Fluorescence Microscopy of Nanochannel-Confined DNA.
Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O
2018-01-01
Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.
Static and Dynamic Properties of DNA Confined in Nanochannels
Gupta, Damini
Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain
DNA confinement in nanochannels: physics and biological applications
DEFF Research Database (Denmark)
Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H
2012-01-01
in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...
Counterion effects on nano-confined metal–drug–DNA complexes
Directory of Open Access Journals (Sweden)
Nupur Biswas
2016-01-01
Full Text Available We have explored morphology of DNA molecules bound with Cu complexes of piroxicam (a non-steroidal anti-inflammatory drug molecules under one-dimensional confinement of thin films and have studied the effect of counterions present in a buffer. X-ray reflectivity at and away from the Cu K absorption edge and atomic force microscopy studies reveal that confinement segregates the drug molecules preferentially in a top layer of the DNA film, and counterions enhance this segregation.
DNA analysis by single molecule stretching in nanofluidic biochips
DEFF Research Database (Denmark)
Abad, E.; Juarros, A.; Retolaza, A.
2011-01-01
Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...
Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao
2018-03-25
The nanopore can generate an electrochemical confinement for single-molecule sensing which help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this concept, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.
2018-01-01
Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.
Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J
2018-01-10
Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.
Structure and spectra of a confined HeH molecule
International Nuclear Information System (INIS)
Lo, J M H; Klobukowski, M; Bielinska-Wacz, D; Schreiner, E W S; Diercksen, G H F
2006-01-01
The influence of spatial confinement on the structure and spectra of the Rydberg HeH molecule is analysed at the level of the variational full configuration interaction approach. The confining potential is assumed to have cylindrical symmetry, with the symmetry axis of the potential overlapping with the molecular bond. In the direction perpendicular to the axis quadratic dependence of the potential on the electron coordinates is assumed. The influence of the confining potential on the form of the potential energy curves (in particular on the bond lengths), on the electronic spectra and on the ionization due to the confinement is studied in detail
Difference Raman spectroscopy of DNA molecules
International Nuclear Information System (INIS)
Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu
2015-01-01
In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule
Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl
Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.
2018-02-01
Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.
DNA-psoralen interaction: a single molecule experiment.
Rocha, M S; Viana, N B; Mesquita, O N
2004-11-15
By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.
Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond
Directory of Open Access Journals (Sweden)
David eDavidson
2013-01-01
Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA
International Nuclear Information System (INIS)
Wu, N.; Wang, Q.
2012-01-01
The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.
Single-molecule chemical reactions on DNA origami
DEFF Research Database (Denmark)
Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru
2010-01-01
as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...
Rovibrational states of Wigner molecules in spherically symmetric confining potentials
Energy Technology Data Exchange (ETDEWEB)
Cioslowski, Jerzy [Institute of Physics, University of Szczecin, Wielkopolska 15, 70-451 Szczecin, Poland and Max-Planck-Institut für Physik komplexer Systeme, Nöthnitzer Str. 38, D-01187 Dresden (Germany)
2016-08-07
The strong-localization limit of three-dimensional Wigner molecules, in which repulsively interacting particles are confined by a weak spherically symmetric potential, is investigated. An explicit prescription for computation of rovibrational wavefunctions and energies that are asymptotically exact at this limit is presented. The prescription is valid for systems with arbitrary angularly-independent interparticle and confining potentials, including those involving Coulombic and screened (i.e., Yukawa/Debye) interactions. The necessary derivations are greatly simplified by explicit constructions of the Eckart frame and the parity-adapted primitive wavefunctions. The performance of the new formalism is illustrated with the three- and four-electron harmonium atoms at their strong-correlation limits. In particular, the involvement of vibrational modes with the E symmetry is readily pinpointed as the origin of the “anomalous” weak-confinement behavior of the {sup 1}S{sub +} state of the four-electron species that is absent in its {sup 1}D{sub +} companion of the strong-confinement regime.
Extraction of ultrashort DNA molecules from herbarium specimens.
Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A
2017-02-01
DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.
Crowded, Confined, and Frustrated: Dynamics of Molecules Tethered to Nanoparticles
Agarwal, Praveen
2012-12-01
Above a critical chemistry-dependent molecular weight, all polymer molecules entangle and, as a result, exhibit slow dynamics, enhanced viscosity, and elasticity. Herein we report on the dynamics of low molecular weight polymers tethered to nanoparticles and find that even conventionally unentangled chains manifest dynamical features similar to entangled, long-chain molecules. Our findings are shown to imply that crowding and confinement of polymers on particles produce topological constraints analogous to those in entangled systems. © 2012 American Physical Society.
Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.
Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin
2013-06-20
When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.
Nano-manipulation of single DNA molecules
International Nuclear Information System (INIS)
Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie
2004-01-01
Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)
Quantum confinement in hydrogen bond of DNA and RNA
International Nuclear Information System (INIS)
Dos Santos, C S; Filho, E Drigo; Ricotta, R M
2015-01-01
The hydrogen bond is a fundamental ingredient to stabilize the DNA and RNA macromolecules. The main contribution of this work is to describe quantitatively this interaction as a consequence of the quantum confinement of the hydrogen. The results for the free and confined system are compared with experimental data. The formalism to compute the energy gap of the vibration motion used to identify the spectrum lines is the Variational Method allied to Supersymmetric Quantum Mechanics. (papert)
Dimitrov, Valentin V.
2009-01-01
This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Effects of confinement on the Rydberg molecule NeH
International Nuclear Information System (INIS)
Lo, J M H; Klobukowski, M; Bielinska-Waz, D; Diercksen, G H F; Schreiner, E W S
2005-01-01
Ab initio potential energy curves of the Rydberg NeH molecule in the presence of cylindrical spatial confinement were computed by the method of multi-reference configuration interaction with extended basis sets. The influence of the applied potential to the structures and spectra of the ground and excited states of NeH was analysed in terms of perturbation theory. In addition, the phenomenon of field-induced ionization was discussed
Surface-confined electroactive molecules for multistate charge storage information.
Mas-Torrent, M; Rovira, C; Veciana, J
2013-01-18
Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.
DNA-Based Single-Molecule Electronics: From Concept to Function
2018-01-01
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091
DNA-Based Single-Molecule Electronics: From Concept to Function.
Wang, Kun
2018-01-17
Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.
International Nuclear Information System (INIS)
Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira
2009-01-01
We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
A Single-Molecule Barcoding System using Nanoslits for DNA Analysis
Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.
Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Single Molecule Screening of Disease DNA Without Amplification
Energy Technology Data Exchange (ETDEWEB)
Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)
2006-01-01
The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA
Mieritz, Daniel; Li, Xiang; Volosin, Alex; Liu, Minghui; Yan, Hao; Walter, Nils G; Seo, Dong-Kyun
2017-06-27
Housing bio-nano guest devices based on DNA nanostructures within porous, conducting, inorganic host materials promise valuable applications in solar energy conversion, chemical catalysis, and analyte sensing. Herein, we report a single-template synthetic development of hierarchically porous, transparent conductive metal oxide coatings whose pores are freely accessible by large biomacromolecules. Their hierarchal pore structure is bimodal with a larger number of closely packed open macropores (∼200 nm) at the higher rank and with the remaining space being filled with a gel network of antimony-doped tin oxide (ATO) nanoparticles that is highly porous with a broad size range of textual pores mainly from 20-100 nm at the lower rank. The employed carbon black template not only creates the large open macropores but also retains the highly structured gel network as holey pore walls. Single molecule fluorescence microscopic studies with fluorophore-labeled DNA nanotweezers reveal a detailed view of multimodal diffusion dynamics of the biomacromolecules inside the hierarchically porous structure. Two diffusion constants were parsed from trajectory analyses that were attributed to free diffusion (diffusion constant D = 2.2 μm 2 /s) and to diffusion within an average confinement length of 210 nm (D = 0.12 μm 2 /s), consistent with the average macropore size of the coating. Despite its holey nature, the ATO gel network acts as an efficient barrier to the diffusion of the DNA nanostructures, which is strongly indicative of physical interactions between the molecules and the pore nanostructure.
[Single-molecule detection and characterization of DNA replication based on DNA origami].
Wang, Qi; Fan, Youjie; Li, Bin
2014-08-01
To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...
Electron microscope autoradiography of isolated DNA molecules
International Nuclear Information System (INIS)
Delain, Etienne; Bouteille, Michel
1980-01-01
Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections
Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.
Gahlon, Hailey L; Romano, Louis J; Rueda, David
2017-11-20
Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.
Thermophoretic forces on DNA measured with a single-molecule spring balance
DEFF Research Database (Denmark)
Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe
2014-01-01
We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...
Hengel, Sarah R; Spies, M Ashley; Spies, Maria
2017-09-21
To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.
DNA origami as biocompatible surface to match single-molecule and ensemble experiments
Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip
2012-01-01
Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083
Highly parallel translation of DNA sequences into small molecules.
Directory of Open Access Journals (Sweden)
Rebecca M Weisinger
Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.
Developing DNA nanotechnology using single-molecule fluorescence.
Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal
2014-06-17
CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and
Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.
Yadav, Hemendra; Sharma, Pulkit
2017-11-01
Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.
Single-molecule mechanics of protein-labelled DNA handles
Directory of Open Access Journals (Sweden)
Vivek S. Jadhav
2016-01-01
Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular
Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses
International Nuclear Information System (INIS)
Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.
2003-01-01
DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses
The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows
International Nuclear Information System (INIS)
Shen Zigang; Huang Yibo; Li Bin; Zhang Yi
2007-01-01
Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)
How to read and write mechanical information in DNA molecules
Schiessel, Helmut
In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.
The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties
International Nuclear Information System (INIS)
Kozłowska, Justyna; Bartkowiak, Wojciech
2014-01-01
Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule
The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties
Energy Technology Data Exchange (ETDEWEB)
Kozłowska, Justyna; Bartkowiak, Wojciech, E-mail: wojciech.bartkowiak@pwr.edu.pl
2014-09-30
Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule.
The Knot Spectrum of Confined Random Equilateral Polygons
Directory of Open Access Journals (Sweden)
Diao Y.
2014-01-01
Full Text Available It is well known that genomic materials (long DNA chains of living organisms are often packed compactly under extreme confining conditions using macromolecular self-assembly processes but the general DNA packing mechanism remains an unsolved problem. It has been proposed that the topology of the packed DNA may be used to study the DNA packing mechanism. For example, in the case of (mutant bacteriophage P4, DNA molecules packed inside the bacteriophage head are considered to be circular since the two sticky ends of the DNA are close to each other. The DNAs extracted from the capsid without separating the two ends can thus preserve the topology of the (circular DNAs. It turns out that the circular DNAs extracted from bacteriophage P4 are non-trivially knotted with very high probability and with a bias toward chiral knots. In order to study this problem using a systematic approach based on mathematical modeling, one needs to introduce a DNA packing model under extreme volume confinement condition and test whether such a model can produce the kind of knot spectrum observed in the experiments. In this paper we introduce and study a model of equilateral random polygons con_ned in a sphere. This model is not meant to generate polygons that model DNA packed in a virus head directly. Instead, the average topological characteristics of this model may serve as benchmark data for totally randomly packed circular DNAs. The difference between the biologically observed topological characteristics and our benchmark data might reveal the bias of DNA packed in the viral capsids and possibly lead to a better understanding of the DNA packing mechanism, at least for the bacteriophage DNA. The purpose of this paper is to provide information about the knot spectrum of equilateral random polygons under such a spherical confinement with length and confinement ratios in a range comparable to circular DNAs packed inside bacteriophage heads.
Visualizing Single-molecule DNA Replication with Fluorescence Microscopy
Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van
2009-01-01
We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The
DNA molecules and human therapeutics | Danquah | African Journal ...
African Journals Online (AJOL)
Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...
Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Automation of a single-DNA molecule stretching device
DEFF Research Database (Denmark)
Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels
2015-01-01
We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...
Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.
Cao, Chan; Long, Yi-Tao
2018-02-20
Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis
Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.
Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C
2010-01-19
Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.
Abdalla, S; Obaid, A; Al-Marzouki, F M
2017-12-01
Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a
Studying DNA looping by single-molecule FRET.
Le, Tung T; Kim, Harold D
2014-06-28
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.
From stripe to slab confinement for DNA linearization in nanochannels
Cifra, Peter; Benkova, Zuzana; Namer, Pavol
We investigate suggested advantageous analysis in the linearization experiments with macromolecules confined in a stripe-like channel using Monte Carlo simulations. The enhanced chain extension in a stripe that is due to significant excluded volume interactions between monomers in two dimensions weakens on transition to experimentally feasible slit-like channel. Based on the chain extension-confinement strength dependence and the structure factor behavior for the chain in stripe we infer the excluded volume regime typical for two-dimensional systems. On transition to the slab geometry, the advantageous chain extension decreases and the Gaussian regime is observed for not very long semiflexible chains. The evidence for pseudo-ideality in confined chains is based on indicators such as the extension curves, variation of the extension with the persistence length or the structure factor. The slab behavior is observed when the stripe (originally of monomer thickness) reaches the thickness larger than cca 10nm in the third dimension. This maximum height of the slab to retain the advantage of the stripe is very low and this have implication for DNA linearization experiments. The presented analysis, however, has a broader relevance for confined polymers. Support from Slovak R&D Agency (SRDA-0451-11) is acknowledged.
[The effect of spermine on acid-base equilibrium in DNA molecule].
Slonitskiĭ, S V; Kuptsov, V Iu
1990-01-01
The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
Buyukdagli, Sahin
2016-01-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...
Quantifying DNA melting transitions using single-molecule force spectroscopy
International Nuclear Information System (INIS)
Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J
2009-01-01
We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.
Quantifying DNA melting transitions using single-molecule force spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu
2009-01-21
We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.
A 3D-DNA Molecule Made of PlayMais
Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl
2015-01-01
More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…
DEFF Research Database (Denmark)
Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads
2017-01-01
Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
A single molecule DNA flow stretching microscope for undergraduates
Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.
2011-01-01
The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no
Compressing a confined DNA: from nano-channel to nano-cavity
Sakaue, Takahiro
2018-06-01
We analyze the behavior of a semiflexible polymer confined in nanochannel under compression in axial direction. Key to our discussion is the identification of two length scales; the correlation length ξ of concentration fluctuation and what we call the segregation length . These length scales, while degenerate in uncompressed state in nanochannel, generally split as upon compression, and the way they compete with the system size during the compression determines the crossover from quasi-1D nanochannel to quasi-0D nanocavity behaviors. For a flexible polymer, the story becomes very simple, which corresponds to a special limit of our description, but a much richer behavior is expected for a semiflexible polymer relevant to DNA in confined spaces. We also briefly discuss the dynamical properties of the compressed polymer.
Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I
National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...
Wang, Shujiao; Feng, Yingxin; Yu, Ming'an; Wan, Qiang; Lin, Sen
2017-09-27
The deposition of a two-dimensional (2D) atomic nanosheet on a metal surface has been considered as a new route for tuning the molecule-metal interaction and surface reactivity in terms of the confinement effect. In this work, we use first-principles calculations to systematically explore a novel nanospace constructed by placing a 2D graphitic carbon nitride (g-C 3 N 4 ) nanosheet over a Pt(111) surface. The confined catalytic activity in this nanospace is investigated using CO oxidation as a model reaction. With the inherent triangular pores in the g-C 3 N 4 overlayer being taken advantage of, molecules such as CO and O 2 can diffuse to adsorb on the Pt(111) surface underneath the g-C 3 N 4 overlayer. Moreover, the mechanism of intercalation is also elucidated, and the results reveal that the energy barrier depends mainly on the properties of the molecule and the channel. Importantly, the molecule-catalyst interaction can be tuned by the g-C 3 N 4 overlayer, considerably reducing the adsorption energy of CO on Pt(111) and leading to enhanced reactivity in CO oxidation. This work will provide important insight for constructing a promising nanoreactor in which the following is observed: The molecule intercalation is facile; the molecule-metal interaction is efficiently tuned; the metal-catalyzed reaction is promoted.
Friedrich, Sarah; Wang, Tza-Huei
Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.
Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.
Directory of Open Access Journals (Sweden)
Marijn T J van Loenhout
Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.
DNA origami-based shape IDs for single-molecule nanomechanical genotyping
Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai
2017-04-01
Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.
Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases
Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef
2012-01-01
Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Multiplex single-molecule interaction profiling of DNA-barcoded proteins.
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M
2014-11-27
In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.
DNA replication at the single-molecule level
Stratmann, S.A.; Oijen, A.M. van
2014-01-01
A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or
International Nuclear Information System (INIS)
Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S
2008-01-01
Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters
Single-molecule analysis of DNA replication in Xenopus egg extracts
Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel
The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the
Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments
International Nuclear Information System (INIS)
Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.
2007-01-01
We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
Distribution of distances between DNA barcode labels in nanochannels close to the persistence length
Reinhart, Wesley F.; Reifenberger, Jeff G.; Gupta, Damini; Muralidhar, Abhiram; Sheats, Julian; Cao, Han; Dorfman, Kevin D.
2015-02-01
We obtained experimental extension data for barcoded E. coli genomic DNA molecules confined in nanochannels from 40 nm to 51 nm in width. The resulting data set consists of 1 627 779 measurements of the distance between fluorescent probes on 25 407 individual molecules. The probability density for the extension between labels is negatively skewed, and the magnitude of the skewness is relatively insensitive to the distance between labels. The two Odijk theories for DNA confinement bracket the mean extension and its variance, consistent with the scaling arguments underlying the theories. We also find that a harmonic approximation to the free energy, obtained directly from the probability density for the distance between barcode labels, leads to substantial quantitative error in the variance of the extension data. These results suggest that a theory for DNA confinement in such channels must account for the anharmonic nature of the free energy as a function of chain extension.
Inhibition of DNA glycosylases via small molecule purine analogs.
Directory of Open Access Journals (Sweden)
Aaron C Jacobs
Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.
Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors
DEFF Research Database (Denmark)
Fu, Yanming; Zeng, Dongdong; Chao, Jie
2013-01-01
nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...
Real-time single-molecule observation of rolling-circle DNA replication
Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van
2009-01-01
We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities
Single-strand DNA molecule translocation through nanoelectrode gaps
International Nuclear Information System (INIS)
Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W
2007-01-01
Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation
Nartowski, K P; Tedder, J; Braun, D E; Fábián, L; Khimyak, Y Z
2015-10-14
The nanocrystallisation of complex molecules inside mesoporous hosts and control over the resulting structure is a significant challenge. To date the largest organic molecule crystallised inside the nano-pores is a known pharmaceutical intermediate - ROY (259.3 g mol(-1)). In this work we demonstrate smart manipulation of the phase of a larger confined pharmaceutical - indomethacin (IMC, 357.8 g mol(-1)), a substance with known conformational flexibility and complex polymorphic behaviour. We show the detailed structural analysis and the control of solid state transformations of encapsulated molecules inside the pores of mesoscopic cellular foam (MCF, pore size ca. 29 nm) and controlled pore glass (CPG, pore size ca. 55 nm). Starting from confined amorphous IMC we drive crystallisation into a confined methanol solvate, which upon vacuum drying leads to the stabilised rare form V of IMC inside the MCF host. In contrast to the pure form, encapsulated form V does not transform into a more stable polymorph upon heating. The size of the constraining pores and the drug concentration within the pores determine whether the amorphous state of the drug is stabilised or it recrystallises into confined nanocrystals. The work presents, in a critical manner, an application of complementary techniques (DSC, PXRD, solid-state NMR, N2 adsorption) to confirm unambiguously the phase transitions under confinement and offers a comprehensive strategy towards the formation and control of nano-crystalline encapsulated organic solids.
Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules
Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan
DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
Enzyme Molecules in Solitary Confinement
Directory of Open Access Journals (Sweden)
Raphaela B. Liebherr
2014-09-01
Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.
Generating equilateral random polygons in confinement
International Nuclear Information System (INIS)
Diao, Y; Ernst, C; Montemayor, A; Ziegler, U
2011-01-01
One challenging problem in biology is to understand the mechanism of DNA packing in a confined volume such as a cell. It is known that confined circular DNA is often knotted and hence the topology of the extracted (and relaxed) circular DNA can be used as a probe of the DNA packing mechanism. However, in order to properly estimate the topological properties of the confined circular DNA structures using mathematical models, it is necessary to generate large ensembles of simulated closed chains (i.e. polygons) of equal edge lengths that are confined in a volume such as a sphere of certain fixed radius. Finding efficient algorithms that properly sample the space of such confined equilateral random polygons is a difficult problem. In this paper, we propose a method that generates confined equilateral random polygons based on their probability distribution. This method requires the creation of a large database initially. However, once the database has been created, a confined equilateral random polygon of length n can be generated in linear time in terms of n. The errors introduced by the method can be controlled and reduced by the refinement of the database. Furthermore, our numerical simulations indicate that these errors are unbiased and tend to cancel each other in a long polygon. (paper)
Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S
2018-04-18
Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.
Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.
Directory of Open Access Journals (Sweden)
Scott S Walker
Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.
Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.
Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W
2018-03-05
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1 s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A
2007-09-15
We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.
Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy
Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto
2011-01-01
DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016
Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu
2015-01-31
A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.
Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas
2018-06-27
DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.
Kuzmenko, Anton; Tankov, Stoyan; English, Brian P.; Tarassov, Ivan; Tenson, Tanel; Kamenski, Piotr; Elf, Johan; Hauryliuk, Vasili
2011-12-01
Tom40 is an integral protein of the mitochondrial outer membrane, which as the central component of the Translocase of the Outer Membrane (TOM) complex forms a channel for protein import. We characterize the diffusion properties of individual Tom40 molecules fused to the photoconvertable fluorescent protein Dendra2 with millisecond temporal resolution. By imaging individual Tom40 molecules in intact isolated yeast mitochondria using photoactivated localization microscopy with sub-diffraction limited spatial precision, we demonstrate that Tom40 movement in the outer mitochondrial membrane is highly dynamic but confined in nature, suggesting anchoring of the TOM complex as a whole.
Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET
Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William
2018-01-01
Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...
Directory of Open Access Journals (Sweden)
M. Moradi
2004-12-01
Full Text Available The density functional theory analogue of Percus Yevick (PY and Hyper-Netted chain (HNC has been used to write the grand potential of a liquid with cylindrical and ellipsoidal molecules. The integral equations for the density can be obtained by minimizing the grand potential with respect to the density. Some kinds of liquid crystals, can have the cylindrical or ellipsoidal rigid molecules. In this study we have calculated the density profile of this kind of liquids confined between hard walls and we compared the results. As it is seen from the graphs of the density profiles the molecules can be arranged as layers with respect to the walls.
NMR relaxation dispersion of Miglyol molecules confined inside polymeric micro-capsules.
Nechifor, Ruben; Ardelean, Ioan; Mattea, Carlos; Stapf, Siegfried; Bogdan, Mircea
2011-11-01
Frequency dependent NMR relaxation studies have been carried out on Miglyol molecules confined inside core shell polymeric capsules to obtain a correlation between capsule dimension and the measurable parameters. The polymeric capsules were prepared using an interfacial polymerization technique for three different concentrations of Miglyol. It was shown that the variation of Miglyol concentration influences the capsule dimension. Their average size was estimated using the pulsed field gradient diffusometry technique. The relaxation dispersion curves were obtained at room temperature by a combined use of a fast field cycling instrument and a high-field instrument. The frequency dependence of relaxation rate shows a transition from a diffusion-limited to a surface-limited relaxation regime. Copyright © 2011 John Wiley & Sons, Ltd.
DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments
Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.
2012-02-01
We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.
Analysis of DNA interactions using single-molecule force spectroscopy.
Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert
2013-06-01
Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.
THz–IR spectroscopy of single H.sub.2./sub.O molecules confined in nanocage of beryl crystal lattice
Czech Academy of Sciences Publication Activity Database
Gorshunov, B. P.; Zhukova, E.S.; Torgashev, V. I.; Motovilova, E.A.; Lebedev, V.V.; Prokhorov, A. S.; Shakurov, G.S.; Kremer, R. K.; Uskov, V.V.; Pestrjakov, E.V.; Thomas, V.G.; Fursenko, D.A.; Kadlec, Christelle; Kadlec, Filip; Dressel, M.
2014-01-01
Roč. 87, 10-11 (2014), s. 966-972 ISSN 0141-1594 R&D Projects: GA ČR(CZ) GA14-25639S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * nano-confined water molecule Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.954, year: 2014
Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.
Directory of Open Access Journals (Sweden)
Jonghyun Park
2010-11-01
Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.
DEFF Research Database (Denmark)
Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders
2011-01-01
We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....
DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.
Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi
2017-12-06
We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.
DEFF Research Database (Denmark)
Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru
2010-01-01
DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....
International Nuclear Information System (INIS)
Cruz, Fernando J. A. L.; Pablo, Juan J. de; Mota, José P. B.
2014-01-01
Although carbon nanotubes are potential candidates for DNA encapsulation and subsequent delivery of biological payloads to living cells, the thermodynamical spontaneity of DNA encapsulation under physiological conditions is still a matter of debate. Using enhanced sampling techniques, we show for the first time that, given a sufficiently large carbon nanotube, the confinement of a double-stranded DNA segment, 5′-D( * CP * GP * CP * GP * AP * AP * TP * TP * CP * GP * CP * G)-3′, is thermodynamically favourable under physiological environments (134 mM, 310 K, 1 bar), leading to DNA-nanotube hybrids with lower free energy than the unconfined biomolecule. A diameter threshold of 3 nm is established below which encapsulation is inhibited. The confined DNA segment maintains its translational mobility and exhibits the main geometrical features of the canonical B form. To accommodate itself within the nanopore, the DNA's end-to-end length increases from 3.85 nm up to approximately 4.1 nm, due to a ∼0.3 nm elastic expansion of the strand termini. The canonical Watson-Crick H-bond network is essentially conserved throughout encapsulation, showing that the contact between the DNA segment and the hydrophobic carbon walls results in minor rearrangements of the nucleotides H-bonding. The results obtained here are paramount to the usage of carbon nanotubes as encapsulation media for next generation drug delivery technologies
Single-molecule denaturation mapping of DNA in nanofluidic channels
DEFF Research Database (Denmark)
Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli
2010-01-01
Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...
Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong
2018-02-01
Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.
Knotting dynamics of DNA chains of different length confined in nanochannels
International Nuclear Information System (INIS)
Suma, Antonio; Micheletti, Cristian; Orlandini, Enzo
2015-01-01
Langevin dynamics simulations are used to characterize the typical mechanisms governing the spontaneous tying, untying and the dynamical evolution of knots in coarse-grained models of DNA chains confined in nanochannels. In particular we focus on how these mechanisms depend on the chain contour length, L c , at a fixed channel width D = 56 nm corresponding to the onset of the Odijk scaling regime where chain backfoldings and hence knots are disfavoured but not suppressed altogether. We find that the lifetime of knots grows significantly with L c , while that of unknots varies to a lesser extent. The underlying kinetic mechanisms are clarified by analysing the evolution of the knot position along the chain. At the considered confinement, in fact, knots are typically tied by local backfoldings of the chain termini where they are eventually untied after a stochastic motion along the chain. Consequently, the lifetime of unknots is mostly controlled by backfoldings events at the chain ends, which is largely independent of L c . The lifetime of knots, instead, increases significantly with L c because knots can, on average, travel farther along the chain before being untied. The observed interplay of knots and unknots lifetimes underpins the growth of the equilibrium knotting probability of longer and longer chains at fixed channel confinement. (paper)
Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark
2003-01-01
Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Zhang, Yuning; Reisner, Walter
2013-03-01
Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.
Directory of Open Access Journals (Sweden)
Greta Zubaite
2017-02-01
Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.
Energy Technology Data Exchange (ETDEWEB)
Cruz, Fernando J. A. L., E-mail: fj.cruz@fct.unl.pt [Requimte/CQFB, Departamento de Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica 2829-516 (Portugal); Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States); Pablo, Juan J. de [Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States); Institute of Molecular Engineering, University of Chicago, Chicago, Illinois 60637 (United States); Mota, José P. B. [Requimte/CQFB, Departamento de Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica 2829-516 (Portugal)
2014-06-14
Although carbon nanotubes are potential candidates for DNA encapsulation and subsequent delivery of biological payloads to living cells, the thermodynamical spontaneity of DNA encapsulation under physiological conditions is still a matter of debate. Using enhanced sampling techniques, we show for the first time that, given a sufficiently large carbon nanotube, the confinement of a double-stranded DNA segment, 5′-D({sup *}CP{sup *}GP{sup *}CP{sup *}GP{sup *}AP{sup *}AP{sup *}TP{sup *}TP{sup *}CP{sup *}GP{sup *}CP{sup *}G)-3′, is thermodynamically favourable under physiological environments (134 mM, 310 K, 1 bar), leading to DNA-nanotube hybrids with lower free energy than the unconfined biomolecule. A diameter threshold of 3 nm is established below which encapsulation is inhibited. The confined DNA segment maintains its translational mobility and exhibits the main geometrical features of the canonical B form. To accommodate itself within the nanopore, the DNA's end-to-end length increases from 3.85 nm up to approximately 4.1 nm, due to a ∼0.3 nm elastic expansion of the strand termini. The canonical Watson-Crick H-bond network is essentially conserved throughout encapsulation, showing that the contact between the DNA segment and the hydrophobic carbon walls results in minor rearrangements of the nucleotides H-bonding. The results obtained here are paramount to the usage of carbon nanotubes as encapsulation media for next generation drug delivery technologies.
Topological and metric properties of linear and circular DNA chains in nano-slits and nano-channels
Orlandini, Enzo; Micheletti, Cristian
2014-03-01
Motivated by recent advancements in single DNA molecule experiments, based on nanofluidic devices, we investigate numerically the metric and topological properties of a modelof open and circular DNA chains confined inside nano-slits and nano-channles. The results reveal an interesting characterization of the metric crossover behaviour in terms of the abundance, type and length of occuring knots. In particular we find that the knotting probability is nonmonotonic for increasing confinement and can be largely enhanced or suppressed, compared to the bulk case, by simply varying the slit or channel trasversal dimension. The observed knot population consists of knots that are far simpler than for DNA chains in spherical (i.e. cavities or capsids) confinement. These results suggest that nanoslits and nanochannels can be properly designed to produce open DNA chains hosting simple knots or to sieve DNA rings according to their knotted state. Finally we discuss the implications that the presence of knots may have on the dynamical properties of confined DNA chains such as chain elongation, injection/ejection processes and entanglement relaxation. We acknowledge financial support from the Italian ministry of education, grant PRIN 2010HXAW77.
Moayed, F.; Mashaghi, A.; Tans, S.J.
2013-01-01
Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an
Single molecule DNA detection with an atomic vapor notch filter
Energy Technology Data Exchange (ETDEWEB)
Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)
2015-12-01
The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)
International Nuclear Information System (INIS)
Diao, Y; Hinson, K; Sun, Y; Arsuaga, J
2015-01-01
Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the
Diao, Y.; Hinson, K.; Sun, Y.; Arsuaga, J.
2015-10-01
Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the
Positive cell-free fetal DNA testing for trisomy 13 reveals confined placental mosaicism.
Hall, April L; Drendel, Holli M; Verbrugge, Jennifer L; Reese, Angela M; Schumacher, Katherine L; Griffith, Christopher B; Weaver, David D; Abernathy, Mary P; Litton, Christian G; Vance, Gail H
2013-09-01
We report on a case in which cell-free fetal DNA was positive for trisomy 13 most likely due to confined placental mosaicism. Cell-free fetal DNA testing analyzes DNA derived from placental trophoblast cells and can lead to incorrect results that are not representative of the fetus. We sought to confirm commercial cell-free fetal DNA testing results by chorionic villus sampling and amniocentesis. These results were followed up by postnatal chromosome analysis of cord blood and placental tissue. First-trimester cell-free fetal DNA test results were positive for trisomy 13. Cytogenetic analysis of chorionic villus sampling yielded a mosaic karyotype of 47,XY,+13[10]/46,XY[12]. G-banded analysis of amniotic fluid was normal, 46,XY. Postnatal cytogenetic analysis of cord blood was normal. Karyotyping of tissues from four quadrants of the placenta demonstrated mosaicism for trisomy 13 in two of the quadrants and a normal karyotype in the other two. Our case illustrates several important aspects of this new testing methodology: that cell-free fetal DNA may not be representative of the fetal karyotype; that follow-up with diagnostic testing of chorionic villus sampling and/or amniotic fluid for abnormal test results should be performed; and that pretest counseling regarding the full benefits, limitations, and possible testing outcomes of cell-free fetal DNA screening is important.
Single-molecule studies of DNA transcription using atomic force microscopy
International Nuclear Information System (INIS)
Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer
2012-01-01
Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)
Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems
Williams, Mark C
2011-01-01
This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...
Production of highly knotted DNA by means of cosmid circularization inside phage capsids
Directory of Open Access Journals (Sweden)
Trigueros Sonia
2007-12-01
Full Text Available Abstract Background The formation of DNA knots is common during biological transactions. Yet, functional implications of knotted DNA are not fully understood. Moreover, potential applications of DNA molecules condensed by means of knotting remain to be explored. A convenient method to produce abundant highly knotted DNA would be highly valuable for these studies. Results We had previously shown that circularization of the 11.2 kb linear DNA of phage P4 inside its viral capsid generates complex knots by the effect of confinement. We demonstrate here that this mechanism is not restricted to the viral genome. We constructed DNA cosmids as small as 5 kb and introduced them inside P4 capsids. Such cosmids were then recovered as a complex mixture of highly knotted DNA circles. Over 250 μg of knotted cosmid were typically obtained from 1 liter of bacterial culture. Conclusion With this biological system, DNA molecules of varying length and sequence can be shaped into very complex and heterogeneous knotted forms. These molecules can be produced in preparative amounts suitable for systematic studies and applications.
Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET
Hohlbein, J.; Kapanidis, A.N.
2016-01-01
Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open
Single Molecule Study of DNA Organization and Recombination
Xiao, Botao
We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force
Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.
2016-01-01
Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595
Non-Gaussian Distribution of DNA Barcode Extension In Nanochannels Using High-throughput Imaging
Sheats, Julian; Reinhart, Wesley; Reifenberger, Jeff; Gupta, Damini; Muralidhar, Abhiram; Cao, Han; Dorfman, Kevin
2015-03-01
We present experimental data for the extension of internal segments of highly confined DNA using a high-throughput experimental setup. Barcode-labeled E. coli genomic DNA molecules were imaged at a high areal density in square nanochannels with sizes ranging from 40 nm to 51 nm in width. Over 25,000 molecules were used to obtain more than 1,000,000 measurements for genomic distances between 2,500 bp and 100,000 bp. The distribution of extensions has positive excess kurtosis and is skew left due to weak backfolding in the channel. As a result, the two Odijk theories for the chain extension and variance bracket the experimental data. We compared to predictions of a harmonic approximation for the confinement free energy and show that it produces a substantial error in the variance. These results suggest an inherent error associated with any statistical analysis of barcoded DNA that relies on harmonic models for chain extension. Present address: Department of Chemical and Biological Engineering, Princeton University.
Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.
Directory of Open Access Journals (Sweden)
Mária Džunková
Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.
Protein dynamics during presynaptic complex assembly on individual ssDNA molecules
Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.
2014-01-01
Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...
Directory of Open Access Journals (Sweden)
Toshitsugu Fujita
2015-09-01
Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.
DEFF Research Database (Denmark)
Reisner, Walter; Beech, J. P.; Larsen, Niels Bent
2007-01-01
100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....
Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA
Czech Academy of Sciences Publication Activity Database
Hanzálek, Petr; Kypr, Jaroslav
2001-01-01
Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001
DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.
Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg
2014-04-15
DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target
Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan
1999-01-01
By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first
Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates
DEFF Research Database (Denmark)
Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru
2012-01-01
Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...
Biswas, Rajib; Bagchi, Biman
2018-01-01
In nature, water is often found in contact with surfaces that are extended on the scale of molecule size but small on a macroscopic scale. Examples include lipid bilayers and reverse micelles as well as biomolecules like proteins, DNA and zeolites, to name a few. While the presence of surfaces and interfaces interrupts the continuous hydrogen bond network of liquid water, confinement on a mesoscopic scale introduces new features. Even when extended on a molecular scale, natural and biological surfaces often have features (like charge, hydrophobicity) that vary on the scale of the molecular diameter of water. As a result, many new and exotic features, which are not seen in the bulk, appear in the dynamics of water close to the surface. These different behaviors bear the signature of both water-surface interactions and of confinement. In other words, the altered properties are the result of the synergistic effects of surface-water interactions and confinement. Ultrafast spectroscopy, theoretical modeling and computer simulations together form powerful synergistic approaches towards an understanding of the properties of confined water in such systems as nanocavities, reverse micelles (RMs), water inside and outside biomolecules like proteins and DNA, and also between two hydrophobic walls. We shall review the experimental results and place them in the context of theory and simulations. For water confined within RMs, we discuss the possible interference effects propagating from opposite surfaces. Similar interference is found to give rise to an effective attractive force between two hydrophobic surfaces immersed and kept fixed at a separation of d, with the force showing an exponential dependence on this distance. For protein and DNA hydration, we shall examine a multitude of timescales that arise from frustration effects due to the inherent heterogeneity of these surfaces. We pay particular attention to the role of orientational correlations and modification of the
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
How to determine local stretching and tension in a flow-stretched DNA molecule
DEFF Research Database (Denmark)
Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders
2016-01-01
We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....
On the identification techniques for ionizing radiation structure breaks in the DNA molecule
International Nuclear Information System (INIS)
Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.
2012-01-01
In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)
Morris, Graham P.; Baker, Ruth E.; Gillow, Kathryn; Davis, Jason J.; Gavaghan, David J.; Bond, Alan M.
2015-01-01
© 2015 American Chemical Society. Commonly, significant discrepancies are reported in theoretical and experimental comparisons of dc voltammograms derived from a monolayer or close to monolayer coverage of redox-active surface-confined molecules. For example, broader-than-predicted voltammetric wave shapes are attributed to the thermodynamic or kinetic dispersion derived from distributions in reversible potentials (E0) and electrode kinetics (k0), respectively. The recent availability of experimentally estimated distributions of E0 and k0 values derived from the analysis of data for small numbers of surface-confined modified azurin metalloprotein molecules now allows more realistic modeling to be undertaken, assuming the same distributions apply under conditions of high surface coverage relevant to voltammetric experiments. In this work, modeling based on conventional and stochastic kinetic theory is considered, and the computationally far more efficient conventional model is shown to be equivalent to the stochastic one when large numbers of molecules are present. Perhaps unexpectedly, when experimentally determined distributions of E0 and k0 are input into the model, thermodynamic dispersion is found to be unimportant and only kinetic dispersion contributes significantly to the broadening of dc voltammograms. Simulations of ac voltammetric experiments lead to the conclusion that the ac method, particularly when the analysis of kinetically very sensitive higher-order harmonics is undertaken, are far more sensitive to kinetic dispersion than the dc method. ac methods are therefore concluded to provide a potentially superior strategy for addressing the inverse problem of determining the k0 distribution that could give rise to the apparent anomalies in surface-confined voltammetry.
Morris, Graham P.
2015-05-05
© 2015 American Chemical Society. Commonly, significant discrepancies are reported in theoretical and experimental comparisons of dc voltammograms derived from a monolayer or close to monolayer coverage of redox-active surface-confined molecules. For example, broader-than-predicted voltammetric wave shapes are attributed to the thermodynamic or kinetic dispersion derived from distributions in reversible potentials (E0) and electrode kinetics (k0), respectively. The recent availability of experimentally estimated distributions of E0 and k0 values derived from the analysis of data for small numbers of surface-confined modified azurin metalloprotein molecules now allows more realistic modeling to be undertaken, assuming the same distributions apply under conditions of high surface coverage relevant to voltammetric experiments. In this work, modeling based on conventional and stochastic kinetic theory is considered, and the computationally far more efficient conventional model is shown to be equivalent to the stochastic one when large numbers of molecules are present. Perhaps unexpectedly, when experimentally determined distributions of E0 and k0 are input into the model, thermodynamic dispersion is found to be unimportant and only kinetic dispersion contributes significantly to the broadening of dc voltammograms. Simulations of ac voltammetric experiments lead to the conclusion that the ac method, particularly when the analysis of kinetically very sensitive higher-order harmonics is undertaken, are far more sensitive to kinetic dispersion than the dc method. ac methods are therefore concluded to provide a potentially superior strategy for addressing the inverse problem of determining the k0 distribution that could give rise to the apparent anomalies in surface-confined voltammetry.
Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules
International Nuclear Information System (INIS)
Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.
1979-01-01
The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage
Continuous throughput and long-term observation of single-molecule FRET without immobilization.
Tyagi, Swati; VanDelinder, Virginia; Banterle, Niccolò; Fuertes, Gustavo; Milles, Sigrid; Agez, Morgane; Lemke, Edward A
2014-03-01
We present an automated microfluidic platform that performs multisecond observation of single molecules with millisecond time resolution while bypassing the need for immobilization procedures. With this system, we confine biomolecules to a thin excitation field by reversibly collapsing microchannels to nanochannels. We demonstrate the power of our method by studying a variety of complex nucleic acid and protein systems, including DNA Holliday junctions, nucleosomes and human transglutaminase 2.
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics
Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.
2014-01-01
Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.
Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R
2017-01-01
During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.
Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA
Directory of Open Access Journals (Sweden)
Weixin Qian
2014-08-01
Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.
Yonamine, Yusuke; Cervantes-Salguero, Keitel; Minami, Kosuke; Kawamata, Ibuki; Nakanishi, Waka; Hill, Jonathan P; Murata, Satoshi; Ariga, Katsuhiko
2016-05-14
In this study, a Langmuir-Blodgett (LB) system has been utilized for the regulation of polymerization of a DNA origami structure at the air-water interface as a two-dimensionally confined medium, which enables dynamic condensation of DNA origami units through variation of the film area at the macroscopic level (ca. 10-100 cm(2)). DNA origami sheets were conjugated with a cationic lipid (dioctadecyldimethylammonium bromide, 2C18N(+)) by electrostatic interaction and the corresponding LB-film was prepared. By applying dynamic pressure variation through compression-expansion processes, the lipid-modified DNA origami sheets underwent anisotropic polymerization forming a one-dimensionally assembled belt-shaped structure of a high aspect ratio although the thickness of the polymerized DNA origami was maintained at the unimolecular level. This approach opens up a new field of mechanical induction of the self-assembly of DNA origami structures.
Directory of Open Access Journals (Sweden)
Fatemeh Moayed
Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.
DNA expressions - A formal notation for DNA
Vliet, Rudy van
2015-01-01
We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which
Precision platform for convex lens-induced confinement microscopy
Berard, Daniel; McFaul, Christopher M. J.; Leith, Jason S.; Arsenault, Adriel K. J.; Michaud, François; Leslie, Sabrina R.
2013-10-01
We present the conception, fabrication, and demonstration of a versatile, computer-controlled microscopy device which transforms a standard inverted fluorescence microscope into a precision single-molecule imaging station. The device uses the principle of convex lens-induced confinement [S. R. Leslie, A. P. Fields, and A. E. Cohen, Anal. Chem. 82, 6224 (2010)], which employs a tunable imaging chamber to enhance background rejection and extend diffusion-limited observation periods. Using nanopositioning stages, this device achieves repeatable and dynamic control over the geometry of the sample chamber on scales as small as the size of individual molecules, enabling regulation of their configurations and dynamics. Using microfluidics, this device enables serial insertion as well as sample recovery, facilitating temporally controlled, high-throughput measurements of multiple reagents. We report on the simulation and experimental characterization of this tunable chamber geometry, and its influence upon the diffusion and conformations of DNA molecules over extended observation periods. This new microscopy platform has the potential to capture, probe, and influence the configurations of single molecules, with dramatically improved imaging conditions in comparison to existing technologies. These capabilities are of immediate interest to a wide range of research and industry sectors in biotechnology, biophysics, materials, and chemistry.
Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain
2010-04-22
Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G
Building superlattices from individual nanoparticles via template-confined DNA-mediated assembly
Lin, Qing-Yuan; Mason, Jarad A.; Li, Zhongyang; Zhou, Wenjie; O’Brien, Matthew N.; Brown, Keith A.; Jones, Matthew R.; Butun, Serkan; Lee, Byeongdu; Dravid, Vinayak P.; Aydin, Koray; Mirkin, Chad A.
2018-02-01
DNA programmable assembly has been combined with top-down lithography to construct superlattices of discrete, reconfigurable nanoparticle architectures on a gold surface over large areas. Specifically, the assembly of individual colloidal plasmonic nanoparticles with different shapes and sizes is controlled by oligonucleotides containing “locked” nucleic acids and confined environments provided by polymer pores to yield oriented architectures that feature tunable arrangements and independently controllable distances at both nanometer- and micrometer-length scales. These structures, which would be difficult to construct by other common assembly methods, provide a platform to systematically study and control light-matter interactions in nanoparticle-based optical materials. The generality and potential of this approach are explored by identifying a broadband absorber with a solvent polarity response that allows dynamic tuning of visible light absorption.
Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi
2018-06-01
It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.
International Nuclear Information System (INIS)
Pham, Quang Trung
2014-01-01
The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA
Dynamics in geometrical confinement
Kremer, Friedrich
2014-01-01
This book describes the dynamics of low molecular weight and polymeric molecules when they are constrained under conditions of geometrical confinement. It covers geometrical confinement in different dimensionalities: (i) in nanometer thin layers or self supporting films (1-dimensional confinement) (ii) in pores or tubes with nanometric diameters (2-dimensional confinement) (iii) as micelles embedded in matrices (3-dimensional) or as nanodroplets.The dynamics under such conditions have been a much discussed and central topic in the focus of intense worldwide research activities within the last two decades. The present book discusses how the resulting molecular mobility is influenced by the subtle counterbalance between surface effects (typically slowing down molecular dynamics through attractive guest/host interactions) and confinement effects (typically increasing the mobility). It also explains how these influences can be modified and tuned, e.g. through appropriate surface coatings, film thicknesses or pore...
Protein dynamics during presynaptic complex assembly on individual ssDNA molecules
Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.
2014-01-01
Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049
Paximadis, M; Rey, M E
2001-12-01
The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.
Nanoscale Trapping and Squeeze-Out of Confined Alkane Monolayers.
Gosvami, N N; O'Shea, S J
2015-12-01
We present combined force curve and conduction atomic force microscopy (AFM) data for the linear alkanes CnH2n+2 (n = 10, 12, 14, 16) confined between a gold-coated AFM tip and a graphite surface. Solvation layering is observed in the force curves for all liquids, and conduction AFM is used to study in detail the removal of the confined (mono)layer closest to the graphite surface. The squeeze-out behavior of the monolayer can be very different depending upon the temperature. Below the monolayer melting transition temperatures the molecules are in an ordered state on the graphite surface, and fast and complete removal of the confined molecules is observed. However, above the melting transition temperature the molecules are in a disordered state, and even at large applied pressure a few liquid molecules are trapped within the tip-sample contact zone. These findings are similar to a previous study for branched alkanes [ Gosvami Phys. Rev. Lett. 2008, 100, 076101 ], but the observation for the linear alkane homologue series demonstrates clearly the dependence of the squeeze-out and trapping on the state of the confined material.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)
2015-07-28
Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.
Statics and dynamics of DNA knotting
Orlandini, Enzo
2018-02-01
Knots and entanglement in polymers and biopolymers such as DNA and proteins constitute a timely topic that spans various scientific disciplines ranging from physics to chemistry, biology and mathematics. Although in the past many advancements have been made in understanding the equilibrium knotting probability and knot complexity of long polymer chains in solutions, many questions have been addressed in recent years by both experimental and theoretical means—for instance, how the knotting probability depends on the quality of the solvent, the elastic properties of the molecule and its degree of confinement. How knots form, evolve and eventually disappear in a fluctuating chain. Are the equilibrium and non-equilibrium properties of knotted molecules affected by the knot swelling/shrinking dynamics? Moreover, thanks to the great advance in nanotechnology and micromanipulation techniques, nowadays knots can be ‘manually’ tied in a single DNA molecule, followed during their motion along the chains, forced to pass through nanopores, or stretched by external forces or elongational flows. All these experimental approaches allow access to new information on the interplay of topology and polymer physics, and this has opened new perspectives in the field. Here, we provide an overview of the current knowledge of this topic, stressing the main results obtained, including the recent developments in experimental and computational approaches. Since almost all experiments on knotting involve DNA, the review will be mainly focused on the topological properties of this fascinating and biologically relevant molecule.
Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip
2014-10-21
Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.
Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores
Bell, Nicholas A. W.; Keyser, Ulrich F.
2016-07-01
The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.
International Nuclear Information System (INIS)
Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.
1976-01-01
Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de
van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.
2008-01-01
Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of
Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi
2012-03-14
We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.
In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.
Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C
2017-12-14
Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.
Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D
2007-12-15
The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.
International Nuclear Information System (INIS)
Waters, R.
1980-01-01
The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not
Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution
Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.
2016-01-01
We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell
Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.
Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J
2003-10-01
Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.
Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I
2013-01-01
To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET
Directory of Open Access Journals (Sweden)
Mengyi Yang
2018-01-01
Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing
The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.
Rubinovich, Leonid; Polak, Micha
2013-05-08
Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.
Resolving Fast, Confined Diffusion in Bacteria with Image Correlation Spectroscopy.
Rowland, David J; Tuson, Hannah H; Biteen, Julie S
2016-05-24
By following single fluorescent molecules in a microscope, single-particle tracking (SPT) can measure diffusion and binding on the nanometer and millisecond scales. Still, although SPT can at its limits characterize the fastest biomolecules as they interact with subcellular environments, this measurement may require advanced illumination techniques such as stroboscopic illumination. Here, we address the challenge of measuring fast subcellular motion by instead analyzing single-molecule data with spatiotemporal image correlation spectroscopy (STICS) with a focus on measurements of confined motion. Our SPT and STICS analysis of simulations of the fast diffusion of confined molecules shows that image blur affects both STICS and SPT, and we find biased diffusion rate measurements for STICS analysis in the limits of fast diffusion and tight confinement due to fitting STICS correlation functions to a Gaussian approximation. However, we determine that with STICS, it is possible to correctly interpret the motion that blurs single-molecule images without advanced illumination techniques or fast cameras. In particular, we present a method to overcome the bias due to image blur by properly estimating the width of the correlation function by directly calculating the correlation function variance instead of using the typical Gaussian fitting procedure. Our simulation results are validated by applying the STICS method to experimental measurements of fast, confined motion: we measure the diffusion of cytosolic mMaple3 in living Escherichia coli cells at 25 frames/s under continuous illumination to illustrate the utility of STICS in an experimental parameter regime for which in-frame motion prevents SPT and tight confinement of fast diffusion precludes stroboscopic illumination. Overall, our application of STICS to freely diffusing cytosolic protein in small cells extends the utility of single-molecule experiments to the regime of fast confined diffusion without requiring advanced
Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun
2017-11-01
The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.
Hussain, Tanveer
2017-09-14
Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.
Multiplex single-molecule interaction profiling of DNA barcoded proteins
Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.
2014-01-01
In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978
Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V
2017-08-04
Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination
Directory of Open Access Journals (Sweden)
Hsiu-Fang Fan
2018-05-01
Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.
Directory of Open Access Journals (Sweden)
Ilko Bald
2014-09-01
Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.
Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library
DEFF Research Database (Denmark)
Petersen, L. K.; Blakskjær, P.; Chaikuad, A.
2016-01-01
A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...
Confined catalysis under two-dimensional materials
Li, Haobo; Xiao, Jianping; Fu, Qiang; Bao, Xinhe
2017-01-01
Small spaces in nanoreactors may have big implications in chemistry, because the chemical nature of molecules and reactions within the nanospaces can be changed significantly due to the nanoconfinement effect. Two-dimensional (2D) nanoreactor formed under 2D materials can provide a well-defined model system to explore the confined catalysis. We demonstrate a general tendency for weakened surface adsorption under the confinement of graphene overlayer, illustrating the feasible modulation of su...
Dynamics and reactivity of confined water
International Nuclear Information System (INIS)
Musat, R.
2008-01-01
In the context of new sustainable energy sources quest, the nuclear energy remains a key solution. However, with the development of nuclear technology, problems relating to nuclear waste disposal arise; thus, the radiolysis of water in confined media is extremely important with respect to matters related to long time storage of nuclear waste. Studies in model porous media would allow the projection of a confined water radiolysis simulator. A first step in this direction was made by studying the radiolysis of water confined in Vycor and CPG glasses; this study continues the trend set and investigates the effects of confinement in metal materials upon the water radiolysis allowing the understanding of metal - water radiation induced corrosion. A further/complete understanding of the radiolytic process under confinement requires knowledge of the effect of confinement upon the dynamics of confined molecules and on the evolution of the species produced upon ionizing radiation. In this respect, we have used the OH vibrator as a probe of the hydrogen bond network properties and thus investigated the dynamics of confined water using IR time resolved spectroscopy. The evolution of the hydrated electron under confinement was studied on a nano and picosecond time scale using UV pump - visible probe technique and single shot spectroscopy. (author) [fr
Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures
Energy Technology Data Exchange (ETDEWEB)
Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)
2016-10-15
Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.
Electronic properties and assambly of DNA-based molecules on gold surfaces
DEFF Research Database (Denmark)
Salvatore, Princia
, highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....
Shirbini, Afnan
2017-05-01
Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.
Fisher, Patrick D Ellis; Shen, Qi; Akpinar, Bernice; Davis, Luke K; Chung, Kenny Kwok Hin; Baddeley, David; Šarić, Anđela; Melia, Thomas J; Hoogenboom, Bart W; Lin, Chenxiang; Lusk, C Patrick
2018-02-27
Nuclear pore complexes (NPCs) form gateways that control molecular exchange between the nucleus and the cytoplasm. They impose a diffusion barrier to macromolecules and enable the selective transport of nuclear transport receptors with bound cargo. The underlying mechanisms that establish these permeability properties remain to be fully elucidated but require unstructured nuclear pore proteins rich in Phe-Gly (FG)-repeat domains of different types, such as FxFG and GLFG. While physical modeling and in vitro approaches have provided a framework for explaining how the FG network contributes to the barrier and transport properties of the NPC, it remains unknown whether the number and/or the spatial positioning of different FG-domains along a cylindrical, ∼40 nm diameter transport channel contributes to their collective properties and function. To begin to answer these questions, we have used DNA origami to build a cylinder that mimics the dimensions of the central transport channel and can house a specified number of FG-domains at specific positions with easily tunable design parameters, such as grafting density and topology. We find the overall morphology of the FG-domain assemblies to be dependent on their chemical composition, determined by the type and density of FG-repeat, and on their architectural confinement provided by the DNA cylinder, largely consistent with here presented molecular dynamics simulations based on a coarse-grained polymer model. In addition, high-speed atomic force microscopy reveals local and reversible FG-domain condensation that transiently occludes the lumen of the DNA central channel mimics, suggestive of how the NPC might establish its permeability properties.
Arif, S M; Geethanandan, K; Mishra, P; Surolia, A; Varshney, U; Vijayan, M
2015-07-01
17 independent crystal structures of family I uracil-DNA glycosylase from Mycobacterium tuberculosis (MtUng) and its complexes with uracil and its derivatives, distributed among five distinct crystal forms, have been determined. Thermodynamic parameters of binding in the complexes have been measured using isothermal titration calorimetry. The two-domain protein exhibits open and closed conformations, suggesting that the closure of the domain on DNA binding involves conformational selection. Segmental mobility in the enzyme molecule is confined to a 32-residue stretch which plays a major role in DNA binding. Uracil and its derivatives can bind to the protein in two possible orientations. Only one of them is possible when there is a bulky substituent at the 5' position. The crystal structures of the complexes provide a reasonable rationale for the observed thermodynamic parameters. In addition to providing fresh insights into the structure, plasticity and interactions of the protein molecule, the results of the present investigation provide a platform for structure-based inhibitor design.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev
2017-01-01
Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory
Wu, Tsai-Chin; Anderson, Rae
We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.
Preparation of translationally cold neutral molecules.
Di Domenicantonio, Giulia; Bertsche, Benjamin; Osterwalder, Andreas
2011-01-01
Efforts at EPFL to obtain translationally cold neutral molecules are described. Active deceleration of polar molecules is performed by confining the molecules in moving three-dimensional electrostatic traps, and by appropriately choosing the velocity of those traps. Alternatively, cold molecules can be obtained by velocity filtering. Here, the velocity of the molecules is not changed, but instead the cold molecules are extracted from a thermal sample by using the competition between the electrostatic force and the centrifugal force inside a bent electrostatic guide for polar molecules.
Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason
2009-03-01
The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Application of quasi-elastic neutron scattering to dynamics study of confined water
International Nuclear Information System (INIS)
Li Hua; Zhang Lili; Yi Zhou
2014-01-01
Background: Quasi-elastic neutron scattering (QENS) is an important experiment for dynamics study of confined water. It is significant to study the dynamics of confined water in cement paste. Purpose: In this paper, we have two aims. One is to present a reviewer of QENS study on dynamics of confined water in cement paste in recent years. The other is to illustrate the QENS application to the study on dynamics of confined water based on cement paste. Method: Relaxing cage model (RCM) is specially introduced for the analyses of QENS spectra. Results: Based on RCM, several parameters for describing the dynamics of confined water in cement paste, can be obtained from the analyses of QENS spectra: a fraction of mobile 'glassy' water molecules embedded in amorphous gel region surrounding the hydration products, 1-p, the capture time of confined water molecule in some place-τ 0 , the average translational relaxation time-<τ>, the self-diffusion coefficient-D, and a phenomenological shape parameter describing the uniform of amorphous in cement paste-β. Conclusion: All these provide a practical method for QENS study on dynamics of confined water in cement paste. (authors)
Kühnemund, M; Nilsson, M
2015-05-15
Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.
Local structural ordering in surface-confined liquid crystals
Śliwa, I.; Jeżewski, W.; Zakharov, A. V.
2017-06-01
The effect of the interplay between attractive nonlocal surface interactions and attractive pair long-range intermolecular couplings on molecular structures of liquid crystals confined in thin cells with flat solid surfaces has been studied. Extending the McMillan mean field theory to include finite systems, it has been shown that confining surfaces can induce complex orientational and translational ordering of molecules. Typically, local smectic A, nematic, and isotropic phases have been shown to coexist in certain temperature ranges, provided that confining cells are sufficiently thick, albeit finite. Due to the nonlocality of surface interactions, the spatial arrangement of these local phases can display, in general, an unexpected complexity along the surface normal direction. In particular, molecules located in the vicinity of surfaces can still be organized in smectic layers, even though nematic and/or isotropic order can simultaneously appear in the interior of cells. The resulting surface freezing of smectic layers has been confirmed to occur even for rather weak surface interactions. The surface interactions cannot, however, prevent smectic layers from melting relatively close to system boundaries, even when molecules are still arranged in layers within the central region of the system. The internal interfaces, separating individual liquid-crystal phases, are demonstrated here to form fronts of local finite-size transitions that move across cells under temperature changes. Although the complex molecular ordering in surface confined liquid-crystal systems can essentially be controlled by temperature variations, specific thermal properties of these systems, especially the nature of the local transitions, are argued to be strongly conditioned to the degree of molecular packing.
Study of confinement and sliding friction of fluids using sum frequency generation spectroscopy
Nanjundiah, Kumar
2007-12-01
Friction and wear are important technologically. Tires on wet roads, windshield wipers and human joints are examples where nanometer-thick liquids are confined between flexible-rigid contact interfaces. Fundamental understanding of the structure of these liquids can assist in the design of products such as artificial joints and lubricants for Micro-electromechanical systems [MEMS]. Prior force measurements have suggested an increase in apparent viscosity of confined liquid and sometimes solid-like responses. But, these have not given the state of molecules under confinement. In the present study, we have used a surface sensitive, non-linear optical technique (infrared-visible sum frequency generation spectroscopy [SFG]) to investigate molecular structure at hidden interfaces. SFG can identify chemical groups, concentration and orientation of molecules at an interface. A friction cell was developed to study sliding of a smooth elastomeric lens against a sapphire surface. Experiments were done with dry sliding as well as lubricated sliding in the presence of linear alkane liquids. SFG spectra at the alkane/sapphire interface revealed ordering of the confined alkane molecules. These were more ordered than alkane liquid, but less ordered than alkane crystal. Cooling of the confined alkane below its melting temperature [TM] led to molecular orientation that was different from that of bulk crystal next to a sapphire surface. Molecules were oriented with their symmetry axis parallel to the surface normal. In addition, the melting temperature [Tconf] under confinement for a series of linear alkanes (n =15--27) showed a surprising trend. Intermediate molecular weights showed melting point depression. The T conf values suggested that melting started at the alkane/sapphire interface. In another investigation, confinement of water between an elastomeric PDMS lens and sapphire was studied. SFG spectra at the sapphire/water/PDMS interface revealed a heterogeneous morphology. The
Directory of Open Access Journals (Sweden)
Haowei Wang
Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.
International Nuclear Information System (INIS)
Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon
2008-01-01
We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations
DNA polymerase. beta. reaction with ultraviolet-irradiated DNA incised by correndonuclease
Energy Technology Data Exchange (ETDEWEB)
Nowak, R; Zarebska, Z [Instytut Onkologii, Warsaw (Poland); Zmudzka, B [Polska Akademia Nauk, Warsaw. Inst. Biochemii i Biofizyki
1980-09-19
Covalently closed circular Col E1 DNA was ultraviolet-irradiated with a dose of 60 J/m/sup 2/, thus introducing about 3.2 pyrimidine dimers per DNA molecule. Treatment of irradiated Col E1 DNA with Micrococcus luteus correndonuclease resulted, in the vicinity of pyrimidine dimers, in an average of 3.3 incisions per DNA molecule, and converted DNA to the open circular form. Incised Col E1 DNA stimulated no reaction with calf thymus DNA polymerase ..cap alpha.. but was recognized as a template by DNA polymerase ..beta... The latter enzyme incorporated about 1.6 molecules of dTMP (corresponding to 6 molecules of dNMP) per one correndonuclease incision. The length of the DNA polymerase ..beta.. product was comparable to the anticipated length of the DNA region within which the hydrogen bonds were disrupted owing to dimer formation. The enzyme required Mg/sup 2 +/ and four dNTPs for reaction and was resistant to N-ethylmaleimide or p-mercuribenzoate.
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
Energy Technology Data Exchange (ETDEWEB)
Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)
2009-07-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase
International Nuclear Information System (INIS)
Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.
2009-01-01
When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)
Studying DNA Looping by Single-Molecule FRET
Le, Tung T.; Kim, Harold D.
2014-01-01
Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...
Capillary condensation of short-chain molecules.
Bryk, Paweł; Pizio, Orest; Sokolowski, Stefan
2005-05-15
A density-functional study of capillary condensation of fluids of short-chain molecules confined to slitlike pores is presented. The molecules are modeled as freely jointed tangent spherical segments with a hard core and with short-range attractive interaction between all the segments. We investigate how the critical parameters of capillary condensation of the fluid change when the pore width decreases and eventually becomes smaller than the nominal linear dimension of the single-chain molecule. We find that the dependence of critical parameters for a fluid of dimers and of tetramers on pore width is similar to that of the monomer fluid. On the other hand, for a fluid of chains consisting of a larger number of segments we observe an inversion effect. Namely, the critical temperature of capillary condensation decreases with increasing pore width for a certain interval of values of the pore width. This anomalous behavior is also influenced by the interaction between molecules and pore walls. We attribute this behavior to the effect of conformational changes of molecules upon confinement.
Probing the properties of confined liquids
de Beer, Sissi Jacoba Adrianus
2011-01-01
In this thesis we describe Atomic Force Microscopy (AFM) measurements and Molecular Dynamics (MD) simulation of the static and dynamic properties of layered liquids confined between two solid surfaces. Liquid molecules in the proximity of a solid surface assemble into layers. When a fluid is
Regulating DNA Self-assembly by DNA-Surface Interactions.
Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde
2017-12-14
DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level
Raducanu, Vlad-Stefan
2016-05-01
Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.
Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C
2015-04-01
DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.
Structural and dynamical properties of water confined between two hydrophilic surfaces
Energy Technology Data Exchange (ETDEWEB)
Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)
2009-10-01
The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.
Structural and dynamical properties of water confined between two hydrophilic surfaces
International Nuclear Information System (INIS)
Di Napoli, Solange; Gamba, Zulema
2009-01-01
The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.
Decreasing the electronic confinement in layered perovskites through intercalation.
Smith, Matthew D; Pedesseau, Laurent; Kepenekian, Mikaël; Smith, Ian C; Katan, Claudine; Even, Jacky; Karunadasa, Hemamala I
2017-03-01
We show that post-synthetic small-molecule intercalation can significantly reduce the electronic confinement of 2D hybrid perovskites. Using a combined experimental and theoretical approach, we explain structural, optical, and electronic effects of intercalating highly polarizable molecules in layered perovskites designed to stabilize the intercalants. Polarizable molecules in the organic layers substantially alter the optical and electronic properties of the inorganic layers. By calculating the spatially resolved dielectric profiles of the organic and inorganic layers within the hybrid structure, we show that the intercalants afford organic layers that are more polarizable than the inorganic layers. This strategy reduces the confinement of excitons generated in the inorganic layers and affords the lowest exciton binding energy for an n = 1 perovskite of which we are aware. We also demonstrate a method for computationally evaluating the exciton's binding energy by solving the Bethe-Salpeter equation for the exciton, which includes an ab initio determination of the material's dielectric profile across organic and inorganic layers. This new semi-empirical method goes beyond the imprecise phenomenological approximation of abrupt dielectric-constant changes at the organic-inorganic interfaces. This work shows that incorporation of polarizable molecules in the organic layers, through intercalation or covalent attachment, is a viable strategy for tuning 2D perovskites towards mimicking the reduced electronic confinement and isotropic light absorption of 3D perovskites while maintaining the greater synthetic tunability of the layered architecture.
Ultra-cold molecule production
International Nuclear Information System (INIS)
Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.
2005-01-01
The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled
Energy Technology Data Exchange (ETDEWEB)
Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))
1989-07-11
Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.
Energy Technology Data Exchange (ETDEWEB)
Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)
2016-05-01
Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.
Superfluid response of two-dimensional parahydrogen clusters in confinement
Energy Technology Data Exchange (ETDEWEB)
Idowu, Saheed; Boninsegni, Massimo [Department of Physics, University of Alberta, Edmonton, Alberta T6G 2E7 (Canada)
2015-04-07
We study by computer simulations the effect of confinement on the superfluid properties of small two-dimensional (2D) parahydrogen clusters. For clusters of fewer than twenty molecules, the superfluid response in the low temperature limit is found to remain comparable in magnitude to that of free clusters, within a rather wide range of depth and size of the confining well. The resilience of the superfluid response is attributable to the “supersolid” character of these clusters. We investigate the possibility of establishing a bulk 2D superfluid “cluster crystal” phase of p-H{sub 2}, in which a global superfluid response would arise from tunnelling of molecules across adjacent unit cells. The computed energetics suggests that for clusters of about ten molecules, such a phase may be thermodynamically stable against the formation of the equilibrium insulating crystal, for values of the cluster crystal lattice constant possibly allowing tunnelling across adjacent unit cells.
Radiation-induced DNA damage as a function of DNA hydration
International Nuclear Information System (INIS)
Swarts, S.G.; Miao, L.; Wheeler, K.T.; Sevilla, M.D.; Becker, D.
1995-01-01
Radiation-induced DNA damage is produced from the sum of the radicals generated by the direct ionization of the DNA (direct effect) and by the reactions of the DNA with free radicals formed in the surrounding environment (indirect effect). The indirect effect has been believed to be the predominant contributor to radiation-induced intracellular DNA damage, mainly as the result of reactions of bulk water radicals (e.g., OH·) with DNA. However, recent evidence suggests that DNA damage, derived from the irradiation of water molecules that are tightly bound in the hydration layer, may occur as the result of the transfer of electron-loss centers (e.g. holes) and electrons from these water molecules to the DNA. Since this mechanism for damaging DNA more closely parallels that of the direct effect, the irradiation of these tightly bound water molecules may contribute to a quasi-direct effect. These water molecules comprise a large fraction of the water surrounding intracellular DNA and could account for a significant proportion of intracellular radiation-induced DNA damage. Consequently, the authors have attempted to characterize this quasi-direct effect to determine: (1) the extent of the DNA hydration layer that is involved with this effect, and (2) what influence this effect has on the types and quantities of radiation-induced DNA damage
Sun, Lu
2014-10-16
© 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
Qin, Yangzhong; Yang, Yi; Zhang, Luyuan; Fowler, Jason D.; Qiu, Weihong; Wang, Lijuan; Suo, Zucai; Zhong, Dongping
2013-01-01
Water plays essential structural and dynamical roles in protein-DNA recognition through contributing to enthalpic or entropic stabilization of binding complex and by mediating intermolecular interactions and fluctuations for biological function. These interfacial water molecules are confined by the binding partners in nanospace but in many cases they are highly mobile and exchange with outside bulk solution. Here, we report our studies of the interfacial water dynamics in the binary and terna...
International Nuclear Information System (INIS)
Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.
2011-01-01
To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)
Confined Mobility of TonB and FepA in Escherichia coli Membranes.
Directory of Open Access Journals (Sweden)
Yoriko Lill
Full Text Available The important process of nutrient uptake in Escherichia coli, in many cases, involves transit of the nutrient through a class of beta-barrel proteins in the outer membrane known as TonB-dependent transporters (TBDTs and requires interaction with the inner membrane protein TonB. Here we have imaged the mobility of the ferric enterobactin transporter FepA and TonB by tracking them in the membranes of live E. coli with single-molecule resolution at time-scales ranging from milliseconds to seconds. We employed simple simulations to model/analyze the lateral diffusion in the membranes of E.coli, to take into account both the highly curved geometry of the cell and artifactual effects expected due to finite exposure time imaging. We find that both molecules perform confined lateral diffusion in their respective membranes in the absence of ligand with FepA confined to a region [Formula: see text] μm in radius in the outer membrane and TonB confined to a region [Formula: see text] μm in radius in the inner membrane. The diffusion coefficient of these molecules on millisecond time-scales was estimated to be [Formula: see text] μm2/s and [Formula: see text] μm2/s for FepA and TonB, respectively, implying that each molecule is free to diffuse within its domain. Disruption of the inner membrane potential, deletion of ExbB/D from the inner membrane, presence of ligand or antibody to FepA and disruption of the MreB cytoskeleton was all found to further restrict the mobility of both molecules. Results are analyzed in terms of changes in confinement size and interactions between the two proteins.
In silico single-molecule manipulation of DNA with rigid body dynamics.
Directory of Open Access Journals (Sweden)
Pascal Carrivain
2014-02-01
Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.
Djikaev, Yuri S; Ruckenstein, Eli
2015-07-01
Liquid water in a hydrophobic confinement is the object of high interest in physicochemical sciences. Confined between two macroscopic hydrophobic surfaces, liquid water transforms into vapor if the distance between surfaces is smaller than a critical separation, referred to as the evaporation lengthscale. To investigate the temperature dependence of the evaporation lengthscale of water confined between two hydrophobic parallel plates, we use the combination of the density functional theory (DFT) with the probabilistic hydrogen bond (PHB) model for water-water hydrogen bonding. The PHB model provides an analytic expression for the average number of hydrogen bonds per water molecule as a function of its distance to a hydrophobic surface and its curvature. Knowing this expression, one can implement the effect of hydrogen bonding between water molecules on their interaction with the hydrophobe into DFT, which is then employed to determine the distribution of water molecules between two macroscopic hydrophobic plates at various interplate distances and various temperatures. For water confined between hydrophobic plates, our results suggest the evaporation lengthscale to be of the order of several nanometers and a linearly increasing function of temperature from T=293 K to T=333 K, qualitatively consistent with previous results. Copyright © 2015 Elsevier Inc. All rights reserved.
Delage, E.; Pham, Q. T.; Karamitros, M.; Payno, H.; Stepan, V.; Incerti, S.; Maigne, L.; Perrot, Y.
2015-07-01
This paper describes PDB4DNA, a new Geant4 user application, based on an independent, cross-platform, free and open source C++ library, so-called PDBlib, which enables use of atomic level description of DNA molecule in Geant4 Monte Carlo particle transport simulations. For the evaluation of direct damage induced on the DNA molecule by ionizing particles, the application makes use of an algorithm able to determine the closest atom in the DNA molecule to energy depositions. Both the PDB4DNA application and the PDBlib library are available as free and open source under the Geant4 license.
Single molecules and nanotechnology
Vogel, Horst
2007-01-01
This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.
Energy Technology Data Exchange (ETDEWEB)
Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2015-01-07
Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three
Trapping neutral molecules in a traveling potential well
Bethlem, H. L.; G. Berden,; van Roij, A. J. A.; Crompvoets, F. M. H.; Meijer, G.
2000-01-01
A series of pulsed electric fields can be arranged such that it creates a traveling potential well in which neutral dipolar molecules can be confined. This provides a method to transport, to decelerate, and to cool a sample of neutral molecules while maintaining the initial phase-space density. This
Ramos, Sergio Luis L M; Ogino, Michihiko; Oguni, Masaharu
2015-01-28
We investigated the thermal properties of liquid methylcyclohexane and racemic sec-butylcyclohexane, as representatives of a molecular system with only dispersion-force intermolecular interactions, confined in the pores (thickness/diameter d = 12, 6, 1.1 nm) of silica gels by adiabatic calorimetry. The results imply a heterogeneous picture for molecular aggregate under confinement consisting of an interfacial region and an inner pore one. In the vicinity of a glass-transition temperature T(g,bulk) of bulk liquid, two distinguishable relaxation phenomena were observed for the confined systems and their origins were attributed to the devitrification, namely glass transition, processes of (1) a layer of interfacial molecules adjacent to the pore walls and (2) the molecules located in the middle of the pore. A third glass-transition phenomenon was observed at lower temperatures and ascribed to a secondary relaxation process. The glass transition of the interfacial-layer molecules was found to proceed at temperatures rather above T(g,bulk), whereas that of the molecules located in the inner pore region occurred at temperatures below T(g,bulk). We discuss the reason why the molecules located in different places in the pores reveal the respectively different dynamical properties.
Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology
DEFF Research Database (Denmark)
Olsen, Eva Maria
2012-01-01
Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...
Structure and phase behavior of a confined nanodroplet composed of the flexible chain molecules.
Kim, Soon-Chul; Kim, Eun-Young; Seong, Baek-Seok
2011-04-28
A polymer density functional theory has been employed for investigating the structure and phase behaviors of the chain polymer, which is modelled as the tangentially connected sphere chain with an attractive interaction, inside the nanosized pores. The excess free energy of the chain polymer has been approximated as the modified fundamental measure-theory for the hard spheres, the Wertheim's first-order perturbation for the chain connectivity, and the mean-field approximation for the van der Waals contribution. For the value of the chemical potential corresponding to a stable liquid phase in the bulk system and a metastable vapor phase, the flexible chain molecules undergo the liquid-vapor transition as the pore size is reduced; the vapor is the stable phase at small volume, whereas the liquid is the stable phase at large volume. The wide liquid-vapor coexistence curve, which explains the wide range of metastable liquid-vapor states, is observed at low temperature. The increase of temperature and decrease of pore size result in a narrowing of liquid-vapor coexistence curves. The increase of chain length leads to a shift of the liquid-vapor coexistence curve towards lower values of chemical potential. The coexistence curves for the confined phase diagram are contained within the corresponding bulk liquid-vapor coexistence curve. The equilibrium capillary phase transition occurs at a higher chemical potential than in the bulk phase.
Reiter, G F; Senesi, R; Mayers, J
2010-10-01
The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6 water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.
International Nuclear Information System (INIS)
Reiter, G. F.; Senesi, R.; Mayers, J.
2010-01-01
The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6 water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Angst .
FINAL REPORT: Room Temperature Hydrogen Storage in Nano-Confined Liquids
Energy Technology Data Exchange (ETDEWEB)
VAJO, JOHN
2014-06-12
experiments. Overall, the combined experimental measurements and simulations indicate that hydrogen storage based on enhanced solubility in nano-confined liquids is unlikely to meet the storage densities required for practical use. Only low gravimetric capacities of < 0.5 wt% were achieved. More importantly, solvent filled scaffolds had lower volumetric capacities than corresponding empty scaffolds. Nevertheless, several of the composites measured did show significant (>~ 5x) enhanced hydrogen solubility relative to bulk solvent solubility, when the hydrogen capacity was attributed only to dissolution in the confined solvent. However, when the hydrogen capacity was compared to an empty scaffold that is known to store hydrogen by surface adsorption on the scaffold walls, including the solvent always reduced the hydrogen capacity. For the best composites, this reduction relative to an empty scaffold was ~30%; for the worst it was ~90%. The highest capacities were obtained with the largest solvent molecules and with scaffolds containing 3- dimensionally confined pore geometries. The simulations suggested that the capacity of the composites originated from hydrogen adsorption on the scaffold pore walls at sites not occupied by solvent molecules. Although liquid solvent filled the pores, not all of the adsorption sites on the pore walls were occupied due to restricted motion of the solvent molecules within the confined pore space.
DNA nanotechnology-enabled biosensors.
Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai
2016-02-15
Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.
2015-03-01
Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated
Block copolymer templated self-assembly of disk-shaped molecules
Aragones, J. L.; Alexander-Katz, A.
2017-08-01
Stacking of disk-shaped organic molecules is a promising strategy to develop electronic and photovoltaic devices. Here, we investigate the capability of a soft block copolymer matrix that microphase separates into a cylindrical phase to direct the self-assembly of disk-shaped molecules by means of molecular simulations. We show that two disk molecules confined in the cylinder domain experience a depletion force, induced by the polymer chains, which results in the formation of stacks of disks. This entropic interaction and the soft confinement provided by the matrix are both responsible for the structures that can be self-assembled, which include slanted or columnar stacks. In addition, we evidence the transmission of stresses between the different minority domains of the microphase, which results in the establishment of a long-ranged interaction between disk molecules embedded in different domains; this interaction is of the order of the microphase periodicity and may be exploited to direct assembly of disks at larger scales.
DNA Open states and DNA hydratation
International Nuclear Information System (INIS)
Lema-Larre, B. de; Martin-Landrove, M
1995-01-01
It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es
The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.
Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai
2018-01-09
Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
International Nuclear Information System (INIS)
Yamamoto, Takatoki; Fujii, Teruo
2010-01-01
Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.
Layering of confined water between two graphene sheets and its liquid–liquid transition
International Nuclear Information System (INIS)
Zhou Xuyan; Duan Yunrui; Wang Long; Liu Sida; Li Tao; Li Yifan; Li Hui
2017-01-01
Molecular dynamics (MD) simulations are performed to explore the layering structure and liquid–liquid transition of liquid water confined between two graphene sheets with a varied distance at different pressures. Both the size of nanoslit and pressure could cause the layering and liquid–liquid transition of the confined water. With increase of pressure and the nanoslit’s size, the confined water could have a more obvious layering. In addition, the neighboring water molecules firstly form chain structure, then will transform into square structure, and finally become triangle with increase of pressure. These results throw light on layering and liquid–liquid transition of water confined between two graphene sheets. (paper)
Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina
2018-01-01
Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion
Shirbini, Afnan
2017-01-01
and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
Nayak, Alpana; Suresh, K. A.
2008-08-01
We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.
Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang
2017-01-01
The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.
Energy Technology Data Exchange (ETDEWEB)
Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)
2015-06-01
Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.
A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.
Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M
2017-11-17
The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.
International Nuclear Information System (INIS)
Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.
1999-01-01
The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)
Spectrally resolved single-molecule electrometry
Ruggeri, F.; Krishnan, M.
2018-03-01
Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.
DNA damage, homology-directed repair, and DNA methylation.
Directory of Open Access Journals (Sweden)
Concetta Cuozzo
2007-07-01
Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.
Directory of Open Access Journals (Sweden)
Zach Hensel
Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.
Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules
International Nuclear Information System (INIS)
Gareev, F.A.; Gareeva, G.F.
2001-01-01
Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of
International Nuclear Information System (INIS)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi
2017-01-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)
Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi
2017-03-01
In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.
Density, distribution, and orientation of water molecules inside and outside carbon nanotubes.
Thomas, J A; McGaughey, A J H
2008-02-28
The behavior of water molecules inside and outside 1.1, 2.8, 6.9, and 10.4 nm diameter armchair carbon nanotubes (CNTs) is predicted using molecular dynamics simulations. The effects of CNT diameter on mass density, molecular distribution, and molecular orientation are identified for both the confined and unconfined fluids. Within 1 nm of the CNT surface, unconfined water molecules assume a spatially varying density profile. The molecules distribute nonuniformly around the carbon surface and have preferred orientations. The behavior of the unconfined water molecules is invariant with CNT diameter. The behavior of the confined water, however, can be correlated to tube diameter. Inside the 10.4 nm CNT, the molecular behavior is indistinguishable from that of the unconfined fluid. Within the smaller CNTs, surface curvature effects reduce the equilibrium water density and force water molecules away from the surface. This effect changes both the molecular distribution and preferred molecular orientations.
Bound states and Cooper pairs of molecules in 2D optical lattices bilayer
Energy Technology Data Exchange (ETDEWEB)
Camacho-Guardian, A.; Dominguez-Castro, G.A.; Paredes, R. [Instituto de Fisica, Universidad Nacional Autonoma de Mexico (Mexico)
2016-08-15
We investigate the formation of Cooper pairs, bound dimers and the dimer-dimer elastic scattering of ultracold dipolar Fermi molecules confined in a 2D optical lattice bilayer configuration. While the energy and their associated bound states are determined in a variational way, the correlated two-molecule pair is addressed as in the original Cooper formulation. We demonstrate that the 2D lattice confinement favors the formation of zero center mass momentum bound states. Regarding the Cooper pairs binding energy, this depends on the molecule populations in each layer. Maximum binding energies occur for non-zero (zero) pair momentum when the Fermi system is polarized (unpolarized). We find an analytic expression for the dimer-dimer effective interaction in the deep BEC regime. The present analysis represents a route for addressing the BCS-BEC crossover in dipolar Fermi gases confined in 2D optical lattices within the current experimental panorama. (copyright 2016 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K
2005-01-01
Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the
Semisynthetic protein nanoreactor for single-molecule chemistry
Lee, Joongoo; Bayley, Hagan
2015-01-01
The modulation of ionic current flowing through an individual protein pore provides information at the single-molecule level about chemical reactions occurring within the pore. However, chemistry investigated in this way has been largely confined to the reactions of thiolates, presented by the side chains of cysteine residues. The introduction of unnatural amino acids would provide a large variety of reactive side chains with which additional single-molecule chemistry could be investigated. H...
Energy Technology Data Exchange (ETDEWEB)
Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.
2008-01-28
Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.
Seeman, Nadrian C.; Sleiman, Hanadi F.
2018-01-01
DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.
Electrochemical proton relay at the single-molecule level
DEFF Research Database (Denmark)
Kuznetsov, A. M.; Medvedev, I. G.; Ulstrup, Jens
2009-01-01
A scheme for the experimental study of single-proton transfer events, based on proton-coupled two-electron transfer between a proton donor and a proton acceptor molecule confined in the tunneling gap between two metal leads in electrolyte solution is suggested. Expressions for the electric current...... are derived and compared with formalism for electron tunneling through redox molecules. The scheme allows studying the kinetics of proton and hydrogen atom transfer as well as kinetic isotope effects at the single-molecule level under electrochemical potential control....
DNA maintenance in plastids and mitochondria of plants
Directory of Open Access Journals (Sweden)
Delene J Oldenburg
2015-10-01
Full Text Available The DNA molecules in plastids and mitochondria of plants have been studied for over 40 years. Here, we review the data on the circular or linear form, replication, repair, and persistence of the organellar DNA (orgDNA in plants. The bacterial origin of orgDNA appears to have profoundly influenced ideas about the properties of chromosomal DNA molecules in these organelles to the point of dismissing data inconsistent with ideas from the 1970s. When found at all, circular genome-sized molecules comprise a few percent of orgDNA. In cells active in orgDNA replication, most orgDNA is found as linear and branched-linear forms larger than the size of the genome, likely a consequence of a virus-like DNA replication mechanism. In contrast to the stable chromosomal DNA molecules in bacteria and the plant nucleus, the molecular integrity of orgDNA declines during leaf development at a rate that varies among plant species. This decline is attributed to degradation of damaged-but-not-repaired molecules, with a proposed repair cost-saving benefit most evident in grasses. All orgDNA maintenance activities are proposed to occur on the nucleoid tethered to organellar membranes by developmentally-regulated proteins.
Crowded, Confined, and Frustrated: Dynamics of Molecules Tethered to Nanoparticles
Agarwal, Praveen; Kim, Sung A.; Archer, Lynden A.
2012-01-01
Above a critical chemistry-dependent molecular weight, all polymer molecules entangle and, as a result, exhibit slow dynamics, enhanced viscosity, and elasticity. Herein we report on the dynamics of low molecular weight polymers tethered
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2008-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050
Structural and mechanical properties of glassy water in nanoscale confinement.
Lombardo, Thomas G; Giovambattista, Nicolás; Debenedetti, Pablo G
2009-01-01
We investigate the structure and mechanical properties of glassy water confined between silica-based surfaces with continuously tunable hydrophobicity and hydrophilicity by computing and analyzing minimum energy, mechanically stable configurations (inherent structures). The structured silica substrate imposes long-range order on the first layer of water molecules under hydrophobic confinement at high density (p > or = 1.0 g cm(-3)). This proximal layer is also structured in hydrophilic confinement at very low density (p approximately 0.4 g cm(-3)). The ordering of water next to the hydrophobic surface greatly enhances the mechanical strength of thin films (0.8 nm). This leads to a substantial stress anisotropy; the transverse strength of the film exceeds the normal strength by 500 MPa. The large transverse strength results in a minimum in the equation of state of the energy landscape that does not correspond to a mechanical instability, but represents disruption of the ordered layer of water next to the wall. In addition, we find that the mode of mechanical failure is dependent on the type of confinement. Under large lateral strain, water confined by hydrophilic surfaces preferentially forms voids in the middle of the film and fails cohesively. In contrast, water under hydrophobic confinement tends to form voids near the walls and fails by loss of adhesion.
Indian Academy of Sciences (India)
DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.
Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya
2015-08-01
Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar
2016-06-03
Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules
International Nuclear Information System (INIS)
Gareev, F.A.; Gareeva, G.F.
2001-01-01
Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
Structural Transitions in Supercoiled Stretched DNA
v, Croquette
1998-03-01
Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).
Sun, Lu; Frykholm, Karolin; Fornander, Louise H.; Svedhem, Sofia; Westerlund, Fredrik; Å kerman, Bjö rn
2014-01-01
© 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Dynamics of water confined in clay minerals
International Nuclear Information System (INIS)
Le Caer, S.; Pommeret, S.; Renault, J.Ph.; Lima, M.; Righini, R.; Gosset, D.; Simeone, D.; Bergaya, F.
2012-01-01
Ultrafast infrared spectroscopy of the O-D stretching mode of dilute HOD in H 2 O probes the local environment and the hydrogen bond network of confined water. The dynamics of water molecules confined in the interlayer space of montmorillonites (Mt) and in interaction with two types of cations (Li + and Ca 2+ ) but also with the negatively charged siloxane surface are studied. The results evidence that the OD vibrational dynamics is significantly slowed down in confined media: it goes from 1.7 ps in neat water to 2.6 Ps in the case of Li + cations with two water pseudo-layers (2.2-2.3 ps in the case of Ca 2+ cations) and to 4.7 ps in the case of Li + cations with one water pseudo-layer. No significant difference between the two cations is noticed. In this 2D confined geometry (the interlayer space being about 0.6 nm for two water pseudo-layers), the relaxation time constants obtained are comparable to the ones measured in analogous concentrated salt solutions. Nevertheless, and in strong opposition to the observations performed in the liquid phase, anisotropy experiments evidence the absence of rotational motions on a 5 ps time scale, proving that the hydrogen bond network in the interlayer space of the clay mineral is locked at this time scale. (authors)
Single Molecule Nano-Metronome
Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip
2006-01-01
We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...
The vibrational dynamics of carbon monoxide in a confined space-CO in zeolites.
Nachtigallová, Dana; Bludský, Ota; Otero Areán, Carlos; Bulánek, Roman; Nachtigall, Petr
2006-11-14
Based on theoretical calculations, and a survey of infrared spectra of CO adsorbed on different cation exchanged zeolites, a model is proposed to explain the influence of the zeolite framework on the vibrational behaviour of CO confined into small void spaces (zeolite channels and cavities). The concepts developed should help to understand a number of details relevant to both, precise interpretation of IR spectra and a better understanding of the vibrational dynamics of small molecules in a confined space.
Robertson, Carol
2016-01-01
Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…
The elastic theory of a single DNA molecule
Indian Academy of Sciences (India)
methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.
Biofunctionalization of zinc oxide nanowires for DNA sensory applications
Directory of Open Access Journals (Sweden)
Rudolph Bettina
2011-01-01
Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.
Concentrating and labeling genomic DNA in a nanofluidic array
DEFF Research Database (Denmark)
Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.
2018-01-01
, however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...
Physics of Polymers under Nanoscopic Confinement: a Single Molecule Study
Keshavarz, M.
2016-01-01
Physicist Masoumeh Keshavarz studied the thermal motion of a fluorescently labelled, individual “reporter” polymer molecule, surrounded and entangled by a gel of similar but unlabelled polymers. Owing to their extreme length and stiffness, it is possible to follow the shape and the motion of the
Detection of DNA hybridizations using solid-state nanopores
International Nuclear Information System (INIS)
Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng
2010-01-01
We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.
Detection of DNA hybridizations using solid-state nanopores
Energy Technology Data Exchange (ETDEWEB)
Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)
2010-08-20
We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.
International Nuclear Information System (INIS)
Itoh, S; Fukuzawa, K; Hamamoto, Y; Zhang, H
2007-01-01
When a liquid is confined in molecularly narrow gaps, it shows characteristic viscoelasticity such as enhanced viscosity or prolonged relaxation time. In order to investigate the dynamic viscoelasticity of the confined liquid, we developed a new shear force measuring method that uses a ball-ended optical fiber as a shearing probe. Our method can measure the shear force of 0.1 nN order with the oscillation frequency of up to 10 kHz. In addition, the gap that confines the liquid can be set at any constant value ranging from 10 μm to 0.1 nm. In this study, we measured the gap dependence of viscoelasticity of confined liquid lubricants. The gap ranged from 200 nm to a few nm. The tested lubricant was Fomblin Z03 and Zdo14000. A magnetic disk was used as the solid substrate. Oscillation frequency was set at 800 Hz. The experiment showed the viscosity of both Z03 and Zdo14000 gradually increased as the confining gap decreased. The gap width where the viscosity increase started was wider than 100 nm, which is dozens of times larger than the gyration diameter of lubricant molecules. Although Z03 and Zdo14000 have negligibly small elasticity in a bulk state, elasticity suddenly appeared at gaps less than about 8 nm with Zdo14000, and at gaps less than about 4 nm with Z03. Stronger affinity of Zdo14000 molecules to the solid substrate could cause the wider gap width of elasticity appearance
Directory of Open Access Journals (Sweden)
Francesco Gentile
2018-04-01
Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.
International Nuclear Information System (INIS)
Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.
2014-01-01
The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)
Directory of Open Access Journals (Sweden)
Lindy L. Esterhuizen
2012-09-01
Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.
3D DNA Crystals and Nanotechnology
Directory of Open Access Journals (Sweden)
Paul J. Paukstelis
2016-08-01
Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.
Crystallization of Organic Semiconductor Molecules in Nanosized Cavities
DEFF Research Database (Denmark)
Milita, Silvia; Dionigi, Chiara; Borgatti, Francesco
2008-01-01
The crystallization of an organic semiconductor, viz., tetrahexil-sexithiophene (H4T6) molecules, confined into nanosized cavities of a self-organized polystyrene beads template, has been investigated by means of in situ grazing incidence X-ray diffraction measurements, during the solvent evapora...
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate
Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation
International Nuclear Information System (INIS)
An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun
2007-01-01
We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously
Electron Scattering From Atoms, Molecules, Nuclei, and Bulk Matter
Whelan, Colm T
2005-01-01
Topics that are covered include electron scattering in the scanning TEM; basic theory of inelastic electron imaging; study of confined atoms by electron excitation; helium bubbles created in extreme pressure with application to nuclear safety; lithium ion implantation; electron and positron scattering from clusters; electron scattering from physi- and chemi-absorbed molecules on surfaces; coincidence studies; electron scattering from biological molecules; electron spectroscopy as a tool for environmental science; electron scattering in the presence of intense fields; electron scattering from astrophysical molecules; electon interatctions an detection of x-ray radiation.
Collective Behavior of Quorum-Sensing Run-and-Tumble Particles under Confinement.
Rein, Markus; Heinß, Nike; Schmid, Friederike; Speck, Thomas
2016-02-05
We study a generic model for quorum-sensing bacteria in circular confinement. Every bacterium produces signaling molecules, the local concentration of which triggers a response when a certain threshold is reached. If this response lowers the motility, then an aggregation of bacteria occurs which differs fundamentally from standard motility-induced phase separation due to the long-ranged nature of the concentration of signal molecules. We analyze this phenomenon analytically and by numerical simulations employing two different protocols leading to stationary cluster and ring morphologies, respectively.
The structure of DNA by direct imaging
Marini, Monica
2015-08-28
The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.
The structure of DNA by direct imaging
Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo M.
2015-01-01
The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.
Design and Assembly of DNA Nano-Objects and 2D DNA Origami Arrays
Liu, Wenyan
DNA, which plays a central role in biology as the carrier of genetic information, is also an excellent candidate for structural nanotechnology. Researches have proven that a variety of complicated DNA assemblies, such as objects, 2D & 3D crystals, and nanomechanical devices, can be fabricated through the combination of robust branched DNA motifs and sticky ends. This dissertation focuses on the design and construction of DNA nano--objects and 2D DNA origami arrays. In this dissertation, we first describe the formation of a triangular species that has four strands per edge, held together by PX interactions. We demonstrate by nondenaturing gel electrophoresis and by atomic force microscopy (AFM) that we can combine a partial triangle with other strands to form a robust four--stranded molecule. By combining them with a novel three--domain molecule, we also demonstrate by AFM that these triangles can be self--assembled into a linear array. Second, we demonstrate our attempts to design and self--assemble 2D DNA origami arrays using several different strategies. Specifically, we introduce the self--assembly of 2D DNA origami lattices using a symmetric cross--like design. This design strategy resulted in a well--ordered woven latticework array with edge dimensions of 2--3 mum. This size is likely to be large enough to connect bottom-up methods of patterning with top--down approaches. Third, we illustrate the design and construction of DNA nano--objects for exploring the substrate preferences of topoisomerase (topo) II. We designed and fabricated four double rhombus--like DNA molecules, each of which contains a different conformation of crossover in the middle, as possible substrates to establish the structural preferences for topo II. We characterized the formation of each substrate molecule by gel electrophoresis. Finally, we study the effect of M13 DNA knotting on the formation of the DNA origami tiles. We demonstrate by atomic force microscopy (AFM) that knotted M13
Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu
2006-10-01
In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.
Hansen, J S; Daivis, Peter J; Todd, B D
2009-10-01
In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.
Tymoczko, Jakub; Schuhmann, Wolfgang; Gebala, Magdalena
2014-12-24
Surface-confined DNA hybridization reactions are sensitive to the number and identity of DNA capture probes and experimental conditions such as the nature and the ionic strength of the electrolyte solution. When the surface probe density is high or the concentration of bulk ions is much lower than the concentration of ions within the DNA layer, hybridization is significantly slowed down or does not proceed at all. However, high-density DNA monolayers are attractive for designing high-sensitivity DNA sensors. Thus, circumventing sluggish DNA hybridization on such interfaces allows a high surface concentration of target DNA and improved signal/noise ratio. We present potential-assisted hybridization as a strategy in which an external voltage is applied to the ssDNA-modified interface during the hybridization process. Results show that a significant enhancement of hybridization can be achieved using this approach.
DNA-Based Applications in Nanobiotechnology
Directory of Open Access Journals (Sweden)
Khalid M. Abu-Salah
2010-01-01
Full Text Available Biological molecules such as deoxyribonucleic acid (DNA have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.
Bacterial natural transformation by highly fragmented and damaged DNA
DEFF Research Database (Denmark)
Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre
2013-01-01
for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...
Geertsema, Hylkje
2014-01-01
De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs
The re-entrant cholesteric phase of DNA
Yevdokimov, Yu. M.; Skuridin, S. G.; Salyanov, V. I.; Semenov, S. V.; Shtykova, E. V.; Dadinova, L. A.; Kompanets, O. N.; Kats, E. I.
2017-07-01
The character of packing of double-stranded DNA molecules in particles of liquid-crystal dispersions formed as a result of the phase exclusion of DNA molecules from aqueous salt polyethylene glycol solutions has been estimated by comparing the circular dichroism (CD) spectra of these dispersions recorded at different osmotic pressures and temperatures. It is shown that the first cycle of heating of dispersion particles with hexagonally packed double-stranded DNA molecules leads to the occurrence of abnormal optical activity of these particles, which manifests itself in the form of a strong negative CD band, characteristic of DNA cholesterics. Moreover, subsequent cooling is accompanied by a further increase in the abnormal optical activity, which indicates the existence of the "hexagonal → cholesteric packing" phase transition, controlled by both the osmotic pressure of the solution and its temperature. The result obtained can be described in terms of "quasi-nematic" layers composed of orientationally ordered DNA molecules in the structure of dispersion particles. There are two possible ways of packing for these layers, which determine their hexagonal or cholesteric spatial structure. The second heating → cooling cycle confirms these results and is indicative of possible differences in the packing of double-stranded DNA molecules in the hexagonal phase, which depend on the osmotic pressure of the solution.
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr
2003-01-01
Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.
BMP4 density gradient in disk-shaped confinement
Bozorgui, Behnaz; Teimouri, Hamid; Kolomeisky, Anatoly B.
We present a quantitative model that explains the scaling of BMP4 gradients during gastrulation and the recent experimental observation that geometric confinement of human embryonic stem cells is sufficient to recapitulate much of germ layer patterning. Based on a assumption that BMP4 diffusion rate is much smaller than the diffusion rate of it's inhibitor molecules, our results confirm that the length-scale which defines germ layer territories does not depend on system size.
DNA binding and aggregation by carbon nanoparticles
International Nuclear Information System (INIS)
An, Hongjie; Liu, Qingdai; Ji, Qiaoli; Jin, Bo
2010-01-01
Significant environmental and health risks due to the increasing applications of engineered nanoparticles in medical and industrial activities have been concerned by many communities. The interactions between nanomaterials and genomes have been poorly studied so far. This study examined interactions of DNA with carbon nanoparticles (CNP) using atomic force microscopy (AFM). We experimentally assessed how CNP affect DNA molecule and bacterial growth of Escherichia coli. We found that CNP were bound to the DNA molecules during the DNA replication in vivo. The results revealed that the interaction of DNA with CNP resulted in DNA molecule binding and aggregation both in vivo and in vitro in a dose-dependent manner, and consequently inhabiting the E. coli growth. While this was a preliminary study, our results showed that this nanoparticle may have a significant impact on genomic activities.
Conformation-dependent DNA attraction
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-05-01
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by
International Nuclear Information System (INIS)
Molayem, M.; Tayebi-Rad, Gh.; Esmaeli, L.; Namiranian, A.; Fouladvand, M. E.; Neek-Amal, M.
2006-01-01
Using the diffusion quantum monte Carlo method, the ground state energy of an Hydrogen atom confined in a carbon nano tube and a C60 molecule is calculated. For Hydrogen atom confined in small diameter tubes, the ground state energy shows significant deviation from a free Hydrogen atom, while with increasing the diameter this deviation tends to zero.
Coherent confinement of plasmonic field in quantum dot-metallic nanoparticle molecules.
Sadeghi, S M; Hatef, A; Fortin-Deschenes, Simon; Meunier, Michel
2013-05-24
Interaction of a hybrid system consisting of a semiconductor quantum dot and a metallic nanoparticle (MNP) with a laser beam can replace the intrinsic plasmonic field of the MNP with a coherently normalized field (coherent-plasmonic or CP field). In this paper we show how quantum coherence effects in such a hybrid system can form a coherent barrier (quantum cage) that spatially confines the CP field. This allows us to coherently control the modal volume of this field, making it significantly smaller or larger than that of the intrinsic plasmonic field of the MNP. We investigate the spatial profiles of the CP field and discuss how the field barrier depends on the collective states of the hybrid system.
Radioprotection of DNA molecule by oxido-reduction's coenzymes
International Nuclear Information System (INIS)
Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.
1978-01-01
The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)
DNA adsorption and desorption on mica surface studied by atomic force microscopy
Energy Technology Data Exchange (ETDEWEB)
Sun Lanlan [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhao Dongxu [Key Laboratory of Excited State Processes, Changchun Institute of Optics, Fine Mechanics and Physics, Chinese Academy of Sciences, 16 East Nan-Hu Road, Open Economic Zone, Changchun 130033 (China); Zhang Yue; Xu Fugang [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China); Li Zhuang, E-mail: zli@ciac.jl.cn [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Graduate school of the Chinese Academy of Sciences, Chinese Academy of Sciences, Renmin Street 5625, Changchun 130022 (China)
2011-05-15
The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/{mu}L. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.
DNA adsorption and desorption on mica surface studied by atomic force microscopy
International Nuclear Information System (INIS)
Sun Lanlan; Zhao Dongxu; Zhang Yue; Xu Fugang; Li Zhuang
2011-01-01
The adsorption of DNA molecules on mica surface and the following desorption of DNA molecules at ethanol-mica interface were studied using atomic force microscopy. By changing DNA concentration, different morphologies on mica surface have been observed. A very uniform and orderly monolayer of DNA molecules was constructed on the mica surface with a DNA concentration of 30 ng/μL. When the samples were immersed into ethanol for about 15 min, various desorption degree of DNA from mica (0-99%) was achieved. It was found that with the increase of DNA concentration, the desorption degree of DNA from the mica at ethanol-mica interface decreased. And when the uniform and orderly DNA monolayers were formed on the mica surface, almost no DNA molecule desorbed from the mica surface in this process. The results indicated that the uniform and orderly DNA monolayer is one of the most stable DNA structures formed on the mica surface. In addition, we have studied the structure change of DNA molecules after desorbed from the mica surface with atomic force microscopy, and found that the desorption might be ascribed to the ethanol-induced DNA condensation.
Svensson, Tomas; Lewander, Märta; Svanberg, Sune
2010-08-02
We demonstrate high-resolution tunable diode laser absorption spectroscopy (TDLAS) of water vapor confined in nanoporous alumina. Strong multiple light scattering results in long photon pathlengths (1 m through a 6 mm sample). We report on strong line broadening due to frequent wall collisions (gas-surface interactions). For the water vapor line at 935.685 nm, the HWHM of confined molecules are about 4.3 GHz as compared to 2.9 GHz for free molecules (atmospheric pressure). Gas diffusion is also investigated, and in contrast to molecular oxygen (that moves rapidly in and out of the alumina), the exchange of water vapor is found very slow.
Preparation and self-folding of amphiphilic DNA origami.
Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng
2015-03-01
Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA under Force: Mechanics, Electrostatics, and Hydration
Directory of Open Access Journals (Sweden)
Jingqiang Li
2015-02-01
Full Text Available Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.
van den Berg, A.A.
2017-01-01
During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and
Rapid purification of circular DNA by triplex-mediated affinity capture
Ji, H.; Smith, L.M.
1997-01-07
A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.
Long-Lived Feshbach Molecules in a Three-Dimensional Optical Lattice
International Nuclear Information System (INIS)
Thalhammer, G.; Winkler, K.; Lang, F.; Schmid, S.; Denschlag, J. Hecker; Grimm, R.
2006-01-01
We have created and trapped a pure sample of 87 Rb 2 Feshbach molecules in a three-dimensional optical lattice. Compared to previous experiments without a lattice, we find dramatic improvements such as long lifetimes of up to 700 ms and a near unit efficiency for converting tightly confined atom pairs into molecules. The lattice shields the trapped molecules from collisions and, thus, overcomes the problem of inelastic decay by vibrational quenching. Furthermore, we have developed an advanced purification scheme that removes residual atoms, resulting in a lattice in which individual sites are either empty or filled with a single molecule in the vibrational ground state of the lattice
Bai, Peter; Yang, Sui; Bao, Wei; Salmeron, Miquel; Zhang, Xiang; Xu, Ting
2015-03-01
Block copolymer-based supramolecules provide a versatile platform to direct the self-assembly of nanoparticles (NPs) into precisely controlled nanostructures in bulk and thin film geometries. A supramolecule, PS-b-P4VP(PDP), composed of the small molecule 3-pentadecylphenol (PDP) hydrogen bonded to a diblock copolymer, polystyrene-block-poly(4-vinylpyridine) (PS-b-P4VP), was subjected to 2-D volume confinement in cylindrical anodic aluminum oxide (AAO) membrane pores. TEM and 3-D TEM tomography reveal that the morphologies accessible by the supramolecule and supramolecule/NP composites, such as NP clusters, arrays, stacked rings, and single and double helical ribbons, are significantly different from those in the bulk or thin film. Furthermore, single molecule dark field scattering measurements demonstrate strong chiral optical response of single helical Au NP ribbon nanostructures in the near infrared wavelength regime. These studies demonstrate 2-D confinement to be an effective means to tailor self-assembled NP structure within supramolecule nanocomposites and pave the way for this assembly approach to be applied towards next generation chiral metamaterials and optoelectronic devices.
Real-time monitoring and manipulation of single bio-molecules in free solution
Energy Technology Data Exchange (ETDEWEB)
Li, Hung-Wing [Iowa State Univ., Ames, IA (United States)
2005-01-01
The observation and manipulation of single biomolecules allow their dynamic behaviors to be studied to provide insight into molecular genetics, biochip assembly, biosensor design, DNA biophysics. In a PDMS/glass microchannel, a nonuniform electroosmotic flow (EOF) was created. By using a scanning confocal fluorescence microscope and total internal-reflection fluorescence microscope (TIRFM), we demonstrated that negatively charged DNA molecules were focused by the nonuniform EOF into a thin layer at the glass surface. This phenomenon was applied to selectively detect target DNA molecules without requiring the separation of excessive probes and can be applied continuously to achieve high throughput. A variable-angle-TIRFM was constructed for imaging single DNA molecule dynamics at a solid/liquid interface. Implications we have are that the measured intensities cannot be used directly to determine the distances of molecules from the surface and the experimental counting results depict the distance-dependent dynamics of molecules near the surface; Molecules at low ionic strengths experience electrostatic repulsion at distances much further away from the surface than the calculated thickness of the electrical double layer. {delta}-DNA was employed as a nanoprobe for different functionalized surfaces to elucidate adsorption in chromatography. The 12-base unpaired ends of this DNA provide exposed purine and pyrimidine groups for adsorption. Patterns of self-assembled monolayers (SAMs) and patterns of metal oxides are generated. By recording the real-time dynamic motion of DNA molecules at the SAMs/aqueous interface, the various parameters governing the retention of an analyte during chromatographic separation can be studied. Even subtle differences among adsorptive forces can be revealed. Dynamic conformational changes of the prosthetic group, flavin adenine dinucleotide (FAD), in flavoprotein NADH peroxidase, in thioredoxin reductase, and in free solution were monitored
Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures
Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.
2018-05-01
Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.
Mitochondrial DNA copy number threshold in mtDNA depletion myopathy.
Durham, S E; Bonilla, E; Samuels, D C; DiMauro, S; Chinnery, P F
2005-08-09
The authors measured the absolute amount of mitochondrial DNA (mtDNA) within single muscle fibers from two patients with thymidine kinase 2 (TK2) deficiency and two healthy controls. TK2 deficient fibers containing more than 0.01 mtDNA/microm3 had residual cytochrome c oxidase (COX) activity. This defines the minimum amount of wild-type mtDNA molecules required to maintain COX activity in skeletal muscle and provides an explanation for the mosaic histochemical pattern seen in patients with mtDNA depletion syndrome.
DNA-FET using carbon nanotube electrodes
International Nuclear Information System (INIS)
Sasaki, T K; Ikegami, A; Aoki, N; Ochiai, Y
2006-01-01
We demonstrate DNA field effect transistor (DNA-FET) using multiwalled carbon nanotube (MWNT) as nano-structural source and drain electrodes. The MWNT electrodes have been fabricated by focused ion-beam bombardment (FIBB). A very short channel, approximately 50 nm, was easily formed between the severed MWNT. The current-voltage (I-V) characteristics of DNA molecules between the MWNT electrodes showed hopping transport property. We have also measured the gate-voltage dependence in the I-V characteristics and found that poly DNA molecules exhibits p-type conduction. The transport of DNA-FET can be explained by two hopping lengths which depend on the range of the source-drain bias voltages
Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface
Energy Technology Data Exchange (ETDEWEB)
Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)
2005-01-01
Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.
Large branched self-assembled DNA complexes
International Nuclear Information System (INIS)
Tosch, Paul; Waelti, Christoph; Middelberg, Anton P J; Davies, A Giles
2007-01-01
Many biological molecules have been demonstrated to self-assemble into complex structures and networks by using their very efficient and selective molecular recognition processes. The use of biological molecules as scaffolds for the construction of functional devices by self-assembling nanoscale complexes onto the scaffolds has recently attracted significant attention and many different applications in this field have emerged. In particular DNA, owing to its inherent sophisticated self-organization and molecular recognition properties, has served widely as a scaffold for various nanotechnological self-assembly applications, with metallic and semiconducting nanoparticles, proteins, macromolecular complexes, inter alia, being assembled onto designed DNA scaffolds. Such scaffolds may typically contain multiple branch-points and comprise a number of DNA molecules selfassembled into the desired configuration. Previously, several studies have used synthetic methods to produce the constituent DNA of the scaffolds, but this typically constrains the size of the complexes. For applications that require larger self-assembling DNA complexes, several tens of nanometers or more, other techniques need to be employed. In this article, we discuss a generic technique to generate large branched DNA macromolecular complexes
Solvated protein–DNA docking using HADDOCK
International Nuclear Information System (INIS)
Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J.
2013-01-01
Interfacial water molecules play an important role in many aspects of protein–DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein–DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein–DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein–DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein–DNA complexes.
Solvated protein-DNA docking using HADDOCK
Energy Technology Data Exchange (ETDEWEB)
Dijk, Marc van; Visscher, Koen M.; Kastritis, Panagiotis L.; Bonvin, Alexandre M. J. J., E-mail: a.m.j.j.bonvin@uu.nl [Utrecht University, Bijvoet Center for Biomolecular Research, Faculty of Science-Chemistry (Netherlands)
2013-05-15
Interfacial water molecules play an important role in many aspects of protein-DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the docking of protein-DNA complexes and demonstrate its feasibility on a benchmark of 30 high-resolution protein-DNA complexes containing crystallographically-determined water molecules at their interfaces. Our protocol is capable of reproducing the solvation pattern at the interface and recovers hydrogen-bonded water-mediated contacts in many of the benchmark cases. Solvated docking leads to an overall improvement in the quality of the generated protein-DNA models for cases with limited conformational change of the partners upon complex formation. The applicability of this approach is demonstrated on real cases by docking a representative set of 6 complexes using unbound protein coordinates, model-built DNA and knowledge-based restraints. As HADDOCK supports the inclusion of a variety of NMR restraints, solvated docking is also applicable for NMR-based structure calculations of protein-DNA complexes.
International Nuclear Information System (INIS)
Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui
2011-01-01
An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.
Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai
2018-01-01
Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283
DEFF Research Database (Denmark)
Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir
1998-01-01
This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.
2017-06-06
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-06-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-01-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan
2011-01-25
DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.
Patel, H. S.; Kushwaha, P. K.; Swami, M. K.
2018-05-01
Photonic nanojets (PNJs) owing to their sub-wavelength near-field features have found many interesting applications like nanoscopy, nano photolithography, high density optical storage, enhancement of Raman signal and single molecule spectroscopy etc. More recently, the focus of research has been on tailoring of PNJs either for better confinement and thus higher peak intensity or for elongation of nanojet for high resolution far field applications. In this paper, we show that crescent-shape refractive index profile (CSRP) of microspheres can be used to generate highly confined PNJ. By optimizing the refractive index of different layers in CSRP microsphere, we show a free space confinement down to ∼ λ / 4 . 5 (FWHM ∼ 110 nm for excitation with 500 nm wavelength). Further, it was observed that the optical properties of substrates also modulate the PNJ characteristics and lead to a further improvement in the transverse confinement to ∼ λ / 6 . 7.
Conformation-dependent DNA attraction.
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-06-21
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.
Supercoiled circular DNA of an insect granulosis virus.
Tweeten, K A; Bulla, L A; Consigli, R A
1977-08-01
The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.
Supercoil Formation During DNA Melting
Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan
2009-03-01
Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.
Cholesterol modulates CFTR confinement in the plasma membrane of primary epithelial cells.
Abu-Arish, Asmahan; Pandzic, Elvis; Goepp, Julie; Matthes, Elizabeth; Hanrahan, John W; Wiseman, Paul W
2015-07-07
The cystic fibrosis transmembrane conductance regulator (CFTR) is a plasma-membrane anion channel that, when mutated, causes the disease cystic fibrosis. Although CFTR has been detected in a detergent-resistant membrane fraction prepared from airway epithelial cells, suggesting that it may partition into cholesterol-rich membrane microdomains (lipid rafts), its compartmentalization has not been demonstrated in intact cells and the influence of microdomains on CFTR lateral mobility is unknown. We used live-cell imaging, spatial image correlation spectroscopy, and k-space image correlation spectroscopy to examine the aggregation state of CFTR and its dynamics both within and outside microdomains in the plasma membrane of primary human bronchial epithelial cells. These studies were also performed during treatments that augment or deplete membrane cholesterol. We found two populations of CFTR molecules that were distinguishable based on their dynamics at the cell surface. One population showed confinement and had slow dynamics that were highly cholesterol dependent. The other, more abundant population was less confined and diffused more rapidly. Treatments that deplete the membrane of cholesterol caused the confined fraction and average number of CFTR molecules per cluster to decrease. Elevating cholesterol had the opposite effect, increasing channel aggregation and the fraction of channels displaying confinement, consistent with CFTR recruitment into cholesterol-rich microdomains with dimensions below the optical resolution limit. Viral infection caused the nanoscale microdomains to fuse into large platforms and reduced CFTR mobility. To our knowledge, these results provide the first biophysical evidence for multiple CFTR populations and have implications for regulation of their surface expression and channel function. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes
Directory of Open Access Journals (Sweden)
Kazuo Umemura
2016-10-01
Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.
Control of electrical conduction in DNA using hole doping
Lee, Hea-Yeon; Taniguchi, Masateru; Yoo, K. H.; Otsuka, Youichi; Tanaka, Hidekazu; Kawai, Tomoji
2002-03-01
Control of electrical conduction in DNA using hole doping H.Y.Lee1, M.Taniguchi1, K.H.Yoo2, Y.Otsuka1 H.Tanaka1 and T.Kawai1 1The Institute of Scientific and Industrial Research(ISIR), Osaka University, Osaka, Japan. 2Department of Physics, Younsei University, Seoul, Korea Possible applications of DNA molecules in electronic devices and biosensors were suggested almost ten years ago A DNA structure containing a single type of base pair appears to be a good candidate for conduction along the \\x81E-electron clouds of the stacked bases. There have been lots of investigations on conduction mechanisms of the DNA molecules. However, it is not still clear whether the observed conductions of some DNA molecules come from motions of either ionic charges or other carriers. Although the basic mechanism for DNA-mediated charge transport should be understood for electronic applications, there have been divergent reports on its nature. And I will be present the research for the charge carrier conduction of DNA film under oxygen and iodine gas by using 10¡V100 nm gap. The doping studies using oxygen and iodine gas can provide a definite answer for the carrier conduction mechanism and also a possible method to control the carrier concentration in DNA molecules. Using oxygen and iodine adsorption experiments on the poly (dG)-poly (dC) DNA molecules, we will show that their conductance becomes increased easily by several orders of magnitudes due to the hole doping, which is a characteristic behavior of a p-type semiconductor. On the other hand, we will also show that the poly (dA) - poly (dT) DNA molecules behave as an n-type semiconductor. Our works indicate that the concentration and the type of carriers in the DNA molecules could be controlled using proper doping methods. We expect that this would be a major breakthrough in DNA-based nano-electronics, similar to the fact that the doped conductive has polyacetylene opened up a new field of electronics with exciting implications
Micropatterning stretched and aligned DNA for sequence-specific nanolithography
Petit, Cecilia Anna Paulette
Techniques for fabricating nanostructured materials can be categorized as either "top-down" or "bottom-up". Top-down techniques use lithography and contact printing to create patterned surfaces and microfluidic channels that can corral and organize nanoscale structures, such as molecules and nanorods in contrast; bottom-up techniques use self-assembly or molecular recognition to direct the organization of materials. A central goal in nanotechnology is the integration of bottom-up and top-down assembly strategies for materials development, device design; and process integration. With this goal in mind, we have developed strategies that will allow this integration by using DNA as a template for nanofabrication; two top-down approaches allow the placement of these templates, while the bottom-up technique uses the specific sequence of bases to pattern materials along each strand of DNA. Our first top-down approach, termed combing of molecules in microchannels (COMMIC), produces microscopic patterns of stretched and aligned molecules of DNA on surfaces. This process consists of passing an air-water interface over end adsorbed molecules inside microfabricated channels. The geometry of the microchannel directs the placement of the DNA molecules, while the geometry of the airwater interface directs the local orientation and curvature of the molecules. We developed another top-down strategy for creating micropatterns of stretched and aligned DNA using surface chemistry. Because DNA stretching occurs on hydrophobic surfaces, this technique uses photolithography to pattern vinyl-terminated silanes on glass When these surface-, are immersed in DNA solution, molecules adhere preferentially to the silanized areas. This approach has also proven useful in patterning protein for cell adhesion studies. Finally, we describe the use of these stretched and aligned molecules of DNA as templates for the subsequent bottom-up construction of hetero-structures through hybridization
Energy Technology Data Exchange (ETDEWEB)
Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)
2016-10-12
Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.
Adiabatic Field-Free Alignment of Asymmetric Top Molecules with an Optical Centrifuge.
Korobenko, A; Milner, V
2016-05-06
We use an optical centrifuge to align asymmetric top SO_{2} molecules by adiabatically spinning their most polarizable O-O axis. The effective centrifugal potential in the rotating frame confines the sulfur atoms to the plane of the laser-induced rotation, leading to the planar molecular alignment that persists after the molecules are released from the centrifuge. The periodic appearance of the full three-dimensional alignment, typically observed only with linear and symmetric top molecules, is also detected. Together with strong in-plane centrifugal forces, which bend the molecules by up to 10 deg, permanent field-free alignment offers new ways of controlling molecules with laser light.
On the electrostatics of DNA in chromatin
Directory of Open Access Journals (Sweden)
Klemen Bohinc
2016-02-01
Full Text Available We examine the interaction between DNA molecules immersed in an aqueous solution of oppositely charged, trivalent spermidine molecules. The DNA molecules are modeled as planar, likecharged surfaces immersed in an aqueous solution of multivalent, rod-like ions consisting of rigidly bonded point charges. An approximate field theory is used to determine the properties of this system from the weak to the intermediate through to the strong coupling regimes. In the weak coupling limit, the interaction between the charged surfaces is only repulsive, whereas in the intermediate coupling regime, the rod-like ions with spatial charge distribution can induce attractive force between the charged surfaces. In the strong coupling limit, the inter-ionic charge correlations induce attractive interaction at short separations between the surfaces. This theoretical study can give new insights in the problem of interaction between DNA molecules mediated by trivalent spermidine molecules.
Repurposing a Benchtop Centrifuge for High-Throughput Single-Molecule Force Spectroscopy.
Yang, Darren; Wong, Wesley P
2018-01-01
We present high-throughput single-molecule manipulation using a benchtop centrifuge, overcoming limitations common in other single-molecule approaches such as high cost, low throughput, technical difficulty, and strict infrastructure requirements. An inexpensive and compact Centrifuge Force Microscope (CFM) adapted to a commercial centrifuge enables use by nonspecialists, and integration with DNA nanoswitches facilitates both reliable measurements and repeated molecular interrogation. Here, we provide detailed protocols for constructing the CFM, creating DNA nanoswitch samples, and carrying out single-molecule force measurements.
Counting molecules in cell-free DNA and single cells RNA
Karlsson, Kasper
2016-01-01
The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...
Energy Technology Data Exchange (ETDEWEB)
Dulieu, O [Laboratoire Aime Cotton, CNRS, Bat. 505, Univ Paris-Sud 11, F-91405 Orsay Cedex (France); Gabbanini, C [Istituto per i processi chimico-fisici del C.N.R., Via Moruzzi 1, 56124 Pisa (Italy)], E-mail: olivier.dulieu@lac.u-psud.fr, E-mail: carlo@ipcf.cnr.it
2009-08-15
Progress on research in the field of molecules at cold and ultracold temperatures is reported in this review. It covers extensively the experimental methods to produce, detect and characterize cold and ultracold molecules including association of ultracold atoms, deceleration by external fields and kinematic cooling. Confinement of molecules in different kinds of traps is also discussed. The basic theoretical issues related to the knowledge of the molecular structure, the atom-molecule and molecule-molecule mutual interactions, and to their possible manipulation and control with external fields, are reviewed. A short discussion on the broad area of applications completes the review.
DNA Origami-Graphene Hybrid Nanopore for DNA Detection.
Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R
2017-01-11
DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.
Energy Technology Data Exchange (ETDEWEB)
Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)
2011-01-24
An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.
Physics of Complex Polymeric Molecules
Kelly, Joshua Walter
The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.
Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
The growth of the mean average crossing number of equilateral polygons in confinement
International Nuclear Information System (INIS)
Arsuaga, J; Borgo, B; Scharein, R; Diao, Y
2009-01-01
The physical and biological properties of collapsed long polymer chains as well as of highly condensed biopolymers (such as DNA in all organisms) are known to be determined, at least in part, by their topological and geometrical properties. With this purpose of characterizing the topological properties of such condensed systems equilateral random polygons restricted to confined volumes are often used. However, very few analytical results are known. In this paper, we investigate the effect of volume confinement on the mean average crossing number (ACN) of equilateral random polygons. The mean ACN of knots and links under confinement provides a simple alternative measurement for the topological complexity of knots and links in the statistical sense. For an equilateral random polygon of n segments without any volume confinement constrain, it is known that its mean ACN (ACN) is of the order 3/16 n log n + O(n). Here we model the confining volume as a simple sphere of radius R. We provide an analytical argument which shows that (ACN) of an equilateral random polygon of n segments under extreme confinement (meaning R 2 ). We propose to model the growth of (ACN) as a(R)n 2 + b(R)nln(n) under a less-extreme confinement condition, where a(R) and b(R) are functions of R with R being the radius of the confining sphere. Computer simulations performed show a fairly good fit using this model.
Loading dynamics of a sliding DNA clamp.
Cho, Won-Ki
2014-05-22
Sliding DNA clamps are loaded at a ss/dsDNA junction by a clamp loader that depends on ATP binding for clamp opening. Sequential ATP hydrolysis results in closure of the clamp so that it completely encircles and diffuses on dsDNA. We followed events during loading of an E. coli β clamp in real time by using single-molecule FRET (smFRET). Three successive FRET states were retained for 0.3 s, 0.7 s, and 9 min: Hydrolysis of the first ATP molecule by the γ clamp loader resulted in closure of the clamp in 0.3 s, and after 0.7 s in the closed conformation, the clamp was released to diffuse on the dsDNA for at least 9 min. An additional single-molecule polarization study revealed that the interfacial domain of the clamp rotated in plane by approximately 8° during clamp closure. The single-molecule polarization and FRET studies thus revealed the real-time dynamics of the ATP-hydrolysis-dependent 3D conformational change of the β clamp during loading at a ss/dsDNA junction.
Photothermal Transport of DNA in Entropy-Landscape Plasmonic Waveguides
DEFF Research Database (Denmark)
Smith, Cameron; Thilsted, Anil Haraksingh; Pedersen, Jonas Nyvold
2017-01-01
The ability to handle single, free molecules in lab-on-a-chip systems is key to the development of advanced biotechnologies. Entropic confinement offers passive control of polymers in nanofluidic systems by locally asserting a molecule's number of available conformation states through structured......-driven actuator provides a convenient platform to filter, route, and manipulate individual molecules and may be realized wholly by wafer-scale fabrication suitable for parallelized investigation....
DNA conformation on surfaces measured by fluorescence self-interference.
Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R
2006-02-21
The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.
Superstable Ultrathin Water Film Confined in a Hydrophilized Carbon Nanotube.
Tomo, Yoko; Askounis, Alexandros; Ikuta, Tatsuya; Takata, Yasuyuki; Sefiane, Khellil; Takahashi, Koji
2018-03-14
Fluids confined in a nanoscale space behave differently than in the bulk due to strong interactions between fluid molecules and solid atoms. Here, we observed water confined inside "open" hydrophilized carbon nanotubes (CNT), with diameter of tens of nanometers, using transmission electron microscopy (TEM). A 1-7 nm water film adhering to most of the inner wall surface was observed and remained stable in the high vacuum (order of 10 -5 Pa) of the TEM. The superstability of this film was attributed to a combination of curvature, nanoroughness, and confinement resulting in a lower vapor pressure for water and hence inhibiting its vaporization. Occasional, suspended ultrathin water film with thickness of 3-20 nm were found and remained stable inside the CNT. This film thickness is 1 order of magnitude smaller than the critical film thickness (about 40 nm) reported by the Derjaguin-Landau-Verwey-Overbeek theory and previous experimental investigations. The stability of the suspended ultrathin water film is attributed to the additional molecular interactions due to the extended water meniscus, which balances the rest of the disjoining pressures.
Enhanced ordering reduces electric susceptibility of liquids confined to graphene slit pores
Terrones, Jeronimo; Kiley, Patrick J.; Elliott, James A.
2016-01-01
The behaviours of a range of polar and non-polar organic liquids (acetone, ethanol, methanol, N-methyl-2-pyrrolidone (NMP), carbon tetrachloride and water) confined to 2D graphene nanochannels with thicknesses in the range of 4.5 Å to 40 Å were studied using classical molecular dynamics and hybrid density functional theory. All liquids were found to organise spontaneously into ordered layers parallel to the confining surfaces, with those containing polar molecules having their electric dipoles aligned parallel to such surfaces. In particular, monolayers of NMP showed remarkable in-plane ordering and low molecular mobility, suggesting the existence of a previously unknown 2D solid-like phase. Calculations for polar liquids showed dramatically reduced static permittivities normal to the confining surfaces; these changes are expected to improve electron tunnelling across the liquid films, modifying the DC electrical properties of immersed assemblies of carbon nanomaterials. PMID:27265098
Force microscopy on insulators: imaging of organic molecules
International Nuclear Information System (INIS)
Pfeiffer, O; Gnecco, E; Zimmerli, L; Maier, S; Meyer, E; Nony, L; Bennewitz, R; Diederich, F; Fang, H; Bonifazi, D
2005-01-01
So far, most of the high resolution scanning probe microscopy studies of organic molecules were restricted to metallic substrates. Insulating substrates are mandatory when the molecules need to be electrically decoupled in a electronic circuit. In such a case, atomic force microscopy is required. In this paper we will discuss our recent studies on different organic molecules deposited on KBr surfaces in ultra-high vacuum, and then imaged by AFM at room temperature. The distance between tip and surface was controlled either by the frequency-shift of the cantilever resonance or by the excitation signal required to keep the oscillation amplitude constant. Advantages and drawbacks of both techniques are discussed. The high mobility of the molecules, due to their weak interaction with the substrate, hinders the formation of regular self assembled structures. To overcome this problem we created artificial structures on the surface by annealing and by electron irradiation, which made possible the growth of the molecules onto step edges and their confinement into rectangular pits
Studies of G-quadruplex DNA structures at the single molecule level
DEFF Research Database (Denmark)
Kragh, Sofie Louise
2015-01-01
Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...
Carlsson, Nils; Jonsson, Fabian; Wilhelmsson, L. Marcus; Nordé n, Bengt; Å kerman, Bjö rn
2013-01-01
We report that DNA molecules can be intercalated and macroscopically oriented in the aqueous interstitia of a lyotropic lamellar liquid crystal. Using UV-vis linear dichroism and fluorescence spectroscopy we show that double-stranded oligonucleotides (25 base pairs) in the water-octanoate-decanol system remain base-paired in the B conformation and are confined in two dimensions, with the helix axis preferentially parallel to the lipid bilayer surfaces but free to rotate within this plane. The degree of helix confinement and the corresponding 2-D orientation can be improved by decreasing the thickness of the water interstitia via the fraction of water in the ternary mixture. Not surprisingly, the corresponding single-stranded oligonucleotides are not aligned, with their persistence length being short in comparison to the lamellar interstitium thickness. We propose this as a model system for studying interactions of DNA-ligand complexes near a lipid bilayer membrane which we demonstrate by using dye probes that are either covalently attached to one end of the oligonucleotide or reversibly bound by intercalation between the base pairs. Three cationic dyes, all strongly bound by intercalation to DNA when free in solution, are found to not bind to DNA but to prefer the membrane surface. The covalently attached Cy5 also binds to the bilayer while Cy3 tends to end-stack to the oligonucleotide duplex. The orientation of Cy5 parallel to the membrane indicates that electrostatic surface binding predominates over insertion into the hydrophobic interior of the membrane. Anionic and zwitterionic dyes (FAM and ROX) are found to remain randomly oriented in the water between the lipid bilayer surfaces. © The Royal Society of Chemistry.
Alternative end-joining of DNA breaks
Schendel, Robin van
2016-01-01
DNA is arguably the most important molecule found in any organism, as it contains all information to perform cellular functions and enables continuity of species. It is continuously exposed to DNA-damaging agents both from endogenous and exogenous sources. To protect DNA against these sources of DNA
Second-strand cDNA synthesis: classical method
International Nuclear Information System (INIS)
Gubler, U.
1987-01-01
The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described
Development of novel vaccines using DNA shuffling and screening strategies.
Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha
2004-02-01
DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.
A novel small molecule inhibitor of the DNA repair protein Ku70/80.
Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka
2016-07-01
Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All
Single DNA denaturation and bubble dynamics
International Nuclear Information System (INIS)
Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C
2009-01-01
While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.
Origin of the electrophoretic force on DNA in solid-state nanopores
van Dorp, Stijn; Keyser, Ulrich F.; Dekker, Nynke H.; Dekker, Cees; Lemay, Serge G.
2009-05-01
Despite gel electrophoresis being one of the main workhorses of molecular biology, the physics of polyelectrolyte electrophoresis in a strongly confined environment remains poorly understood. Theory indicates that forces in electrophoresis result from interplay between ionic screening and hydrodynamics, but these ideas could so far be addressed only indirectly by experiments based on macroscopic porous gels. Here, we provide a first direct experimental test by measuring the electrophoretic force on a single DNA molecule threading through a solid-state nanopore as a function of pore size. The stall force gradually decreases on increasing the nanopore diameter from 6 to 90nm, inconsistent with expectations from simple electrostatics and strikingly demonstrating the influence of the hydrodynamic environment. We model this process by applying the coupled Poisson-Boltzmann and Stokes equations in the nanopore geometry and find good agreement with the experimental results.
Size distribution of DNA molecules recovered from non-denaturing filter elution
International Nuclear Information System (INIS)
Bloecher, D.; Iliakis, G.
1991-01-01
DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)
Exciton confinement in organic dendrimer quantum wells for opto-electronic applications
Lupton, J. M.; Samuel, I. D. W.; Burn, P. L.; Mukamel, S.
2002-01-01
Organic dendrimers are a fascinating new class of materials for opto-electronic applications. We present coupled electronic oscillator calculations on novel nanoscale conjugated dendrimers for use in organic light-emitting diodes. Strong confinement of excitations at the center of the dendrimers is observed, which accounts for the dependence of intermolecular interactions and charge transport on the degree of branching of the dendrimer. The calculated absorption spectra are in excellent agreement with the measured data and show that benzene rings are shared between excitations on the linear segments of the hyperbranched molecules. The coupled electronic oscillator approach is ideally suited to treat large dendritic molecules.
Giri, Gaurav; Li, Ruipeng; Smilgies, Detlef Matthias; Li, Erqiang; Diao, Ying; Lenn, Kristina M.; Chiu, Melanie; Lin, Debora W.; Allen, Ranulfo A.; Reinspach, Julia A.; Mannsfeld, Stefan C B; Thoroddsen, Sigurdur T; Clancy, Paulette; Bao, Zhenan; Amassian, Aram
2014-01-01
A crystal's structure has significant impact on its resulting biological, physical, optical and electronic properties. In organic electronics, 6,13(bis-triisopropylsilylethynyl)pentacene (TIPS-pentacene), a small-molecule organic semiconductor, adopts metastable polymorphs possessing significantly faster charge transport than the equilibrium crystal when deposited using the solution-shearing method. Here, we use a combination of high-speed polarized optical microscopy, in situ microbeam grazing incidence wide-angle X-ray-scattering and molecular simulations to understand the mechanism behind formation of metastable TIPS-pentacene polymorphs. We observe that thin-film crystallization occurs first at the air-solution interface, and nanoscale vertical spatial confinement of the solution results in formation of metastable polymorphs, a one-dimensional and large-area analogy to crystallization of polymorphs in nanoporous matrices. We demonstrate that metastable polymorphism can be tuned with unprecedented control and produced over large areas by either varying physical confinement conditions or by tuning energetic conditions during crystallization through use of solvent molecules of various sizes. © 2014 Macmillan Publishers Limited.
Giri, Gaurav; Li, Ruipeng; Smilgies, Detlef-M; Li, Er Qiang; Diao, Ying; Lenn, Kristina M; Chiu, Melanie; Lin, Debora W; Allen, Ranulfo; Reinspach, Julia; Mannsfeld, Stefan C B; Thoroddsen, Sigurdur T; Clancy, Paulette; Bao, Zhenan; Amassian, Aram
2014-04-16
A crystal's structure has significant impact on its resulting biological, physical, optical and electronic properties. In organic electronics, 6,13(bis-triisopropylsilylethynyl)pentacene (TIPS-pentacene), a small-molecule organic semiconductor, adopts metastable polymorphs possessing significantly faster charge transport than the equilibrium crystal when deposited using the solution-shearing method. Here, we use a combination of high-speed polarized optical microscopy, in situ microbeam grazing incidence wide-angle X-ray-scattering and molecular simulations to understand the mechanism behind formation of metastable TIPS-pentacene polymorphs. We observe that thin-film crystallization occurs first at the air-solution interface, and nanoscale vertical spatial confinement of the solution results in formation of metastable polymorphs, a one-dimensional and large-area analogy to crystallization of polymorphs in nanoporous matrices. We demonstrate that metastable polymorphism can be tuned with unprecedented control and produced over large areas by either varying physical confinement conditions or by tuning energetic conditions during crystallization through use of solvent molecules of various sizes.
Single DNA denaturation and bubble dynamics
DEFF Research Database (Denmark)
Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas
2009-01-01
While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...... for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation...
CCSD(T) calculations of stabilities and properties of confined systems
Energy Technology Data Exchange (ETDEWEB)
Holka, F.; Urban, M. [Slovak University of Technology in Bratislava, Faculty of Materials Science and Technology in Trnava, Institute of Materials Science, Bottova 25, SK-917 24 Trnava (Slovakia); Melicherčík, M.; Neogrády, P. [Department of Physical and Theoretical Chemistry, Faculty of Natural Sciences, Comenius University, Mlynská dolina, SK-842 15 Bratislava (Slovakia); Paldus, J. [Department of Applied Mathematics, University of Waterloo, N2L 3G1, Ontario (Canada)
2015-01-22
We analyze energies, electron affinities and polarizabilities of small anions exposed to an external confinement. The second electron in free O{sup 2−} and S{sup 2−} anions is unbound. We investigate the stabilizing effect of the spherical harmonic-oscillator confining potential ω. on these anions employing the Hartree-Fock stability analysis as introduced by Čížek and Paldus. With increasing strength of the external harmonic-oscillator confinement potential ω the broken symmetry (BS) solutions are systematically eliminated. For ω larger than 0.1 all BS solutions for O{sup 2−} disappear. For ω larger than 0.13 the CCSD(T) energy of O{sup 2−} becomes more negative than the energy of the singly charged O{sup −} anion. We relate the harmonic-oscillator confining potential to a crystalline environment in which the O{sup 2−} and S{sup 2−} anions are stable. We also present a model allowing calculations of the in-crystal polarizabilities of anions. The model is based on CCSD(T) calculations of static polarizabilities of selected anions exposed to the spherical harmonic-oscillator confining potential ω This artificial confinement potential ω is then related to the ionic radii of the cation in representative crystal lattices. We investigate the polarizability of O{sup 2−} and S{sup 2−} anions in MgO, MgS, CaO, CaS, SrO, SrS, BaO and BaS crystals. We compare our results with alternative models for in-crystal polarizabilities. External confinement also stabilizes the uracil anion U{sup −}, as is shown by calculations with a stepwise micro-hydration of U{sup −}. Upon hydration is the CCSD(T) adiabatic electron affinity (AEA) of uracil enhanced by about 250 up to 570 meV in comparison with AEA of the isolated molecule, depending on the geometry of the hydrated uracil anion complex. We tried to find an analogy of the stabilization effect of the external confinement on the otherwise unstable anions. In uracil and its anion is the external
International Nuclear Information System (INIS)
Tabet, J.
2007-11-01
The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)
Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA
Energy Technology Data Exchange (ETDEWEB)
Greulich-Bode, Karin; Wang, Mei; Rhein, Andreas; Weier, Jingly; Weier, Heinz-Ulli
2008-12-16
Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-?B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.
Validation of DNA probes for molecular cytogenetics by mapping onto immobilized circular DNA
Energy Technology Data Exchange (ETDEWEB)
Greulich-Bode, Karin M.; Wang, Mei; Rhein, Andreas P.; Weier, Jingly F.; Weier, Heinz-Ulli G.
2008-12-04
Fluorescence in situ hybridization (FISH) is a sensitive and rapid procedure to detect gene rearrangements in tumor cells using non-isotopically labeled DNA probes. Large insert recombinant DNA clones such as bacterial artificial chromosome (BAC) or P1/PAC clones have established themselves in recent years as preferred starting material for probe preparations due to their low rates of chimerism and ease of use. However, when developing probes for the quantitative analysis of rearrangements involving genomic intervals of less than 100kb, careful probe selection and characterization are of paramount importance. We describe a sensitive approach to quality control probe clones suspected of carrying deletions or for measuring clone overlap with near kilobase resolution. The method takes advantage of the fact that P1/PAC/BAC's can be isolated as circular DNA molecules, stretched out on glass slides and fine-mapped by multicolor hybridization with smaller probe molecules. Two examples demonstrate the application of this technique: mapping of a gene-specific {approx}6kb plasmid onto an unusually small, {approx}55kb circular P1 molecule and the determination of the extent of overlap between P1 molecules homologous to the human NF-{kappa}B2 locus. The relatively simple method presented here does not require specialized equipment and may thus find widespread applications in DNA probe preparation and characterization, the assembly of physical maps for model organisms or in studies on gene rearrangements.
Hands on Group Work Paper Model for Teaching DNA Structure, Central Dogma and Recombinant DNA
Altiparmak, Melek; Nakiboglu Tezer, Mahmure
2009-01-01
Understanding life on a molecular level is greatly enhanced when students are given the opportunity to visualize the molecules. Especially understanding DNA structure and function is essential for understanding key concepts of molecular biology such as DNA, central dogma and the manipulation of DNA. Researches have shown that undergraduate…
Molecular dynamics simulations of ultrathin water film confined between flat diamond plates
Directory of Open Access Journals (Sweden)
A.V. Khomenko
2008-12-01
Full Text Available Molecular dynamics simulations of ultrathin water film confined between atomically flat rigid diamond plates are described. Films with thickness of one and two molecular diameters are concerned and TIP4P model is used for water molecules. Dynamical and equilibrium characteristics of the system for different values of the external load and shear force are investigated. An increase of the external load causes the transition of the film to a solidlike state. This is manifested in a decrease of the diffusion constant and in the ordering of the liquid molecules into quasidiscrete layers. For two-layer film under high loads, the molecules also become ordered parallel to the surfaces. Time dependencies of the friction force and the changes of its average value with the load are obtained. In general, the behaviour of the studied model is consistent with the experimental results obtained for simple liquids with spherical molecules.
Early models of DNA damage formation
International Nuclear Information System (INIS)
Śmiałek, Małgorzata A
2012-01-01
Quantification of DNA damage, induced by various types of incident radiation as well as chemical agents, has been the subject of many theoretical and experimental studies, supporting the development of modern cancer therapy. The primary observations showed that many factors can lead to damage of DNA molecules. It became clear that the development of experimental techniques for exploring this phenomenon is required. Another problem was simultaneously dealt with, anticipating on how the damage is distributed within the double helix of the DNA molecule and how the single strand break formation and accumulation can influence the lethal double strand break formation. In this work the most important probabilistic models for DNA strand breakage and damage propagation are summarized and compared.
Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.
2018-01-01
The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784
Model of biological quantum logic in DNA.
Mihelic, F Matthew
2013-08-02
The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.
Multiplexed single-molecule force spectroscopy using a centrifuge.
Yang, Darren; Ward, Andrew; Halvorsen, Ken; Wong, Wesley P
2016-03-17
We present a miniature centrifuge force microscope (CFM) that repurposes a benchtop centrifuge for high-throughput single-molecule experiments with high-resolution particle tracking, a large force range, temperature control and simple push-button operation. Incorporating DNA nanoswitches to enable repeated interrogation by force of single molecular pairs, we demonstrate increased throughput, reliability and the ability to characterize population heterogeneity. We perform spatiotemporally multiplexed experiments to collect 1,863 bond rupture statistics from 538 traceable molecular pairs in a single experiment, and show that 2 populations of DNA zippers can be distinguished using per-molecule statistics to reduce noise.
Confinement effect of protonation/deprotonation of carboxylic group modified in nanochannel
International Nuclear Information System (INIS)
Gao, Hong-Li; Zhang, Hui; Li, Cheng-Yong; Xia, Xing-Hua
2013-01-01
Protonation and deprotonation processes are the key step of acid–base reaction and occur in many biological processes. Study on the deprotonation process of molecules and/or functional groups in confined conditions would help us understand the acid–base theory and confinement effect of biomolecules. In this paper, we use a recently established approach to the study of protonation and deprotonation processes of functional groups in porous anodic alumina array nanochannels by measuring the flux of electrochemical active probes (ferricyanide ions) using an Au film electrochemical detector sputtered at the end of nanochannels. The protonation and deprotonation processes of surface functional groups in nanochannels will change the surface charges and in turn modulate the transportation of charged electroactive probes through nanochannels. The titration curve for the deprotonation of carboxylic groups in nanochannel confined conditions is obtained by measuring the current signal of ferricyanide probe flowing through an carboxylic-anchored PAA nanochannels array at different solution pH. Results show that the deprotonation of carboxylic group in nanochannel occurs in one step with a pK 1/2 = 6.2. The present method provides an effective tool to study the deprotonation processes of various functional groups and biomolecules under confined conditions
Dynamics of DNA conformations and DNA-protein interaction
DEFF Research Database (Denmark)
Metzler, R.; Ambjörnsson, T.; Lomholt, Michael Andersen
2005-01-01
Optical tweezers, atomic force microscopes, patch clamping, or fluorescence techniques make it possible to study both the equilibrium conformations and dynamics of single DNA molecules as well as their interaction with binding proteins. In this paper we address the dynamics of local DNA...... denaturation (bubble breathing), deriving its dynamic response to external physical parameters and the DNA sequence in terms of the bubble relaxation time spectrum and the autocorrelation function of bubble breathing. The interaction with binding proteins that selectively bind to the DNA single strand exposed...... in a denaturation bubble are shown to involve an interesting competition of time scales, varying between kinetic blocking of protein binding up to full binding protein-induced denaturation of the DNA. We will also address the potential to use DNA physics for the design of nanosensors. Finally, we report recent...
Heme as a danger molecule in pathogen recognition.
Wegiel, Barbara; Hauser, Carl J; Otterbein, Leo E
2015-12-01
Appropriate control of redox mechanisms are critical for and effective innate immune response, which employs multiple cell types, receptors and molecules that recognize danger signals when they reach the host. Recognition of pathogen-associated pattern molecules (PAMPs) is a fundamental host survival mechanism for efficient elimination of invading pathogens and resolution of the infection and inflammation. In addition to PAMPs, eukaryotic cells contain a plethora of intracellular molecules that are normally secured within the confines of the plasma membrane, but if liberated and encountered in the extracellular milieu can provoke rapid cell activation. These are known as Alarmins or Danger-Associated Molecular Patterns (DAMPs) and can be released actively by cells or passively as a result of sterile cellular injury after trauma, ischemia, or toxin-induced cell rupture. Both PAMPs and DAMPs are recognized by a series of cognate receptors that increase the generation of free radicals and activate specific signaling pathways that result in regulation of a variety of stress response, redox sensitive genes. Multiple mediators released, as cells die include, but are not limited to ATP, hydrogen peroxide, heme, formyl peptides, DNA or mitochondria provide the second signal to amplify immune responses. In this review, we will focus on how sterile and infective stimuli activate the stress response gene heme oxygenase-1 (Hmox1, HO-1), a master gene critical to an appropriate host response that is now recognized as one with enormous therapeutic potential. HO-1 gene expression is regulated in large part by redox-sensitive proteins including but not limited to nrf2. Both PAMPs and DAMPs increase the activation of nrf2 and HO-1. Heme is a powerful pro-oxidant and as such should be qualified as a DAMP. With its degradation by HO-1a molecule of carbon monoxide (CO) is generated that in turn serves as a bioactive signaling molecule. PAMPs such as bacterial endotoxin activate HO-1
Modeling inhomogeneous DNA replication kinetics.
Directory of Open Access Journals (Sweden)
Michel G Gauthier
Full Text Available In eukaryotic organisms, DNA replication is initiated at a series of chromosomal locations called origins, where replication forks are assembled proceeding bidirectionally to replicate the genome. The distribution and firing rate of these origins, in conjunction with the velocity at which forks progress, dictate the program of the replication process. Previous attempts at modeling DNA replication in eukaryotes have focused on cases where the firing rate and the velocity of replication forks are homogeneous, or uniform, across the genome. However, it is now known that there are large variations in origin activity along the genome and variations in fork velocities can also take place. Here, we generalize previous approaches to modeling replication, to allow for arbitrary spatial variation of initiation rates and fork velocities. We derive rate equations for left- and right-moving forks and for replication probability over time that can be solved numerically to obtain the mean-field replication program. This method accurately reproduces the results of DNA replication simulation. We also successfully adapted our approach to the inverse problem of fitting measurements of DNA replication performed on single DNA molecules. Since such measurements are performed on specified portion of the genome, the examined DNA molecules may be replicated by forks that originate either within the studied molecule or outside of it. This problem was solved by using an effective flux of incoming replication forks at the model boundaries to represent the origin activity outside the studied region. Using this approach, we show that reliable inferences can be made about the replication of specific portions of the genome even if the amount of data that can be obtained from single-molecule experiments is generally limited.
Dynamic translocation of ligand-complexed DNA through solid-state nanopores with optical tweezers
International Nuclear Information System (INIS)
Sischka, Andy; Spiering, Andre; Anselmetti, Dario; Khaksar, Maryam; Laxa, Miriam; Koenig, Janine; Dietz, Karl-Josef
2010-01-01
We investigated the threading and controlled translocation of individual lambda-DNA (λ-DNA) molecules through solid-state nanopores with piconewton force sensitivity, millisecond time resolution and picoampere ionic current sensitivity with a set-up combining quantitative 3D optical tweezers (OT) with electrophysiology. With our virtually interference-free OT set-up the binding of RecA and single peroxiredoxin protein molecules to λ-DNA was quantitatively investigated during dynamic translocation experiments where effective forces and respective ionic currents of the threaded DNA molecule through the nanopore were measured during inward and outward sliding. Membrane voltage-dependent experiments of reversible single protein/DNA translocation scans yield hysteresis-free, asymmetric single-molecule fingerprints in the measured force and conductance signals that can be attributed to the interplay of optical trap and electrostatic nanopore potentials. These experiments allow an exact localization of the bound protein along the DNA strand and open fascinating applications for label-free detection of DNA-binding ligands, where structural and positional binding phenomena can be investigated at a single-molecule level.
Encaged molecules in external electric fields: A molecular "tug-of-war"
Gurav, Nalini D.; Gejji, Shridhar P.; Bartolotti, Libero J.; Pathak, Rajeev K.
2016-08-01
Response of polar molecules CH3OH and H2O2 and a non-polar molecule, CO2, as "guests" encapsulated in the dodecahedral water cage (H2O)20 "host," to an external, perturbative electric field is investigated theoretically. We employ the hybrid density-functionals M06-2X and ωB97X-D incorporating the effects of damped dispersion, in conjunction with the maug-cc-pVTZ basis set, amenable for a hydrogen bonding description. While the host cluster (cage) tends to confine the embedded guest molecule through cooperative hydrogen bonding, the applied electric field tends to rupture the cluster-composite by stretching it; these two competitive effects leading to a molecular "tug-of-war." The composite remains stable up to a maximal sustainable threshold electric field, beyond which, concomitant with the vanishing of the HOMO-LUMO gap, the field wins over and the cluster breaks down. The electric-field effects are gauged in terms of the changes in the molecular geometry of the confined species, interaction energy, molecular electrostatic potential surfaces, and frequency shifts of characteristic normal vibrations in the IR regime. Interestingly, beyond the characteristic threshold electric field, the labile, distorted host cluster fragmentizes, and the guest molecule still tethered to a remnant fragment, an effect attributed to the underlying hydrogen-bonded networks.
Hou, Sen; Sun, Lili; Wieczorek, Stefan A; Kalwarczyk, Tomasz; Kaminski, Tomasz S; Holyst, Robert
2014-01-15
Fluorescent double-stranded DNA (dsDNA) molecules labeled at both ends are commonly produced by annealing of complementary single-stranded DNA (ssDNA) molecules, labeled with fluorescent dyes at the same (3' or 5') end. Because the labeling efficiency of ssDNA is smaller than 100%, the resulting dsDNA have two, one or are without a dye. Existing methods are insufficient to measure the percentage of the doubly-labeled dsDNA component in the fluorescent DNA sample and it is even difficult to distinguish the doubly-labeled DNA component from the singly-labeled component. Accurate measurement of the percentage of such doubly labeled dsDNA component is a critical prerequisite for quantitative biochemical measurements, which has puzzled scientists for decades. We established a fluorescence correlation spectroscopy (FCS) system to measure the percentage of doubly labeled dsDNA (PDL) in the total fluorescent dsDNA pool. The method is based on comparative analysis of the given sample and a reference dsDNA sample prepared by adding certain amount of unlabeled ssDNA into the original ssDNA solution. From FCS autocorrelation functions, we obtain the number of fluorescent dsDNA molecules in the focal volume of the confocal microscope and PDL. We also calculate the labeling efficiency of ssDNA. The method requires minimal amount of material. The samples have the concentration of DNA in the nano-molar/L range and the volume of tens of microliters. We verify our method by using restriction enzyme Hind III to cleave the fluorescent dsDNA. The kinetics of the reaction depends strongly on PDL, a critical parameter for quantitative biochemical measurements. Copyright © 2013 Elsevier B.V. All rights reserved.
Precise Coating of a Wide Range of DNA Templates by a Protein Polymer with a DNA Binding Domain
Hernandez-Garcia, Armando; Estrich, Nicole A.; Werten, Marc W.T.; Maarel, van der Johan R.C.; Labean, Thomas H.; Wolf, de Frits A.; Cohen Stuart, Martien A.; Vries, de Renko
2017-01-01
Emerging DNA-based nanotechnologies would benefit from the ability to modulate the properties (e.g., solubility, melting temperature, chemical stability) of diverse DNA templates (single molecules or origami nanostructures) through controlled, self-assembling coatings. We here introduce a DNA
Simple Laboratory methods to measure cell proliferation using DNA synthesis property
Directory of Open Access Journals (Sweden)
Madhavan H N
2007-01-01
Full Text Available This is a mini-review on the techniques to measure proliferation of cells by estimation of DNA synthesis. This is not an exhaustive review of literature, but a bird’s eye view of a few selected articles which may provide the technical details to the readers.The nucleus of a cell occupies about 10-30% of the cells space, depends on the type of genetic material (DNA -DeoxyriboNucleic Acid. DNA is a long, double-stranded, helical molecule which carries the genetic information. Duplication of the DNA takes place by the phenomena of replication. One copy of double-stranded DNA molecule forms two double-stranded DNA molecules. DNA replication is the fundamental process used in all living organisms as it is the basis for biological inheritance. This process is known also as Mitosis in somatic cells. In Mitosis, the duplication process results in two genetically identical "daughter" cells from a single "parent" cell. The resulting double-stranded DNA molecules are identical; proof reading and error-checking mechanisms exist to ensure near perfect pair. Mitosis is divided into six phases: prophase, prometaphase, metaphase, anaphase, telophase, and cytokinesis.
Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles
Huschka, Ryan
Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on
DEFF Research Database (Denmark)
Gothelf, Kurt Vesterager
2012-01-01
-dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...
International Nuclear Information System (INIS)
Berk, H.L.
1992-01-01
An overview is presented of the principles of magnetic confinement of plasmas for the purpose of achieving controlled fusion conditions. Sec. 1 discusses the different nuclear fusion reactions which can be exploited in prospective fusion reactors and explains why special technologies need to be developed for the supply of tritium or 3 He, the probable fuels. In Sec. 2 the Lawson condition, a criterion that is a measure of the quality of confinement relative to achieving fusion conditions, is explained. In Sec. 3 fluid equations are used to describe plasma confinement. Specific confinement configurations are considered. In Sec. 4 the orbits of particle sin magneti and electric fields are discussed. In Sec. 5 stability considerations are discussed. It is noted that confinement systems usually need to satisfy stability constraints imposed by ideal magnetohydrodynamic (MHD) theory. The paper culminates with a summary of experimental progress in magnetic confinement. Present experiments in tokamaks have reached the point that the conditions necessary to achieve fusion are being satisfied
Torkelson, John; Chen, Lawrence
2013-03-01
The Tg-confinement effect in polymers was first characterized in supported polystyrene (PS) films by Keddie et al. in 1994. Since then, many researchers have shown that (pseudo-)thermodynamic Tg measurements of supported PS films taken on cooling consistently yield the same qualitative results, with a decrease from bulk Tg beginning at 40-60 nm thickness and becoming very strong below 20 nm thickness. Some quantitative differences have been noted between studies, which may be ascribed to measurement method or the analysis employed. In 2004, we showed that the Tg-confinement effect in PS may be suppressed by adding several wt% of small-molecule diluents such as dioctyl phthalate. Recently, Kremer and co-workers (Macromolecules 2010, 43, 9937) reported that there was no Tg-confinement in supported PS films based on an analysis of the second derivative of ellipsometry data and use of a ninth order polynomial fit. Here, we demonstrate a new method for suppressing the Tg-confinement effect. In particular, PS made by emulsion polymerization yields no Tg-confinement effect as measured by ellipsometry or fluorescence, while PS made by anionic or conventional free radical polymerization yield strong Tg-confinement effects. The difference is hypothesized to result from surfactant in the emulsion polymerized PS. We also show that the absence of the Tg-confinement effect reported by Kremer is due to inappropriate analysis of ellipsometry data and that correct analysis yields Tg-confinement effects.
Ribosomal DNA-binding proteins in the nucleolus of Physarum polycephalum
International Nuclear Information System (INIS)
Graham-Lorence, S.E.
1987-01-01
In Physarum polycephalum, the nucleoli are extra chromosomal structures containing 200 to 400 copies of a linear 60 kilobase palindromic rDNA molecule. These rDNA molecules are organized into minichromosomes which apparently are held within a nucleolar protein matrix. To obtained evidence for attachment of the rDNA to such a matrix, both intact and lithium diiodosalicylate/NaCl-extracted nucleoli were digested for various lengths of time with micrococcal nuclease, so that portions of the rDNA molecules not attached within the nucleolar structure would be released. Nucleolar DNA-binding proteins were determined by blotting electrophoretically separated proteins from SDS-polyacrylamide gels onto nitrocellulose paper and probing them with radiolabeled DNA. In addition to the histones and lexosome proteins, eight DNA-binding proteins were identified having molecular weights of 25, 38, 47, 53, 55, 67, and 70 kD, with the 47, 53, 67, and 70 kD proteins requiring Ca 2+ for binding
Nanopore sensors for DNA analysis
DEFF Research Database (Denmark)
Solovyeva, Vita; Venkatesan, B.M.; Shim, Jeong
2012-01-01
Solid-state nanopore sensors are promising devices for single DNA molecule detection and sequencing. This paper presents a review of our work on solid-state nanopores performed over the last decade. In particular, here we discuss atomic-layer-deposited (ALD)-based, graphene-based, and functionali......Solid-state nanopore sensors are promising devices for single DNA molecule detection and sequencing. This paper presents a review of our work on solid-state nanopores performed over the last decade. In particular, here we discuss atomic-layer-deposited (ALD)-based, graphene...
Metallization of DNA on silicon surface
International Nuclear Information System (INIS)
Puchkova, Anastasiya Olegovna; Sokolov, Petr; Petrov, Yuri Vladimirovich; Kasyanenko, Nina Anatolievna
2011-01-01
New simple way for silver deoxyribonucleic acid (DNA)-based nanowires preparation on silicon surface was developed. The electrochemical reduction of silver ions fixed on DNA molecule provides the forming of tightly matched zonate silver clusters. Highly homogeneous metallic clusters have a size about 30 nm. So the thickness of nanowires does not exceed 30–50 nm. The surface of n-type silicon monocrystal is the most convenient substrate for this procedure. The comparative analysis of DNA metallization on of n-type silicon with a similar way for nanowires fabrication on p-type silicon, freshly cleaved mica, and glass surface shows the advantage of n-type silicon, which is not only the substrate for DNA fixation but also the source of electrons for silver reduction. Images of bound DNA molecules and fabricated nanowires have been obtained using an atomic force microscope and a scanning ion helium microscope. DNA interaction with silver ions in a solution was examined by the methods of ultraviolet spectroscopy and circular dichroism.
How do rod-like molecules freeze and arrange in mesopores?
International Nuclear Information System (INIS)
Huber, Patrick; Wallacher, Dirk; Hofmann, Tommy; Knorr, Klaus
2003-01-01
We present an x-ray diffraction study on rod-like molecules, i.e. the normal alkanes C 19 H 40 and C 9 H 20 condensed in nanoporous Vycor glass. Temperature-dependent diffraction patterns elucidate how the structure and phase behaviour of these molecules are affected by the random substrate disorder and the geometric confinement. For the medium-length alkane C 19 H 40 a quenching of the lamellar ordering is observed, whereas this geometric ordering principle survives in the case of the short-length C 9 H 20 , although in a modified fashion
Ligation bias in Illumina next-generation DNA libraries
DEFF Research Database (Denmark)
Seguin-Orlando, Andaine; Schubert, Mikkel; Clary, Joel
2013-01-01
Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products,...... for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.......Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by......-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate...
Low energy electron-initiated ion-molecule reactions of ribose analogues
International Nuclear Information System (INIS)
Mozejko, P.
2003-01-01
Recent experiments in which plasmid DNA samples were bombarded with low energy ( 2 O, DNA bases, and sugar-phosphate backbone analogues. To this end, the cyclic molecule tetrahydrofuran, and its derivatives, provide useful models for the sugar-like molecules contained in the backbone of DNA. In addition to LEE induced dissociation by processes such as dissociative electron attachment (DEA), molecules may be damaged by ions and neutral species of non-thermal energies created by LEE in the surrounding environment. In this contribution, we investigate with electron stimulated desorption techniques, LEE damage to films of desoxy-ribose analogues in the presence of various molecular coadsorbates, that simulate changes in local molecular environment. In one type of experiments tetrahydrofuran is deposited onto multilayer O2. A desorbed signal of OH - indicates ion-molecule reactions of the type O - + C 4 H 8 O -> OH - + C 4 H 7 O, where the O - was formed initially by DEA to O 2 . Further electron stimulated desorption measurements for tetrahydrofuran and derivatives adsorbed on H 2 O, Kr, N 2 O and CH 3 OH will be presented and discussed
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
Electrostatic force microscopy: imaging DNA and protein polarizations one by one
International Nuclear Information System (INIS)
Mikamo-Satoh, Eriko; Yamada, Fumihiko; Takagi, Akihiko; Matsumoto, Takuya; Kawai, Tomoji
2009-01-01
We present electrostatic force microscopy images of double-stranded DNA and transcription complex on an insulating mica substrate obtained with molecular resolution using a frequency-mode noncontact atomic force microscope. The electrostatic potential images show that both DNA and transcription complexes are polarized with an upward dipole moment. Potential differences of these molecules from the mica substrate enabled us to estimate dipole moments of isolated DNA and transcription complex in zero external field to be 0.027 D/base and 0.16 D/molecule, respectively. Scanning capacitance microscopy demonstrates characteristic contrast inversion between DNA and transcription complex images, indicating the difference in electric polarizability of these molecules. These findings indicate that the electrostatic properties of individual biological molecules can be imaged on an insulator substrate while retaining complex formation.
DNA: Polymer and molecular code
Shivashankar, G. V.
1999-10-01
The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes
Probe DNA-Cisplatin Interaction with Solid-State Nanopores
Zhou, Zhi; Hu, Ying; Li, Wei; Xu, Zhi; Wang, Pengye; Bai, Xuedong; Shan, Xinyan; Lu, Xinghua; Nanopore Collaboration
2014-03-01
Understanding the mechanism of DNA-cisplatin interaction is essential for clinical application and novel drug design. As an emerging single-molecule technology, solid-state nanopore has been employed in biomolecule detection and probing DNA-molecule interactions. Herein, we reported a real-time monitoring of DNA-cisplatin interaction by employing solid-state SiN nanopores. The DNA-cisplatin interacting process is clearly classified into three stages by measuring the capture rate of DNA-cisplatin adducts. In the first stage, the negative charged DNA molecules were partially discharged due to the bonding of positive charged cisplatin and forming of mono-adducts. In the second stage, forming of DNA-cisplatin di-adducts with the adjacent bases results in DNA bending and softening. The capture rate increases since the softened bi-adducts experience a lower barrier to thread into the nanopores. In the third stage, complex structures, such as micro-loop, are formed and the DNA-cisplatin adducts are aggregated. The capture rate decreases to zero as the aggregated adduct grows to the size of the pore. The characteristic time of this stage was found to be linear with the diameter of the nanopore and this dynamic process can be described with a second-order reaction model. We are grateful to Laboratory of Microfabrication, Dr. Y. Yao, and Prof. R.C. Yu (Institute of Physics, Chinese Academy of Sciences) for technical assistance.
Hysteresis in pressure-driven DNA denaturation.
Directory of Open Access Journals (Sweden)
Enrique Hernández-Lemus
Full Text Available In the past, a great deal of attention has been drawn to thermal driven denaturation processes. In recent years, however, the discovery of stress-induced denaturation, observed at the one-molecule level, has revealed new insights into the complex phenomena involved in the thermo-mechanics of DNA function. Understanding the effect of local pressure variations in DNA stability is thus an appealing topic. Such processes as cellular stress, dehydration, and changes in the ionic strength of the medium could explain local pressure changes that will affect the molecular mechanics of DNA and hence its stability. In this work, a theory that accounts for hysteresis in pressure-driven DNA denaturation is proposed. We here combine an irreversible thermodynamic approach with an equation of state based on the Poisson-Boltzmann cell model. The latter one provides a good description of the osmotic pressure over a wide range of DNA concentrations. The resulting theoretical framework predicts, in general, the process of denaturation and, in particular, hysteresis curves for a DNA sequence in terms of system parameters such as salt concentration, density of DNA molecules and temperature in addition to structural and configurational states of DNA. Furthermore, this formalism can be naturally extended to more complex situations, for example, in cases where the host medium is made up of asymmetric salts or in the description of the (helical-like charge distribution along the DNA molecule. Moreover, since this study incorporates the effect of pressure through a thermodynamic analysis, much of what is known from temperature-driven experiments will shed light on the pressure-induced melting issue.
Hong, Pei-Ying; Li, Xiangzhen; Yang, Xufei; Shinkai, Takumi; Zhang, Yuanhui; Wang, Xinlei; Mackie, Roderick I
2012-06-01
Given the growing concerns over human and animal health issues related to confined animal feeding operations, an in-depth examination is required to monitor for airborne bacteria and associated antibiotic resistance genes. Our 16S rRNA-based pyrosequencing revealed that the airborne microbial community skewed towards a higher abundance of Firmicutes (> 59.2%) and Bacteroidetes (4.2-31.4%) within the confinement buildings, while the office environment was predominated by Proteobacteria (55.2%). Furthermore, bioaerosols in the confinement buildings were sporadically associated with genera of potential pathogens, and these genera were more frequently observed in the bioaerosols of pig and layer hen confinement than the turkey confinement buildings and office environment. High abundances of tetracycline resistance genes (9.55 × 10(2) to 1.69 × 10(6) copies ng(-1) DNA) were also detected in the bioaerosols sampled from confinement buildings. Bacterial lineages present in the poultry bioaerosols clustered apart from those present in the pig bioaerosols and among the different phases of pig production, suggesting that different livestock as well as production phase were associated with a distinct airborne microbial community. By understanding the diversity of biotic contaminants associated with the different confinement buildings, this study facilitates the implementation of better management strategies to minimize potential health impacts on both livestock and humans working in this environment. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.
2015-07-01
Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.
Giri, Gaurav
2014-04-16
A crystal\\'s structure has significant impact on its resulting biological, physical, optical and electronic properties. In organic electronics, 6,13(bis-triisopropylsilylethynyl)pentacene (TIPS-pentacene), a small-molecule organic semiconductor, adopts metastable polymorphs possessing significantly faster charge transport than the equilibrium crystal when deposited using the solution-shearing method. Here, we use a combination of high-speed polarized optical microscopy, in situ microbeam grazing incidence wide-angle X-ray-scattering and molecular simulations to understand the mechanism behind formation of metastable TIPS-pentacene polymorphs. We observe that thin-film crystallization occurs first at the air-solution interface, and nanoscale vertical spatial confinement of the solution results in formation of metastable polymorphs, a one-dimensional and large-area analogy to crystallization of polymorphs in nanoporous matrices. We demonstrate that metastable polymorphism can be tuned with unprecedented control and produced over large areas by either varying physical confinement conditions or by tuning energetic conditions during crystallization through use of solvent molecules of various sizes. © 2014 Macmillan Publishers Limited.
Single-molecule dynamics in nanofabricated traps
Cohen, Adam
2009-03-01
The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.
Smith, Douglas E.; Fuller, Derek N.; Raymer, Dorian M.; Rickgauer, Peter; Grimes, Shelley; Jardine, Paul J.; Anderson, Dwight L.; Catalano, Carlos E.; Kottadiel, Vishal; Rao, Venigalla B.
2007-09-01
A key step in the assembly of many viruses is the packaging of double-stranded DNA into a viral procapsid (an empty protein shell) by the action of an ATP-powered portal motor complex. We have developed methods to measure the packaging of single DNA molecules into single viral proheads in real time using optical tweezers. We can measure DNA binding and initiation of translocation, the DNA translocation dynamics, and the filling of the capsid against resisting forces. In addition to studying bacteriophage φ29, we have recently extended these methods to study the E. coli bacteriophages λ and T4, two important model systems in molecular biology. The three systems have different capsid sizes/shapes, genome lengths, and biochemical and structural differences in their packaging motors. Here, we compare and contrast these three systems. We find that all three motors translocate DNA processively and generate very large forces, each exceeding 50 piconewtons, ~20x higher force than generated by the skeletal muscle myosin 2 motor. This high force generation is required to overcome the forces resisting the confinement of the stiff, highly charged DNA at high density within the viral capsids. However, there are also striking differences between the three motors: they exhibit different DNA translocation rates, degrees of static and dynamic disorder, responses to load, and pausing and slipping dynamics.
Study of the confined solutions properties: case of gel formed during nuclear glass alteration
International Nuclear Information System (INIS)
Matar-Briman, I.
2012-01-01
In this study, we have investigated the thermodynamic properties, the structure and the dynamics of confined solutions in model gels and in a gel coming from glass alteration. The first step was to determine the structure and the dynamics of pure confined water in porous materials by using nuclear magnetic resonance and neutron scattering. Meso-porous silica was elaborated and grafted by sol-gel route to decrease the pore sizes from 2.7 to 2 nm and to modify pore surfaces to have Si-OH, Zr-OH and Al-OH. The second step involved determining the dynamics of water in leachate confined in the model gels and in the gel of altered glass by using neutron scattering. In the model gels and at a 10 -12 -10 -9 second timescale, two kinds of waters were highlighted: first, an interfacial water linked to the pore surfaces and second, a free water in the pore core. Their ratio depends on the pore size and pore surface composition. Whatever the pore surface, when the pore size decreases the free water ratio in the pore center also decreases. For pores smaller than 2.3 nm and pore surfaces with Zr-OH or Al-OH surfaces, water is strongly linked to the surface and few water molecules are mobile. This is due to the ability of alumina and zirconia to immobilize water molecules through chemical coordination bonds stronger than the physical bonds established between silica and water. The result also highlight that pore surface composition could be the predominant parameter affecting the fixed proton content. Moreover, the mobility of water confined in a leachate is not modified. The study of the water dynamics in a gel formed during alteration of glass constituted of SiO 2 , Al 2 O 3 and CaO, and having a porosity between 2 and 7 nm showed the same behavior as water confined in pores presenting an Al-OH surface. (author) [fr
Nucleic Acids as Information Molecules.
McInerney, Joseph D.
1996-01-01
Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)
Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry
DEFF Research Database (Denmark)
Vranken, Charlotte; Deen, Jochem; Dirix, Lieve
2014-01-01
We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore...... to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay...... the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes...
Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin
2014-05-01
Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].
International Nuclear Information System (INIS)
Khadkikar, S.B.; Vinodkumar, P.C.
1987-04-01
Confinement model for gluons using a 'colour super current' is formulated. An attempt has been made to derive a suitable dielectric function corresponding to the current confinement model. A simple inhomogeneous dielectric confinement model for gluons is studied for comparison. The model Hamiltonians are second quantized and the glueball states are constructed. The spurious motion of the centre of confinement is accounted for. The results of the current confinement scheme are found to be in good agreement with the experimental candidates for glueballs. (author). 16 refs, 3 tabs
Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens
Energy Technology Data Exchange (ETDEWEB)
Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.
2015-09-14
Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.
Comments on confinement criteria
International Nuclear Information System (INIS)
Kurak, V.; Schroer, B.; Swieca, J.A.
1977-01-01
For a QED 2 model with SU(n) flavour, the nature of the physical states space is more subtle than one expects on the basis of the loop criterion for confinement. One may have colour confinement without confinement of the fundamental flavour representation. Attempts to formulate confinement criteria in which the quark fields play a more fundamental role are discussed [pt
Energy Technology Data Exchange (ETDEWEB)
Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.
2009-05-11
The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.
Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation
Energy Technology Data Exchange (ETDEWEB)
Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie
1981-01-01
Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.
International Nuclear Information System (INIS)
Lee, C.; Gamble, L.; Grainger, D.; Castner, D.
2006-01-01
Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s→π* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein
Note: A well-confined pulsed low-energy ion beam: Test experiments of Ar+
Hu, Jie; Wu, Chun-Xiao; Tian, Shan Xi
2018-06-01
Here we report a pulsed low-energy ion beam source for ion-molecule reaction study, in which the ions produced by the pulsed electron impact are confined well in the spatial size of each bunch. In contrast to the ion focusing method to reduce the transverse section of the beam, the longitudinal section in the translational direction is compressed by introducing a second pulse in the ion time-of-flight system. The test experiments for the low-energy argon ions are performed. The present beam source is ready for applications in the ion-molecule reaction dynamics experiments, in particular, in combination with the ion velocity map imaging technique.
Carbon Nanotube Biosensors for Space Molecule Detection and Clinical Molecular Diagnostics
Han, Jie
2001-01-01
Both space molecule detection and clinical molecule diagnostics need to develop ultra sensitive biosensors for detection of less than attomole molecules such as amino acids for DNA. However all the electrode sensor systems including those fabricated from the existing carbon nanotubes, have a background level of nA (nanoAmp). This has limited DNA or other molecule detection to nA level or molecules whose concentration is, much higher than attomole level. A program has been created by NASA and NCI (National Cancer Institute) to exploit the possibility of carbon nanotube based biosensors to solve this problem for both's interest. In this talk, I will present our effort on the evaluation and novel design of carbon nanotubes as electrode biosensors with strategies to minimize background currents while maximizing signal intensity.The fabrication of nanotube electrode arrays, immobilization of molecular probes on nanotube electrodes and in vitro biosensor testing will also be discussed.
International Nuclear Information System (INIS)
Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha
2012-01-01
DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)
Energy Technology Data Exchange (ETDEWEB)
University of California, Berkeley; Lawrence Berkeley National Laboratory; Raymond, Kenneth; Pluth, Michael D.; Bergman, Robert G.; Raymond, Kenneth N.
2007-09-27
Nature uses enzymes to activate otherwise unreactive compounds in remarkable ways. For example, DNases are capable of hydrolyzing phosphate diester bonds in DNA within seconds,[1-3]--a reaction with an estimated half-life of 200 million years without an enzyme.[4] The fundamental features of enzyme catalysis have been much discussed over the last sixty years in an effort to explain the dramatic rate increases and high selectivities of enzymes. As early as 1946, Linus Pauling suggested that enzymes must preferentially recognize and stabilize the transition state over the ground state of a substrate.[5] Despite the intense study of enzymatic selectivity and ability to catalyze chemical reactions, the entire nature of enzyme-based catalysis is still poorly understood. For example, Houk and co-workers recently reported a survey of binding affinities in a wide variety of enzyme-ligand, enzyme-transition-state, and synthetic host-guest complexes and found that the average binding affinities were insufficient to generate many of the rate accelerations observed in biological systems.[6] Therefore, transition-state stabilization cannot be the sole contributor to the high reactivity and selectivity of enzymes, but rather, other forces must contribute to the activation of substrate molecules. Inspired by the efficiency and selectivity of Nature, synthetic chemists have admired the ability of enzymes to activate otherwise unreactive molecules in the confines of an active site. Although much less complex than the evolved active sites of enzymes, synthetic host molecules have been developed that can carry out complex reactions with their cavities. While progress has been made toward highly efficient and selective reactivity inside of synthetic hosts, the lofty goal of duplicating enzymes specificity remains.[7-9] Pioneered by Lehn, Cram, Pedersen, and Breslow, supramolecular chemistry has evolved well beyond the crown ethers and cryptands originally studied.[10-12] Despite the
Biosensors for DNA sequence detection
Vercoutere, Wenonah; Akeson, Mark
2002-01-01
DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.
Radiation damage of DNA. Model for direct ionization of DNA
International Nuclear Information System (INIS)
Kobayashi, Kazuo; Tagawa, Seiichi
2004-01-01
Current aspects of radiation damage of DNA, particularly induced by the direct effect of radiation, and author's method of pulse radiolysis are described in relation to behavior of ions formed by radiation and active principles to induce the strand break. In irradiation of DNA solution in water, the direct effect of radiation is derived from ionization of DNA itself and indirect one, from the reaction between DNA and radicals generated from water molecules and the former direct one has been scarcely investigated due to difficulty of experimental approach. Radicals generated in sugar moiety of DNA are shown important in the strand break by recent studies on crystalline DNA irradiated by X-ray, DNA solution by electron and photon beams, hydrated DNA by γ-ray and by high linear energy transfer (LET) ion. Author's pulse radiolysis studies have revealed behaviors of guanine and adenine radical cations in dynamics of DNA oxidation. Since reactions described are the model, the experimental approach is thought necessary for elucidation of the actually occurring DNA damage in living cells. (N.I.)
Glass transition and relaxation dynamics of propylene glycol-water solutions confined in clay
Elamin, Khalid; Björklund, Jimmy; Nyhlén, Fredrik; Yttergren, Madeleine; Mârtensson, Lena; Swenson, Jan
2014-07-01
The molecular dynamics of aqueous solutions of propylene glycol (PG) and propylene glycol methylether (PGME) confined in a two-dimensional layer-structured Na-vermiculite clay has been studied by broadband dielectric spectroscopy and differential scanning calorimetry. As typical for liquids in confined geometries the intensity of the cooperative α-relaxation becomes considerably more suppressed than the more local β-like relaxation processes. In fact, at high water contents the calorimetric glass transition and related structural α-relaxation cannot even be observed, due to the confinement. Thus, the intensity of the viscosity related α-relaxation is dramatically reduced, but its time scale as well as the related glass transition temperature Tg are for both systems only weakly influenced by the confinement. In the case of the PGME-water solutions it is an important finding since in the corresponding bulk system a pronounced non-monotonic concentration dependence of the glass transition related dynamics has been observed due to the growth of hydrogen bonded relaxing entities of water bridging between PGME molecules [J. Sjöström, J. Mattsson, R. Bergman, and J. Swenson, Phys. Chem. B 115, 10013 (2011)]. The present results suggest that the same type of structural entities are formed in the quasi-two-dimensional space between the clay platelets. It is also observed that the main water relaxation cannot be distinguished from the β-relaxation of PG or PGME in the concentration range up to intermediate water contents. This suggests that these two processes are coupled and that the water molecules affect the time scale of the β-relaxation. However, this is most likely true also for the corresponding bulk solutions, which exhibit similar time scales of this combined relaxation process below Tg. Finally, it is found that at higher water contents the water relaxation does not merge with, or follow, the α-relaxation above Tg, but instead crosses the
International Nuclear Information System (INIS)
Novello, M.; Lorenci, V.A. de; Elbaz, E.
1997-02-01
In this paper we present a new model for a gauge field theory such that self-interacting spin-one particles can be confined in a compact domain. The necessary conditions to produce the confining potential appear already in the properties of the eikonal structure generated by the particular choice of the dynamics. (author)
Confining Domains Lead to Reaction Bursts: Reaction Kinetics in the Plasma Membrane
Kalay, Ziya; Fujiwara, Takahiro K.; Kusumi, Akihiro
2012-01-01
Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity. PMID:22479350
Confining domains lead to reaction bursts: reaction kinetics in the plasma membrane.
Directory of Open Access Journals (Sweden)
Ziya Kalay
Full Text Available Confinement of molecules in specific small volumes and areas within a cell is likely to be a general strategy that is developed during evolution for regulating the interactions and functions of biomolecules. The cellular plasma membrane, which is the outermost membrane that surrounds the entire cell, was considered to be a continuous two-dimensional liquid, but it is becoming clear that it consists of numerous nano-meso-scale domains with various lifetimes, such as raft domains and cytoskeleton-induced compartments, and membrane molecules are dynamically trapped in these domains. In this article, we give a theoretical account on the effects of molecular confinement on reversible bimolecular reactions in a partitioned surface such as the plasma membrane. By performing simulations based on a lattice-based model of diffusion and reaction, we found that in the presence of membrane partitioning, bimolecular reactions that occur in each compartment proceed in bursts during which the reaction rate is sharply and briefly increased even though the asymptotic reaction rate remains the same. We characterized the time between reaction bursts and the burst amplitude as a function of the model parameters, and discussed the biological significance of the reaction bursts in the presence of strong inhibitor activity.
cGAS Conducts Micronuclei DNA Surveillance.
de Oliveira Mann, Carina C; Kranzusch, Philip J
2017-10-01
DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.
Saini, Natalie
2015-12-01
21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.
Functional transferred DNA within extracellular vesicles
Energy Technology Data Exchange (ETDEWEB)
Cai, Jin [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China); Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Jiangsu Province (China); Wu, Gengze [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China); Jose, Pedro A. [Division of Nephrology, Department of Medicine and Physiology, University of Maryland, School of Medicine, Baltimore, MD 21201 (United States); Zeng, Chunyu, E-mail: Chunyuzeng01@163.com [Department of Cardiology, Daping Hospital, The Third Military Medical University, Chongqing 400042 (China)
2016-11-15
Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmic macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.
Functional transferred DNA within extracellular vesicles
International Nuclear Information System (INIS)
Cai, Jin; Wu, Gengze; Jose, Pedro A.; Zeng, Chunyu
2016-01-01
Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmic macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.
Bio-recognitive photonics of a DNA-guided organic semiconductor
Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June
2016-01-01
Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.
Bio-recognitive photonics of a DNA-guided organic semiconductor.
Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June
2016-01-04
Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.
Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production
Directory of Open Access Journals (Sweden)
Junji Tominaga4
2012-04-01
Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.
Yamaguchi, Akira; Namekawa, Manato; Itoh, Tetsuji; Teramae, Norio
2012-01-01
The fluorescence dynamics of rhodamine B (RhB) immobilized on the pore surface of aminopropyl (AP)-modified mesoporous silica (diameter of the silica framework, 3.1 nm) was examined at temperatures between 293 and 193 K to study the microviscosity of supercooled water confined inside the pores. The mesoporous silica specimen with a dense AP layer (2.1 molecules nm(-2)) was prepared, and RhB isothiocyanate was covalently bound to part of the surface AP groups. The fluorescence lifetime of the surface RhB increased with decreasing temperature from 293 to 223 K, indicating that freezing of the confined water did not occur in this temperature range. The microviscosity of the supercooled confined water was evaluated from an analysis of the lifetime data based on a frequency-dependent friction model.
Applications of a general random-walk theory for confined diffusion.
Calvo-Muñoz, Elisa M; Selvan, Myvizhi Esai; Xiong, Ruichang; Ojha, Madhusudan; Keffer, David J; Nicholson, Donald M; Egami, Takeshi
2011-01-01
A general random walk theory for diffusion in the presence of nanoscale confinement is developed and applied. The random-walk theory contains two parameters describing confinement: a cage size and a cage-to-cage hopping probability. The theory captures the correct nonlinear dependence of the mean square displacement (MSD) on observation time for intermediate times. Because of its simplicity, the theory also requires modest computational requirements and is thus able to simulate systems with very low diffusivities for sufficiently long time to reach the infinite-time-limit regime where the Einstein relation can be used to extract the self-diffusivity. The theory is applied to three practical cases in which the degree of order in confinement varies. The three systems include diffusion of (i) polyatomic molecules in metal organic frameworks, (ii) water in proton exchange membranes, and (iii) liquid and glassy iron. For all three cases, the comparison between theory and the results of molecular dynamics (MD) simulations indicates that the theory can describe the observed diffusion behavior with a small fraction of the computational expense. The confined-random-walk theory fit to the MSDs of very short MD simulations is capable of accurately reproducing the MSDs of much longer MD simulations. Furthermore, the values of the parameter for cage size correspond to the physical dimensions of the systems and the cage-to-cage hopping probability corresponds to the activation barrier for diffusion, indicating that the two parameters in the theory are not simply fitted values but correspond to real properties of the physical system.
Directory of Open Access Journals (Sweden)
T Banerjee
Full Text Available DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM and spectroscopy (AFS. The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.
Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R
2016-01-01
DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.
DNA adsorption characteristics of hollow spherule allophane nano-particles
International Nuclear Information System (INIS)
Matsuura, Yoko; Iyoda, Fumitoshi; Arakawa, Shuichi; John, Baiju; Okamoto, Masami; Hayashi, Hidetomo
2013-01-01
To understand the propensity of natural allophane to adsorb the DNA molecules, the adsorption characteristics were assessed against natural allophane (AK70), using single-stranded DNA (ss-DNA) and adenosine 5′-monophosphate (5′-AMP) as a reference molecule. The adsorption capacity of ss-DNA on AK70 exhibited one order of magnitude lower value as compared with that of 5′-AMP. The adsorption capacity of ss-DNA decreased with increasing pH due to the interaction generated between phosphate groups of ss-DNA and functional Al–OH groups on the wall perforations through deprotonating, associated with higher energy barrier for the adsorption of ss-DNA. The adsorption morphologies consisting of the individual ss-DNA with mono-layer coverage of the clustered allophane particle were observed successfully through transmission electron microscopy analysis. - Highlights: • The interaction between phosphate groups of ss-DNA and Al–OH groups • Higher energy barrier for the adsorption of ss-DNA • The individual ss-DNA with mono-layer coverage of the allophane clustered particle
Saini, Natalie
2015-01-01
21 years ago, the DNA Repair Enzyme was declared “Molecule of the Year”. Today, we are celebrating another “year of repair”, with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.
Binding of radiation-induced phenylalanine radicals to DNA
International Nuclear Information System (INIS)
Schans, G.P. van der; Rijn, C.J.S. van; Bleichrodt, J.F.
1975-11-01
When an aqueous solution of double-stranded DNA of bacteriophage PM2 containing phenylalanine and saturated with N 2 O is irradiated with γ-rays, radiation-induced phenylalanine radicals are bound covalently. Under the conditions used about 25 phenylalanine molecules may be bound per lethal hit. Also for single-stranded PM2 DNA, most of the phenylalanine radicals bound are non-lethal. Evidence is presented that in double-stranded DNA an appreciable fraction of the single-strand breaks is induced by phenylalanine radicals. Radiation products of phenylalanine and the phenylalanine bound to the DNA decrease the sensitivity of the DNA to the induction of single-strand breaks. There are indications that the high efficiency of protection by radiation products of phenylalanine is due to their positive charge, which will result in a relatively high concentration of these compounds in the vicinity of the negatively charged DNA molecules
Structural DNA Nanotechnology: Artificial Nanostructures for Biomedical Research.
Ke, Yonggang; Castro, Carlos; Choi, Jong Hyun
2018-04-04
Structural DNA nanotechnology utilizes synthetic or biologic DNA as designer molecules for the self-assembly of artificial nanostructures. The field is founded upon the specific interactions between DNA molecules, known as Watson-Crick base pairing. After decades of active pursuit, DNA has demonstrated unprecedented versatility in constructing artificial nanostructures with significant complexity and programmability. The nanostructures could be either static, with well-controlled physicochemical properties, or dynamic, with the ability to reconfigure upon external stimuli. Researchers have devoted considerable effort to exploring the usability of DNA nanostructures in biomedical research. We review the basic design methods for fabricating both static and dynamic DNA nanostructures, along with their biomedical applications in fields such as biosensing, bioimaging, and drug delivery. Expected final online publication date for the Annual Review of Biomedical Engineering Volume 20 is June 4, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA
International Nuclear Information System (INIS)
Verebová, Valéria; Adamcik, Jozef; Danko, Patrik; Podhradský, Dušan; Miškovský, Pavol; Staničová, Jana
2014-01-01
Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode
Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA and lengthen linear DNA
Energy Technology Data Exchange (ETDEWEB)
Verebová, Valéria [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia); Adamcik, Jozef [Food and Soft Materials Science, Institute of Food, Nutrition and Health, ETH Zurich, Schmelzbergstrasse 9, CH-8092 Zürich (Switzerland); Danko, Patrik; Podhradský, Dušan [Department of Biochemistry, Institute of Chemistry, Faculty of Sciences, P.J. Šafárik University, Moyzesova 11, 041 54 Košice (Slovakia); Miškovský, Pavol [Department of Biophysics, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Center for Interdisciplinary Biosciences, Faculty of Sciences, P.J. Šafárik University, Jesenná 5, 041 54 Košice (Slovakia); Staničová, Jana, E-mail: jana.stanicova@uvlf.sk [Institute of Biophysics, University of Veterinary Medicine and Pharmacy, Komenského 73, 041 81 Košice (Slovakia)
2014-01-31
Highlights: • Anthraquinones quinizarin and danthron unwind negatively supercoiled DNA. • Anthraquinones quinizarin and danthron lengthen linear DNA. • Anthraquinones quinizarin and danthron possess middle binding affinity to DNA. • Anthraquinones quinizarin and danthron interact with DNA by intercalating mode. - Abstract: The intercalating drugs possess a planar aromatic chromophore unit by which they insert between DNA bases causing the distortion of classical B-DNA form. The planar tricyclic structure of anthraquinones belongs to the group of chromophore units and enables anthraquinones to bind to DNA by intercalating mode. The interactions of simple derivatives of anthraquinone, quinizarin (1,4-dihydroxyanthraquinone) and danthron (1,8-dihydroxyanthraquinone), with negatively supercoiled and linear DNA were investigated using a combination of the electrophoretic methods, fluorescence spectrophotometry and single molecule technique an atomic force microscopy. The detection of the topological change of negatively supercoiled plasmid DNA, unwinding of negatively supercoiled DNA, corresponding to appearance of DNA topoisomers with the low superhelicity and an increase of the contour length of linear DNA in the presence of quinizarin and danthron indicate the binding of both anthraquinones to DNA by intercalating mode.
Directory of Open Access Journals (Sweden)
Anang Kristianto
2012-11-01
Full Text Available One of the important requirements for earthquake resistant building related to confinement is the use of seismic hooks in the hoop or confining reinforcement of reinforced-concrete column elements. However, installation of a confining reinforcement with a 135-degree hook is not easy. Therefore, in practice, many construction workers apply a confining reinforcement with a 90-degreehook (non-code compliant. Based on research and records of recent earthquakes in Indonesia, the use of a non-code compliant confining reinforcement for concrete columns produces structures with poor seismic performance. This paper presents a study that introduces an additional element that is expected to improve the effectiveness of concrete columns confined with a non-code compliant confining reinforcement. The additional element, named a pen-binder, is used to keep the non-code compliant confining reinforcement in place. The effectiveness of this element under pure axial concentric loading was investigatedcomprehensively.The specimens tested in this study were 18 concrete columns,with a cross-section of 170 mm x 170 mm and a height of 480 mm. The main test variables were the material type of the pen-binder, the angle of the hook, and the confining reinforcement configuration.The test results indicate that adding pen-binders can effectively improve the strength and ductility of the column specimens confined with a non-code compliant confining reinforcement
Physicochemical and nanotechnological approaches to the design of 'rigid' spatial structures of DNA
International Nuclear Information System (INIS)
Yevdokimov, Yu M; Salyanov, V I; Skuridin, S G; Shtykova, E V; Khlebtsov, N G; Kats, E I
2015-01-01
This review focuses on physicochemical and nanotechnological approaches to the design of 'rigid' particles based on double-stranded DNA molecules. The physicochemical methods imply cross-linking of adjacent DNA molecules ordered in quasinematic layers of liquid-crystalline dispersion particles by synthetic nanobridges consisting of alternating molecules of an antibiotic (daunomycin) and divalent copper ions, as well as cross-linking of these molecules as a result of their salting-out in quasinematic layers of liquid-crystalline dispersion particles under the action of lanthanide cations. The nanotechnological approach is based on the insertion of gold nanoparticles into the free space between double-stranded DNA molecules that form quasinematic layers of liquid-crystalline dispersion particles. This gives rise to extended clusters of gold nanoparticles and is accompanied by an enhancement of the interaction between the DNA molecules through gold nanoparticles and by a decrease in the solubility of dispersion particles. These approaches produce integrated 'rigid' DNA-containing spatial structures, which are incompatible with the initial aqueous polymeric solutions and have unique properties. The bibliography includes 116 references
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
Synthesis of furan-based DNA binders and their interaction with DNA
International Nuclear Information System (INIS)
Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef
2006-01-01
In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)
International Nuclear Information System (INIS)
Koning, M.M.G.
1990-01-01
The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs
Master equation approach to DNA breathing in heteropolymer DNA
DEFF Research Database (Denmark)
Ambjörnsson, Tobias; Banik, Suman K; Lomholt, Michael A
2007-01-01
After crossing an initial barrier to break the first base-pair (bp) in double-stranded DNA, the disruption of further bps is characterized by free energies up to a few k(B)T. Thermal motion within the DNA double strand therefore causes the opening of intermittent single-stranded denaturation zones......, the DNA bubbles. The unzipping and zipping dynamics of bps at the two zipper forks of a bubble, where the single strand of the denatured zone joins the still intact double strand, can be monitored by single molecule fluorescence or NMR methods. We here establish a dynamic description of this DNA breathing...... in a heteropolymer DNA with given sequence in terms of a master equation that governs the time evolution of the joint probability distribution for the bubble size and position along the sequence. The transfer coefficients are based on the Poland-Scheraga free energy model. We derive the autocorrelation function...
Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y
1977-04-01
Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.
Hazeltine, R D
2003-01-01
Detailed and authoritative, this volume examines the essential physics underlying international research in magnetic confinement fusion. It offers readable, thorough accounts of the fundamental concepts behind methods of confining plasma at or near thermonuclear conditions. Designed for a one- or two-semester graduate-level course in plasma physics, it also represents a valuable reference for professional physicists in controlled fusion and related disciplines.
The role of DNA dependent protein kinase in synapsis of DNA ends.
Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C
2003-12-15
DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.
Solvated protein-DNA docking using HADDOCK
van Dijk, Marc; Visscher, Koen M; Bonvin, Alexandre M.J.J; Kastritis, Panagiotis L.
2013-01-01
Interfacial water molecules play an important role in many aspects of protein-DNA specificity and recognition. Yet they have been mostly neglected in the computational modeling of these complexes. We present here a solvated docking protocol that allows explicit inclusion of water molecules in the
DNA Structure and Supercoiling: Ribbons and a Yo-Yo Model
Van Horn, J. David
2011-01-01
The double-helical structure of DNA is a pop cultural icon. Images of the DNA molecule appear in newspapers, popular journals, and advertisements. In addition to scientific instrument sales, the aura surrounding the central molecule of life has been used to sell everything from perfume to beverages and is the inspiration of items ranging from…
DNA nanotechnology and fluorescence applications.
Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf
2016-06-01
Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. Copyright © 2016 Elsevier Ltd. All rights reserved.
Quantitative measurement of water diffusion lifetimes at a protein/DNA interface by NMR
International Nuclear Information System (INIS)
Gruschus, James M.; Ferretti, James A.
2001-01-01
Hydration site lifetimes of slowly diffusing water molecules at the protein/DNA interface of the vnd/NK-2 homeodomain DNA complex were determined using novel three-dimensional NMR techniques. The lifetimes were calculated using the ratios of ROE and NOE cross-relaxation rates between the water and the protein backbone and side chain amides. This calculation of the lifetimes is based on a model of the spectral density function of the water-protein interaction consisting of three timescales of motion: fast vibrational/rotational motion, diffusion into/out of the hydration site, and overall macromolecular tumbling. The lifetimes measured ranged from approximately 400 ps to more than 5 ns, and nearly all the slowly diffusing water molecules detected lie at the protein/DNA interface. A quantitative analysis of relayed water cross-relaxation indicated that even at very short mixing times, 5 ms for ROESY and 12 ms for NOESY, relay of magnetization can make a small but detectable contribution to the measured rates. The temperature dependences of the NOE rates were measured to help discriminate direct dipolar cross-relaxation from chemical exchange. Comparison with several X-ray structures of homeodomain/DNA complexes reveals a strong correspondence between water molecules in conserved locations and the slowly diffusing water molecules detected by NMR. A homology model based on the X-ray structures was created to visualize the conserved water molecules detected at the vnd/NK-2 homeodomain DNA interface. Two chains of water molecules are seen at the right and left sides of the major groove, adjacent to the third helix of the homeodomain. Two water-mediated hydrogen bond bridges spanning the protein/DNA interface are present in the model, one between the backbone of Phe8 and a DNA phosphate, and one between the side chain of Asn51 and a DNA phosphate. The hydrogen bond bridge between Asn51 and the DNA might be especially important since the DNA contact made by the invariant
A general approach to break the concentration barrier in single-molecule imaging
Loveland, Anna B.
2012-09-09
Single-molecule fluorescence imaging is often incompatible with physiological protein concentrations, as fluorescence background overwhelms an individual molecule\\'s signal. We solve this problem with a new imaging approach called PhADE (PhotoActivation, Diffusion and Excitation). A protein of interest is fused to a photoactivatable protein (mKikGR) and introduced to its surface-immobilized substrate. After photoactivation of mKikGR near the surface, rapid diffusion of the unbound mKikGR fusion out of the detection volume eliminates background fluorescence, whereupon the bound molecules are imaged. We labeled the eukaryotic DNA replication protein flap endonuclease 1 with mKikGR and added it to replication-competent Xenopus laevis egg extracts. PhADE imaging of high concentrations of the fusion construct revealed its dynamics and micrometer-scale movements on individual, replicating DNA molecules. Because PhADE imaging is in principle compatible with any photoactivatable fluorophore, it should have broad applicability in revealing single-molecule dynamics and stoichiometry of macromolecular protein complexes at previously inaccessible fluorophore concentrations. © 2012 Nature America, Inc. All rights reserved.
Metaphors of DNA: a review of the popularisation processes
Directory of Open Access Journals (Sweden)
Sergi Cortiñas Rovira
2008-03-01
Full Text Available This article offers a 1953-present day review of the models that have popularised DNA, one of the fundamental molecules of biochemistry. DNA has become an iconic concept over the 20th century, overcoming the boundaries of science and spreading into literature, painting, sculpture or religion. This work analyses the reasons why DNA has penetrated society so effectively and examines some of the main metaphors used by the scientists and scientific popularisers. Furthermore, this article, taken from the author's PhD thesis, describes some recent popularisation models for this molecule.
Visualization of DNA double-strand break repair: From molecules to cells
Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.
2008-01-01
DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.
Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.
Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard
2007-10-30
We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.
Thermodynamic perturbation theory for associating fluids confined in a one-dimensional pore
Energy Technology Data Exchange (ETDEWEB)
Marshall, Bennett D. [ExxonMobil Research and Engineering, 22777 Springwoods Village Parkway, Spring, Texas 77389 (United States)
2015-06-21
In this paper, a new theory is developed for the self-assembly of associating molecules confined to a single spatial dimension, but allowed to explore all orientation angles. The interplay of the anisotropy of the pair potential and the low dimensional space results in orientationally ordered associated clusters. This local order enhances association due to a decrease in orientational entropy. Unlike bulk 3D fluids which are orientationally homogeneous, association in 1D necessitates the self-consistent calculation of the orientational distribution function. To test the new theory, Monte Carlo simulations are performed and the theory is found to be accurate. It is also shown that the traditional treatment in first order perturbation theory fails to accurately describe this system. The theory developed in this paper may be used as a tool to study hydrogen bonding of molecules in 1D zeolites as well as the hydrogen bonding of molecules in carbon nanotubes.
Palaska, P; Aritzoglou, E; Girousi, S
2007-05-15
The interaction of cyclophosphamide (CP) with calf thymus double-stranded DNA (dsDNA) and thermally denatured single-stranded DNA (ssDNA) immobilized at the carbon paste (CPE) and pencil graphite electrodes (PGE), was studied electrochemically based on oxidation signals of guanine and adenine using differential pulse voltammetry (DPV). As a result of the interaction of CP with DNA, the voltammetric signals of guanine and adenine increased in the case of dsDNA while a slight increase was observed in ssDNA. The effect of experimental parameters such as the interaction time between CP and DNA forms and the concentration of CP, were studied using DPV with CPE and PGE. Additionally, reproducibility and detection limits were determined using both electrodes. A comparison of the analytical performance between CPE and PGE was done. Our results showed that these two different DNA biosensors could be used for the sensitive, rapid and cost effective detection of CP itself as well as of CP-DNA interaction. Furthermore, the interaction of CP with dsDNA and ssDNA was studied in solution and at the electrode surface by means of alternating current voltammetry (ACV) in 0.3M NaCl and 50mM sodium phosphate buffer (pH 8.5) supporting electrolyte, using a hanging mercury drop electrode (HMDE) as working electrode. The conclusions of this study were mainly based on tensammetric peaks I (at -1.183V) and II (-1.419V) of DNA. This study involved the interaction of CP with surface-confined and solution phase DNA where experimental parameters, such as the concentration of CP and the interaction time, were studied. By increasing the concentration of CP, an increase of peak II was observed in both ds and ssDNA, while an increase of peak I was observed only in the case of dsDNA. An overall conclusion of the study using HMDE was that the interaction of CP with surface-confined DNA significantly differed from that with solution phase DNA. The increase of peaks I and II was lower in the case of
Storing data encoded DNA in living organisms
Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA
2006-06-06
Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.
International Nuclear Information System (INIS)
Joos, H.
1976-07-01
The main topics of these lectures are: phenomenological approach to quark confinement, standard Lagrangian of hadrondynamics, Lagrangian field theory and quark confinement, classical soliton solutions in a simple model, quantization of extended systems, colour charge screening and quantization on a lattice and remarks on applications. A survey of the scientific publications listed according to the topics until 26 March 1976 is supplemented. (BJ) [de
Development of novel small molecules for imaging and drug release
Cao, Yanting
Small organic molecules, including small molecule based fluorescent probes, small molecule based drugs or prodrugs, and smart multifunctional fluorescent drug delivery systems play important roles in biological research, drug discovery, and clinical practices. Despite the significant progress made in these fields, the development of novel and diverse small molecules is needed to meet various demands for research and clinical applications. My Ph.D study focuses on the development of novel functional molecules for recognition, imaging and drug release. In the first part, a turn-on fluorescent probe is developed for the detection of intracellular adenosine-5'-triphosphate (ATP) levels based on multiplexing recognitions. Considering the unique and complicated structure of ATP molecules, a fluorescent probe has been implemented with improved sensitivity and selectivity due to two synergistic binding recognitions by incorporating of 2, 2'-dipicolylamine (Dpa)-Zn(II) for targeting of phospho anions and phenylboronic acid group for cis-diol moiety. The novel probe is able to detect intracellular ATP levels in SH-SY5Y cells. Meanwhile, the advantages of multiplexing recognition design concept have been demonstrated using two control molecules. In the second part, a prodrug system is developed to deliver multiple drugs within one small molecule entity. The prodrug is designed by using 1-(2-nitrophenyl)ethyl (NPE) as phototrigger, and biphenol biquaternary ammonium as the prodrug. With controlled photo activation, both DNA cross-linking agents mechlorethamine and o-quinone methide are delivered and released at the preferred site, leading to efficient DNA cross-links formation and cell death. The prodrug shows negligible cytotoxicity towards normal skin cells (Hekn cells) with and without UV activation, but displays potent activity towards cancer cells (HeLa cells) upon UV activation. The multiple drug release system may hold a great potential for practical application. In the
Single Molecule Detection in Living Biological Cells using Carbon Nanotube Optical Probes
Strano, Michael
2009-03-01
Nanoscale sensing elements offer promise for single molecule analyte detection in physically or biologically constrained environments. Molecular adsorption can be amplified via modulation of sharp singularities in the electronic density of states that arise from 1D quantum confinement [1]. Single-walled carbon nanotubes (SWNT), as single molecule optical sensors [2-3], offer unique advantages such as photostable near-infrared (n-IR) emission for prolonged detection through biological media, single-molecule sensitivity and, nearly orthogonal optical modes for signal transduction that can be used to identify distinct classes of analytes. Selective binding to the SWNT surface is difficult to engineer [4]. In this lecture, we will briefly review the immerging field of fluorescent diagnostics using band gap emission from SWNT. In recent work, we demonstrate that even a single pair of SWNT provides at least four optical modes that can be modulated to uniquely fingerprint chemical agents by the degree to which they alter either the emission band intensity or wavelength. We validate this identification method in vitro by demonstrating detection and identification of six genotoxic analytes, including chemotherapeutic drugs and reactive oxygen species (ROS), which are spectroscopically differentiated into four distinct classes. We also demonstrate single-molecule sensitivity in detecting hydrogen peroxide, one of the most common genotoxins and an important cellular signal. Finally, we employ our sensing and fingerprinting method of these analytes in real time within live 3T3 cells, demonstrating the first multiplexed optical detection from a nanoscale biosensor and the first label-free tool to optically discriminate between genotoxins. We will also discuss our recent efforts to fabricate biomedical sensors for real time detection of glucose and other important physiologically relevant analytes in-vivo. The response of embedded SWNT in a swellable hydrogel construct to
Single DNA imaging and length quantification through a mobile phone microscope
Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan
2016-03-01
The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.
Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.
Directory of Open Access Journals (Sweden)
Khondaker M Rahman
Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.
Energy Technology Data Exchange (ETDEWEB)
Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)
1999-02-01
DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)
Plasmid DNA Delivery: Nanotopography Matters.
Song, Hao; Yu, Meihua; Lu, Yao; Gu, Zhengying; Yang, Yannan; Zhang, Min; Fu, Jianye; Yu, Chengzhong
2017-12-20
Plasmid DNA molecules with unique loop structures have widespread bioapplications, in many cases relying heavily on delivery vehicles to introduce them into cells and achieve their functions. Herein, we demonstrate that control over delicate nanotopography of silica nanoparticles as plasmid DNA vectors has significant impact on the transfection efficacy. For silica nanoparticles with rambutan-, raspberry-, and flower-like morphologies composed of spike-, hemisphere-, and bowl-type subunit nanotopographies, respectively, the rambutan-like nanoparticles with spiky surfaces demonstrate the highest plasmid DNA binding capability and transfection efficacy of 88%, higher than those reported for silica-based nanovectors. Moreover, it is shown that the surface spikes of rambutan nanoparticles provide a continuous open space to bind DNA chains via multivalent interactions and protect the gene molecules sheltered in the spiky layer against nuclease degradation, exhibiting no significant transfection decay. This unique protection feature is in great contrast to a commercial transfection agent with similar transfection performance but poor protection capability against enzymatic cleavage. Our study provides new understandings in the rational design of nonviral vectors for efficient gene delivery.
Chernobyl new safe confinement
International Nuclear Information System (INIS)
Dodd, L.
2011-01-01
The author presents the new safe confinement that will be commissioned at Unit 4 of the Chernobyl NPP in 2015. The confinement will ensure that Chernobyl Unit 4 will be placed in an environmentally safe condition for at least next 100 years. The article highlights the current work status, future perspectives and the feasibility of confinement concept [ru
DNA Knots: Theory and Experiments
Sumners, D. W.
Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.
Twisting short dsDNA with applied tension
Zoli, Marco
2018-02-01
The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.
Synthesis and DNA-binding study of imidazole linked thiazolidinone derivatives.
War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi
2017-02-01
A novel series of imidazole-linked thiazolidinone hybrid molecules were designed and synthesized through a feasible synthetic protocol. The molecules were characterized with Fourier transform infrared (FT-IR), 1 H nuclear magnetic resonance (NMR), 13 C NMR and high-resolution mass spectrometry (HRMS) techniques. In vitro susceptibility tests against Gram-positive (S. aureus and B. subtilis) and Gram-negative bacteria (E. coli and P. aeruginosa) gave highly promising results. The most active molecule (3e) gave a minimal inhibitory concentration (MIC) value of 3.125 μg/mL which is on par with the reference drug streptomycin. Structure-activity relationships revealed activity enhancement by nitro and chloro groups when they occupied meta position of the arylidene ring in 2-((3-(imidazol-1-yl)propyl)amino)-5-benzylidenethiazolidin-4-ones. DNA-binding study of the most potent molecule 3e with salmon milt DNA (sm-DNA) under simulated physiological pH was probed with UV-visible absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. These studies established that compound 3e has a strong affinity towards DNA and binds at DNA minor groove with a binding constant (K b ) 0.18 × 10 2 L mol -1 . Molecular docking simulations predicted strong affinity of 3e towards DNA with a binding affinity (ΔG) -8.5 kcal/mol. Van der Waals forces, hydrogen bonding and hydrophobic interactions were predicted as the main forces of interaction. The molecule 3e exhibited specific affinity towards adenine-thiamine base pairs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D
2013-07-01
The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.
The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA
Directory of Open Access Journals (Sweden)
Lee Robert W
2009-03-01
Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this
International Nuclear Information System (INIS)
Reiter, G F; Deb, Aniruddha
2014-01-01
Neutron Compton scattering(NCS) measurements of the momentum distribution of light ions using the Vesuvio instrument at ISIS provide a sensitive local probe of the environment of those ions. NCS measurements of the proton momentum distribution in bulk water show only small deviations from the usual picture of water as a collection of molecules, with the protons covalently bonded to an oxygen and interacting weakly, primarily electrostatically, with nearby molecules. However, a series of measurements of the proton momentum distribution in carbon nanotubes, xerogel, and Nafion show that the proton delocalizes over distances of 0.2-0.3Å when water is confined on the scale of 20Å. This delocalization must be the result of changes in the Born-Oppenheimer surface for the protons, which would imply that there are large deviations in the electron distribution from that of a collection of weakly interacting molecules. This has been observed at Spring-8 using x-ray Compton scattering. The observed deviation in the valence electron momentum distribution from that of bulk water is more than an order of magnitude larger than the change observed in bulk water as the water is heated from just above melting to just below boiling. We conclude that the protons and electrons in nano-confined water are in a qualitatively different ground state from that of bulk water. Since the properties of this state persist at room temperature, and the confinement distance necessary to observe it is comparable to the distance between the elements of biological cells, this state presumably plays a role in the functioning of those cells
Chiral Molecule-Enhanced Extinction Ratios of Quantum Dots Coupled to Random Plasmonic Structures.
Bezen, Lior; Yochelis, Shira; Jayarathna, Dilhara; Bhunia, Dinesh; Achim, Catalina; Paltiel, Yossi
2018-03-06
Devices based on self-assembled hybrid colloidal quantum dots (CQDs) coupled with specific organic linker molecules are a promising way to simply realize room-temperature, spectrally tunable light detectors. Nevertheless, this type of devices usually has low quantum efficiency. Plasmonics has been shown as an efficient tool in guiding and confining light at nanoscale dimensions. As plasmonic modes exhibit highly confined fields, they locally increase light-matter interactions and consequently enhance the performance of CQD-based photodetectors. Recent publications presented experimental results of large extinction enhancement from a monolayer of CQDs coupled to random gold nanoislands using a monolayer of organic alkyl linkers. We report here that a twofold larger extinction enhancement in the visible spectrum is observed when a monolayer of helical chiral molecules connects the CQDs to the gold structure instead of a monolayer of achiral linkers. We also show that this effect provides insight into the chirality of the molecules within the monolayer. In future work, we plan to evaluate the potential of these results to be used in the construction of a more efficient and sensitive photon detector based on surface QDs, as well as to supply a simple way to map the chirality of a single chiral monolayer.
Confined detection volume of fluorescence correlation spectroscopy by bare fiber probes.
Lu, Guowei; Lei, Franck H; Angiboust, Jean-François; Manfait, Michel
2010-04-01
A fiber-tip-based near-field fluorescence correlation spectroscopy (FCS) has been developed for confining the detection volume to sub-diffraction-limited dimensions. This near-field FCS is based on near-field illumination by coupling a scanning near-field optical microscope (SNOM) to a conventional confocal FCS. Single-molecule FCS analysis at 100 nM Rhodamine 6G has been achieved by using bare chemically etched, tapered fiber tips. The detection volume under control of the SNOM system has been reduced over one order of magnitude compared to that of the conventional confocal FCS. Related factors influencing the near-field FCS performance are investigated and discussed in detail. In this proof-of-principle study, the preliminary experimental results suggest that the fiber-tip-based near-field FCS might be a good alternative to realize localized analysis at the single-molecule level.
The Incorporation of Ribonucleotides Induces Structural and Conformational Changes in DNA.
Meroni, Alice; Mentegari, Elisa; Crespan, Emmanuele; Muzi-Falconi, Marco; Lazzaro, Federico; Podestà, Alessandro
2017-10-03
Ribonucleotide incorporation is the most common error occurring during DNA replication. Cells have hence developed mechanisms to remove ribonucleotides from the genome and restore its integrity. Indeed, the persistence of ribonucleotides into DNA leads to severe consequences, such as genome instability and replication stress. Thus, it becomes important to understand the effects of ribonucleotides incorporation, starting from their impact on DNA structure and conformation. Here we present a systematic study of the effects of ribonucleotide incorporation into DNA molecules. We have developed, to our knowledge, a new method to efficiently synthesize long DNA molecules (hundreds of basepairs) containing ribonucleotides, which is based on a modified protocol for the polymerase chain reaction. By means of atomic force microscopy, we could therefore investigate the changes, upon ribonucleotide incorporation, of the structural and conformational properties of numerous DNA populations at the single-molecule level. Specifically, we characterized the scaling of the contour length with the number of basepairs and the scaling of the end-to-end distance with the curvilinear distance, the bending angle distribution, and the persistence length. Our results revealed that ribonucleotides affect DNA structure and conformation on scales that go well beyond the typical dimension of the single ribonucleotide. In particular, the presence of ribonucleotides induces a systematic shortening of the molecules, together with a decrease of the persistence length. Such structural changes are also likely to occur in vivo, where they could directly affect the downstream DNA transactions, as well as interfere with protein binding and recognition. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Impact of production systems on swine confinement buildings bioaerosols.
Létourneau, Valérie; Nehmé, Benjamin; Mériaux, Anne; Massé, Daniel; Duchaine, Caroline
2010-02-01
Hog production has been substantially intensified in Eastern Canada. Hogs are now fattened in swine confinement buildings with controlled ventilation systems and high animal densities. Newly designed buildings are equipped with conventional manure handling and management systems, shallow or deep litter systems, or source separation systems to manage the large volumes of waste. However, the impacts of those alternative production systems on bioaerosol concentrations within the barns have never been evaluated. Bioaerosols were characterized in 18 modern swine confinement buildings, and the differences in bioaerosol composition in the three different production systems were evaluated. Total dust, endotoxins, culturable actinomycetes, fungi, and bacteria were collected with various apparatuses. The total DNA of the air samples was extracted, and quantitative polymerase chain reaction (PCR) was used to assess the total number of bacterial genomes, as a total (culturable and nonculturable) bacterial assessment. The measured total dust and endotoxin concentrations were not statistically different in the three studied production systems. In buildings with sawdust beds, actinomycetes and molds were found in higher concentrations than in the conventional barns. Aspergillus, Cladosporium, Penicillium, and Scopulariopsis species were identified in all the studied swine confinement buildings. A. flavus, A. terreus, and A. versicolor were abundantly present in the facilities with sawdust beds. Thermotolerant A. fumigatus and Mucor were usually found in all the buildings. The culturable bacteria concentrations were higher in the barns with litters than in the conventional buildings, while real-time PCR revealed nonstatistically different concentrations of total bacteria in all the studied swine confinement buildings. In terms of workers' respiratory health, barns equipped with a solid/liquid separation system may offer better air quality than conventional buildings or barns with
DNA nanochannels [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Dianming Wang
2017-04-01
Full Text Available Transmembrane proteins are mostly nanochannels playing a highly important role in metabolism. Understanding their structures and functions is vital for revealing life processes. It is of fundamental interest to develop chemical devices to mimic biological channels. Structural DNA nanotechnology has been proven to be a promising method for the preparation of fine DNA nanochannels as a result of the excellent properties of DNA molecules. This review presents the development history and current situation of three different types of DNA nanochannel: tile-based nanotube, DNA origami nanochannel, and DNA bundle nanochannel.
Self-DNA inhibitory effects: Underlying mechanisms and ecological implications.
Cartenì, Fabrizio; Bonanomi, Giuliano; Giannino, Francesco; Incerti, Guido; Vincenot, Christian Ernest; Chiusano, Maria Luisa; Mazzoleni, Stefano
2016-01-01
DNA is usually known as the molecule that carries the instructions necessary for cell functioning and genetic inheritance. A recent discovery reported a new functional role for extracellular DNA. After fragmentation, either by natural or artificial decomposition, small DNA molecules (between ∼50 and ∼2000 bp) exert a species specific inhibitory effect on individuals of the same species. Evidence shows that such effect occurs for a wide range of organisms, suggesting a general biological process. In this paper we explore the possible molecular mechanisms behind those findings and discuss the ecological implications, specifically those related to plant species coexistence.
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution
Stellwagen, Nancy C.
2009-01-01
This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510