembrane force probes (BFPs) and single-molecule fluorescence (SMF). I then present several applications of SME to the study of nucleic acids (DNA, RNA and DNA condensation) and proteins (protein-protein interactions, protein folding and molecular motors). Finally, I discuss applications of SMEs to the study of the nonequilibrium thermodynamics of small systems and the experimental verification of fluctuation theorems. I conclude with a discussion of open questions and future perspectives.

  15. Burkholderia thailandensis: Genetic Manipulation.

    Science.gov (United States)

    Garcia, Erin C

    2017-05-16

    Burkholderia thailandensis is a Gram-negative bacterium endemic to Southeast Asian and northern Australian soils. It is non-pathogenic; therefore, it is commonly used as a model organism for the related human pathogens Burkholderia mallei and Burkholderia pseudomallei. B. thailandensis is relatively easily genetically manipulated and a variety of robust genetic tools can be used in this organism. This unit describes protocols for conjugation, natural transformation, mini-Tn7 insertion, and allelic exchange in B. thailandensis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  16. Spatial manipulation with microfluidics

    Directory of Open Access Journals (Sweden)

    Benjamin eLin

    2015-04-01

    Full Text Available Biochemical gradients convey information through space, time, and concentration, and are ultimately capable of spatially resolving distinct cellular phenotypes, such as differentiation, proliferation, and migration. How these gradients develop, evolve, and function during development, homeostasis, and various disease states is a subject of intense interest across a variety of disciplines. Microfluidic technologies have become essential tools for investigating gradient sensing in vitro due to their ability to precisely manipulate fluids on demand in well controlled environments at cellular length scales. This minireview will highlight their utility for studying gradient sensing along with relevant applications to biology.

  17. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  18. Remote control manipulator

    Energy Technology Data Exchange (ETDEWEB)

    Sugawara, T

    1970-02-28

    A prior-art remote control manipulator comprises a horizontal suspension section, a master arm and a slave arm which are coupled to ends of the suspension section in a manner to pivotally move relative to the suspension section, and a connecting device which includes a tape and which joins both the arms. When the connecting device malfunctions, the slave arm can neither be extended nor contracted. Means to keep the tension of the tape is required which restricts the extension length of the slave arm. Further, the slave arm can be moved only in the axial direction. The invention described provides an improved remote control manipulator of the specified type. A moving device which moves the slave arm relative to the master arm without the intervention of the connecting device is mounted on a movable part of the slave arm, while pulleys which maintain the joining relationship of the connecting device are mounted on the movable part and fixed part of the slave arm. Owing to this construction, movement of the slave arm is assured despite troubles which may arise in the connecting device. In addition, no slack arises in the tape. By applying a similar construction to the horizontal suspension section, the suspension section can be stretched, and hence, the slave arm can be moved in a direction orthogonal to its axis.

  19. Writing with molecules on molecular printboards

    NARCIS (Netherlands)

    Crespo biel, O.; Ravoo, B.J.; Huskens, Jurriaan; Reinhoudt, David

    2006-01-01

    Nanotechnology aspires to create functional materials with characteristic dimensions of the order 1–100 nm. One requirement to make nanotechnology work is to precisely position molecules and nanoparticles on surfaces, so that they may be addressed and manipulated for bottom-up construction of

  20. Hydraulic manipulator research at ORNL

    International Nuclear Information System (INIS)

    Kress, R.L.; Jansen, J.F.; Love, L.J.

    1997-01-01

    Recently, task requirements have dictated that manipulator payload capacity increase to accommodate greater payloads, greater manipulator length, and larger environmental interaction forces. General tasks such as waste storage tank cleanup and facility dismantlement and decommissioning require manipulator life capacities in the range of hundreds of pounds rather than tens of pounds. To meet the increased payload capacities demanded by present-day tasks, manipulator designers have turned once again to hydraulics as a means of actuation. In order to successfully design, build, and deploy a new hydraulic manipulator (or subsystem), sophisticated modeling, analysis, and control experiments are usually needed. Oak Ridge National Laboratory (ORNL) has a history of projects that incorporate hydraulics technology, including mobile robots, teleoperated manipulators, and full-scale construction equipment. In addition, to support the development and deployment of new hydraulic manipulators, ORNL has outfitted a significant experimental laboratory and has developed the software capability for research into hydraulic manipulators, hydraulic actuators, hydraulic systems, modeling of hydraulic systems, and hydraulic controls. The purpose of this article is to describe the past hydraulic manipulator developments and current hydraulic manipulator research capabilities at ORNL. Included are example experimental results from ORNL's flexible/prismatic test stand

  1. Hydraulic manipulator research at ORNL

    Energy Technology Data Exchange (ETDEWEB)

    Kress, R.L.; Jansen, J.F. [Oak Ridge National Lab., TN (United States); Love, L.J. [Oak Ridge Inst. for Science and Education, TN (United States)

    1997-03-01

    Recently, task requirements have dictated that manipulator payload capacity increase to accommodate greater payloads, greater manipulator length, and larger environmental interaction forces. General tasks such as waste storage tank cleanup and facility dismantlement and decommissioning require manipulator life capacities in the range of hundreds of pounds rather than tens of pounds. To meet the increased payload capacities demanded by present-day tasks, manipulator designers have turned once again to hydraulics as a means of actuation. In order to successfully design, build, and deploy a new hydraulic manipulator (or subsystem), sophisticated modeling, analysis, and control experiments are usually needed. Oak Ridge National Laboratory (ORNL) has a history of projects that incorporate hydraulics technology, including mobile robots, teleoperated manipulators, and full-scale construction equipment. In addition, to support the development and deployment of new hydraulic manipulators, ORNL has outfitted a significant experimental laboratory and has developed the software capability for research into hydraulic manipulators, hydraulic actuators, hydraulic systems, modeling of hydraulic systems, and hydraulic controls. The purpose of this article is to describe the past hydraulic manipulator developments and current hydraulic manipulator research capabilities at ORNL. Included are example experimental results from ORNL`s flexible/prismatic test stand.

  2. Manipulation resolves non-trivial structure of corrole monolayer on Ag(111)

    International Nuclear Information System (INIS)

    Tebi, Stefano; Serrano, Giulia; Koch, Reinhold; Müllegger, Stefan; Aldahhak, Hazem; Rauls, Eva; Schmidt, Wolf Gero; Schöfberger, Wolfgang

    2016-01-01

    Non-trivial arrangement of molecules within a molecular network complicates structure determination due to interdigitation, partial overlap, or stacking. We demonstrate that combined imaging and lateral manipulation with a scanning tunneling microscope resolves the intricate structure of a molecular network in two-dimensions in a straightforward manner. The network, formed by a monolayer of 5,10,15-tris(pentafluorophenyl)-corrole molecules on Ag(111), is manipulated for the first time with single-molecule precision. Our results reveal a shingle-like packing of partially overlapping corrole molecules. Density functional theory calculations support our findings. (paper)

  3. [Language Manipulation, Surrogacy, Altruism].

    Science.gov (United States)

    Serrano Ruiz-Calderón, José Miguel

    2017-01-01

    The Newspeak propitiates a change of the sense of the words and next to the double thinking forms the picture of totalitarianism described by Orwell in 1984. The purpose of the Newspeak is to make all other forms of thought impossible. In bioethics the Newspeak is applied, not because Bioethics is a new science but by the manipulative intention. The twentieth-century political language has, according to Orwell, the intention to remove the ″mental image ″ of what really happens. This is clear in the terms ″surrogacy ″. On the one hand, the mother is deprived of her child. On the other, there is no legal subrogation. As has been said the technique reduces a woman to the condition of a vessel. The excuse of gratuity does not change the exploitative relationship, since gratuitousness in the provision of women is not the altruism of all those involved in surrogacy.

  4. Media and manipulation

    Directory of Open Access Journals (Sweden)

    Kovačević Braco

    2013-01-01

    Full Text Available The role and importance of the media are huge, both in everyday life and in cultural, spiritual and political life of modern man. Their power in the sense of political shaping of people and shaping of public opinion is very distinctive. In the process of propaganda to influence public opinion, they use various manipulative procedures in order to accomplish certain interests and objectives. Through the media, politics realizes its economic, ideological, political and even military activities. The war in the former Yugoslavia and former Bosnia and Herzegovina was also waged through the media. This media war still is spreading the hate speech, thus still causing conflicts and disintegration processes in the Balkans.

  5. Interactive protein manipulation

    Energy Technology Data Exchange (ETDEWEB)

    SNCrivelli@lbl.gov

    2003-07-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures.

  6. Interactive protein manipulation

    International Nuclear Information System (INIS)

    2003-01-01

    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures

  7. Characteristics of manipulative in mathematics laboratory

    Science.gov (United States)

    Istiandaru, A.; Istihapsari, V.; Prahmana, R. C. I.; Setyawan, F.; Hendroanto, A.

    2017-12-01

    A manipulative is a teaching aid designed such that students could understand mathematical concepts by manipulating it. This article aims to provide an insight to the characteristics of manipulatives produced in the mathematics laboratory of Universitas Ahmad Dahlan, Indonesia. A case study was conducted to observe the existing manipulatives produced during the latest three years and classified the manipulatives based on the characteristics found. There are four kinds of manipulatives: constructivism manipulative, virtual manipulative, informative manipulative, and game-based manipulative. Each kinds of manipulative has different characteristics and impact towards the mathematics learning.

  8. Adaptive control of robotic manipulators

    Science.gov (United States)

    Seraji, H.

    1987-01-01

    The author presents a novel approach to adaptive control of manipulators to achieve trajectory tracking by the joint angles. The central concept in this approach is the utilization of the manipulator inverse as a feedforward controller. The desired trajectory is applied as an input to the feedforward controller which behaves as the inverse of the manipulator at any operating point; the controller output is used as the driving torque for the manipulator. The controller gains are then updated by an adaptation algorithm derived from MRAC (model reference adaptive control) theory to cope with variations in the manipulator inverse due to changes of the operating point. An adaptive feedback controller and an auxiliary signal are also used to enhance closed-loop stability and to achieve faster adaptation. The proposed control scheme is computationally fast and does not require a priori knowledge of the complex dynamic model or the parameter values of the manipulator or the payload.

  9. PyMOL mControl: Manipulating Molecular Visualization with Mobile Devices

    Science.gov (United States)

    Lam, Wendy W. T.; Siu, Shirley W. I.

    2017-01-01

    Viewing and manipulating three-dimensional (3D) structures in molecular graphics software are essential tasks for researchers and students to understand the functions of molecules. Currently, the way to manipulate a 3D molecular object is mainly based on mouse-and-keyboard control that is usually difficult and tedious to learn. While gesture-based…

  10. Manipulation of Nano-/Micro Particles Using Light-Actuated Marangoni Tweezers

    Science.gov (United States)

    Lu, Cunjing; Varanakkottu, Subramanyan; Hardt, Steffen; Nano-; Microfluidics, Center of Smart Interfaces, TU Darmstadt Team

    2015-11-01

    The ability to manipulate and produce patterns of nano-/micro objects has been of great interest from both a fundamental and an application point of view. Here we demonstrate particle patterning using an optical landscape and optical nanoparticle manipulation based on light-actuated Marangoni tweezers. A liquid film with a photosurfactant which exists in two isomeric states (cis and trans) is employed for that purpose. Under multiple laser spots created by diffractive optical elements from a He-Cd laser, cis-rich regions with higher surface tension than unexposed trans-rich regions are created, resulting in converging Marangoni flows directing particles attached to the liquid surface toward the irradiated area. 10 μm polystyrene particles and 600 nm λ-DNA molecules distributed over the liquid surface move to the nearest laser spot and can be arranged in specific patterns. Furthermore, 100 nm polystyrene particles and 20 nm quantum dots can also be trapped, and the 100 nm particles can be driven along quite complex trajectories. Compared to conventional optical tweezers, the corresponding power requirements are much lower.

  11. DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

    Science.gov (United States)

    Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

    2016-09-15

    We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Enzymatic Ligation of Large Biomolecules to DNA

    DEFF Research Database (Denmark)

    Sørensen, Rasmus Schøler; Okholm, Anders Hauge; Schaffert, David Henning

    2013-01-01

    The ability to synthesize, characterize, and manipulate DNA forms the foundation of a range of advanced disciplines including genomics, molecular biology, and biomolecular engineering. In particular for the latter field, DNA has proven useful as a structural or functional component in nanoscale s....... As a proof of principle, parallelly labeled oligonucleotides were used to produce nanopatterned DNA origami structures, demonstrating rapid and versatile incorporation of non-DNA components into DNA nanoarchitectures....

  13. Image manipulation as research misconduct.

    Science.gov (United States)

    Parrish, Debra; Noonan, Bridget

    2009-06-01

    A growing number of research misconduct cases handled by the Office of Research Integrity involve image manipulations. Manipulations may include simple image enhancements, misrepresenting an image as something different from what it is, and altering specific features of an image. Through a study of specific cases, the misconduct findings associated with image manipulation, detection methods and those likely to identify such manipulations, are discussed. This article explores sanctions imposed against guilty researchers and the factors that resulted in no misconduct finding although relevant images clearly were flawed. Although new detection tools are available for universities and journals to detect questionable images, this article explores why these tools have not been embraced.

  14. The Manipulative Discourse of Gandalf

    Directory of Open Access Journals (Sweden)

    Farid Mohammadi

    2014-07-01

    Full Text Available The aim of this essay is to investigate discursive, cognitive and social aspects of manipulation in regard to the dialogues of the literary fictional character of Gandalf in the trilogy of The Lord of the Rings. Accordingly, the researcher has taken a multidisciplinary approach to an account of discursive manipulation, and focuses on the cognitive dimensions of manipulation. As a result, the researcher demonstrates meticulously how manipulation involves intensifying the power, moral superiority and the credibility of the speaker(s, while abusing the others (recipients, along with an emotional and attractive way of expression, and supplemented by reasonable facts and documents in regard to a specific issue.

  15. Tree manipulation experiment

    Science.gov (United States)

    Nishina, K.; Takenaka, C.; Ishizuka, S.; Hashimoto, S.; Yagai, Y.

    2012-12-01

    Some forest operations such as thinning and harvesting management could cause changes in N cycling and N2O emission from soils, since thinning and harvesting managements are accompanied with changes in aboveground environments such as an increase of slash falling and solar radiation on the forest floor. However, a considerable uncertainty exists in effects of thinning and harvesting on N2O fluxes regarding changes in belowground environments by cutting trees. To focus on the effect of changes in belowground environments on the N2O emissions from soils, we conducted a tree manipulation experiment in Japanese cedar (Cryptomeria japonica) stand without soil compaction and slash falling near the chambers and measured N2O flux at 50 cm and 150 cm distances from the tree trunk (stump) before and after cutting. We targeted 5 trees for the manipulation and established the measurement chambers to the 4 directions around each targeted tree relative to upper slope (upper, left, right, lower positions). We evaluated the effect of logging on the emission by using hierarchical Bayesian model. HB model can evaluate the variability in observed data and their uncertainties in the estimation with various probability distributions. Moreover, the HB model can easily accommodate the non-linear relationship among the N2O emissions and the environmental factors, and explicitly take non-independent data (nested structure of data) for the estimation into account by using random effects in the model. Our results showed tree cutting stimulated N2O emission from soils, and also that the increase of N2O flux depended on the distance from the trunk (stump): the increase of N2O flux at 50 cm from the trunk (stump) was greater than that of 150 cm from the trunk. The posterior simulation of the HB model indicated that the stimulation of N2O emission by tree cut- ting could reach up to 200 cm in our experimental plot. By tree cutting, the estimated N2O emission at 0-40 cm from the trunk doubled

  16. Remote inspection manipulators for AGR II: Babcock Power's interstitial manipulator

    International Nuclear Information System (INIS)

    Whyley, S.R.

    1985-01-01

    The interstitial manipulator has been designed and built by Babcock Power for the remote visual inspection of AGR II reactors at Heysham and Torness. Its five drives are operated from a console local to the manipulator on the pile cap, or from a similar console located remotely. The need to operate from an interstitial ISI standpipe has restricted the size of the components entering the reactor, and this has consequently provided the major design constraint. A detailed structural assessment of the manipulator was carried out to demonstrate the ability to operate with payloads in excess of the largest camera weight of 13.6 kg. The manipulator finite element model was also used to determine static deflections, and, as a consequence, has provided data from which the control system is able to predict accurately the camera's position. Other computer aided design techniques have enabled the step by step sequences of manipulator deployment, in the restricted space available, to be successfully demonstrated. (author)

  17. Intramolecularly Protein-Crosslinked DNA Gels: New Biohybrid Nanomaterials with Controllable Size and Catalytic Activity.

    Science.gov (United States)

    Zhou, Li; Morel, Mathieu; Rudiuk, Sergii; Baigl, Damien

    2017-07-01

    DNA micro- and nanogels-small-sized hydrogels made of a crosslinked DNA backbone-constitute new promising materials, but their functions have mainly been limited to those brought by DNA. Here a new way is described to prepare sub-micrometer-sized DNA gels of controllable crosslinking density that are able to embed novel functions, such as an enzymatic activity. It consists of using proteins, instead of traditional base-pairing assembly or covalent approaches, to form crosslinks inside individual DNA molecules, resulting in structures referred to as intramolecularly protein-crosslinked DNA gels (IPDGs). It is first shown that the addition of streptavidin to biotinylated T4DNA results in the successful formation of thermally stable IPDGs with a controllable crosslinking density, forming structures ranging from elongated to raspberry-shaped and pearl-necklace-like morphologies. Using reversible DNA condensation strategies, this paper shows that the gels can be reversibly actuated at a low crosslinking density, or further stabilized when they are highly crosslinked. Finally, by using streptavidin-protein conjugates, IPDGs with various enzymes are successfully functionalized. It is demonstrated that the enzymes keep their catalytic activity upon their incorporation into the gels, opening perspectives ranging from biotechnologies (e.g., enzyme manipulation) to nanomedicine (e.g., vectorization). © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  19. Stereoscopically Observing Manipulative Actions.

    Science.gov (United States)

    Ferri, S; Pauwels, K; Rizzolatti, G; Orban, G A

    2016-08-01

    The purpose of this study was to investigate the contribution of stereopsis to the processing of observed manipulative actions. To this end, we first combined the factors "stimulus type" (action, static control, and dynamic control), "stereopsis" (present, absent) and "viewpoint" (frontal, lateral) into a single design. Four sites in premotor, retro-insular (2) and parietal cortex operated specifically when actions were viewed stereoscopically and frontally. A second experiment clarified that the stereo-action-specific regions were driven by actions moving out of the frontoparallel plane, an effect amplified by frontal viewing in premotor cortex. Analysis of single voxels and their discriminatory power showed that the representation of action in the stereo-action-specific areas was more accurate when stereopsis was active. Further analyses showed that the 4 stereo-action-specific sites form a closed network converging onto the premotor node, which connects to parietal and occipitotemporal regions outside the network. Several of the specific sites are known to process vestibular signals, suggesting that the network combines observed actions in peripersonal space with gravitational signals. These findings have wider implications for the function of premotor cortex and the role of stereopsis in human behavior. © The Author 2016. Published by Oxford University Press.

  20. ADVERTISING AND LANGUAGE MANIPULATION

    Directory of Open Access Journals (Sweden)

    Cristina-Maria PRELIPCEANU

    2013-11-01

    Full Text Available Research has revealed that much of what happens in our minds as a result of language use is still hidden from our conscious awareness. Advertisers know this phenomenon better. They use the manipulation of language to suggest something about their products without directly claiming it to be true. Although the advertisers use colours, symbols, and imagery in advertisements, “the most direct way to study ads is through an analysis of the language employed” as all the other aspects are meant to reinforce the language message. Ads are designed to have an effect on consumers while being laughed at, belittle and all but ignored. Some modern advertisements appear to be almost dissuading consumers from the product – but this is just a modern technique. This paper is going to analyze a series of language techniques used by advertisers to arrest our attention, to arouse our interest, to stimulate desire for a product and ultimately to motivate us to buy it. Once we become familiar with the language strategies used in advertising messages we will be more able to make our own buying decisions.

  1. Stud manipulating device

    International Nuclear Information System (INIS)

    Bunyan, T.W.

    1980-01-01

    A device for inserting and removing studs from bores in a workpiece, for example a nuclear reactor vessel, comprises manipulating devices for operating on individual studs, each capable of tensioning a stud slackening a working nut on the stud, and subsequently removing the stud from the bore. A ring has dogs which can engage working nut recesses to interlock with the nut against relative rotation. Motors coupled to the ring rotate the working nut. A top nut is coupled to the motors to rotate the nut and screw it onto the stud. The top nut with other device parts can be raised and lowered on a tube by a hydraulic actuator. A hydraulic load cell between the top nut and a stool on the workpiece is pressurised to tension the stud by means of the top nut and thus facilitate rotation of the working nut when tightening or slackening. A dog clutch mechanism engages a stud end fitting against relative axial and rotational movement. The mechanism is raised and lowered on a guide member by an actuator. The mechanism has a tubular member and the drive coupling for the motors to the top nut includes a tubular member. Tubular members carry teeth which are engaged when the top nut is raised and the clutch mechanism is lowered, to provide a coupling between the motors and the mechanism for rotating the stud. (U.K.)

  2. A Theoretical and Experimental Study of DNA Self-assembly

    Science.gov (United States)

    Chandran, Harish

    The control of matter and phenomena at the nanoscale is fast becoming one of the most important challenges of the 21st century with wide-ranging applications from energy and health care to computing and material science. Conventional top-down approaches to nanotechnology, having served us well for long, are reaching their inherent limitations. Meanwhile, bottom-up methods such as self-assembly are emerging as viable alternatives for nanoscale fabrication and manipulation. A particularly successful bottom up technique is DNA self-assembly where a set of carefully designed DNA strands form a nanoscale object as a consequence of specific, local interactions among the different components, without external direction. The final product of the self-assembly process might be a static nanostructure or a dynamic nanodevice that performs a specific function. Over the past two decades, DNA self-assembly has produced stunning nanoscale objects such as 2D and 3D lattices, polyhedra and addressable arbitrary shaped substrates, and a myriad of nanoscale devices such as molecular tweezers, computational circuits, biosensors and molecular assembly lines. In this dissertation we study multiple problems in the theory, simulations and experiments of DNA self-assembly. We extend the Turing-universal mathematical framework of self-assembly known as the Tile Assembly Model by incorporating randomization during the assembly process. This allows us to reduce the tile complexity of linear assemblies. We develop multiple techniques to build linear assemblies of expected length N using far fewer tile types than previously possible. We abstract the fundamental properties of DNA and develop a biochemical system, which we call meta-DNA, based entirely on strands of DNA as the only component molecule. We further develop various enzyme-free protocols to manipulate meta-DNA systems and provide strand level details along with abstract notations for these mechanisms. We simulate DNA circuits by

  3. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  4. Manipulation Robustness of Collaborative Filtering

    OpenAIRE

    Benjamin Van Roy; Xiang Yan

    2010-01-01

    A collaborative filtering system recommends to users products that similar users like. Collaborative filtering systems influence purchase decisions and hence have become targets of manipulation by unscrupulous vendors. We demonstrate that nearest neighbors algorithms, which are widely used in commercial systems, are highly susceptible to manipulation and introduce new collaborative filtering algorithms that are relatively robust.

  5. Dielectrophoresis of gold nanoparticles conjugated to DNA origami structures

    Directory of Open Access Journals (Sweden)

    Anja Henning-Knechtel

    2016-07-01

    Full Text Available DNA nanostructures are promising construction materials to bridge the gap between self-assembly of functional molecules and conventional top-down fabrication methods in nanotechnology. Their positioning onto specific locations of a microstructured substrate is an important task towards this aim. Here we study manipulation and positioning of pristine and of gold nanoparticle-conjugated tubular DNA origami structures using ac dielectrophoresis. The dielectrophoretic behavior was investigated employing fluorescence microscopy. For the pristine origami, a significant dielectrophoretic response was found to take place in the megahertz range, whereas, due to the higher polarizability of the metallic nanoparticles, the nanoparticle/DNA hybrid structures required a lower electrical field strength and frequency for a comparable trapping at the edges of the electrode structure. The nanoparticle conjugation additionally resulted in a remarkable alteration of the DNA structure arrangement. The growth of linear, chain-like structures in between electrodes at applied frequencies in the megahertz range was observed. The long-range chain formation is caused by a local, gold nanoparticle-induced field concentration along the DNA nanostructures, which in turn, creates dielectrophoretic forces that enable the observed self-alignment of the hybrid structures.

  6. CLIMAN - a mobile manipulator concept

    International Nuclear Information System (INIS)

    Noltingk, B.E.; Owen, C.K.V.

    With increasing age the integrity of more remote parts of reactors, such as the core restraints, is questioned so there is a need for a means of access to these places to carry out inspection, minor repairs and alterations. Conventional standpipe manipulators are about 20 m long so that extending them further presents difficulties of load capacity, rigidity, dexterity and control which must increase steeply with range. The proposal outlined here is for a mobile manipulator which can climb at the end of a cable (CLImbing MANipulator - CLIMAN) into a reactor and reach well beyond the range of a fixed base machine. In addition to virtually unlimited range such a mobile manipulator has twice as many degrees of freedom as a fixed base machine. Its body or base can be manoeuvred with six degrees of freedom so as to obtain the maximum coverage and obstacle avoidance for its manipulator. It is proposed that it should be manually controlled. (author)

  7. A wireless centrifuge force microscope (CFM) enables multiplexed single-molecule experiments in a commercial centrifuge.

    Science.gov (United States)

    Hoang, Tony; Patel, Dhruv S; Halvorsen, Ken

    2016-08-01

    The centrifuge force microscope (CFM) was recently introduced as a platform for massively parallel single-molecule manipulation and analysis. Here we developed a low-cost and self-contained CFM module that works directly within a commercial centrifuge, greatly improving accessibility and ease of use. Our instrument incorporates research grade video microscopy, a power source, a computer, and wireless transmission capability to simultaneously monitor many individually tethered microspheres. We validated the instrument by performing single-molecule force shearing of short DNA duplexes. For a 7 bp duplex, we observed over 1000 dissociation events due to force dependent shearing from 2 pN to 12 pN with dissociation times in the range of 10-100 s. We extended the measurement to a 10 bp duplex, applying a 12 pN force clamp and directly observing single-molecule dissociation over an 85 min experiment. Our new CFM module facilitates simple and inexpensive experiments that dramatically improve access to single-molecule analysis.

  8. Characterization of photoactivated singlet oxygen damage in single-molecule optical trap experiments.

    Science.gov (United States)

    Landry, Markita P; McCall, Patrick M; Qi, Zhi; Chemla, Yann R

    2009-10-21

    Optical traps or "tweezers" use high-power, near-infrared laser beams to manipulate and apply forces to biological systems, ranging from individual molecules to cells. Although previous studies have established that optical tweezers induce photodamage in live cells, the effects of trap irradiation have yet to be examined in vitro, at the single-molecule level. In this study, we investigate trap-induced damage in a simple system consisting of DNA molecules tethered between optically trapped polystyrene microspheres. We show that exposure to the trapping light affects the lifetime of the tethers, the efficiency with which they can be formed, and their structure. Moreover, we establish that these irreversible effects are caused by oxidative damage from singlet oxygen. This reactive state of molecular oxygen is generated locally by the optical traps in the presence of a sensitizer, which we identify as the trapped polystyrene microspheres. Trap-induced oxidative damage can be reduced greatly by working under anaerobic conditions, using additives that quench singlet oxygen, or trapping microspheres lacking the sensitizers necessary for singlet state photoexcitation. Our findings are relevant to a broad range of trap-based single-molecule experiments-the most common biological application of optical tweezers-and may guide the development of more robust experimental protocols.

  9. Manipulation and soldering of carbon nanotubes using atomic force microscope

    International Nuclear Information System (INIS)

    Kashiwase, Yuta; Ikeda, Takayuki; Oya, Takahide; Ogino, Toshio

    2008-01-01

    Manipulation of carbon nanotubes (CNTs) by an atomic force microscope (AFM) and soldering of CNTs using Fe oxide nanoparticles are described. We succeeded to separate a CNT bundle into two CNTs or CNT bundles, to move the separated CNT to a desirable position, and to bind it to another bundle. For the accurate manipulation, load of the AFM cantilever and frequency of the scan were carefully selected. We soldered two CNTs using an Fe oxide nanoparticle prepared from a ferritin molecule. The adhesion forces between the soldered CNTs were examined by an AFM and it was found that the CNTs were bound, though the binding force was not strong

  10. Dexterous Manipulation: Making Remote Manipulators Easy to Use

    International Nuclear Information System (INIS)

    HARRIGAN, RAYMOND W.; BENNETT, PHIL C.

    2001-01-01

    Perhaps the most basic barrier to the widespread deployment of remote manipulators is that they are very difficult to use. Remote manual operations are fatiguing and tedious, while fully autonomous systems are seldom able to function in changing and unstructured environments. An alternative approach to these extremes is to exploit computer control while leaving the operator in the loop to take advantage of the operator's perceptual and decision-making capabilities. This report describes research that is enabling gradual introduction of computer control and decision making into operator-supervised robotic manipulation systems, and its integration on a commercially available, manually controlled mobile manipulator

  11. BioWord: A sequence manipulation suite for Microsoft Word

    Directory of Open Access Journals (Sweden)

    Anzaldi Laura J

    2012-06-01

    Full Text Available Abstract Background The ability to manipulate, edit and process DNA and protein sequences has rapidly become a necessary skill for practicing biologists across a wide swath of disciplines. In spite of this, most everyday sequence manipulation tools are distributed across several programs and web servers, sometimes requiring installation and typically involving frequent switching between applications. To address this problem, here we have developed BioWord, a macro-enabled self-installing template for Microsoft Word documents that integrates an extensive suite of DNA and protein sequence manipulation tools. Results BioWord is distributed as a single macro-enabled template that self-installs with a single click. After installation, BioWord will open as a tab in the Office ribbon. Biologists can then easily manipulate DNA and protein sequences using a familiar interface and minimize the need to switch between applications. Beyond simple sequence manipulation, BioWord integrates functionality ranging from dyad search and consensus logos to motif discovery and pair-wise alignment. Written in Visual Basic for Applications (VBA as an open source, object-oriented project, BioWord allows users with varying programming experience to expand and customize the program to better meet their own needs. Conclusions BioWord integrates a powerful set of tools for biological sequence manipulation within a handy, user-friendly tab in a widely used word processing software package. The use of a simple scripting language and an object-oriented scheme facilitates customization by users and provides a very accessible educational platform for introducing students to basic bioinformatics algorithms.

  12. BioWord: A sequence manipulation suite for Microsoft Word

    Science.gov (United States)

    2012-01-01

    Background The ability to manipulate, edit and process DNA and protein sequences has rapidly become a necessary skill for practicing biologists across a wide swath of disciplines. In spite of this, most everyday sequence manipulation tools are distributed across several programs and web servers, sometimes requiring installation and typically involving frequent switching between applications. To address this problem, here we have developed BioWord, a macro-enabled self-installing template for Microsoft Word documents that integrates an extensive suite of DNA and protein sequence manipulation tools. Results BioWord is distributed as a single macro-enabled template that self-installs with a single click. After installation, BioWord will open as a tab in the Office ribbon. Biologists can then easily manipulate DNA and protein sequences using a familiar interface and minimize the need to switch between applications. Beyond simple sequence manipulation, BioWord integrates functionality ranging from dyad search and consensus logos to motif discovery and pair-wise alignment. Written in Visual Basic for Applications (VBA) as an open source, object-oriented project, BioWord allows users with varying programming experience to expand and customize the program to better meet their own needs. Conclusions BioWord integrates a powerful set of tools for biological sequence manipulation within a handy, user-friendly tab in a widely used word processing software package. The use of a simple scripting language and an object-oriented scheme facilitates customization by users and provides a very accessible educational platform for introducing students to basic bioinformatics algorithms. PMID:22676326

  13. BioWord: a sequence manipulation suite for Microsoft Word.

    Science.gov (United States)

    Anzaldi, Laura J; Muñoz-Fernández, Daniel; Erill, Ivan

    2012-06-07

    The ability to manipulate, edit and process DNA and protein sequences has rapidly become a necessary skill for practicing biologists across a wide swath of disciplines. In spite of this, most everyday sequence manipulation tools are distributed across several programs and web servers, sometimes requiring installation and typically involving frequent switching between applications. To address this problem, here we have developed BioWord, a macro-enabled self-installing template for Microsoft Word documents that integrates an extensive suite of DNA and protein sequence manipulation tools. BioWord is distributed as a single macro-enabled template that self-installs with a single click. After installation, BioWord will open as a tab in the Office ribbon. Biologists can then easily manipulate DNA and protein sequences using a familiar interface and minimize the need to switch between applications. Beyond simple sequence manipulation, BioWord integrates functionality ranging from dyad search and consensus logos to motif discovery and pair-wise alignment. Written in Visual Basic for Applications (VBA) as an open source, object-oriented project, BioWord allows users with varying programming experience to expand and customize the program to better meet their own needs. BioWord integrates a powerful set of tools for biological sequence manipulation within a handy, user-friendly tab in a widely used word processing software package. The use of a simple scripting language and an object-oriented scheme facilitates customization by users and provides a very accessible educational platform for introducing students to basic bioinformatics algorithms.

  14. DNA nanotechnology: On-command molecular Trojans

    Science.gov (United States)

    Niemeyer, Christof M.

    2017-12-01

    Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.

  15. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Alternative end-joining of DNA breaks

    NARCIS (Netherlands)

    Schendel, Robin van

    2016-01-01

    DNA is arguably the most important molecule found in any organism, as it contains all information to perform cellular functions and enables continuity of species. It is continuously exposed to DNA-damaging agents both from endogenous and exogenous sources. To protect DNA against these sources of DNA

  17. Direct Manipulation in Virtual Reality

    Science.gov (United States)

    Bryson, Steve

    2003-01-01

    Virtual Reality interfaces offer several advantages for scientific visualization such as the ability to perceive three-dimensional data structures in a natural way. The focus of this chapter is direct manipulation, the ability for a user in virtual reality to control objects in the virtual environment in a direct and natural way, much as objects are manipulated in the real world. Direct manipulation provides many advantages for the exploration of complex, multi-dimensional data sets, by allowing the investigator the ability to intuitively explore the data environment. Because direct manipulation is essentially a control interface, it is better suited for the exploration and analysis of a data set than for the publishing or communication of features found in that data set. Thus direct manipulation is most relevant to the analysis of complex data that fills a volume of three-dimensional space, such as a fluid flow data set. Direct manipulation allows the intuitive exploration of that data, which facilitates the discovery of data features that would be difficult to find using more conventional visualization methods. Using a direct manipulation interface in virtual reality, an investigator can, for example, move a data probe about in space, watching the results and getting a sense of how the data varies within its spatial volume.

  18. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  19. Kinematic sensitivity of robot manipulators

    Science.gov (United States)

    Vuskovic, Marko I.

    1989-01-01

    Kinematic sensitivity vectors and matrices for open-loop, n degrees-of-freedom manipulators are derived. First-order sensitivity vectors are defined as partial derivatives of the manipulator's position and orientation with respect to its geometrical parameters. The four-parameter kinematic model is considered, as well as the five-parameter model in case of nominally parallel joint axes. Sensitivity vectors are expressed in terms of coordinate axes of manipulator frames. Second-order sensitivity vectors, the partial derivatives of first-order sensitivity vectors, are also considered. It is shown that second-order sensitivity vectors can be expressed as vector products of the first-order sensitivity vectors.

  20. Modeling manipulation in medical education.

    Science.gov (United States)

    Dailey, Jason I

    2010-05-01

    As residents and medical students progress through their medical training, they are presented with multiple instances in which they feel they must manipulate the healthcare system and deceive others in order to efficiently treat their patients. This, however, creates a culture of manipulation resulting in untoward effects on trainees' ethical and professional development. Yet manipulation need not be a skill necessary to practice medicine, and steps should be taken by both individuals and institutions to combat the view that the way medicine must be practiced "in the real world" is somehow different from what one's affective moral sense implores.

  1. Engineered cell manipulation for biomedical application

    CERN Document Server

    Akashi, Misturu; Matsusaki, Michiya

    2014-01-01

    This book is the first to summarize new technologies for engineered cell manipulation. The contents focus on control of cellular functions by nanomaterials and control of three-dimensional cell-cell interactions. Control of cellular functions is important for cell differentiation, maturation, and activation, which generally are controlled by the addition of soluble cytokines or growth factors into cell culture dishes. Target antigen molecules can be efficiently delivered to the cytosol of the dendritic cells using the nanoparticle technique described here, and cellular functions such as dendritic cell maturation can be controlled easily and with precision. This book describes basic preparation of the nanoparticles, activation control of dendritic cells, immune function control, and in vivo application for various vaccination systems. The second type of control,that of cell-cell interaction, is important for tissue engineering in order to develop three-dimensional cellular constructs. To achieve in vitro engin...

  2. Computational simulator of robotic manipulators

    International Nuclear Information System (INIS)

    Leal, Alexandre S.; Campos, Tarcisio P.R.

    1995-01-01

    Robotic application for industrial plants is discussed and a computational model for a mechanical manipulator of three links is presented. A neural network feed-forward type has been used to model the dynamic control of the manipulator. A graphic interface was developed in C programming language as a virtual world in order to visualize and simulate the arm movements handling radioactive waste environment. (author). 7 refs, 5 figs

  3. Can earnings manipulation create value?

    OpenAIRE

    Anton Miglo

    2008-01-01

    Existing literature usually considers earnings manipulation to be a negative social phenomenon. We argue that earnings manipulation can be a part of the equilibrium relationships between firm's insiders and outsiders. We consider an optimal contract between an entrepreneur and an investor where the entrepreneur is subject to a double moral hazard problem (one being the choice of production effort and the other being intertemporal substitution, which consists of transferring cash flows between...

  4. Final Report: Cooling Molecules with Laser Light

    International Nuclear Information System (INIS)

    Di Rosa, Michael D.

    2012-01-01

    Certain diatomic molecules are disposed to laser cooling in the way successfully applied to certain atoms and that ushered in a revolution in ultracold atomic physics, an identification first made at Los Alamos and which took root during this program. Despite their manipulation into numerous achievements, atoms are nonetheless mundane denizens of the quantum world. Molecules, on the other hand, with their internal degrees of freedom and rich dynamical interplay, provide considerably more complexity. Two main goals of this program were to demonstrate the feasibility of laser-cooling molecules to the same temperatures as laser-cooled atoms and introduce a means for collecting laser-cooled molecules into dense ensembles, a foundational start of studies and applications of ultracold matter without equivalence in atomic systems.

  5. Coherent Bichromatic Force Deflection of Molecules

    Science.gov (United States)

    Kozyryev, Ivan; Baum, Louis; Aldridge, Leland; Yu, Phelan; Eyler, Edward E.; Doyle, John M.

    2018-02-01

    We demonstrate the effect of the coherent optical bichromatic force on a molecule, the polar free radical strontium monohydroxide (SrOH). A dual-frequency retroreflected laser beam addressing the X˜2Σ+↔A˜2Π1 /2 electronic transition coherently imparts momentum onto a cryogenic beam of SrOH. This directional photon exchange creates a bichromatic force that transversely deflects the molecules. By adjusting the relative phase between the forward and counterpropagating laser beams we reverse the direction of the applied force. A momentum transfer of 70 ℏk is achieved with minimal loss of molecules to dark states. Modeling of the bichromatic force is performed via direct numerical solution of the time-dependent density matrix and is compared with experimental observations. Our results open the door to further coherent manipulation of molecular motion, including the efficient optical deceleration of diatomic and polyatomic molecules with complex level structures.

  6. Fungal Production and Manipulation of Plant Hormones.

    Science.gov (United States)

    Fonseca, Sandra; Radhakrishnan, Dhanya; Prasad, Kalika; Chini, Andrea

    2018-01-01

    Living organisms are part of a highly interconnected web of interactions, characterised by species nurturing, competing, parasitizing and preying on one another. Plants have evolved cooperative as well as defensive strategies to interact with neighbour organisms. Among these, the plant-fungus associations are very diverse, ranging from pathogenic to mutualistic. Our current knowledge of plant-fungus interactions suggests a sophisticated coevolution to ensure dynamic plant responses to evolving fungal mutualistic/pathogenic strategies. The plant-fungus communication relies on a rich chemical language. To manipulate the plant defence mechanisms, fungi produce and secrete several classes of biomolecules, whose modeof- action is largely unknown. Upon perception of the fungi, plants produce phytohormones and a battery of secondary metabolites that serve as defence mechanism against invaders or to promote mutualistic associations. These mutualistic chemical signals can be co-opted by pathogenic fungi for their own benefit. Among the plant molecules regulating plant-fungus interaction, phytohormones play a critical role since they modulate various aspects of plant development, defences and stress responses. Intriguingly, fungi can also produce phytohormones, although the actual role of fungalproduced phytohormones in plant-fungus interactions is poorly understood. Here, we discuss the recent advances in fungal production of phytohormone, their putative role as endogenous fungal signals and how fungi manipulate plant hormone balance to their benefits. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  7. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  8. High resolution low dose transmission electron microscopy real-time imaging and manipulation of nano-scale objects in the electron beam

    Science.gov (United States)

    Brown, Jr., R. Malcolm; Barnes, Zack [Austin, TX; Sawatari, Chie [Shizuoka, JP; Kondo, Tetsuo [Kukuoka, JP

    2008-02-26

    The present invention includes a method, apparatus and system for nanofabrication in which one or more target molecules are identified for manipulation with an electron beam and the one or more target molecules are manipulated with the electron beam to produce new useful materials.

  9. Handbook of Single-Molecule Biophysics

    CERN Document Server

    Hinterdorfer, Peter

    2009-01-01

    The last decade has seen the development of a number of novel biophysical methods that allow the manipulation and study of individual biomolecules. The ability to monitor biological processes at this fundamental level of sensitivity has given rise to an improved understanding of the underlying molecular mechanisms. Through the removal of ensemble averaging, distributions and fluctuations of molecular properties can be characterized, transient intermediates identified, and catalytic mechanisms elucidated. By applying forces on biomolecules while monitoring their activity, important information can be obtained on how proteins couple function to structure. The Handbook of Single-Molecule Biophysics provides an introduction to these techniques and presents an extensive discussion of the new biological insights obtained from them. Coverage includes: Experimental techniques to monitor and manipulate individual biomolecules The use of single-molecule techniques in super-resolution and functional imaging Single-molec...

  10. Single-molecule dynamics in nanofabricated traps

    Science.gov (United States)

    Cohen, Adam

    2009-03-01

    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  11. Molecular spintronics using single-molecule magnets

    Science.gov (United States)

    Bogani, Lapo; Wernsdorfer, Wolfgang

    2008-03-01

    A revolution in electronics is in view, with the contemporary evolution of the two novel disciplines of spintronics and molecular electronics. A fundamental link between these two fields can be established using molecular magnetic materials and, in particular, single-molecule magnets. Here, we review the first progress in the resulting field, molecular spintronics, which will enable the manipulation of spin and charges in electronic devices containing one or more molecules. We discuss the advantages over more conventional materials, and the potential applications in information storage and processing. We also outline current challenges in the field, and propose convenient schemes to overcome them.

  12. Fiscal 1997 R and D project on industrial science and technology under a consignment from NEDO. R and D of the ultimate manipulation technology of atoms and molecules (R and D of the formation of advanced materials for power generation environment); 1997 nendo sangyo kagaku gijutsu kenkyu kaihatsu jigyo Shin energy Sangyo Gijutsu Sogo Kaihatsu Kiko itaku. Genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho (hatsuden kankyoyo kokino sozai keisei gijutsu kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This paper describes R and D of the ultimate manipulation technology of atoms and molecules (atom technology). Ten nanoscale Ge islands were successfully formed in proper positions on an Si substrate surface by using mask technology of nanoscale atomic layers. Growth of less-defect ZnSe films on a GaAs(110) surface was possible under various conditions. The magnetic transfer mechanism of Mn oxide with huge reluctance was clarified. Through study on selective-area deposition of Si on plasma-oxidized ultrathin SiO2 mask layers patterned by direct electron-beam exposure and an idea of SiO2/SiNx bilayer mask, direct use of the ultrathin mask layer as insulating layer in device structure was achieved. The superior property as electron beam resist of methano- fullerene composed of fullerene C60 with side chains including oxygen was clarified. The initial oxidation process of an Si(100) surface was analyzed, and the observation result by SREM was theoretically explained. Development of a high-resolution spin polarization electron microscope was also mentioned. 48 refs., 145 figs., 20 tabs.

  13. 3D DNA Crystals and Nanotechnology

    Directory of Open Access Journals (Sweden)

    Paul J. Paukstelis

    2016-08-01

    Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  14. Electrokinetic Phenomena in Chemically Manipulated Environments

    Science.gov (United States)

    Nery Azevedo, Rodrigo

    Suspended particles are integral part of many systems and engineering technologies. They can be found in the form of colloidal suspensions, emulsions, polymer precursor solutions, and in biological materials such as blood. The miniaturization of new technologies and the advent of microfludics has made the manipulation of suspended particles in the microscale particularly important for a variety of fields. The ability to easily impart complex chemical environments to suspensions in microfluidic devices enables us to characterize these systems, modify their properties and drive their motion. Nonetheless, precise manipulation of the chemistry surrounding suspended particles has been particularly difficult up until recently. This thesis dissertation shows how microfluidic devices integrated with hydrogel membranes can be used to control the chemical environment of suspended particles for a variety of studies and practical applications. First, I demonstrate how particles move diffusiophoretically under ionic surfactant gradients. Diffusiophoresis, the motion of particles under concentration gradients, has been known for several decades but it has rarely been studied experimentally outside the context of simple electrolytes. Here, we show that diffusiophoresis in ionic surfactants below the CMC can be understood in terms of the classic theory for electrolytes. Above the CMC, however, the drive for diffsuiophoresis is significantly diminished due to a large drop in the change in chemical potential with added solute. Next, I show that gradients of dipolar molecules such a zwitterions can drive diffusiophoresis. I derive the diffusiophoretic migration of particles under gradients of dipolar molecules. This theory is backed up by experiments which reveal that, in such systems, particle velocities are directly proportional to the imposed gradient but do not scale with the inverse of the local concentration, as occurs under electrolyte gradients. Furthermore, I show that the

  15. Four-dimensional optical manipulation of colloidal particles

    DEFF Research Database (Denmark)

    Rodrigo, Peter John; Daria, Vincent Ricardo Mancao; Glückstad, Jesper

    2010-01-01

    years ago. Bringing together many landmark papers on the field, Optical Tweezers: Methods and Applications covers the techniques and uses of optical tweezers. Each section is introduced by a brief commentary, setting the papers into their historical and contemporary contexts. The first two sections...... of the best in the field, this compendium presents important historical and current developments of optical tweezers in a range of scientific areas, from the manipulation of bacteria to the treatment of DNA....

  16. Suspended DNA structural characterization by TEM diffraction

    KAUST Repository

    Marini, Monica

    2017-12-01

    In this work, micro-fabrication, super-hydrophobic properties and a physiologically compatible preparation step are combined and tailored to obtain background free biological samples to be investigated by Transmission Electron Microscopy (TEM) diffraction technique. The validation was performed evaluating a well-known parameter such as the DNA interbases value. The diffraction spacing measured is in good agreement with those obtained by HRTEM direct metrology and by traditional X-Ray diffraction. This approach addresses single molecule studies in a simplified and reproducible straightforward way with respect to more conventional and widely used techniques. In addition, it overcomes the need of long and elaborated samples preparations: the sample is in its physiological environment and the HRTEM data acquisition occurs without any background interference, coating, staining or additional manipulation. The congruence in the results reported in this paper makes the application of this approach extremely promising towards those molecules for which crystallization remains a hurdle, such as cell membrane proteins and fibrillar proteins.

  17. Suspended DNA structural characterization by TEM diffraction

    KAUST Repository

    Marini, Monica; Allione, Marco; Lopatin, Sergei; Moretti, Manola; Giugni, Andrea; Torre, Bruno; Di Fabrizio, Enzo M.

    2017-01-01

    In this work, micro-fabrication, super-hydrophobic properties and a physiologically compatible preparation step are combined and tailored to obtain background free biological samples to be investigated by Transmission Electron Microscopy (TEM) diffraction technique. The validation was performed evaluating a well-known parameter such as the DNA interbases value. The diffraction spacing measured is in good agreement with those obtained by HRTEM direct metrology and by traditional X-Ray diffraction. This approach addresses single molecule studies in a simplified and reproducible straightforward way with respect to more conventional and widely used techniques. In addition, it overcomes the need of long and elaborated samples preparations: the sample is in its physiological environment and the HRTEM data acquisition occurs without any background interference, coating, staining or additional manipulation. The congruence in the results reported in this paper makes the application of this approach extremely promising towards those molecules for which crystallization remains a hurdle, such as cell membrane proteins and fibrillar proteins.

  18. High precision redundant robotic manipulator

    International Nuclear Information System (INIS)

    Young, K.K.D.

    1998-01-01

    A high precision redundant robotic manipulator for overcoming contents imposed by obstacles or imposed by a highly congested work space is disclosed. One embodiment of the manipulator has four degrees of freedom and another embodiment has seven degrees of freedom. Each of the embodiments utilize a first selective compliant assembly robot arm (SCARA) configuration to provide high stiffness in the vertical plane, a second SCARA configuration to provide high stiffness in the horizontal plane. The seven degree of freedom embodiment also utilizes kinematic redundancy to provide the capability of avoiding obstacles that lie between the base of the manipulator and the end effector or link of the manipulator. These additional three degrees of freedom are added at the wrist link of the manipulator to provide pitch, yaw and roll. The seven degrees of freedom embodiment uses one revolute point per degree of freedom. For each of the revolute joints, a harmonic gear coupled to an electric motor is introduced, and together with properly designed based servo controllers provide an end point repeatability of less than 10 microns. 3 figs

  19. Autonomous Industrial Mobile Manipulation (AIMM)

    DEFF Research Database (Denmark)

    Hvilshøj, Mads; Bøgh, Simon; Nielsen, Oluf Skov

    2012-01-01

    Purpose - The purpose of this paper is to provide a review of the interdisciplinary research field Autonomous Industrial Mobile Manipulation (AIMM), with an emphasis on physical implementations and applications. Design/methodology/approach - Following an introduction to AIMM, this paper investiga......Purpose - The purpose of this paper is to provide a review of the interdisciplinary research field Autonomous Industrial Mobile Manipulation (AIMM), with an emphasis on physical implementations and applications. Design/methodology/approach - Following an introduction to AIMM, this paper......; sustainability, configuration, adaptation, autonomy, positioning, manipulation and grasping, robot-robot interaction, human-robot interaction, process quality, dependability, and physical properties. Findings - The concise yet comprehensive review provides both researchers (academia) and practitioners (industry......) with a quick and gentle overview of AIMM. Furthermore, the paper identifies key open issues and promising research directions to realize real-world integration and maturation of the AIMM technology. Originality/value - This paper reviews the interdisciplinary research field Autonomous Industrial Mobile...

  20. DNA nanotechnology and fluorescence applications.

    Science.gov (United States)

    Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf

    2016-06-01

    Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager

    2012-01-01

    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  2. The journey of DNA repair.

    Science.gov (United States)

    Saini, Natalie

    2015-12-01

    21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  3. The journey of DNA repair

    OpenAIRE

    Saini, Natalie

    2015-01-01

    21 years ago, the DNA Repair Enzyme was declared “Molecule of the Year”. Today, we are celebrating another “year of repair”, with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  4. Understanding pharmaceutical research manipulation in the context of accounting manipulation.

    Science.gov (United States)

    Brown, Abigail

    2013-01-01

    The problem of the manipulation of data that arises when there is both opportunity and incentive to mislead is better accepted and studied - though by no means solved - in financial accounting than in medicine. This article analyzes pharmaceutical company manipulation of medical research as part of a broader problem of corporate manipulation of data in the creation of accounting profits. The article explores how our understanding of accounting fraud and misinformation helps us understand the risk of similar information manipulation in the medical sciences. This understanding provides a framework for considering how best to improve the quality of medical research and analysis in light of the current system of medical information production. I offer three possible responses: (1) use of the Dodd-Frank whistleblower provisions to encourage reporting of medical research fraud; (2) a two-step academic journal review process for clinical trials; and (3) publicly subsidized trial-failure insurance. These would improve the release of negative information about drugs, thereby increasing the reliability of positive information. © 2013 American Society of Law, Medicine & Ethics, Inc.

  5. Learning Area and Perimeter with Virtual Manipulatives

    Science.gov (United States)

    Bouck, Emily; Flanagan, Sara; Bouck, Mary

    2015-01-01

    Manipulatives are considered a best practice for educating students with disabilities, but little research exists which examines virtual manipulatives as tool for supporting students in mathematics. This project investigated the use of a virtual manipulative through the National Library of Virtual Manipulatives--polynominoes (i.e., tiles)--as a…

  6. A six degrees of freedom mems manipulator

    NARCIS (Netherlands)

    de Jong, B.R.

    2006-01-01

    This thesis reports about a six degrees of freedom (DOF) precision manipulator in MEMS, concerning concept generation for the manipulator followed by design and fabrication (of parts) of the proposed manipulation concept in MEMS. Researching the abilities of 6 DOF precision manipulation in MEMS is

  7. Manipulator vehicles and loading shovels

    International Nuclear Information System (INIS)

    Brudermueller, G.; Krueger, W.

    1992-01-01

    Kerntechnische Hilfsdienst GmbH (KHG) is an institution jointly founded by electricity utilities, fuel cycle industries, and national research centers to provide specialist equipment for removing the consequences of accidents inside plants and recognizing damage in the immediate vicinity of such plants, maintain such equipment in an operational condition, and provide personnel instructed in work of this kind. The specialized technical equipment developed includes carriages, carrier vehicles for manipulators, grabs, TV cameras or measuring gear. In addition to manipulator vehicles, especially loading shovels are used. Radio-controlled vehicles are used where cable operation is either not reliable enough or has failed. (orig.) [de

  8. Theoretical modelling of tip effects in the pushing manipulation of C60 on the Si(001) surface

    International Nuclear Information System (INIS)

    Martsinovich, N; Kantorovich, L

    2008-01-01

    We present the results of our theoretical studies on the repulsive (pushing) manipulation of a C 60 molecule on the Si(001) surface with several scanning tunnelling microscopy tips. We show that, for silicon tips, tip-C 60 bonds are formed even with tips that do not initially have dangling bonds, and this tip-C 60 interaction drives the manipulation of the molecule. The details of the atomic structure of the tip and its position relative to the molecule do not have a significant effect on the mechanism and the sequence of adsorption configurations during the pushing manipulation of C 60 along the trough, where the trough itself provides a guiding effect. The pushing manipulation is thus a very robust process that occurs largely independently of the tip structure. On the other hand, the pushing manipulation across an Si-Si dimer row into the neighbouring trough proceeds in a more complex way, with tip deformation and detachment more likely to occur. We demonstrate the role of tip deformation and tip-molecule bond rearrangement in the continuous manipulation of the molecule. Finally, we calculate and analyse the forces acting on the tip during manipulation and identify characteristic patterns

  9. Biofunctionalization of zinc oxide nanowires for DNA sensory applications

    Directory of Open Access Journals (Sweden)

    Rudolph Bettina

    2011-01-01

    Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

  10. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

    2018-01-01

    , however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

  11. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  12. Leadership Manipulation and Ethics in Storytelling

    OpenAIRE

    Auvinen, Tommi; Lämsä, Anna-Maija; Sintonen, Teppo; Takala, Tuomo

    2013-01-01

    This article focuses on exerting influence in leadership, namely manipulation in storytelling. Manipulation is usually considered an unethical approach to leadership. We will argue that manipulation is a more complex phenomenon than just an unethical way of acting in leadership. We will demonstrate through an empirical qualitative study that there are various types of manipulation through storytelling. This article makes a contribution to the literature on manipulation through leadership stor...

  13. Dynamic Control of Kinematically Redundant Robotic Manipulators

    Directory of Open Access Journals (Sweden)

    Erling Lunde

    1987-07-01

    Full Text Available Several methods for task space control of kinematically redundant manipulators have been proposed in the literature. Most of these methods are based on a kinematic analysis of the manipulator. In this paper we propose a control algorithm in which we are especially concerned with the manipulator dynamics. The algorithm is particularly well suited for the class of redundant manipulators consisting of a relatively small manipulator mounted on a larger positioning part.

  14. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  15. Manipulations to regenerate aspen ecosystems

    Science.gov (United States)

    Wayne D. Shepperd

    2001-01-01

    Vegetative regeneration of aspen can be initiated through manipulations that provide hormonal stimulation, proper growth environment, and sucker protection - the three elements of the aspen regeneration triangle. The correct course of action depends upon a careful evaluation of the size, vigor, age, and successional status of the existing clone. Soils and site...

  16. Adaptive Control Of Remote Manipulator

    Science.gov (United States)

    Seraji, Homayoun

    1989-01-01

    Robotic control system causes remote manipulator to follow closely reference trajectory in Cartesian reference frame in work space, without resort to computationally intensive mathematical model of robot dynamics and without knowledge of robot and load parameters. System, derived from linear multivariable theory, uses relatively simple feedforward and feedback controllers with model-reference adaptive control.

  17. Indicial tensor manipulation on MACSYMA

    International Nuclear Information System (INIS)

    Bogen, R.A.; Pavelle, R.

    1977-01-01

    A new computational tool for physical calculations is described. It is the first computer system capable of performing indicial tensor calculus (as opposed to component tensor calculus). It is now operational on the symbolic manipulation system MACSYMA. The authors outline the capabilities of the system and describe some of the physical problems considered as well as others being examined at this time. (Auth.)

  18. Manipulations of Totalitarian Nazi Architecture

    Science.gov (United States)

    Antoszczyszyn, Marek

    2017-10-01

    The paper takes under considerations controversies surrounding German architecture designed during Nazi period between 1933-45. This architecture is commonly criticized for being out of innovation, taste & elementary sense of beauty. Moreover, it has been consequently wiped out from architectural manuals, probably for its undoubted associations with the totalitarian system considered as the most maleficent in the whole history. But in the meantime the architecture of another totalitarian system which appeared to be not less sinister than Nazi one is not stigmatized with such verve. It is Socrealism architecture, developed especially in East Europe & reportedly containing lots of similarities with Nazi architecture. Socrealism totalitarian architecture was never condemned like Nazi one, probably due to politically manipulated propaganda that influenced postwar public opinion. This observation leads to reflection that maybe in the same propaganda way some values of Nazi architecture are still consciously dissembled in order to hide the fact that some rules used by Nazi German architects have been also consciously used after the war. Those are especially manipulations that allegedly Nazi architecture consisted of. The paper provides some definitions around totalitarian manipulations as well as ideological assumptions for their implementation. Finally, the register of confirmed manipulations is provided with use of photo case study.

  19. Mapping and Manipulating Facial Expression

    Science.gov (United States)

    Theobald, Barry-John; Matthews, Iain; Mangini, Michael; Spies, Jeffrey R.; Brick, Timothy R.; Cohn, Jeffrey F.; Boker, Steven M.

    2009-01-01

    Nonverbal visual cues accompany speech to supplement the meaning of spoken words, signify emotional state, indicate position in discourse, and provide back-channel feedback. This visual information includes head movements, facial expressions and body gestures. In this article we describe techniques for manipulating both verbal and nonverbal facial…

  20. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  2. MODULAR MANIPULATOR FOR ROBOTICS APPLICATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Joseph W. Geisinger, Ph.D.

    2001-07-31

    ARM Automation, Inc. is developing a framework of modular actuators that can address the DOE's wide range of robotics needs. The objective of this effort is to demonstrate the effectiveness of this technology by constructing a manipulator from these actuators within a glovebox for Automated Plutonium Processing (APP). At the end of the project, the system of actuators was used to construct several different manipulator configurations, which accommodate common glovebox tasks such as repackaging. The modular nature and quickconnects of this system simplify installation into ''hot'' boxes and any potential modifications or repair therein. This work focused on the development of self-contained robotic actuator modules including the embedded electronic controls for the purpose of building a manipulator system. Both of the actuators developed under this project contain the control electronics, sensors, motor, gear train, wiring, system communications and mechanical interfaces of a complete robotics servo device. Test actuators and accompanying DISC{trademark}s underwent validation testing at The University of Texas at Austin and ARM Automation, Inc. following final design and fabrication. The system also included custom links, an umbilical cord, an open architecture PC-based system controller, and operational software that permitted integration into a completely functional robotic manipulator system. The open architecture on which this system is based avoids proprietary interfaces and communication protocols which only serve to limit the capabilities and flexibility of automation equipment. The system was integrated and tested in the contractor's facility for intended performance and operations. The manipulator was tested using the full-scale equipment and process mock-ups. The project produced a practical and operational system including a quantitative evaluation of its performance and cost.

  3. MODULAR MANIPULATOR FOR ROBOTICS APPLICATIONS

    International Nuclear Information System (INIS)

    Geisinger, Joseph W. Ph.D.

    2001-01-01

    ARM Automation, Inc. is developing a FR-amework of modular actuators that can address the DOE's wide range of robotics needs. The objective of this effort is to demonstrate the effectiveness of this technology by constructing a manipulator FR-om these actuators within a glovebox for Automated Plutonium Processing (APP). At the end of the project, the system of actuators was used to construct several different manipulator configurations, which accommodate common glovebox tasks such as repackaging. The modular nature and quickconnects of this system simplify installation into ''hot'' boxes and any potential modifications or repair therein. This work focused on the development of self-contained robotic actuator modules including the embedded electronic controls for the purpose of building a manipulator system. Both of the actuators developed under this project contain the control electronics, sensors, motor, gear train, wiring, system communications and mechanical interfaces of a complete robotics servo device. Test actuators and accompanying DISC(trademark)s underwent validation testing at The University of Texas at Austin and ARM Automation, Inc. following final design and fabrication. The system also included custom links, an umbilical cord, an open architecture PC-based system controller, and operational software that permitted integration into a completely functional robotic manipulator system. The open architecture on which this system is based avoids proprietary interfaces and communication protocols which only serve to limit the capabilities and flexibility of automation equipment. The system was integrated and tested in the contractor's facility for intended performance and operations. The manipulator was tested using the full-scale equipment and process mock-ups. The project produced a practical and operational system including a quantitative evaluation of its performance and cost

  4. DNA stress and strain, in silico, in vitro and in vivo

    International Nuclear Information System (INIS)

    Levens, David; Benham, Craig J

    2011-01-01

    A vast literature has explored the genetic interactions among the cellular components regulating gene expression in many organisms. Early on, in the absence of any biochemical definition, regulatory modules were conceived using the strict formalism of genetics to designate the modifiers of phenotype as either cis- or trans-acting depending on whether the relevant genes were embedded in the same or separate DNA molecules. This formalism distilled gene regulation down to its essence in much the same way that consideration of an ideal gas reveals essential thermodynamic and kinetic principles. Yet just as the anomalous behavior of materials may thwart an engineer who ignores their non-ideal properties, schemes to control and manipulate the genetic and epigenetic programs of cells may falter without a fuller and more quantitative elucidation of the physical and chemical characteristics of DNA and chromatin in vivo

  5. Combination of intratumoral injections of vaccinia virus MVA expressing GM-CSF and immunization with DNA vaccine prolongs the survival of mice bearing HPV16 induced tumors with downregulated expression of MHC class I molecules

    Czech Academy of Sciences Publication Activity Database

    Němečková, Š.; Šmahel, M.; Hainz, P.; Macková, J.; Zurková, K.; Gabriel, P.; Indrová, Marie; Kutinová, L.

    2007-01-01

    Roč. 54, č. 4 (2007), s. 326-333 ISSN 0028-2685 R&D Projects: GA MZd NR8004 Institutional research plan: CEZ:AV0Z50520514 Keywords : vaccinia virus MVA expressing GM- CSF * DNA vaccine * HPV16 induced tumors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.208, year: 2007

  6. cGAS Conducts Micronuclei DNA Surveillance.

    Science.gov (United States)

    de Oliveira Mann, Carina C; Kranzusch, Philip J

    2017-10-01

    DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Manipulators

    International Nuclear Information System (INIS)

    Papet, I.; Lune, P.; Pellerin, O.; Sapoval, M.; Brisse, H.; Clement, J.P.; Ribeiro, A.; Gomes, H.; Marcus, C.; Rehel, J.L.

    2005-01-01

    These two articles bring notions relative to the safety of procedures, specially in term of irradiation, they give information on different methods in order to reduce the radiation doses delivered to the patients, especially when the examinations concern children or young patients. (N.C.)

  8. Control of Single Molecule Fluorescence Dynamics by Stimulated Emission Depletion

    OpenAIRE

    Marsh, R. J.; Osborne, M. A.; Bain, A. J.

    2003-01-01

    The feasibility of manipulating the single molecule absorption-emission cycle using picosecond stimulated emission depletion (STED) is investigated using a stochastic computer simulation. In the simulation the molecule is subjected to repeated excitation and depletion events using time delayed pairs of excitation (PUMP) and depletion (DUMP) pulses derived from a high repetition rate pulsed laser system. The model is used to demonstrate that a significant and even substantial reduction in the ...

  9. A statistical approach to inelastic electron tunneling spectroscopy on fullerene-terminated molecules

    DEFF Research Database (Denmark)

    Fock, Jeppe; Sørensen, Jakob Kryger; Lörtscher, Emanuel

    2011-01-01

    We report on the vibrational fingerprint of single C(60) terminated molecules in a mechanically controlled break junction (MCBJ) setup using a novel statistical approach manipulating the junction mechanically to address different molecular configurations and to monitor the corresponding vibration...

  10. The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

    NARCIS (Netherlands)

    van den Berg, A.A.

    2017-01-01

    During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

  11. Modeling the manipulator and flipper pose effects on tip over stability of a tracked mobile manipulator

    CSIR Research Space (South Africa)

    Dube, C

    2011-11-01

    Full Text Available Mobile manipulators are used in a number of different applications such as bomb disposal, mining robotics, and search and rescue operations. These mobile manipulators are highly susceptible to tip over due to the motion of the manipulator...

  12. A control method for manipulators with redundancy

    International Nuclear Information System (INIS)

    Furusho, Junji; Usui, Hiroyuki

    1989-01-01

    Redundant manipulators have more ability than nonredundant ones in many aspects such as avoiding obstacles, avoiding singular states, etc. In this paper, a control algorithm for redundant manipulators working under the circumstance in the presence of obstacles is presented. First, the measure of manipulability for robot manipulators under obstacle circumstances is defined. Then, the control algorithm for the obstacle avoidance is derived by using this measure of manipulability. The obstacle avoidance and the maintenance of good posture are simultaneously achieved by this algorithm. Lastly, an experiment and simulation results using an eight degree of freedom manipulator are shown. (author)

  13. Mechanisms of DNA uptake by cells

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S.A.

    1977-01-01

    Three categories of cellular uptake of DNA can be distinguished. First, in the highly transformable bacteria, such as Diplococcus pneumoniae, Haemophilus influenzae and Bacillus subtilis, elaborate mechanisms of DNA transport have evolved, presumably for the purpose of genetic exchange. These mechanisms can introduce substantial amounts of DNA into the cell. Second, methods have been devised for the forced introduction of DNA by manipulation of bacterial cells under nonphysiological conditions. By such means small but significant amounts of DNA have been introduced into various bacteria, including Escherichia coli. Third, mammalian cells are able to take up biologically active DNA. This has been most clearly demonstrated with viral DNA, although the mechanism of uptake is not well understood. The intention, here, is to survey current understanding of the various mechanisms of DNA uptake. A review of experience with the bacterial systems may throw some light on the mammalian system and lead to suggestions for enhancing DNA uptake by mammalian cells.

  14. Adaptive hybrid control of manipulators

    Science.gov (United States)

    Seraji, H.

    1987-01-01

    Simple methods for the design of adaptive force and position controllers for robot manipulators within the hybrid control architecuture is presented. The force controller is composed of an adaptive PID feedback controller, an auxiliary signal and a force feedforward term, and it achieves tracking of desired force setpoints in the constraint directions. The position controller consists of adaptive feedback and feedforward controllers and an auxiliary signal, and it accomplishes tracking of desired position trajectories in the free directions. The controllers are capable of compensating for dynamic cross-couplings that exist between the position and force control loops in the hybrid control architecture. The adaptive controllers do not require knowledge of the complex dynamic model or parameter values of the manipulator or the environment. The proposed control schemes are computationally fast and suitable for implementation in on-line control with high sampling rates.

  15. Master-slave type manipulator

    International Nuclear Information System (INIS)

    Haaker, L.W.; Jelatis, D.G.

    1979-01-01

    Remote control manipulator of the master-slave type for carrying out work on the other side of a shield wall. This appliance allows a Y movement relative displacement, the function of which is to extend the range of the manipulator towards the front and also to facilitate its installation, the lateral rotation or inclination of the slave arm in relation to the master arm, and the Z movement extension through which the length of the slave arm is increased in comparison with that of the master arm. Devices have been developed which transform the linear movements into rotational movements to enable these movements to be transmitted through rotational seal fittings capable of ensuring the safety of the separation between the operator's environment and that in the work area. Particular improvements have been made to the handles, handle seals, pincer mechanisms, etc [fr

  16. Genetic manipulation of Francisella tularensis

    Directory of Open Access Journals (Sweden)

    Xhavit eZogaj

    2011-01-01

    Full Text Available Francisella tularensis is a facultative intracellular pathogen that causes the disease tularemia. F. tularensis subsp. tularensis causes the most severe disease in humans and has been classified as a select A agent and potential bioweapon. There is currently no vaccine approved for human use, making genetic manipulation of this organism critical to unraveling the genetic basis of pathogenesis and developing countermeasures against tularemia. The development of genetic techniques applicable to F. tularensis have lagged behind those routinely used for other bacteria, primarily due to lack of research and the restricted nature of the biocontainment required for studying this pathogen. However, in recent years, genetic techniques, such as transposon mutagenesis and targeted gene disruption, have been developed, that have had a dramatic impact on our understanding of the genetic basis of F. tularensis virulence. In this review, we describe some of the methods developed for genetic manipulation of F. tularensis.

  17. Viruses manipulate the marine environment.

    Science.gov (United States)

    Rohwer, Forest; Thurber, Rebecca Vega

    2009-05-14

    Marine viruses affect Bacteria, Archaea and eukaryotic organisms and are major components of the marine food web. Most studies have focused on their role as predators and parasites, but many of the interactions between marine viruses and their hosts are much more complicated. A series of recent studies has shown that viruses have the ability to manipulate the life histories and evolution of their hosts in remarkable ways, challenging our understanding of this almost invisible world.

  18. Manipulating a stated choice experiment

    DEFF Research Database (Denmark)

    Fosgerau, Mogens; Borjesson, Maria

    2015-01-01

    This paper considers the design of a stated choice experiment intended to measure the marginal rate of substitution (MRS) between cost and an attribute such as time using a conventional logit model. Focusing the experimental design on some target MRS will bias estimates towards that value....... The paper shows why this happens. The resulting estimated MRS can then be manipulated by adapting the target MRS in the experimental design. (C) 2015 Elsevier Ltd. All rights reserved....

  19. List manipulation in Turbo Prolog

    Directory of Open Access Journals (Sweden)

    V.Cotelea

    1995-06-01

    Full Text Available The present paper is concerned with list processing in Turbo Prolog language. It doesn't claim to be an exhaustive description of operations which can be performed upon lists. Nevertheless adduced programs are most representative, more or less known to specialists in logic programming domain. By means of examples are explained the list manipulation techniques, use of recursion, declarative comparison of predicates, analysis and fixation of acceptable prototypes and some problems of predicates' inconsistency. Index terms. Prolog, list, recursion.

  20. Molecules in the mud: Combining ancient DNA and lipid biomarkers to reconstruct vegetation response to climate variability during the Last Interglacial and the Holocene on Baffin Island, Arctic Canada

    Science.gov (United States)

    Crump, S. E.; Sepúlveda, J.; Bunce, M.; Miller, G. H.

    2017-12-01

    Modern ecological studies are revealing that the "greening" of the Arctic, resulting from a poleward shift in woody vegetation ranges, is already underway. The increasing abundance of shrubs in tundra ecosystems plays an important role in the global climate system through multiple positive feedbacks, yet uncertainty in future predictions of terrestrial vegetation means that climate models are likely not capturing these feedbacks accurately. Recently developed molecular techniques for reconstructing past vegetation and climate allow for a closer look at the paleo-record in order to improve our understanding of tundra community responses to climate variability; our current research focus is to apply these tools to both Last Interglacial and Holocene warm times. Here we present initial results from a small lake on southern Baffin Island spanning the last 7.2 ka. We reconstruct climate with both bulk geochemical and biomarker proxies, primarily using biogenic silica and branched glycerol dialkyl glycerol tetraethers (brGDGTs) as temperature indicators. We assess shifts in plant community using multivariate analysis of sedimentary ancient DNA (sedaDNA) metabarcoding data. This combination of approaches reveals that the vegetation community has responded sensitively to early Holocene warmth, Neoglacial cooling, and possibly modern anthropogenic warming. To our knowledge, this represents the first combination of a quantitative, biomarker-based climate reconstruction with a sedaDNA-based paleoecological reconstruction, and offers a glimpse at the potential of these molecular techniques used in tandem.