WorldWideScience

Sample records for dna molecules confined

  1. Fluorescence Microscopy of Nanochannel-Confined DNA.

    Science.gov (United States)

    Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

    2018-01-01

    Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

  2. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr

    2014-09-01

    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  3. DNA confinement in nanochannels: physics and biological applications

    DEFF Research Database (Denmark)

    Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H

    2012-01-01

    in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...

  4. Static and Dynamic Properties of DNA Confined in Nanochannels

    Science.gov (United States)

    Gupta, Damini

    Next-generation sequencing (NGS) techniques have considerably reduced the cost of high-throughput DNA sequencing. However, it is challenging to detect large-scale genomic variations by NGS due to short read lengths. Genome mapping can easily detect large-scale structural variations because it operates on extremely large intact molecules of DNA with adequate resolution. One of the promising methods of genome mapping is based on confining large DNA molecules inside a nanochannel whose cross-sectional dimensions are approximately 50 nm. Even though this genome mapping technology has been commercialized, the current understanding of the polymer physics of DNA in nanochannel confinement is based on theories and lacks much needed experimental support. The results of this dissertation are aimed at providing a detailed experimental understanding of equilibrium properties of nanochannel-confined DNA molecules. The results are divided into three parts. In first part, we evaluate the role of channel shape on thermodynamic properties of channel confined DNA molecules using a combination of fluorescence microscopy and simulations. Specifically, we show that high aspect ratio of rectangular channels significantly alters the chain statistics as compared to an equivalent square channel with same cross-sectional area. In the second part, we present experimental evidence that weak excluded volume effects arise in DNA nanochannel confinement, which form the physical basis for the extended de Gennes regime. We also show how confinement spectroscopy and simulations can be combined to reduce molecular weight dispersity effects arising from shearing, photo-cleavage, and nonuniform staining of DNA. Finally, the third part of the thesis concerns the dynamic properties of nanochannel confined DNA. We directly measure the center-of-mass diffusivity of single DNA molecules in confinement and show that that it is necessary to modify the classical results of de Gennes to account for local chain

  5. Counterion effects on nano-confined metal–drug–DNA complexes

    Directory of Open Access Journals (Sweden)

    Nupur Biswas

    2016-01-01

    Full Text Available We have explored morphology of DNA molecules bound with Cu complexes of piroxicam (a non-steroidal anti-inflammatory drug molecules under one-dimensional confinement of thin films and have studied the effect of counterions present in a buffer. X-ray reflectivity at and away from the Cu K absorption edge and atomic force microscopy studies reveal that confinement segregates the drug molecules preferentially in a top layer of the DNA film, and counterions enhance this segregation.

  6. Structure and spectra of a confined HeH molecule

    International Nuclear Information System (INIS)

    Lo, J M H; Klobukowski, M; Bielinska-Wacz, D; Schreiner, E W S; Diercksen, G H F

    2006-01-01

    The influence of spatial confinement on the structure and spectra of the Rydberg HeH molecule is analysed at the level of the variational full configuration interaction approach. The confining potential is assumed to have cylindrical symmetry, with the symmetry axis of the potential overlapping with the molecular bond. In the direction perpendicular to the axis quadratic dependence of the potential on the electron coordinates is assumed. The influence of the confining potential on the form of the potential energy curves (in particular on the bond lengths), on the electronic spectra and on the ionization due to the confinement is studied in detail

  7. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  8. Crowded, Confined, and Frustrated: Dynamics of Molecules Tethered to Nanoparticles

    KAUST Repository

    Agarwal, Praveen

    2012-12-01

    Above a critical chemistry-dependent molecular weight, all polymer molecules entangle and, as a result, exhibit slow dynamics, enhanced viscosity, and elasticity. Herein we report on the dynamics of low molecular weight polymers tethered to nanoparticles and find that even conventionally unentangled chains manifest dynamical features similar to entangled, long-chain molecules. Our findings are shown to imply that crowding and confinement of polymers on particles produce topological constraints analogous to those in entangled systems. © 2012 American Physical Society.

  9. Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.

    Science.gov (United States)

    Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin

    2013-06-20

    When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.

  10. Effects of confinement on the Rydberg molecule NeH

    International Nuclear Information System (INIS)

    Lo, J M H; Klobukowski, M; Bielinska-Waz, D; Diercksen, G H F; Schreiner, E W S

    2005-01-01

    Ab initio potential energy curves of the Rydberg NeH molecule in the presence of cylindrical spatial confinement were computed by the method of multi-reference configuration interaction with extended basis sets. The influence of the applied potential to the structures and spectra of the ground and excited states of NeH was analysed in terms of perturbation theory. In addition, the phenomenon of field-induced ionization was discussed

  11. Surface-confined electroactive molecules for multistate charge storage information.

    Science.gov (United States)

    Mas-Torrent, M; Rovira, C; Veciana, J

    2013-01-18

    Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.

  12. Rovibrational states of Wigner molecules in spherically symmetric confining potentials

    Energy Technology Data Exchange (ETDEWEB)

    Cioslowski, Jerzy [Institute of Physics, University of Szczecin, Wielkopolska 15, 70-451 Szczecin, Poland and Max-Planck-Institut für Physik komplexer Systeme, Nöthnitzer Str. 38, D-01187 Dresden (Germany)

    2016-08-07

    The strong-localization limit of three-dimensional Wigner molecules, in which repulsively interacting particles are confined by a weak spherically symmetric potential, is investigated. An explicit prescription for computation of rovibrational wavefunctions and energies that are asymptotically exact at this limit is presented. The prescription is valid for systems with arbitrary angularly-independent interparticle and confining potentials, including those involving Coulombic and screened (i.e., Yukawa/Debye) interactions. The necessary derivations are greatly simplified by explicit constructions of the Eckart frame and the parity-adapted primitive wavefunctions. The performance of the new formalism is illustrated with the three- and four-electron harmonium atoms at their strong-correlation limits. In particular, the involvement of vibrational modes with the E symmetry is readily pinpointed as the origin of the “anomalous” weak-confinement behavior of the {sup 1}S{sub +} state of the four-electron species that is absent in its {sup 1}D{sub +} companion of the strong-confinement regime.

  13. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  14. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  15. Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.

    Science.gov (United States)

    Cao, Chan; Long, Yi-Tao

    2018-02-20

    Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis

  16. Quantum confinement in hydrogen bond of DNA and RNA

    International Nuclear Information System (INIS)

    Dos Santos, C S; Filho, E Drigo; Ricotta, R M

    2015-01-01

    The hydrogen bond is a fundamental ingredient to stabilize the DNA and RNA macromolecules. The main contribution of this work is to describe quantitatively this interaction as a consequence of the quantum confinement of the hydrogen. The results for the free and confined system are compared with experimental data. The formalism to compute the energy gap of the vibration motion used to identify the spectrum lines is the Variational Method allied to Supersymmetric Quantum Mechanics. (papert)

  17. Single-Molecule Sensing with Nanopore Confinement: from Chemical Reactions to Biological Interactions.

    Science.gov (United States)

    Lin, Yao; Ying, Yi-Lun; Gao, Rui; Long, Yi-Tao

    2018-03-25

    The nanopore can generate an electrochemical confinement for single-molecule sensing which help understand the fundamental chemical principle in nanoscale dimensions. By observing the generated ionic current, individual bond-making and bond-breaking steps, single biomolecule dynamic conformational changes and electron transfer processes that occur within pore can be monitored with high temporal and current resolution. These single-molecule studies in nanopore confinement are revealing information about the fundamental chemical and biological processes that cannot be extracted from ensemble measurements. In this concept, we introduce and discuss the electrochemical confinement effects on single-molecule covalent reactions, conformational dynamics of individual molecules and host-guest interactions in protein nanopores. Then, we extend the concept of nanopore confinement effects to confine electrochemical redox reactions in solid-state nanopores for developing new sensing mechanisms. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  19. From stripe to slab confinement for DNA linearization in nanochannels

    Science.gov (United States)

    Cifra, Peter; Benkova, Zuzana; Namer, Pavol

    We investigate suggested advantageous analysis in the linearization experiments with macromolecules confined in a stripe-like channel using Monte Carlo simulations. The enhanced chain extension in a stripe that is due to significant excluded volume interactions between monomers in two dimensions weakens on transition to experimentally feasible slit-like channel. Based on the chain extension-confinement strength dependence and the structure factor behavior for the chain in stripe we infer the excluded volume regime typical for two-dimensional systems. On transition to the slab geometry, the advantageous chain extension decreases and the Gaussian regime is observed for not very long semiflexible chains. The evidence for pseudo-ideality in confined chains is based on indicators such as the extension curves, variation of the extension with the persistence length or the structure factor. The slab behavior is observed when the stripe (originally of monomer thickness) reaches the thickness larger than cca 10nm in the third dimension. This maximum height of the slab to retain the advantage of the stripe is very low and this have implication for DNA linearization experiments. The presented analysis, however, has a broader relevance for confined polymers. Support from Slovak R&D Agency (SRDA-0451-11) is acknowledged.

  20. Crowded, Confined, and Frustrated: Dynamics of Molecules Tethered to Nanoparticles

    KAUST Repository

    Agarwal, Praveen; Kim, Sung A.; Archer, Lynden A.

    2012-01-01

    Above a critical chemistry-dependent molecular weight, all polymer molecules entangle and, as a result, exhibit slow dynamics, enhanced viscosity, and elasticity. Herein we report on the dynamics of low molecular weight polymers tethered

  1. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  2. Physics of Polymers under Nanoscopic Confinement: a Single Molecule Study

    NARCIS (Netherlands)

    Keshavarz, M.

    2016-01-01

    Physicist Masoumeh Keshavarz studied the thermal motion of a fluorescently labelled, individual “reporter” polymer molecule, surrounded and entangled by a gel of similar but unlabelled polymers. Owing to their extreme length and stiffness, it is possible to follow the shape and the motion of the

  3. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  4. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  5. Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl

    Science.gov (United States)

    Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.

    2018-02-01

    Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.

  6. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  7. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  8. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  9. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  10. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  11. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  12. Single molecule tracking fluorescence microscopy in mitochondria reveals highly dynamic but confined movement of Tom40

    Science.gov (United States)

    Kuzmenko, Anton; Tankov, Stoyan; English, Brian P.; Tarassov, Ivan; Tenson, Tanel; Kamenski, Piotr; Elf, Johan; Hauryliuk, Vasili

    2011-12-01

    Tom40 is an integral protein of the mitochondrial outer membrane, which as the central component of the Translocase of the Outer Membrane (TOM) complex forms a channel for protein import. We characterize the diffusion properties of individual Tom40 molecules fused to the photoconvertable fluorescent protein Dendra2 with millisecond temporal resolution. By imaging individual Tom40 molecules in intact isolated yeast mitochondria using photoactivated localization microscopy with sub-diffraction limited spatial precision, we demonstrate that Tom40 movement in the outer mitochondrial membrane is highly dynamic but confined in nature, suggesting anchoring of the TOM complex as a whole.

  13. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  14. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  15. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  16. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  17. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  18. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  19. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  20. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  1. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  2. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  3. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  4. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  5. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  6. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  7. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  8. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  9. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  10. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  11. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  12. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  13. NMR relaxation dispersion of Miglyol molecules confined inside polymeric micro-capsules.

    Science.gov (United States)

    Nechifor, Ruben; Ardelean, Ioan; Mattea, Carlos; Stapf, Siegfried; Bogdan, Mircea

    2011-11-01

    Frequency dependent NMR relaxation studies have been carried out on Miglyol molecules confined inside core shell polymeric capsules to obtain a correlation between capsule dimension and the measurable parameters. The polymeric capsules were prepared using an interfacial polymerization technique for three different concentrations of Miglyol. It was shown that the variation of Miglyol concentration influences the capsule dimension. Their average size was estimated using the pulsed field gradient diffusometry technique. The relaxation dispersion curves were obtained at room temperature by a combined use of a fast field cycling instrument and a high-field instrument. The frequency dependence of relaxation rate shows a transition from a diffusion-limited to a surface-limited relaxation regime. Copyright © 2011 John Wiley & Sons, Ltd.

  14. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  15. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  16. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  17. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  18. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  19. Tracking Single DNA Nanodevices in Hierarchically Meso-Macroporous Antimony-Doped Tin Oxide Demonstrates Finite Confinement.

    Science.gov (United States)

    Mieritz, Daniel; Li, Xiang; Volosin, Alex; Liu, Minghui; Yan, Hao; Walter, Nils G; Seo, Dong-Kyun

    2017-06-27

    Housing bio-nano guest devices based on DNA nanostructures within porous, conducting, inorganic host materials promise valuable applications in solar energy conversion, chemical catalysis, and analyte sensing. Herein, we report a single-template synthetic development of hierarchically porous, transparent conductive metal oxide coatings whose pores are freely accessible by large biomacromolecules. Their hierarchal pore structure is bimodal with a larger number of closely packed open macropores (∼200 nm) at the higher rank and with the remaining space being filled with a gel network of antimony-doped tin oxide (ATO) nanoparticles that is highly porous with a broad size range of textual pores mainly from 20-100 nm at the lower rank. The employed carbon black template not only creates the large open macropores but also retains the highly structured gel network as holey pore walls. Single molecule fluorescence microscopic studies with fluorophore-labeled DNA nanotweezers reveal a detailed view of multimodal diffusion dynamics of the biomacromolecules inside the hierarchically porous structure. Two diffusion constants were parsed from trajectory analyses that were attributed to free diffusion (diffusion constant D = 2.2 μm 2 /s) and to diffusion within an average confinement length of 210 nm (D = 0.12 μm 2 /s), consistent with the average macropore size of the coating. Despite its holey nature, the ATO gel network acts as an efficient barrier to the diffusion of the DNA nanostructures, which is strongly indicative of physical interactions between the molecules and the pore nanostructure.

  20. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. The structure of nematic model of liquid crystal with cylindrical and ellipsoidal molecules confined in between walls

    Directory of Open Access Journals (Sweden)

    M. Moradi

    2004-12-01

    Full Text Available   The density functional theory analogue of Percus Yevick (PY and Hyper-Netted chain (HNC has been used to write the grand potential of a liquid with cylindrical and ellipsoidal molecules. The integral equations for the density can be obtained by minimizing the grand potential with respect to the density. Some kinds of liquid crystals, can have the cylindrical or ellipsoidal rigid molecules. In this study we have calculated the density profile of this kind of liquids confined between hard walls and we compared the results. As it is seen from the graphs of the density profiles the molecules can be arranged as layers with respect to the walls.

  2. Structure and phase behavior of a confined nanodroplet composed of the flexible chain molecules.

    Science.gov (United States)

    Kim, Soon-Chul; Kim, Eun-Young; Seong, Baek-Seok

    2011-04-28

    A polymer density functional theory has been employed for investigating the structure and phase behaviors of the chain polymer, which is modelled as the tangentially connected sphere chain with an attractive interaction, inside the nanosized pores. The excess free energy of the chain polymer has been approximated as the modified fundamental measure-theory for the hard spheres, the Wertheim's first-order perturbation for the chain connectivity, and the mean-field approximation for the van der Waals contribution. For the value of the chemical potential corresponding to a stable liquid phase in the bulk system and a metastable vapor phase, the flexible chain molecules undergo the liquid-vapor transition as the pore size is reduced; the vapor is the stable phase at small volume, whereas the liquid is the stable phase at large volume. The wide liquid-vapor coexistence curve, which explains the wide range of metastable liquid-vapor states, is observed at low temperature. The increase of temperature and decrease of pore size result in a narrowing of liquid-vapor coexistence curves. The increase of chain length leads to a shift of the liquid-vapor coexistence curve towards lower values of chemical potential. The coexistence curves for the confined phase diagram are contained within the corresponding bulk liquid-vapor coexistence curve. The equilibrium capillary phase transition occurs at a higher chemical potential than in the bulk phase.

  3. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  4. Confined Catalysis in the g-C3N4/Pt(111) Interface: Feasible Molecule Intercalation, Tunable Molecule-Metal Interaction, and Enhanced Reaction Activity of CO Oxidation.

    Science.gov (United States)

    Wang, Shujiao; Feng, Yingxin; Yu, Ming'an; Wan, Qiang; Lin, Sen

    2017-09-27

    The deposition of a two-dimensional (2D) atomic nanosheet on a metal surface has been considered as a new route for tuning the molecule-metal interaction and surface reactivity in terms of the confinement effect. In this work, we use first-principles calculations to systematically explore a novel nanospace constructed by placing a 2D graphitic carbon nitride (g-C 3 N 4 ) nanosheet over a Pt(111) surface. The confined catalytic activity in this nanospace is investigated using CO oxidation as a model reaction. With the inherent triangular pores in the g-C 3 N 4 overlayer being taken advantage of, molecules such as CO and O 2 can diffuse to adsorb on the Pt(111) surface underneath the g-C 3 N 4 overlayer. Moreover, the mechanism of intercalation is also elucidated, and the results reveal that the energy barrier depends mainly on the properties of the molecule and the channel. Importantly, the molecule-catalyst interaction can be tuned by the g-C 3 N 4 overlayer, considerably reducing the adsorption energy of CO on Pt(111) and leading to enhanced reactivity in CO oxidation. This work will provide important insight for constructing a promising nanoreactor in which the following is observed: The molecule intercalation is facile; the molecule-metal interaction is efficiently tuned; the metal-catalyzed reaction is promoted.

  5. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  6. The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties

    International Nuclear Information System (INIS)

    Kozłowska, Justyna; Bartkowiak, Wojciech

    2014-01-01

    Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule

  7. The effect of spatial confinement on the noble-gas HArF molecule: structure and electric properties

    Energy Technology Data Exchange (ETDEWEB)

    Kozłowska, Justyna; Bartkowiak, Wojciech, E-mail: wojciech.bartkowiak@pwr.edu.pl

    2014-09-30

    Highlights: • The structure and electrical properties of HArF in spatial confinement are analyzed. • Orbital compression leads to decrease of bond lengths in the HArF molecule. • Spatial restriction causes a drop of the molecular (hyper)polarizabilities. • Spatial confinement reduces the electron correlation contribution to μ, α and β. - Abstract: A systematic study on the dipole moment and (hyper)polarizabilities of argon fluorohydride under spatial restriction was performed. Detailed analysis of the confinement induced changes in the structure of HArF is also presented. In order to render the influence of chemical compression on the properties in question a two-dimensional harmonic oscillator potential, mimicking a cylindrical confinement, was applied. Through the comparison of the results obtained for HArF with those of HF the effect of Ar insertion on the above properties was discussed. A hierarchy of ab initio methods including HF, MP2, CCSD and CCSD(T), has been employed to investigate the effect of orbital compression on the electron correlation contribution to the studied electric properties. It was observed that the external confining potential modifies the electronic contributions to the dipole moment and (hyper)polarizabilities of HArF. In particular, the first hyperpolarizability of HArF is remarkably smaller than that of the unconfined HArF molecule.

  8. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  9. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  10. Positive cell-free fetal DNA testing for trisomy 13 reveals confined placental mosaicism.

    Science.gov (United States)

    Hall, April L; Drendel, Holli M; Verbrugge, Jennifer L; Reese, Angela M; Schumacher, Katherine L; Griffith, Christopher B; Weaver, David D; Abernathy, Mary P; Litton, Christian G; Vance, Gail H

    2013-09-01

    We report on a case in which cell-free fetal DNA was positive for trisomy 13 most likely due to confined placental mosaicism. Cell-free fetal DNA testing analyzes DNA derived from placental trophoblast cells and can lead to incorrect results that are not representative of the fetus. We sought to confirm commercial cell-free fetal DNA testing results by chorionic villus sampling and amniocentesis. These results were followed up by postnatal chromosome analysis of cord blood and placental tissue. First-trimester cell-free fetal DNA test results were positive for trisomy 13. Cytogenetic analysis of chorionic villus sampling yielded a mosaic karyotype of 47,XY,+13[10]/46,XY[12]. G-banded analysis of amniotic fluid was normal, 46,XY. Postnatal cytogenetic analysis of cord blood was normal. Karyotyping of tissues from four quadrants of the placenta demonstrated mosaicism for trisomy 13 in two of the quadrants and a normal karyotype in the other two. Our case illustrates several important aspects of this new testing methodology: that cell-free fetal DNA may not be representative of the fetal karyotype; that follow-up with diagnostic testing of chorionic villus sampling and/or amniotic fluid for abnormal test results should be performed; and that pretest counseling regarding the full benefits, limitations, and possible testing outcomes of cell-free fetal DNA screening is important.

  11. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  12. Compressing a confined DNA: from nano-channel to nano-cavity

    Science.gov (United States)

    Sakaue, Takahiro

    2018-06-01

    We analyze the behavior of a semiflexible polymer confined in nanochannel under compression in axial direction. Key to our discussion is the identification of two length scales; the correlation length ξ of concentration fluctuation and what we call the segregation length . These length scales, while degenerate in uncompressed state in nanochannel, generally split as upon compression, and the way they compete with the system size during the compression determines the crossover from quasi-1D nanochannel to quasi-0D nanocavity behaviors. For a flexible polymer, the story becomes very simple, which corresponds to a special limit of our description, but a much richer behavior is expected for a semiflexible polymer relevant to DNA in confined spaces. We also briefly discuss the dynamical properties of the compressed polymer.

  13. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  14. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  15. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  16. Studying DNA Looping by Single-Molecule FRET

    OpenAIRE

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  17. Knotting dynamics of DNA chains of different length confined in nanochannels

    International Nuclear Information System (INIS)

    Suma, Antonio; Micheletti, Cristian; Orlandini, Enzo

    2015-01-01

    Langevin dynamics simulations are used to characterize the typical mechanisms governing the spontaneous tying, untying and the dynamical evolution of knots in coarse-grained models of DNA chains confined in nanochannels. In particular we focus on how these mechanisms depend on the chain contour length, L c , at a fixed channel width D = 56 nm corresponding to the onset of the Odijk scaling regime where chain backfoldings and hence knots are disfavoured but not suppressed altogether. We find that the lifetime of knots grows significantly with L c , while that of unknots varies to a lesser extent. The underlying kinetic mechanisms are clarified by analysing the evolution of the knot position along the chain. At the considered confinement, in fact, knots are typically tied by local backfoldings of the chain termini where they are eventually untied after a stochastic motion along the chain. Consequently, the lifetime of unknots is mostly controlled by backfoldings events at the chain ends, which is largely independent of L c . The lifetime of knots, instead, increases significantly with L c because knots can, on average, travel farther along the chain before being untied. The observed interplay of knots and unknots lifetimes underpins the growth of the equilibrium knotting probability of longer and longer chains at fixed channel confinement. (paper)

  18. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  19. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  20. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

    2014-01-01

    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  1. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  2. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    Science.gov (United States)

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  4. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    OpenAIRE

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  5. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  6. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  7. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  8. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  9. Building superlattices from individual nanoparticles via template-confined DNA-mediated assembly

    Science.gov (United States)

    Lin, Qing-Yuan; Mason, Jarad A.; Li, Zhongyang; Zhou, Wenjie; O’Brien, Matthew N.; Brown, Keith A.; Jones, Matthew R.; Butun, Serkan; Lee, Byeongdu; Dravid, Vinayak P.; Aydin, Koray; Mirkin, Chad A.

    2018-02-01

    DNA programmable assembly has been combined with top-down lithography to construct superlattices of discrete, reconfigurable nanoparticle architectures on a gold surface over large areas. Specifically, the assembly of individual colloidal plasmonic nanoparticles with different shapes and sizes is controlled by oligonucleotides containing “locked” nucleic acids and confined environments provided by polymer pores to yield oriented architectures that feature tunable arrangements and independently controllable distances at both nanometer- and micrometer-length scales. These structures, which would be difficult to construct by other common assembly methods, provide a platform to systematically study and control light-matter interactions in nanoparticle-based optical materials. The generality and potential of this approach are explored by identifying a broadband absorber with a solvent polarity response that allows dynamic tuning of visible light absorption.

  10. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  11. Coherent confinement of plasmonic field in quantum dot-metallic nanoparticle molecules.

    Science.gov (United States)

    Sadeghi, S M; Hatef, A; Fortin-Deschenes, Simon; Meunier, Michel

    2013-05-24

    Interaction of a hybrid system consisting of a semiconductor quantum dot and a metallic nanoparticle (MNP) with a laser beam can replace the intrinsic plasmonic field of the MNP with a coherently normalized field (coherent-plasmonic or CP field). In this paper we show how quantum coherence effects in such a hybrid system can form a coherent barrier (quantum cage) that spatially confines the CP field. This allows us to coherently control the modal volume of this field, making it significantly smaller or larger than that of the intrinsic plasmonic field of the MNP. We investigate the spatial profiles of the CP field and discuss how the field barrier depends on the collective states of the hybrid system.

  12. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  13. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

    2016-01-01

    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  14. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Science.gov (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  15. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    Science.gov (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  16. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  17. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  18. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  19. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  20. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  1. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura

    2016-10-01

    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  2. A Programmable DNA Origami Platform for Organizing Intrinsically Disordered Nucleoporins within Nanopore Confinement.

    Science.gov (United States)

    Fisher, Patrick D Ellis; Shen, Qi; Akpinar, Bernice; Davis, Luke K; Chung, Kenny Kwok Hin; Baddeley, David; Šarić, Anđela; Melia, Thomas J; Hoogenboom, Bart W; Lin, Chenxiang; Lusk, C Patrick

    2018-02-27

    Nuclear pore complexes (NPCs) form gateways that control molecular exchange between the nucleus and the cytoplasm. They impose a diffusion barrier to macromolecules and enable the selective transport of nuclear transport receptors with bound cargo. The underlying mechanisms that establish these permeability properties remain to be fully elucidated but require unstructured nuclear pore proteins rich in Phe-Gly (FG)-repeat domains of different types, such as FxFG and GLFG. While physical modeling and in vitro approaches have provided a framework for explaining how the FG network contributes to the barrier and transport properties of the NPC, it remains unknown whether the number and/or the spatial positioning of different FG-domains along a cylindrical, ∼40 nm diameter transport channel contributes to their collective properties and function. To begin to answer these questions, we have used DNA origami to build a cylinder that mimics the dimensions of the central transport channel and can house a specified number of FG-domains at specific positions with easily tunable design parameters, such as grafting density and topology. We find the overall morphology of the FG-domain assemblies to be dependent on their chemical composition, determined by the type and density of FG-repeat, and on their architectural confinement provided by the DNA cylinder, largely consistent with here presented molecular dynamics simulations based on a coarse-grained polymer model. In addition, high-speed atomic force microscopy reveals local and reversible FG-domain condensation that transiently occludes the lumen of the DNA central channel mimics, suggestive of how the NPC might establish its permeability properties.

  3. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  4. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  5. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  6. Supramolecular 1-D polymerization of DNA origami through a dynamic process at the 2-dimensionally confined air-water interface.

    Science.gov (United States)

    Yonamine, Yusuke; Cervantes-Salguero, Keitel; Minami, Kosuke; Kawamata, Ibuki; Nakanishi, Waka; Hill, Jonathan P; Murata, Satoshi; Ariga, Katsuhiko

    2016-05-14

    In this study, a Langmuir-Blodgett (LB) system has been utilized for the regulation of polymerization of a DNA origami structure at the air-water interface as a two-dimensionally confined medium, which enables dynamic condensation of DNA origami units through variation of the film area at the macroscopic level (ca. 10-100 cm(2)). DNA origami sheets were conjugated with a cationic lipid (dioctadecyldimethylammonium bromide, 2C18N(+)) by electrostatic interaction and the corresponding LB-film was prepared. By applying dynamic pressure variation through compression-expansion processes, the lipid-modified DNA origami sheets underwent anisotropic polymerization forming a one-dimensionally assembled belt-shaped structure of a high aspect ratio although the thickness of the polymerized DNA origami was maintained at the unimolecular level. This approach opens up a new field of mechanical induction of the self-assembly of DNA origami structures.

  7. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  8. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  9. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  10. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

    1979-01-01

    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  11. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

    2012-01-01

    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  12. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  13. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  14. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  15. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  16. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

    2008-01-01

    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  17. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    Science.gov (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  18. Endohedral confinement of a DNA dodecamer onto pristine carbon nanotubes and the stability of the canonical B form

    International Nuclear Information System (INIS)

    Cruz, Fernando J. A. L.; Pablo, Juan J. de; Mota, José P. B.

    2014-01-01

    Although carbon nanotubes are potential candidates for DNA encapsulation and subsequent delivery of biological payloads to living cells, the thermodynamical spontaneity of DNA encapsulation under physiological conditions is still a matter of debate. Using enhanced sampling techniques, we show for the first time that, given a sufficiently large carbon nanotube, the confinement of a double-stranded DNA segment, 5′-D( * CP * GP * CP * GP * AP * AP * TP * TP * CP * GP * CP * G)-3′, is thermodynamically favourable under physiological environments (134 mM, 310 K, 1 bar), leading to DNA-nanotube hybrids with lower free energy than the unconfined biomolecule. A diameter threshold of 3 nm is established below which encapsulation is inhibited. The confined DNA segment maintains its translational mobility and exhibits the main geometrical features of the canonical B form. To accommodate itself within the nanopore, the DNA's end-to-end length increases from 3.85 nm up to approximately 4.1 nm, due to a ∼0.3 nm elastic expansion of the strand termini. The canonical Watson-Crick H-bond network is essentially conserved throughout encapsulation, showing that the contact between the DNA segment and the hydrophobic carbon walls results in minor rearrangements of the nucleotides H-bonding. The results obtained here are paramount to the usage of carbon nanotubes as encapsulation media for next generation drug delivery technologies

  19. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  20. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  1. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Science.gov (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

    Science.gov (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  3. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  4. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  5. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

    1978-01-01

    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  6. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)

    2012-07-27

    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  7. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria

    2012-01-01

    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  8. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  9. THz–IR spectroscopy of single H.sub.2./sub.O molecules confined in nanocage of beryl crystal lattice

    Czech Academy of Sciences Publication Activity Database

    Gorshunov, B. P.; Zhukova, E.S.; Torgashev, V. I.; Motovilova, E.A.; Lebedev, V.V.; Prokhorov, A. S.; Shakurov, G.S.; Kremer, R. K.; Uskov, V.V.; Pestrjakov, E.V.; Thomas, V.G.; Fursenko, D.A.; Kadlec, Christelle; Kadlec, Filip; Dressel, M.

    2014-01-01

    Roč. 87, 10-11 (2014), s. 966-972 ISSN 0141-1594 R&D Projects: GA ČR(CZ) GA14-25639S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * nano-confined water molecule Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.954, year: 2014

  10. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  11. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.

    2013-01-01

    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  12. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  13. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    Science.gov (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  15. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    OpenAIRE

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  16. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  17. Endohedral confinement of a DNA dodecamer onto pristine carbon nanotubes and the stability of the canonical B form

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, Fernando J. A. L., E-mail: fj.cruz@fct.unl.pt [Requimte/CQFB, Departamento de Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica 2829-516 (Portugal); Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States); Pablo, Juan J. de [Department of Chemical and Biological Engineering, University of Wisconsin-Madison, Madison, Wisconsin 53706 (United States); Institute of Molecular Engineering, University of Chicago, Chicago, Illinois 60637 (United States); Mota, José P. B. [Requimte/CQFB, Departamento de Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica 2829-516 (Portugal)

    2014-06-14

    Although carbon nanotubes are potential candidates for DNA encapsulation and subsequent delivery of biological payloads to living cells, the thermodynamical spontaneity of DNA encapsulation under physiological conditions is still a matter of debate. Using enhanced sampling techniques, we show for the first time that, given a sufficiently large carbon nanotube, the confinement of a double-stranded DNA segment, 5′-D({sup *}CP{sup *}GP{sup *}CP{sup *}GP{sup *}AP{sup *}AP{sup *}TP{sup *}TP{sup *}CP{sup *}GP{sup *}CP{sup *}G)-3′, is thermodynamically favourable under physiological environments (134 mM, 310 K, 1 bar), leading to DNA-nanotube hybrids with lower free energy than the unconfined biomolecule. A diameter threshold of 3 nm is established below which encapsulation is inhibited. The confined DNA segment maintains its translational mobility and exhibits the main geometrical features of the canonical B form. To accommodate itself within the nanopore, the DNA's end-to-end length increases from 3.85 nm up to approximately 4.1 nm, due to a ∼0.3 nm elastic expansion of the strand termini. The canonical Watson-Crick H-bond network is essentially conserved throughout encapsulation, showing that the contact between the DNA segment and the hydrophobic carbon walls results in minor rearrangements of the nucleotides H-bonding. The results obtained here are paramount to the usage of carbon nanotubes as encapsulation media for next generation drug delivery technologies.

  18. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  19. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  20. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  1. Nanoconfinement-enhanced conformational response of single DNA molecules to changes in ionic environment

    DEFF Research Database (Denmark)

    Reisner, Walter; Beech, J. P.; Larsen, Niels Bent

    2007-01-01

    100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....

  2. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

    2016-01-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  3. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  4. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  5. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  6. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  7. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  8. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  9. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  10. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  12. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  13. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  14. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    Science.gov (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  15. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  16. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  17. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  18. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  19. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  20. Theoretical Analysis of the Relative Significance of Thermodynamic and Kinetic Dispersion in the dc and ac Voltammetry of Surface-Confined Molecules

    KAUST Repository

    Morris, Graham P.; Baker, Ruth E.; Gillow, Kathryn; Davis, Jason J.; Gavaghan, David J.; Bond, Alan M.

    2015-01-01

    © 2015 American Chemical Society. Commonly, significant discrepancies are reported in theoretical and experimental comparisons of dc voltammograms derived from a monolayer or close to monolayer coverage of redox-active surface-confined molecules. For example, broader-than-predicted voltammetric wave shapes are attributed to the thermodynamic or kinetic dispersion derived from distributions in reversible potentials (E0) and electrode kinetics (k0), respectively. The recent availability of experimentally estimated distributions of E0 and k0 values derived from the analysis of data for small numbers of surface-confined modified azurin metalloprotein molecules now allows more realistic modeling to be undertaken, assuming the same distributions apply under conditions of high surface coverage relevant to voltammetric experiments. In this work, modeling based on conventional and stochastic kinetic theory is considered, and the computationally far more efficient conventional model is shown to be equivalent to the stochastic one when large numbers of molecules are present. Perhaps unexpectedly, when experimentally determined distributions of E0 and k0 are input into the model, thermodynamic dispersion is found to be unimportant and only kinetic dispersion contributes significantly to the broadening of dc voltammograms. Simulations of ac voltammetric experiments lead to the conclusion that the ac method, particularly when the analysis of kinetically very sensitive higher-order harmonics is undertaken, are far more sensitive to kinetic dispersion than the dc method. ac methods are therefore concluded to provide a potentially superior strategy for addressing the inverse problem of determining the k0 distribution that could give rise to the apparent anomalies in surface-confined voltammetry.

  1. Theoretical Analysis of the Relative Significance of Thermodynamic and Kinetic Dispersion in the dc and ac Voltammetry of Surface-Confined Molecules

    KAUST Repository

    Morris, Graham P.

    2015-05-05

    © 2015 American Chemical Society. Commonly, significant discrepancies are reported in theoretical and experimental comparisons of dc voltammograms derived from a monolayer or close to monolayer coverage of redox-active surface-confined molecules. For example, broader-than-predicted voltammetric wave shapes are attributed to the thermodynamic or kinetic dispersion derived from distributions in reversible potentials (E0) and electrode kinetics (k0), respectively. The recent availability of experimentally estimated distributions of E0 and k0 values derived from the analysis of data for small numbers of surface-confined modified azurin metalloprotein molecules now allows more realistic modeling to be undertaken, assuming the same distributions apply under conditions of high surface coverage relevant to voltammetric experiments. In this work, modeling based on conventional and stochastic kinetic theory is considered, and the computationally far more efficient conventional model is shown to be equivalent to the stochastic one when large numbers of molecules are present. Perhaps unexpectedly, when experimentally determined distributions of E0 and k0 are input into the model, thermodynamic dispersion is found to be unimportant and only kinetic dispersion contributes significantly to the broadening of dc voltammograms. Simulations of ac voltammetric experiments lead to the conclusion that the ac method, particularly when the analysis of kinetically very sensitive higher-order harmonics is undertaken, are far more sensitive to kinetic dispersion than the dc method. ac methods are therefore concluded to provide a potentially superior strategy for addressing the inverse problem of determining the k0 distribution that could give rise to the apparent anomalies in surface-confined voltammetry.

  2. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  3. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang

    2018-01-01

    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  4. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  5. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  6. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  7. Interference, confinement and non Franck-Condon effects in photoionization of H{sub 2} molecules at high photon energy

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez, J; MartIn, F [Departamento de Quimica, C-9, Universidad Autonoma de Madrid, 28049 Madrid (Spain); Fojon, O, E-mail: jorge@phys.au.d, E-mail: ofojon@fceia.unr.edu.a, E-mail: fernando.martin@uam.e [Institute de Fisica Rosario (CONICET-UNR), Pellegrini 250, 2000 Rosario (Argentina)

    2009-11-01

    We study in detail photoionization of H{sub 2} molecules by high energy photons. Bound and continuum states are accurately evaluated by using B-spline basis functions. The usual Franck-Condon behavior is not followed when the molecule is parallel to the polarization direction. The origin of this anomaly is related to interference effects. Moreover, it is shown that at these high photon energies, the nuclear asymmetry parameter exhibits a reminiscence of these interference patterns.

  8. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  9. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  10. Single-Molecule Titration in a Protein Nanoreactor Reveals the Protonation/Deprotonation Mechanism of a C:C Mismatch in DNA.

    Science.gov (United States)

    Ren, Hang; Cheyne, Cameron G; Fleming, Aaron M; Burrows, Cynthia J; White, Henry S

    2018-04-18

    Measurement of single-molecule reactions can elucidate microscopic mechanisms that are often hidden from ensemble analysis. Herein, we report the acid-base titration of a single DNA duplex confined within the wild-type α-hemolysin (α-HL) nanopore for up to 3 h, while monitoring the ionic current through the nanopore. Modulation between two states in the current-time trace for duplexes containing the C:C mismatch in proximity to the latch constriction of α-HL is attributed to the base flipping of the C:C mismatch. As the pH is lowered, the rate for the C:C mismatch to flip from the intra-helical state to the extra-helical state ( k intra-extra ) decreases, while the rate for base flipping from the extra-helical state to the intra-helical state ( k extra-intra ) remains unchanged. Both k intra-extra and k extra-intra are on the order of 1 × 10 -2 s -1 to 1 × 10 -1 s -1 and remain stable over the time scale of the measurement (several hours). Analysis of the pH-dependent kinetics of base flipping using a hidden Markov kinetic model demonstrates that protonation/deprotonation occurs while the base pair is in the intra-helical state. We also demonstrate that the rate of protonation is limited by transport of H + into the α-HL nanopore. Single-molecule kinetic isotope experiments exhibit a large kinetic isotope effect (KIE) for k intra-extra ( k H / k D ≈ 5) but a limited KIE for k extra-intra ( k H / k D ≈ 1.3), supporting our model. Our experiments correspond to the longest single-molecule measurements performed using a nanopore, and demonstrate its application in interrogating mechanisms of single-molecule reactions in confined geometries.

  11. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  12. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  13. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    Science.gov (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  14. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  15. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  16. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  17. Building superlattices from individual nanoparticles via template-confined DNA-mediated assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Qing-Yuan; Mason, Jarad A.; Li, Zhongyang; Zhou, Wenjie; O’Brien, Matthew N.; Brown, Keith A.; Jones, Matthew R.; Butun, Serkan; Lee, Byeongdu; Dravid, Vinayak P.; Aydin, Koray; Mirkin, Chad A.

    2018-01-18

    DNA programmable assembly has been combined with top-down lithography to construct superlattices of discrete, reconfigurable nanoparticle architectures on a gold surface over large areas. Specifically, individual colloidal plasmonic nanoparticles with different shapes and sizes are assembled with ‘locked” nucleic acids in polymer pores into oriented architectures that feature tunable arrangements and independently controllable distances at both nanometer and micrometer length scales. These structures, which would be difficult to construct via other common assembly methods, provide a platform to systematically study and control light-matter interactions in nanoparticle-based optical materials. The generality and potential of this approach is explored by identifying a broadband absorber with a solvent polarity response that allows dynamic tuning of the wavelength response and amplitude of visible light absorption.

  18. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    Science.gov (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  20. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  1. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  2. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo

    2010-01-01

    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  3. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  4. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain

    2014-02-01

    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  5. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

    Science.gov (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

    2014-10-21

    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  6. Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

    Directory of Open Access Journals (Sweden)

    Haowei Wang

    Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

  7. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  8. A novel small molecule inhibitor of the DNA repair protein Ku70/80.

    Science.gov (United States)

    Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

    2016-07-01

    Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

  9. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    Science.gov (United States)

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Science.gov (United States)

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  11. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  12. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  13. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  14. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  15. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    Science.gov (United States)

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  16. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

  17. Viscous properties of isotropic fluids composed of linear molecules: departure from the classical Navier-Stokes theory in nano-confined geometries.

    Science.gov (United States)

    Hansen, J S; Daivis, Peter J; Todd, B D

    2009-10-01

    In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.

  18. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    Science.gov (United States)

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  19. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    Science.gov (United States)

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  20. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  1. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  2. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    Science.gov (United States)

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  3. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  4. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  6. Counting molecules in cell-free DNA and single cells RNA

    OpenAIRE

    Karlsson, Kasper

    2016-01-01

    The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

  7. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  8. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  9. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  10. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  11. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  12. Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

    International Nuclear Information System (INIS)

    Pham, Quang Trung

    2014-01-01

    The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

  13. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  14. Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level

    OpenAIRE

    Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik

    2012-01-01

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...

  15. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  16. Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.

    Science.gov (United States)

    Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik

    2012-06-27

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.

  17. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  18. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    Energy Technology Data Exchange (ETDEWEB)

    Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

  19. The Knot Spectrum of Confined Random Equilateral Polygons

    Directory of Open Access Journals (Sweden)

    Diao Y.

    2014-01-01

    Full Text Available It is well known that genomic materials (long DNA chains of living organisms are often packed compactly under extreme confining conditions using macromolecular self-assembly processes but the general DNA packing mechanism remains an unsolved problem. It has been proposed that the topology of the packed DNA may be used to study the DNA packing mechanism. For example, in the case of (mutant bacteriophage P4, DNA molecules packed inside the bacteriophage head are considered to be circular since the two sticky ends of the DNA are close to each other. The DNAs extracted from the capsid without separating the two ends can thus preserve the topology of the (circular DNAs. It turns out that the circular DNAs extracted from bacteriophage P4 are non-trivially knotted with very high probability and with a bias toward chiral knots. In order to study this problem using a systematic approach based on mathematical modeling, one needs to introduce a DNA packing model under extreme volume confinement condition and test whether such a model can produce the kind of knot spectrum observed in the experiments. In this paper we introduce and study a model of equilateral random polygons con_ned in a sphere. This model is not meant to generate polygons that model DNA packed in a virus head directly. Instead, the average topological characteristics of this model may serve as benchmark data for totally randomly packed circular DNAs. The difference between the biologically observed topological characteristics and our benchmark data might reveal the bias of DNA packed in the viral capsids and possibly lead to a better understanding of the DNA packing mechanism, at least for the bacteriophage DNA. The purpose of this paper is to provide information about the knot spectrum of equilateral random polygons under such a spherical confinement with length and confinement ratios in a range comparable to circular DNAs packed inside bacteriophage heads.

  20. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  1. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  2. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  3. Dynamics in geometrical confinement

    CERN Document Server

    Kremer, Friedrich

    2014-01-01

    This book describes the dynamics of low molecular weight and polymeric molecules when they are constrained under conditions of geometrical confinement. It covers geometrical confinement in different dimensionalities: (i) in nanometer thin layers or self supporting films (1-dimensional confinement) (ii) in pores or tubes with nanometric diameters (2-dimensional confinement) (iii) as micelles embedded in matrices (3-dimensional) or as nanodroplets.The dynamics under such conditions have been a much discussed and central topic in the focus of intense worldwide research activities within the last two decades. The present book discusses how the resulting molecular mobility is influenced by the subtle counterbalance between surface effects (typically slowing down molecular dynamics through attractive guest/host interactions) and confinement effects (typically increasing the mobility). It also explains how these influences can be modified and tuned, e.g. through appropriate surface coatings, film thicknesses or pore...

  4. 77 FR 54584 - Final Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH...

    Science.gov (United States)

    2012-09-05

    ... changes. Human gene transfer also raises scientific, medical, social, and ethical considerations that... currently reviewed under Section III-B-1, Experiments Involving the Cloning of Toxin Molecules with LD50 of...

  5. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-01-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners

  6. Size and number of DNA molecules from Chinese hamster ovary cells determined by molecular autoradiography

    International Nuclear Information System (INIS)

    Todd, M.B.

    1980-06-01

    A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome

  7. Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

    Science.gov (United States)

    Hatlo, Marius M.; Panja, Debabrata; van Roij, René

    2011-08-01

    Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

  8. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  9. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  10. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  11. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  12. A new fast algorithm for solving the minimum spanning tree problem based on DNA molecules computation.

    Science.gov (United States)

    Wang, Zhaocai; Huang, Dongmei; Meng, Huajun; Tang, Chengpei

    2013-10-01

    The minimum spanning tree (MST) problem is to find minimum edge connected subsets containing all the vertex of a given undirected graph. It is a vitally important NP-complete problem in graph theory and applied mathematics, having numerous real life applications. Moreover in previous studies, DNA molecular operations usually were used to solve NP-complete head-to-tail path search problems, rarely for NP-hard problems with multi-lateral path solutions result, such as the minimum spanning tree problem. In this paper, we present a new fast DNA algorithm for solving the MST problem using DNA molecular operations. For an undirected graph with n vertex and m edges, we reasonably design flexible length DNA strands representing the vertex and edges, take appropriate steps and get the solutions of the MST problem in proper length range and O(3m+n) time complexity. We extend the application of DNA molecular operations and simultaneity simplify the complexity of the computation. Results of computer simulative experiments show that the proposed method updates some of the best known values with very short time and that the proposed method provides a better performance with solution accuracy over existing algorithms. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  13. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.

    1983-01-01

    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  14. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David

    2013-01-01

    as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....

  15. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    Science.gov (United States)

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  16. DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].

    Science.gov (United States)

    2001

    This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…

  17. True single-molecule DNA sequencing of a pleistocene horse bone

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa

    2011-01-01

    -preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...

  18. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  19. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    Science.gov (United States)

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  20. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    Science.gov (United States)

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  1. Interactive measurement and characterization of DNA molecules by analysis of AFM images

    Czech Academy of Sciences Publication Activity Database

    Marek, J.; Demjénová, E.; Tomori, Z.; Janáček, Jiří; Zolotová, I.; Valle, F.; Favre, M.; Dietler, G.

    2005-01-01

    Roč. 63, č. 2 (2005), s. 87-93 ISSN 1552-4922 Grant - others:VEGA(SK) 5048; VEGA(SK) 2185; CZ-SK(CZ) KONTAKT 139; Swiss National Science Foundation(CH) 2100-063746.00/1 Institutional research plan: CEZ:AV0Z5011922 Keywords : DNA * atomic force microscopy * interactive image analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.115, year: 2005

  2. Function of the UVR marker in dark repair of DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

    1975-01-01

    It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.

  3. Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

    Science.gov (United States)

    Gopinath, Ashwin; Rothemund, Paul W K

    2014-12-23

    Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

  4. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules

    Science.gov (United States)

    Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung

    2018-03-01

    Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.

  5. The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

    International Nuclear Information System (INIS)

    Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

    2008-01-01

    We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

  6. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  7. A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

    DEFF Research Database (Denmark)

    Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

    2014-01-01

    . The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

  8. Thermodynamics on Soluble Carbon Nanotubes: How Do DNA Molecules Replace Surfactants on Carbon Nanotubes?

    Science.gov (United States)

    Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi

    2012-01-01

    Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502

  9. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  10. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  11. Xeroderma pigmentosum and other diseases of human premature aging and DNA repair: Molecules to patients

    Science.gov (United States)

    Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.

    2012-01-01

    A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183

  12. Quark confinement

    International Nuclear Information System (INIS)

    Joos, H.

    1976-07-01

    The main topics of these lectures are: phenomenological approach to quark confinement, standard Lagrangian of hadrondynamics, Lagrangian field theory and quark confinement, classical soliton solutions in a simple model, quantization of extended systems, colour charge screening and quantization on a lattice and remarks on applications. A survey of the scientific publications listed according to the topics until 26 March 1976 is supplemented. (BJ) [de

  13. Gluon confinement

    International Nuclear Information System (INIS)

    Novello, M.; Lorenci, V.A. de; Elbaz, E.

    1997-02-01

    In this paper we present a new model for a gauge field theory such that self-interacting spin-one particles can be confined in a compact domain. The necessary conditions to produce the confining potential appear already in the properties of the eikonal structure generated by the particular choice of the dynamics. (author)

  14. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  15. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  16. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  17. Plasma confinement

    CERN Document Server

    Hazeltine, R D

    2003-01-01

    Detailed and authoritative, this volume examines the essential physics underlying international research in magnetic confinement fusion. It offers readable, thorough accounts of the fundamental concepts behind methods of confining plasma at or near thermonuclear conditions. Designed for a one- or two-semester graduate-level course in plasma physics, it also represents a valuable reference for professional physicists in controlled fusion and related disciplines.

  18. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  19. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  20. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  1. Single-step rapid assembly of DNA origami nanostructures for addressable nanoscale bioreactors

    DEFF Research Database (Denmark)

    Fu, Yanming; Zeng, Dongdong; Chao, Jie

    2013-01-01

    nm resolution and at the single-molecule level. We attach a pair of enzymes (horseradish peroxidase and glucose oxidase) at the inner side of DNA nanotubes and observe high coupling efficiency of enzyme cascade within this confined nanospace. Hence, DNA nanostructures with such unprecedented...

  2. Emission spectra of the species ablated from a solid target submerged in liquid: vibrational temperature of C2 molecules in water-confined geometry

    International Nuclear Information System (INIS)

    Sakka, Tetsuo; Saito, Kotaro; Ogata, Yukio H.

    2002-01-01

    Emission spectra of C 2 molecules produced at the water-graphite interface by pulsed laser irradiation were obtained at various delay times from the irradiation. Vibrational temperature was determined by the Boltzmann plot based on the vibrational bands in Δν=-1 branch of the Swan system. The results show that it was ca. 5000 K and did not change significantly with the delay time. With increasing the delay time up to ca. 500 ns the signal from the Swan band disappeared before the decrease of the vibrational temperature. The results were explained by the formation of a gas cavity and its collapse at several hundreds of nanoseconds from the laser pulse

  3. Diversity of Dicotyledenous-Infecting Geminiviruses and Their Associated DNA Molecules in Southern Africa, Including the South-West Indian Ocean Islands

    Directory of Open Access Journals (Sweden)

    Lindy L. Esterhuizen

    2012-09-01

    Full Text Available The family Geminiviridae comprises a group of plant-infecting circular ssDNA viruses that severely constrain agricultural production throughout the temperate regions of the world, and are a particularly serious threat to food security in sub-Saharan Africa. While geminiviruses exhibit considerable diversity in terms of their nucleotide sequences, genome structures, host ranges and insect vectors, the best characterised and economically most important of these viruses are those in the genus Begomovirus. Whereas begomoviruses are generally considered to be either monopartite (one ssDNA component or bipartite (two circular ssDNA components called DNA-A and DNA-B, many apparently monopartite begomoviruses are associated with additional subviral ssDNA satellite components, called alpha- (DNA-as or betasatellites (DNA-βs. Additionally, subgenomic molecules, also known as defective interfering (DIs DNAs that are usually derived from the parent helper virus through deletions of parts of its genome, are also associated with bipartite and monopartite begomoviruses. The past three decades have witnessed the emergence and diversification of various new begomoviral species and associated DI DNAs, in southern Africa, East Africa, and proximal Indian Ocean islands, which today threaten important vegetable and commercial crops such as, tobacco, cassava, tomato, sweet potato, and beans. This review aims to describe what is known about these viruses and their impacts on sustainable production in this sensitive region of the world.

  4. Probing DNA interactions with proteins using a single-molecule toolbox: inside the cell, in a test tube and in a computer.

    Science.gov (United States)

    Wollman, Adam J M; Miller, Helen; Zhou, Zhaokun; Leake, Mark C

    2015-04-01

    DNA-interacting proteins have roles in multiple processes, many operating as molecular machines which undergo dynamic meta-stable transitions to bring about their biological function. To fully understand this molecular heterogeneity, DNA and the proteins that bind to it must ideally be interrogated at a single molecule level in their native in vivo environments, in a time-resolved manner, fast enough to sample the molecular transitions across the free-energy landscape. Progress has been made over the past decade in utilizing cutting-edge tools of the physical sciences to address challenging biological questions concerning the function and modes of action of several different proteins which bind to DNA. These physiologically relevant assays are technically challenging but can be complemented by powerful and often more tractable in vitro experiments which confer advantages of the chemical environment with enhanced detection signal-to-noise of molecular signatures and transition events. In the present paper, we discuss a range of techniques we have developed to monitor DNA-protein interactions in vivo, in vitro and in silico. These include bespoke single-molecule fluorescence microscopy techniques to elucidate the architecture and dynamics of the bacterial replisome and the structural maintenance of bacterial chromosomes, as well as new computational tools to extract single-molecule molecular signatures from live cells to monitor stoichiometry, spatial localization and mobility in living cells. We also discuss recent developments from our laboratory made in vitro, complementing these in vivo studies, which combine optical and magnetic tweezers to manipulate and image single molecules of DNA, with and without bound protein, in a new super-resolution fluorescence microscope.

  5. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

    Science.gov (United States)

    Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2016-06-03

    Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    Science.gov (United States)

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion

  8. Cell-killing efficiency and number of platinum atoms binding to DNA, RNA and protein molecules of HeLa cells treated with combinations of hyperthermia and carboplatin

    International Nuclear Information System (INIS)

    Akaboshi, M.; Kawai, K.; Tanaka, Y.; Takada, J.; Sumino, T.

    1999-01-01

    The effect of hyperthermia on the cell killing efficiency of Pt atoms binding to DNA, RNA and protein molecules of HeLa cells treated with cis-diamine(1,1-cyclobutanedicarboxylato)platinum(II) (CBDCA) was examined. HeLa S-3 cells were treated with 195m Pt-radiolabeled CBDCA for 60 minutes at various temperatures, and the relationship between the lethal effect and the number of Pt atoms binding to DNA, RNA and proteins was examined. The mean lethal concentration (D 0 ) of carboplatin for a 60 min-treatment at 0, 25, 37, 40, 42 and 44 deg C was 671.2, 201.5, 67.3, 33.4, 20.2 and 15.6 μM, respectively. By using identically treated cells, the number of Pt-atoms combined with DNA, RNA and protein molecules were determined in the subcellular fractions. Thus, the D 0 's given as the drug concentrations were replaced with the number of Pt-atoms combined in each fraction. Then, the cell-killing efficiency of the Pt atom was expressed as the reciprocal of the number of Pt-atoms combined and was calculated for each molecule. The efficiency for DNA molecules was 0.699, 1.42, 2.65, 4.84, 7.74 and 8.28x10 4 nucleotides, respectively, for the conditions described above. From 0 to 44 deg C, the cell-killing efficiency of Pt atoms increased by a factor of 11.9. (author)

  9. Current characteristics of λ-DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    Science.gov (United States)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Li, Junjie; Bai, Jintao; Gu, Changzhi

    2017-03-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ-DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices.

  10. Current characteristics of λ -DNA molecules/polystyrene nanoparticles in TBE buffer solution through micro/nanofluidic capillaries under DC electric field

    International Nuclear Information System (INIS)

    Duan, Yifei; Zhao, Wei; Xue, Jing; Sun, Dan; Wang, Kaige; Wang, Guiren; Bai, Jintao; Li, Junjie; Gu, Changzhi

    2017-01-01

    In practical applications of biochips and bio-sensors, electrokinetic mechanisms are commonly employed to manipulate single bio-molecules and analyze their characteristics. To accurately and flexibly control the movement of single-molecule within micro/nanofluidic channels which are the basic components of Lab-chips, the current signals in micro/nanocapillaries filled with solutions of DNA molecules or polystyrene (PS) nanoparticles are systematically studied. Experimental results indicate that the current response along the micro/nanocapillaries can be significantly influenced by the diameter of the capillaries and the pH value of the solutions. Specifically, when there is only a pure (TBE) solution, the electric conductance does not monotonically decrease with decreasing the diameter of the capillaries, but slightly increases with decreasing the capillary diameter. When λ -DNA molecules or PS nanoparticles are added into the TBE buffer, the size effect on the electric conductance of the solutions are quite different. Although in the former, the electric conductance behaves differently from that in the pure TBE solution and decreases with the decreasing diameter, in the latter, the change is similar to that in the pure TBE solution. Besides, an abnormal ‘falling’ of the electric conductance is observed in a capillary with diameter of 200 nm. The investigation will significantly enhance the understanding on the electric properties of the solutions of biomolecules and particles in micro/nanofluidics. This is especially helpful for designing functional Lab-chip devices. (paper)

  11. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

    Science.gov (United States)

    Nayak, Alpana; Suresh, K. A.

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  12. Normal-Mode Analysis of Circular DNA at the Base-Pair Level. 2. Large-Scale Configurational Transformation of a Naturally Curved Molecule.

    Science.gov (United States)

    Matsumoto, Atsushi; Tobias, Irwin; Olson, Wilma K

    2005-01-01

    Fine structural and energetic details embedded in the DNA base sequence, such as intrinsic curvature, are important to the packaging and processing of the genetic material. Here we investigate the internal dynamics of a 200 bp closed circular molecule with natural curvature using a newly developed normal-mode treatment of DNA in terms of neighboring base-pair "step" parameters. The intrinsic curvature of the DNA is described by a 10 bp repeating pattern of bending distortions at successive base-pair steps. We vary the degree of intrinsic curvature and the superhelical stress on the molecule and consider the normal-mode fluctuations of both the circle and the stable figure-8 configuration under conditions where the energies of the two states are similar. To extract the properties due solely to curvature, we ignore other important features of the double helix, such as the extensibility of the chain, the anisotropy of local bending, and the coupling of step parameters. We compare the computed normal modes of the curved DNA model with the corresponding dynamical features of a covalently closed duplex of the same chain length constructed from naturally straight DNA and with the theoretically predicted dynamical properties of a naturally circular, inextensible elastic rod, i.e., an O-ring. The cyclic molecules with intrinsic curvature are found to be more deformable under superhelical stress than rings formed from naturally straight DNA. As superhelical stress is accumulated in the DNA, the frequency, i.e., energy, of the dominant bending mode decreases in value, and if the imposed stress is sufficiently large, a global configurational rearrangement of the circle to the figure-8 form takes place. We combine energy minimization with normal-mode calculations of the two states to decipher the configurational pathway between the two states. We also describe and make use of a general analytical treatment of the thermal fluctuations of an elastic rod to characterize the

  13. Building solids inside nano-space: from confined amorphous through confined solvate to confined 'metastable' polymorph.

    Science.gov (United States)

    Nartowski, K P; Tedder, J; Braun, D E; Fábián, L; Khimyak, Y Z

    2015-10-14

    The nanocrystallisation of complex molecules inside mesoporous hosts and control over the resulting structure is a significant challenge. To date the largest organic molecule crystallised inside the nano-pores is a known pharmaceutical intermediate - ROY (259.3 g mol(-1)). In this work we demonstrate smart manipulation of the phase of a larger confined pharmaceutical - indomethacin (IMC, 357.8 g mol(-1)), a substance with known conformational flexibility and complex polymorphic behaviour. We show the detailed structural analysis and the control of solid state transformations of encapsulated molecules inside the pores of mesoscopic cellular foam (MCF, pore size ca. 29 nm) and controlled pore glass (CPG, pore size ca. 55 nm). Starting from confined amorphous IMC we drive crystallisation into a confined methanol solvate, which upon vacuum drying leads to the stabilised rare form V of IMC inside the MCF host. In contrast to the pure form, encapsulated form V does not transform into a more stable polymorph upon heating. The size of the constraining pores and the drug concentration within the pores determine whether the amorphous state of the drug is stabilised or it recrystallises into confined nanocrystals. The work presents, in a critical manner, an application of complementary techniques (DSC, PXRD, solid-state NMR, N2 adsorption) to confirm unambiguously the phase transitions under confinement and offers a comprehensive strategy towards the formation and control of nano-crystalline encapsulated organic solids.

  14. Irradiation of biological molecules (DNA and RNA bases) by proton impact in the velocity range of the Bragg peak (20-150 keV/amu)

    International Nuclear Information System (INIS)

    Tabet, J.

    2007-11-01

    The aim of this work was to study the ionization of DNA and RNA base molecules by proton impact at energies between 20 and 150 keV/amu. The experiments developed over the course of this project made it possible not only to study the fragmentation of uracil, thymine, adenine, and cytosine, but also to measure absolute cross sections for different ionization processes initiated by proton interactions with these important biological molecules. Firstly, the experimental system enabled the contributions of two key ionization processes to be separated: direct ionization and electron capture. The corresponding mass spectra were measured and analyzed on an event-by-event basis. For uracil, the branching ratios for these two processes were measured as function of the projectile velocity. Secondly, we have developed a system to measure absolute cross sections for the electron capture process. The production rate of neutral atoms compared to protons was measured for the four biological molecules: uracil, cytosine, thymine, and adenine at different vaporization temperatures. This production rate varies as a function of the thickness of the target jet traversed by the protons. Accordingly, a deposit experiment was developed in order to characterize the density of molecules in the targeted gas jets. Theoretical and experimental study of the total effusion and density-profile of the gaseous molecular beams enabled us to deduce the thickness of the target jets traversed by the protons. Thus it was possible to determine absolute cross sections for the ionization of each of the four isolated biological molecules by 80 keV protons impact. To our knowledge, this work provides the first experimental absolute cross sections for DNA and RNA base ionization processes initiated by proton impact in the velocity range corresponding to the Bragg peak. (author)

  15. Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

    Science.gov (United States)

    Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

    2014-05-01

    Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

  16. Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

  17. Generating equilateral random polygons in confinement

    International Nuclear Information System (INIS)

    Diao, Y; Ernst, C; Montemayor, A; Ziegler, U

    2011-01-01

    One challenging problem in biology is to understand the mechanism of DNA packing in a confined volume such as a cell. It is known that confined circular DNA is often knotted and hence the topology of the extracted (and relaxed) circular DNA can be used as a probe of the DNA packing mechanism. However, in order to properly estimate the topological properties of the confined circular DNA structures using mathematical models, it is necessary to generate large ensembles of simulated closed chains (i.e. polygons) of equal edge lengths that are confined in a volume such as a sphere of certain fixed radius. Finding efficient algorithms that properly sample the space of such confined equilateral random polygons is a difficult problem. In this paper, we propose a method that generates confined equilateral random polygons based on their probability distribution. This method requires the creation of a large database initially. However, once the database has been created, a confined equilateral random polygon of length n can be generated in linear time in terms of n. The errors introduced by the method can be controlled and reduced by the refinement of the database. Furthermore, our numerical simulations indicate that these errors are unbiased and tend to cancel each other in a long polygon. (paper)

  18. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  19. Distribution of distances between DNA barcode labels in nanochannels close to the persistence length

    Science.gov (United States)

    Reinhart, Wesley F.; Reifenberger, Jeff G.; Gupta, Damini; Muralidhar, Abhiram; Sheats, Julian; Cao, Han; Dorfman, Kevin D.

    2015-02-01

    We obtained experimental extension data for barcoded E. coli genomic DNA molecules confined in nanochannels from 40 nm to 51 nm in width. The resulting data set consists of 1 627 779 measurements of the distance between fluorescent probes on 25 407 individual molecules. The probability density for the extension between labels is negatively skewed, and the magnitude of the skewness is relatively insensitive to the distance between labels. The two Odijk theories for DNA confinement bracket the mean extension and its variance, consistent with the scaling arguments underlying the theories. We also find that a harmonic approximation to the free energy, obtained directly from the probability density for the distance between barcode labels, leads to substantial quantitative error in the variance of the extension data. These results suggest that a theory for DNA confinement in such channels must account for the anharmonic nature of the free energy as a function of chain extension.

  20. Periodically arranged benzene-linker molecules on boron-doped single-crystalline diamond films for DNA

    Czech Academy of Sciences Publication Activity Database

    Shin, D.; Tokuda, N.; Rezek, Bohuslav; Nebel, C.E.

    2006-01-01

    Roč. 8, - (2006), s. 844-850 ISSN 1388-2481 Institutional research plan: CEZ:AV0Z10100521 Keywords : electrochemical surface modification * single-crystalline CVD diamond * covalent DNA Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.484, year: 2006

  1. On-chip Detection of Rolling Circle Amplified DNA Molecules from Bacillus Globigii spores and Vibrio Cholerae

    DEFF Research Database (Denmark)

    Østerberg, Frederik Westergaard; Rizzi, Giovanni; Donolato, Marco

    2014-01-01

    For the first time DNA coils formed by rolling circle amplification are quantified on-chip by Brownian relaxation measurements on magnetic nanobeads using a magnetoresistive sensor. No external magnetic fields are required besides the magnetic field arising from the current through the sensor...

  2. Magnetic confinement

    Energy Technology Data Exchange (ETDEWEB)

    Batistoni, Paola; De Marco, Francesco; Pieroni, Leonardo (ed.)

    2005-07-01

    The Frascati Tokamak Upgrade (FTU) is a compact, high-magnetic-field tokamak capable of operating at density and magnetic field values similar to, or even encompassing, those of International Thermonuclear Experimental Reactor (ITER) and therefore provides a unique opportunity to explore physics issues that are directly relevant to ITER. During 2004 the experimental activities were focussed on fully exploiting the lower hybrid system (for generating and controlling the plasma current) and the electron cyclotron heating system (joint experiment with the Institute of Plasma Physics of the National Research Council, Milan). With all four gyrotrons in operation, full electron cyclotron power was achieved up to a record level of 1.5 MW. By simultaneously injecting lower hybrid waves, to tailor the plasma current radial profile, and electron cyclotron waves, to heat the plasma centre, good confinement regimes with internal transport barriers were obtained at the highest plasma density values ever achieved for this operation regime (n {approx}1.5X10{sup 20}m{sup -3}). Specific studies were devoted to optimising the coupling of lower hybrid waves to the plasma (by real-time control of the plasma position) and to generating current by electron cyclotron current drive. The new scanning CO{sub 2} interferometer (developed by the Reversed Field Experiment Consortium) for high spatial and time resolution (1 cm/50 {mu}s) density profile measurements was extensively used. The Thomson scattering diagnostic was upgraded and enabled observation of scattered signals associated with the Confinement background plasma dynamics. As for theoretical studies on the dynamics of turbulence in plasmas, the transition from Bohm-like scaling to gyro-Bohm scaling of the local plasma diffusivity was demonstrated on the basis of a generalised four wave model (joint collaboration with Princeton Plasma Physics Laboratory and the University of California at Irvine). The transition from weak to strong

  3. Magnetic confinement

    International Nuclear Information System (INIS)

    Batistoni, Paola; De Marco, Francesco; Pieroni, Leonardo

    2005-01-01

    The Frascati Tokamak Upgrade (FTU) is a compact, high-magnetic-field tokamak capable of operating at density and magnetic field values similar to, or even encompassing, those of International Thermonuclear Experimental Reactor (ITER) and therefore provides a unique opportunity to explore physics issues that are directly relevant to ITER. During 2004 the experimental activities were focussed on fully exploiting the lower hybrid system (for generating and controlling the plasma current) and the electron cyclotron heating system (joint experiment with the Institute of Plasma Physics of the National Research Council, Milan). With all four gyrotrons in operation, full electron cyclotron power was achieved up to a record level of 1.5 MW. By simultaneously injecting lower hybrid waves, to tailor the plasma current radial profile, and electron cyclotron waves, to heat the plasma centre, good confinement regimes with internal transport barriers were obtained at the highest plasma density values ever achieved for this operation regime (n ∼1.5X10 20 m -3 ). Specific studies were devoted to optimising the coupling of lower hybrid waves to the plasma (by real-time control of the plasma position) and to generating current by electron cyclotron current drive. The new scanning CO 2 interferometer (developed by the Reversed Field Experiment Consortium) for high spatial and time resolution (1 cm/50 μs) density profile measurements was extensively used. The Thomson scattering diagnostic was upgraded and enabled observation of scattered signals associated with the Confinement background plasma dynamics. As for theoretical studies on the dynamics of turbulence in plasmas, the transition from Bohm-like scaling to gyro-Bohm scaling of the local plasma diffusivity was demonstrated on the basis of a generalised four wave model (joint collaboration with Princeton Plasma Physics Laboratory and the University of California at Irvine). The transition from weak to strong energetic particle

  4. Small molecule inhibitors uncover synthetic genetic interactions of human flap endonuclease 1 (FEN1 with DNA damage response genes.

    Directory of Open Access Journals (Sweden)

    Thomas A Ward

    Full Text Available Flap endonuclease 1 (FEN1 is a structure selective endonuclease required for proficient DNA replication and the repair of DNA damage. Cellularly active inhibitors of this enzyme have previously been shown to induce a DNA damage response and, ultimately, cell death. High-throughput screens of human cancer cell-lines identify colorectal and gastric cell-lines with microsatellite instability (MSI as enriched for cellular sensitivity to N-hydroxyurea series inhibitors of FEN1, but not the PARP inhibitor olaparib or other inhibitors of the DNA damage response. This sensitivity is due to a synthetic lethal interaction between FEN1 and MRE11A, which is often mutated in MSI cancers through instabilities at a poly(T microsatellite repeat. Disruption of ATM is similarly synthetic lethal with FEN1 inhibition, suggesting that disruption of FEN1 function leads to the accumulation of DNA double-strand breaks. These are likely a result of the accumulation of aberrant replication forks, that accumulate as a consequence of a failure in Okazaki fragment maturation, as inhibition of FEN1 is toxic in cells disrupted for the Fanconi anemia pathway and post-replication repair. Furthermore, RAD51 foci accumulate as a consequence of FEN1 inhibition and the toxicity of FEN1 inhibitors increases in cells disrupted for the homologous recombination pathway, suggesting a role for homologous recombination in the resolution of damage induced by FEN1 inhibition. Finally, FEN1 appears to be required for the repair of damage induced by olaparib and cisplatin within the Fanconi anemia pathway, and may play a role in the repair of damage associated with its own disruption.

  5. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Construction of a Holliday Junction in Small Circular DNA Molecules for Stable Motifs and Two-Dimensional Lattices.

    Science.gov (United States)

    Guo, Xin; Wang, Xue-Mei; Wei, Shuai; Xiao, Shou-Jun

    2018-04-12

    Design rules for DNA nanotechnology have been mostly learnt from using linear single-stranded (ss) DNA as the source material. For example, the core structure of a typical DAO (double crossover, antiparallel, odd half-turns) tile for assembling 2D lattices is constructed from only two linear ss-oligonucleotide scaffold strands, similar to two ropes making a square knot. Herein, a new type of coupled DAO (cDAO) tile and 2D lattices of small circular ss-oligonucleotides as scaffold strands and linear ss-oligonucleotides as staple strands are reported. A cDAO tile of cDAO-c64nt (c64nt: circular 64 nucleotides), shaped as a solid parallelogram, is constructed with a Holliday junction (HJ) at the center and two HJs at both poles of a c64nt; similarly, cDAO-c84nt, shaped as a crossed quadrilateral composed of two congruent triangles, is formed with a HJ at the center and four three-way junctions at the corners of a c84nt. Perfect 2D lattices were assembled from cDAO tiles: infinite nanostructures of nanoribbons, nanotubes, and nanorings, and finite nanostructures. The structural relationship between the visible lattices imaged by AFM and the corresponding invisible secondary and tertiary molecular structures of HJs, inclination angle of hydrogen bonds against the double-helix axis, and the chirality of the tile can be interpreted very well. This work could shed new light on DNA nanotechnology with unique circular tiles. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Vingt ans après (Twenty years after). Comment on "Disentangling DNA molecules" by Alexander Vologodskii

    Science.gov (United States)

    Grosberg, Alexander Y.

    2016-09-01

    The effect of DNA topology simplification by type II topoisomerase enzymes was discovered experimentally by Rybenkov et al. [1] 20 years ago - which motivates me to borrow the title for this comment from Alexandre Dumas [2]. Ever since the original discovery, the effect keeps entertaining theorists - but the most surprising fact is that the original experiment was never repeated, let alone improved. I do not understand why it is so. In my opinion, there is an acute need of new experiments, not only repeating the original measurements, but also examining numerous other aspects of the phenomenon. In this sense, the review [3] by Vologodskii, one of the original discoverers, is both timely and important. In his review, Vologodskii concentrates on what I would call mechanical aspect of the problem - how bent are T- and G-segments, what kinds of juxtaposition are relevant, etc. The importance of these issues notwithstanding, I want to complement this approach, and to consider in greater detail the thermodynamics of the process. My main points are as follows: action of topo II enzyme violates detailed balance for DNA, leading to circular currents and dissipation (which is indeed quite a common occurrence in many living systems). These currents are potentially observable, and dissipation measurable, which should challenge experimenters. The main goal of this comment is to show how general phenomenological point of view allows to formulate theoretical prediction for the energy dissipation rate.

  8. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  9. Comments on confinement criteria

    International Nuclear Information System (INIS)

    Kurak, V.; Schroer, B.; Swieca, J.A.

    1977-01-01

    For a QED 2 model with SU(n) flavour, the nature of the physical states space is more subtle than one expects on the basis of the loop criterion for confinement. One may have colour confinement without confinement of the fundamental flavour representation. Attempts to formulate confinement criteria in which the quark fields play a more fundamental role are discussed [pt

  10. Mechanistic study of DNA damage and radioprotection of small molecule treatment in the irradiated proliferating and quiescent human lung fibroblast cells

    International Nuclear Information System (INIS)

    Dai, Jiawen; Baskar, Rajamanickam

    2014-01-01

    Ionizing radiation is an invaluable diagnostic and treatment tool used in various clinical applications and also in cancer control. However, assessing normal tissue injury is of a great interest. Since radiation sensitivity varies with different phases of cell cycle, understanding how these cells differ in their sensitivity will help to prevent or reduce the radiation injury. We have used both proliferating and quiescent human normal lung fibroblast cells and investigated key proteins involved in the cell cycle, DNA damage and death, further the radioprotective role of small molecule after low doses (d ≤1Gy) of radiation exposure. Among the cell cycle/death proteins investigated, p53 and phosphorylation of p53 (Ser-15) were induced in both the proliferating and quiescent phases of cells when studied at different time intervals. In the proliferating cells after irradiation along with p53, cyclin dependent kinase (CDK) inhibitors p21, p27 were induced. However, similarly in the quiescent cells along with the p53, p21 and p27 were also induced. The DNA damage assessed by phosphorylation of histone H2AX expression showed an increase even in the non-dividing quiescent cells after 1 Gy of radiation exposure. Whereas cell cycle proteins Cyclin A and E and cell death proteins Bax and cytochrome-c did not show any increase in the quiescent cells. In conclusion, human normal lung fibroblast cells that are not actively dividing are also showed similar radiation response as of proliferating cells. Furthermore, proliferating and quiescent cells treated with small molecules attenuate p53 and its downstream target protein p21 indicating radioprotection of the cells. The specific activation of p53, phosphorylation of p53 (Ser-15), p21 and phosphorylation of histone H2AX following radiation doses of d ≤ 1 Gy in the quiescent cells demonstrated in this study may give us a better understanding about the radiation response of non-dividing fibroblast cells, which is present in many

  11. Dynamics and reactivity of confined water

    International Nuclear Information System (INIS)

    Musat, R.

    2008-01-01

    In the context of new sustainable energy sources quest, the nuclear energy remains a key solution. However, with the development of nuclear technology, problems relating to nuclear waste disposal arise; thus, the radiolysis of water in confined media is extremely important with respect to matters related to long time storage of nuclear waste. Studies in model porous media would allow the projection of a confined water radiolysis simulator. A first step in this direction was made by studying the radiolysis of water confined in Vycor and CPG glasses; this study continues the trend set and investigates the effects of confinement in metal materials upon the water radiolysis allowing the understanding of metal - water radiation induced corrosion. A further/complete understanding of the radiolytic process under confinement requires knowledge of the effect of confinement upon the dynamics of confined molecules and on the evolution of the species produced upon ionizing radiation. In this respect, we have used the OH vibrator as a probe of the hydrogen bond network properties and thus investigated the dynamics of confined water using IR time resolved spectroscopy. The evolution of the hydrated electron under confinement was studied on a nano and picosecond time scale using UV pump - visible probe technique and single shot spectroscopy. (author) [fr

  12. Confined catalysis under two-dimensional materials

    OpenAIRE

    Li, Haobo; Xiao, Jianping; Fu, Qiang; Bao, Xinhe

    2017-01-01

    Small spaces in nanoreactors may have big implications in chemistry, because the chemical nature of molecules and reactions within the nanospaces can be changed significantly due to the nanoconfinement effect. Two-dimensional (2D) nanoreactor formed under 2D materials can provide a well-defined model system to explore the confined catalysis. We demonstrate a general tendency for weakened surface adsorption under the confinement of graphene overlayer, illustrating the feasible modulation of su...

  13. Continuous throughput and long-term observation of single-molecule FRET without immobilization.

    Science.gov (United States)

    Tyagi, Swati; VanDelinder, Virginia; Banterle, Niccolò; Fuertes, Gustavo; Milles, Sigrid; Agez, Morgane; Lemke, Edward A

    2014-03-01

    We present an automated microfluidic platform that performs multisecond observation of single molecules with millisecond time resolution while bypassing the need for immobilization procedures. With this system, we confine biomolecules to a thin excitation field by reversibly collapsing microchannels to nanochannels. We demonstrate the power of our method by studying a variety of complex nucleic acid and protein systems, including DNA Holliday junctions, nucleosomes and human transglutaminase 2.

  14. Precision platform for convex lens-induced confinement microscopy

    Science.gov (United States)

    Berard, Daniel; McFaul, Christopher M. J.; Leith, Jason S.; Arsenault, Adriel K. J.; Michaud, François; Leslie, Sabrina R.

    2013-10-01

    We present the conception, fabrication, and demonstration of a versatile, computer-controlled microscopy device which transforms a standard inverted fluorescence microscope into a precision single-molecule imaging station. The device uses the principle of convex lens-induced confinement [S. R. Leslie, A. P. Fields, and A. E. Cohen, Anal. Chem. 82, 6224 (2010)], which employs a tunable imaging chamber to enhance background rejection and extend diffusion-limited observation periods. Using nanopositioning stages, this device achieves repeatable and dynamic control over the geometry of the sample chamber on scales as small as the size of individual molecules, enabling regulation of their configurations and dynamics. Using microfluidics, this device enables serial insertion as well as sample recovery, facilitating temporally controlled, high-throughput measurements of multiple reagents. We report on the simulation and experimental characterization of this tunable chamber geometry, and its influence upon the diffusion and conformations of DNA molecules over extended observation periods. This new microscopy platform has the potential to capture, probe, and influence the configurations of single molecules, with dramatically improved imaging conditions in comparison to existing technologies. These capabilities are of immediate interest to a wide range of research and industry sectors in biotechnology, biophysics, materials, and chemistry.

  15. Single-Molecule Kinetics Reveal Cation-Promoted DNA Duplex Formation Through Ordering of Single-Stranded Helices

    Science.gov (United States)

    Dupuis, Nicholas F.; Holmstrom, Erik D.; Nesbitt, David J.

    2013-01-01

    In this work, the kinetics of short, fully complementary oligonucleotides are investigated at the single-molecule level. Constructs 6–9 bp in length exhibit single exponential kinetics over 2 orders of magnitude time for both forward (kon, association) and reverse (koff, dissociation) processes. Bimolecular rate constants for association are weakly sensitive to the number of basepairs in the duplex, with a 2.5-fold increase between 9 bp (k′on = 2.1(1) × 106 M−1 s−1) and 6 bp (k′on = 5.0(1) × 106 M−1 s−1) sequences. In sharp contrast, however, dissociation rate constants prove to be exponentially sensitive to sequence length, varying by nearly 600-fold over the same 9 bp (koff = 0.024 s−1) to 6 bp (koff = 14 s−1) range. The 8 bp sequence is explored in more detail, and the NaCl dependence of kon and koff is measured. Interestingly, konincreases by >40-fold (kon = 0.10(1) s−1 to 4.0(4) s−1 between [NaCl] = 25 mM and 1 M), whereas in contrast, koffdecreases by fourfold (0.72(3) s−1 to 0.17(7) s−1) over the same range of conditions. Thus, the equilibrium constant (Keq) increases by ≈160, largely due to changes in the association rate, kon. Finally, temperature-dependent measurements reveal that increased [NaCl] reduces the overall exothermicity (ΔΔH° > 0) of duplex formation, albeit by an amount smaller than the reduction in entropic penalty (−TΔΔS° duplex formation. PMID:23931323

  16. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  17. Anomalous water dynamics at surfaces and interfaces: synergistic effects of confinement and surface interactions

    Science.gov (United States)

    Biswas, Rajib; Bagchi, Biman

    2018-01-01

    In nature, water is often found in contact with surfaces that are extended on the scale of molecule size but small on a macroscopic scale. Examples include lipid bilayers and reverse micelles as well as biomolecules like proteins, DNA and zeolites, to name a few. While the presence of surfaces and interfaces interrupts the continuous hydrogen bond network of liquid water, confinement on a mesoscopic scale introduces new features. Even when extended on a molecular scale, natural and biological surfaces often have features (like charge, hydrophobicity) that vary on the scale of the molecular diameter of water. As a result, many new and exotic features, which are not seen in the bulk, appear in the dynamics of water close to the surface. These different behaviors bear the signature of both water-surface interactions and of confinement. In other words, the altered properties are the result of the synergistic effects of surface-water interactions and confinement. Ultrafast spectroscopy, theoretical modeling and computer simulations together form powerful synergistic approaches towards an understanding of the properties of confined water in such systems as nanocavities, reverse micelles (RMs), water inside and outside biomolecules like proteins and DNA, and also between two hydrophobic walls. We shall review the experimental results and place them in the context of theory and simulations. For water confined within RMs, we discuss the possible interference effects propagating from opposite surfaces. Similar interference is found to give rise to an effective attractive force between two hydrophobic surfaces immersed and kept fixed at a separation of d, with the force showing an exponential dependence on this distance. For protein and DNA hydration, we shall examine a multitude of timescales that arise from frustration effects due to the inherent heterogeneity of these surfaces. We pay particular attention to the role of orientational correlations and modification of the

  18. Chernobyl new safe confinement

    International Nuclear Information System (INIS)

    Dodd, L.

    2011-01-01

    The author presents the new safe confinement that will be commissioned at Unit 4 of the Chernobyl NPP in 2015. The confinement will ensure that Chernobyl Unit 4 will be placed in an environmentally safe condition for at least next 100 years. The article highlights the current work status, future perspectives and the feasibility of confinement concept [ru

  19. Multi-Quanta Spin-Locking Nuclear Magnetic Resonance Relaxation Measurements: An Analysis of the Long-Time Dynamical Properties of Ions and Water Molecules Confined within Dense Clay Sediments

    Directory of Open Access Journals (Sweden)

    Patrice Porion

    2017-11-01

    Full Text Available Solid/liquid interfaces are exploited in various industrial applications because confinement strongly modifies the physico-chemical properties of bulk fluids. In that context, investigating the dynamical properties of confined fluids is crucial to identify and better understand the key factors responsible for their behavior and to optimize their structural and dynamical properties. For that purpose, we have developed multi-quanta spin-locking nuclear magnetic resonance relaxometry of quadrupolar nuclei in order to fill the gap between the time-scales accessible by classical procedures (like dielectric relaxation, inelastic and quasi-elastic neutron scattering and obtain otherwise unattainable dynamical information. This work focuses on the use of quadrupolar nuclei (like 2H, 7Li and 133Cs, because quadrupolar isotopes are the most abundant NMR probes in the periodic table. Clay sediments are the confining media selected for this study because they are ubiquitous materials implied in numerous industrial applications (ionic exchange, pollutant absorption, drilling, waste storing, cracking and heterogeneous catalysis.

  20. DNA Repair Systems

    Indian Academy of Sciences (India)

    DNA molecule which makes it ideal for storage and propagation of genetic information. ... of these errors are broadly referred to as DNA repair. DNA can ... changes occur in the human genome per day. ..... nails, frequent physical and mental.

  1. Confinement models for gluons

    International Nuclear Information System (INIS)

    Khadkikar, S.B.; Vinodkumar, P.C.

    1987-04-01

    Confinement model for gluons using a 'colour super current' is formulated. An attempt has been made to derive a suitable dielectric function corresponding to the current confinement model. A simple inhomogeneous dielectric confinement model for gluons is studied for comparison. The model Hamiltonians are second quantized and the glueball states are constructed. The spurious motion of the centre of confinement is accounted for. The results of the current confinement scheme are found to be in good agreement with the experimental candidates for glueballs. (author). 16 refs, 3 tabs

  2. Probing the properties of confined liquids

    NARCIS (Netherlands)

    de Beer, Sissi Jacoba Adrianus

    2011-01-01

    In this thesis we describe Atomic Force Microscopy (AFM) measurements and Molecular Dynamics (MD) simulation of the static and dynamic properties of layered liquids confined between two solid surfaces. Liquid molecules in the proximity of a solid surface assemble into layers. When a fluid is

  3. DNA molecules and human therapeutics

    African Journals Online (AJOL)

    PRECIOUS

    2009-12-29

    Dec 29, 2009 ... vectors, display non-toxicity and are simpler to develop. This review ... technology as well as a staged delivery mechanism for the introduction of plasmid-borne gene to target cells via the ... pathogen's gene to provide immunity against diseases by ... human cytomegalovirus, simian virus, human elongation.

  4. Ultra-cold molecule production

    International Nuclear Information System (INIS)

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

    2005-01-01

    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  5. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  6. Tokamak confinement scaling laws

    International Nuclear Information System (INIS)

    Connor, J.

    1998-01-01

    The scaling of energy confinement with engineering parameters, such as plasma current and major radius, is important for establishing the size of an ignited fusion device. Tokamaks exhibit a variety of modes of operation with different confinement properties. At present there is no adequate first principles theory to predict tokamak energy confinement and the empirical scaling method is the preferred approach to designing next step tokamaks. This paper reviews a number of robust theoretical concepts, such as dimensional analysis and stability boundaries, which provide a framework for characterising and understanding tokamak confinement and, therefore, generate more confidence in using empirical laws for extrapolation to future devices. (author)

  7. Expression of DNA Damage Response Molecules PARP1, γH2AX, BRCA1, and BRCA2 Predicts Poor Survival of Breast Carcinoma Patients

    Directory of Open Access Journals (Sweden)

    See-Hyoung Park

    2015-08-01

    Full Text Available BACKGROUND: Poly(ADP-ribose polymerase 1 (PARP1, γH2AX, BRCA1, and BRCA2 are conventional molecular indicators of DNA damage in cells and are often overexpressed in various cancers. In this study, we aimed, using immunohistochemical detection, whether the co-expression of PARP1, γH2AX, BRCA1, and BRCA2 in breast carcinoma (BCA tissue can provide more reliable prediction of survival of BCA patients. MATERIALS AND METHODS: We investigated immunohistochemical expression and prognostic significance of the expression of PARP1, γH2AX, BRCA1, and BRCA2 in 192 cases of BCAs. RESULTS: The expression of these four molecules predicted earlier distant metastatic relapse, shorter overall survival (OS, and relapse-free survival (RFS by univariate analysis. Multivariate analysis revealed the expression of PARP1, γH2AX, and BRCA2 as independent poor prognostic indicators of OS and RFS. In addition, the combined expressional pattern of BRCA1, BRCA2, PARP1, and γH2AX (CSbbph was an additional independent prognostic predictor for OS (P < .001 and RFS (P < .001. The 10-year OS rate was 95% in the CSbbph-low (CSbbph scores 0 and 1 subgroup, but that was only 35% in the CSbbph-high (CSbbph score 4 subgroup. CONCLUSION: This study has demonstrated that the individual and combined expression patterns of PARP1, γH2AX, BRCA1, and BRCA2 could be helpful in determining an accurate prognosis for BCA patients and for the selection of BCA patients who could potentially benefit from anti-PARP1 therapy with a combination of genotoxic chemotherapeutic agents.

  8. Preparation of translationally cold neutral molecules.

    Science.gov (United States)

    Di Domenicantonio, Giulia; Bertsche, Benjamin; Osterwalder, Andreas

    2011-01-01

    Efforts at EPFL to obtain translationally cold neutral molecules are described. Active deceleration of polar molecules is performed by confining the molecules in moving three-dimensional electrostatic traps, and by appropriately choosing the velocity of those traps. Alternatively, cold molecules can be obtained by velocity filtering. Here, the velocity of the molecules is not changed, but instead the cold molecules are extracted from a thermal sample by using the competition between the electrostatic force and the centrifugal force inside a bent electrostatic guide for polar molecules.

  9. Statics and dynamics of DNA knotting

    Science.gov (United States)

    Orlandini, Enzo

    2018-02-01

    Knots and entanglement in polymers and biopolymers such as DNA and proteins constitute a timely topic that spans various scientific disciplines ranging from physics to chemistry, biology and mathematics. Although in the past many advancements have been made in understanding the equilibrium knotting probability and knot complexity of long polymer chains in solutions, many questions have been addressed in recent years by both experimental and theoretical means—for instance, how the knotting probability depends on the quality of the solvent, the elastic properties of the molecule and its degree of confinement. How knots form, evolve and eventually disappear in a fluctuating chain. Are the equilibrium and non-equilibrium properties of knotted molecules affected by the knot swelling/shrinking dynamics? Moreover, thanks to the great advance in nanotechnology and micromanipulation techniques, nowadays knots can be ‘manually’ tied in a single DNA molecule, followed during their motion along the chains, forced to pass through nanopores, or stretched by external forces or elongational flows. All these experimental approaches allow access to new information on the interplay of topology and polymer physics, and this has opened new perspectives in the field. Here, we provide an overview of the current knowledge of this topic, stressing the main results obtained, including the recent developments in experimental and computational approaches. Since almost all experiments on knotting involve DNA, the review will be mainly focused on the topological properties of this fascinating and biologically relevant molecule.

  10. The confinement problem

    International Nuclear Information System (INIS)

    Seiler, E.

    1985-01-01

    Confinement of quarks is sometimes taken as some kind of dogma in the contemporary theory of strong interactions - quantum chromo-dynamics (QCD). Scientists should not be content with that. What is meant by ''permanent confinement'' should be formulated more precisely to see whether the theory has this property or not. The author looks at some possible interpretations of ''confinement'' and their shortcomings and then turns to the most widely used rather pragmatic definition based on the somewhat unphysical notion of infinitely heavy external sources. He describes what is known about the problem and tries to bring into focus some aspects that are insufficiently understood in his opinion

  11. The confining trailing string

    CERN Document Server

    Kiritsis, E; Nitti, F

    2014-01-01

    We extend the holographic trailing string picture of a heavy quark to the case of a bulk geometry dual to a confining gauge theory. We compute the classical trailing confining string solution for a static as well as a uniformly moving quark. The trailing string is infinitely extended and approaches a confining horizon, situated at a critical value of the radial coordinate, along one of the space-time directions, breaking boundary rotational invariance. We compute the equations for the fluctuations around the classical solutions, which are used to obtain boundary force correlators controlling the Langevin dynamics of the quark. The imaginary part of the correlators has a non-trivial low-frequency limit, which gives rise to a viscous friction coefficient induced by the confining vacuum. The vacuum correlators are used to define finite-temperature dressed Langevin correlators with an appropriate high-frequency behavior.

  12. Solitons and confinement

    International Nuclear Information System (INIS)

    Swieca, J.A.

    1976-01-01

    Some aspects of two recent developments in quantum field theory are discussed. First, related with 'extended particles' such as soliton, kink and the 't Hooft monopole. Second, with confinement of particles which are realized in the Schwinger model [pt

  13. Serogroup-level resolution of the “Super-7” Shiga toxin-producing Escherichia coli using nanopore single-molecule DNA sequencing

    Science.gov (United States)

    DNA sequencing and other DNA-based methods, such as PCR, are now broadly used for detection and identification of bacterial foodborne pathogens. For the identification of foodborne bacterial pathogens, it is important to make taxonomic assignments to the species, or even subspecies level. Long-read ...

  14. Confinement and the Pomeron

    International Nuclear Information System (INIS)

    White, A.R.

    1989-01-01

    The importance of confinement for obtaining a unitary high-energy limit for QCD is discussed. ''Minijets'' are argued to build up non-unitary behavior endash when k T > Λ is imposed. For minijets to mix with low k T Pomeron Field Theory describing confinement, and give consistent asymptotic behavior, new ''quarks'' must enter the theory above the minijet transverse momentum scale. The Critical Pomeron is the resulting high-energy limit. 22 refs

  15. Fusion, magnetic confinement

    International Nuclear Information System (INIS)

    Berk, H.L.

    1992-01-01

    An overview is presented of the principles of magnetic confinement of plasmas for the purpose of achieving controlled fusion conditions. Sec. 1 discusses the different nuclear fusion reactions which can be exploited in prospective fusion reactors and explains why special technologies need to be developed for the supply of tritium or 3 He, the probable fuels. In Sec. 2 the Lawson condition, a criterion that is a measure of the quality of confinement relative to achieving fusion conditions, is explained. In Sec. 3 fluid equations are used to describe plasma confinement. Specific confinement configurations are considered. In Sec. 4 the orbits of particle sin magneti and electric fields are discussed. In Sec. 5 stability considerations are discussed. It is noted that confinement systems usually need to satisfy stability constraints imposed by ideal magnetohydrodynamic (MHD) theory. The paper culminates with a summary of experimental progress in magnetic confinement. Present experiments in tokamaks have reached the point that the conditions necessary to achieve fusion are being satisfied

  16. Topological and metric properties of linear and circular DNA chains in nano-slits and nano-channels

    Science.gov (United States)

    Orlandini, Enzo; Micheletti, Cristian

    2014-03-01

    Motivated by recent advancements in single DNA molecule experiments, based on nanofluidic devices, we investigate numerically the metric and topological properties of a modelof open and circular DNA chains confined inside nano-slits and nano-channles. The results reveal an interesting characterization of the metric crossover behaviour in terms of the abundance, type and length of occuring knots. In particular we find that the knotting probability is nonmonotonic for increasing confinement and can be largely enhanced or suppressed, compared to the bulk case, by simply varying the slit or channel trasversal dimension. The observed knot population consists of knots that are far simpler than for DNA chains in spherical (i.e. cavities or capsids) confinement. These results suggest that nanoslits and nanochannels can be properly designed to produce open DNA chains hosting simple knots or to sieve DNA rings according to their knotted state. Finally we discuss the implications that the presence of knots may have on the dynamical properties of confined DNA chains such as chain elongation, injection/ejection processes and entanglement relaxation. We acknowledge financial support from the Italian ministry of education, grant PRIN 2010HXAW77.

  17. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  18. Production of highly knotted DNA by means of cosmid circularization inside phage capsids

    Directory of Open Access Journals (Sweden)

    Trigueros Sonia

    2007-12-01

    Full Text Available Abstract Background The formation of DNA knots is common during biological transactions. Yet, functional implications of knotted DNA are not fully understood. Moreover, potential applications of DNA molecules condensed by means of knotting remain to be explored. A convenient method to produce abundant highly knotted DNA would be highly valuable for these studies. Results We had previously shown that circularization of the 11.2 kb linear DNA of phage P4 inside its viral capsid generates complex knots by the effect of confinement. We demonstrate here that this mechanism is not restricted to the viral genome. We constructed DNA cosmids as small as 5 kb and introduced them inside P4 capsids. Such cosmids were then recovered as a complex mixture of highly knotted DNA circles. Over 250 μg of knotted cosmid were typically obtained from 1 liter of bacterial culture. Conclusion With this biological system, DNA molecules of varying length and sequence can be shaped into very complex and heterogeneous knotted forms. These molecules can be produced in preparative amounts suitable for systematic studies and applications.

  19. ATR confinement leakage determination

    International Nuclear Information System (INIS)

    Kuan, P.; Buescher, B.J.

    1998-01-01

    The air leakage rate from the Advanced Test Reactor (ATR) confinement is an important parameter in estimating hypothesized accidental releases of radiation to the environment. The leakage rate must be determined periodically to assure that the confinement has not degraded with time and such determination is one of the technical safety requirements of ATR operation. This paper reviews the methods of confinement leakage determination and presents an analysis of leakage determination under windy conditions, which can complicate the interpretation of the determined leakage rates. The paper also presents results of analyses of building air exchange under windy conditions. High wind can enhance air exchange and this could increase the release rates of radioisotopes following an accident

  20. Confinement of quarks

    International Nuclear Information System (INIS)

    Nambu, J.

    1978-01-01

    Three quark models of hadron structure, which suggest an explanation of quarks confinement mechanism in hadrons are considered. Quark classifications, quark flawors and colours, symmetry model of hadron structure based on the colour theory of strong interaction are discussed. Diagrams of colour combinations of quarks and antiquarks, exchange of gluons, binding quarks in hadron. Quark confinement models based on the field theory, string model rotating and bag model are discussed. Diagrams of the colour charge distribution explaining the phenomena of infrared ''slavery'' and ultraviolet ''freedom'' are given. The models considered explain but some quark properties, creating prerequisites for the development of the consequent theory of hadron structure

  1. Direction of Intercalation of a bis-Ru(II) Complex to DNA Probed by a Minor Groove Binding Molecule 4',6-Diamidino-2-phenylindole

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)

    2013-10-15

    Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.

  2. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  3. The effect of volume exclusion on the formation of DNA minicircle networks: implications to kinetoplast DNA

    International Nuclear Information System (INIS)

    Diao, Y; Hinson, K; Sun, Y; Arsuaga, J

    2015-01-01

    Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the

  4. The effect of volume exclusion on the formation of DNA minicircle networks: implications to kinetoplast DNA

    Science.gov (United States)

    Diao, Y.; Hinson, K.; Sun, Y.; Arsuaga, J.

    2015-10-01

    Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the

  5. Confinement for More Space

    DEFF Research Database (Denmark)

    Kipnusu, Wycliffe K.; Elsayed, Mohamed; Kossack, Wilhelm

    2015-01-01

    Broadband dielectric spectroscopy and positron annihilation lifetime spectroscopy are employed to study the molecular dynamics and effective free volume of 2-ethyl-1-hexanol (2E1H) in the bulk state and when confined in unidirectional nanopores with average diameters of 4, 6, and 8 nm. Enhanced α...

  6. Disorder parameter of confinement

    International Nuclear Information System (INIS)

    Nakamura, N.; Ejiri, S.; Matsubara, Y.; Suzuki, T.

    1996-01-01

    The disorder parameter of confinement-deconfinement phase transition based on the monopole action determined previously in SU(2) QCD are investigated. We construct an operator which corresponds to the order parameter defined in the abelian Higgs model. The operator shows proper behaviors as the disorder parameter in the numerical simulations of finite temperature QCD. (orig.)

  7. On confinement and duality

    Energy Technology Data Exchange (ETDEWEB)

    Strassler, M J [University of Pennsylvania, Philadelphia, PA (United States)

    2002-05-15

    Confinement in four-dimensional gauge theories is considered from several points of view. General features are discussed, and the mechanism of confinement is investigated. Dualities between field theories, and duality between field theory and string theory, are both put to use. In these lectures I have given an overview of some of the key ideas underlying confinement as a property of field theory, and now, of string theory as well. This is a tiny fraction of what field theory (and now string theory) is capable of, and we are still uncovering new features on a monthly basis. In fact, most field theories do not have confinement, for reasons entirely different from those of QCD. Many become nontrivial conformal field theories at low energy. Others become composite, weakly-coupled gauge theories. Dualities of many stripes are found everywhere. Ordinary dimensional analysis in string theory is totally wrong in the regime where it looks like weakly-coupled field theory, and ordinary dimensional analysis in field theory is totally wrong in the regime where it looks like weakly-coupled supergravity.

  8. cDNA cloning and expression of a human platelet-derived growth factor (PDGF) receptor specific for B-chain-containing PDGF molecules

    International Nuclear Information System (INIS)

    Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.

    1988-01-01

    The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA

  9. Towards characterization of DNA structure under physiological conditions in vivo at the single-molecule level using single-pair FRET

    Czech Academy of Sciences Publication Activity Database

    Fessl, Tomáš; Adamec, František; Polívka, Tomáš; Foldynová-Trantírková, Silvie; Vácha, František; Trantírek, L.

    2012-01-01

    Roč. 40, č. 16 (2012), s. 10 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z50510513; CEZ:AV0Z60220518 Keywords : in-cell FRET * fluorescence * DNA * nucleic acid * ATTO * in vivo Subject RIV: BO - Biophysics Impact factor: 8.278, year: 2012

  10. Site-directed mutational analysis of structural interactions of low molecule compounds binding to the N-terminal 8 kDa domain of DNA polymerase β

    International Nuclear Information System (INIS)

    Murakami, Shizuka; Kamisuki, Shinji; Takata, Kei-ichi; Kasai, Nobuyuki; Kimura, Seisuke; Mizushina, Yoshiyuki; Ohta, Keisuke; Sugawara, Fumio; Sakaguchi, Kengo

    2006-01-01

    We previously reported the mode of inhibition of DNA polymerase β (pol. β) by long chain fatty acids and a bile acid, involving binding analyses to the N-terminal 8-kDa DNA binding domain. Here we describe a site-directed mutational analysis in which the key amino acids (L11, K35, H51, K60, L77, and T79), which are direct interaction sites in the domain, were substituted with K, A, A, A, K, and A, respectively. And their pol. β interactions with a C24-long chain fatty acid, nervonic acid (NA), and a bile acid, lithocholic acid (LCA), were investigated by gel mobility shift assay and NMR spectroscopy. In the case of K35A, there was complete loss of DNA binding activity while K60A hardly has any activity. In contrast the other mutations had no appreciable effects. Thus, K35 and K60 are key amino acid sites for binding to template DNA. The DNA binding activities of L11K, H51A, and T79A as well as the wild type were inhibited by NA to the same extent. T79A demonstrated a disturbed interaction with LCA. 1 H- 15 N HSQC NMR analysis indicated that despite their many similarities, the wild-type and the mutant proteins displayed some significant chemical shift differences. Not only were the substituted amino acid residues three-dimensionally shifted, but some amino acids which are positioned far distant from the key amino acids showed a shift. These results suggest that the interaction surface was significantly distorted with the result that LCA could not bind to the domain. These findings confirm our previous biochemical and 3D structural proposals concerning inhibition by NA and LCA

  11. DNA origami based Au–Ag-core–shell nanoparticle dimers with single-molecule SERS sensitivity† †Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA bands, SEM images, additional AFM images, FDTD simulations, additional reference spectra for Cy3 and detailed description of EF estimation, simulated absorption and scattering spectra. See DOI: 10.1039/c5nr08674d Click here for additional data file.

    Science.gov (United States)

    Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.

    2016-01-01

    DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. PMID:26892770

  12. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  13. Direct Probing of Solvent Accessibility and Mobility at the Binding Interface of Polymerase (Dpo4)-DNA Complex

    OpenAIRE

    Qin, Yangzhong; Yang, Yi; Zhang, Luyuan; Fowler, Jason D.; Qiu, Weihong; Wang, Lijuan; Suo, Zucai; Zhong, Dongping

    2013-01-01

    Water plays essential structural and dynamical roles in protein-DNA recognition through contributing to enthalpic or entropic stabilization of binding complex and by mediating intermolecular interactions and fluctuations for biological function. These interfacial water molecules are confined by the binding partners in nanospace but in many cases they are highly mobile and exchange with outside bulk solution. Here, we report our studies of the interfacial water dynamics in the binary and terna...

  14. Dynamics of water confined in clay minerals

    International Nuclear Information System (INIS)

    Le Caer, S.; Pommeret, S.; Renault, J.Ph.; Lima, M.; Righini, R.; Gosset, D.; Simeone, D.; Bergaya, F.

    2012-01-01

    Ultrafast infrared spectroscopy of the O-D stretching mode of dilute HOD in H 2 O probes the local environment and the hydrogen bond network of confined water. The dynamics of water molecules confined in the interlayer space of montmorillonites (Mt) and in interaction with two types of cations (Li + and Ca 2+ ) but also with the negatively charged siloxane surface are studied. The results evidence that the OD vibrational dynamics is significantly slowed down in confined media: it goes from 1.7 ps in neat water to 2.6 Ps in the case of Li + cations with two water pseudo-layers (2.2-2.3 ps in the case of Ca 2+ cations) and to 4.7 ps in the case of Li + cations with one water pseudo-layer. No significant difference between the two cations is noticed. In this 2D confined geometry (the interlayer space being about 0.6 nm for two water pseudo-layers), the relaxation time constants obtained are comparable to the ones measured in analogous concentrated salt solutions. Nevertheless, and in strong opposition to the observations performed in the liquid phase, anisotropy experiments evidence the absence of rotational motions on a 5 ps time scale, proving that the hydrogen bond network in the interlayer space of the clay mineral is locked at this time scale. (authors)

  15. Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)

    2016-10-15

    Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.

  16. Phase transitions and quark confinement

    International Nuclear Information System (INIS)

    Polyakov, A.M.; Gava, E.

    1978-02-01

    The publication collects six lectures on the following themes: quantum field theory and classical statistical mechanics, continuous symmetries, lattice gauge theories, the nature of confinement, a criterion for confinement and non-abelian Yang-Mills theories

  17. Controlling gene networks and cell fate with precision-targeted DNA-binding proteins and small-molecule-based genome readers.

    Science.gov (United States)

    Eguchi, Asuka; Lee, Garrett O; Wan, Fang; Erwin, Graham S; Ansari, Aseem Z

    2014-09-15

    Transcription factors control the fate of a cell by regulating the expression of genes and regulatory networks. Recent successes in inducing pluripotency in terminally differentiated cells as well as directing differentiation with natural transcription factors has lent credence to the efforts that aim to direct cell fate with rationally designed transcription factors. Because DNA-binding factors are modular in design, they can be engineered to target specific genomic sequences and perform pre-programmed regulatory functions upon binding. Such precision-tailored factors can serve as molecular tools to reprogramme or differentiate cells in a targeted manner. Using different types of engineered DNA binders, both regulatory transcriptional controls of gene networks, as well as permanent alteration of genomic content, can be implemented to study cell fate decisions. In the present review, we describe the current state of the art in artificial transcription factor design and the exciting prospect of employing artificial DNA-binding factors to manipulate the transcriptional networks as well as epigenetic landscapes that govern cell fate.

  18. Qualitative quark confinement

    International Nuclear Information System (INIS)

    Jackson, T.L.

    1976-01-01

    The infrared limit in asymptotically free non-abelian gauge theories using recently developed non-perturbative methods which allow derivation of zero momentum theorems for Green's functions and vertices is described. These low-energy theorems are compared to the infrared behavior predicted from the renormalization group equation when the existence of an infrared fixed point is assumed. A set of objects is exhibited whose low energy theorems violate the scaling behavior predicted by the renormalization group. This shows that the assumed fixed point cannot exist and that in the Landau gauge the effective charge becomes infinite in the infrared. Qualitatively this implies that as an attempt is made to separate elementary quanta the interaction between the quanta becomes arbitrarily strong. This indicates at least that the theories studied are capable of color confinement. Results are true only for theories with large numbers of quarks. This opens the possibility that large numbers of quarks are actually necessary for confinement

  19. Topological confinement and superconductivity

    Energy Technology Data Exchange (ETDEWEB)

    Al-hassanieh, Dhaled A [Los Alamos National Laboratory; Batista, Cristian D [Los Alamos National Laboratory

    2008-01-01

    We derive a Kondo Lattice model with a correlated conduction band from a two-band Hubbard Hamiltonian. This mapping allows us to describe the emergence of a robust pairing mechanism in a model that only contains repulsive interactions. The mechanism is due to topological confinement and results from the interplay between antiferromagnetism and delocalization. By using Density-Matrix-Renormalization-Group (DMRG) we demonstrate that this mechanism leads to dominant superconducting correlations in aID-system.

  20. Innovative confinement concepts workshop

    International Nuclear Information System (INIS)

    Kirkpatrick, R.C.

    1998-01-01

    The Innovative Confinement Concepts Workshop occurred in California during the week preceding the Second Symposium on Current Trends in International Fusion Research. An informal report was made to the Second Symposium. A summary of the Workshop concluded that some very promising ideas were presented, that innovative concept development is a central element of the restructured US DOE. Fusion Energy Sciences program, and that the Workshop should promote real scientific progress in fusion

  1. Confined exciton spectroscopy

    International Nuclear Information System (INIS)

    Torres, Clivia M.S.

    1998-01-01

    Full text: In this work, the exciton is considered as a sensor of the electronic and optical properties of materials such as semiconductors, which have size compared to the exciton De Broglie wavelength, approximately 20 nm, depending on the semiconductor. Examples of electron-phonon, electron-electron, photon-electron, exciton-polariton, phonon-plasmon, are presented, under different confinement conditions such as quantum wells, superlattices

  2. Helical Confinement Concepts

    Energy Technology Data Exchange (ETDEWEB)

    Beidler, C; Brakel, R; Burhenn, R; Dinklage, A; Erckmann, V; Feng, Y; Geiger, J; Hartmann, D; Hirsch, M; Jaenicke, R; Koenig, R; Laqua, H P; Maassberg, H; Wagner, F; Weller, A; Wobig, H [Max-Planck Institut fuer Plasmaphysik, EURATOM Association, Greifswald (Germany)

    2012-09-15

    Stellarators, conceived 1951 by Lyman Spitzer in Princeton, are toroidal devices that confine a plasma in a magnetic field which originates from currents in coils outside the plasma. A plasma current driven by external means, for example by an ohmic transformer, is not required for confinement. Supplying the desired poloidal field component by external coils leads to a helically structured plasma topology. Thus stellarators - or helical confinement devices - are fully three-dimensional in contrast to the toroidal (rotational) symmetry of tokamaks. As stellarators can be free of an inductive current, whose radial distribution depends on the plasma parameters, their equilibrium must not be established via the evolving plasma itself, but to a first order already given by the vacuum magnetic field. They do not need an active control (like positional feedback) and therefore cannot suffer from its failure. The outstanding conceptual advantage of stellarators is the potential of steady state plasma operation without current drive. As there is no need for current drive, the recirculating power is expected to be smaller than in equivalent tokamaks. The lack of a net current avoids current driven instabilities; specifically, no disruptions, no resistive wall modes and no conventional or neoclassical tearing modes appear. Second order pressure-driven currents (Pfirsch-Schlueter, bootstrap) exist but they can be modified and even minimized by the magnetic design. The magnetic configuration of helical devices naturally possesses a separatrix, which allows the implementation of a helically structured divertor for exhaust and impurity control. (author)

  3. The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.

    Science.gov (United States)

    Rubinovich, Leonid; Polak, Micha

    2013-05-08

    Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.

  4. Pattern replication by confined dewetting

    NARCIS (Netherlands)

    Harkema, S.; Schäffer, E.; Morariu, M.D.; Steiner, U

    2003-01-01

    The dewetting of a polymer film in a confined geometry was employed in a pattern-replication process. The instability of dewetting films is pinned by a structured confining surface, thereby replicating its topographic pattern. Depending on the surface energy of the confining surface, two different

  5. Resolving Fast, Confined Diffusion in Bacteria with Image Correlation Spectroscopy.

    Science.gov (United States)

    Rowland, David J; Tuson, Hannah H; Biteen, Julie S

    2016-05-24

    By following single fluorescent molecules in a microscope, single-particle tracking (SPT) can measure diffusion and binding on the nanometer and millisecond scales. Still, although SPT can at its limits characterize the fastest biomolecules as they interact with subcellular environments, this measurement may require advanced illumination techniques such as stroboscopic illumination. Here, we address the challenge of measuring fast subcellular motion by instead analyzing single-molecule data with spatiotemporal image correlation spectroscopy (STICS) with a focus on measurements of confined motion. Our SPT and STICS analysis of simulations of the fast diffusion of confined molecules shows that image blur affects both STICS and SPT, and we find biased diffusion rate measurements for STICS analysis in the limits of fast diffusion and tight confinement due to fitting STICS correlation functions to a Gaussian approximation. However, we determine that with STICS, it is possible to correctly interpret the motion that blurs single-molecule images without advanced illumination techniques or fast cameras. In particular, we present a method to overcome the bias due to image blur by properly estimating the width of the correlation function by directly calculating the correlation function variance instead of using the typical Gaussian fitting procedure. Our simulation results are validated by applying the STICS method to experimental measurements of fast, confined motion: we measure the diffusion of cytosolic mMaple3 in living Escherichia coli cells at 25 frames/s under continuous illumination to illustrate the utility of STICS in an experimental parameter regime for which in-frame motion prevents SPT and tight confinement of fast diffusion precludes stroboscopic illumination. Overall, our application of STICS to freely diffusing cytosolic protein in small cells extends the utility of single-molecule experiments to the regime of fast confined diffusion without requiring advanced

  6. Single Molecule Nano-Metronome

    Science.gov (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  7. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  8. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  9. Direct identification of antibiotic resistance genes on single plasmid molecules using CRISPR/Cas9 in combination with optical DNA mapping

    Science.gov (United States)

    Müller, Vilhelm; Rajer, Fredrika; Frykholm, Karolin; Nyberg, Lena K.; Quaderi, Saair; Fritzsche, Joachim; Kristiansson, Erik; Ambjörnsson, Tobias; Sandegren, Linus; Westerlund, Fredrik

    2016-12-01

    Bacterial plasmids are extensively involved in the rapid global spread of antibiotic resistance. We here present an assay, based on optical DNA mapping of single plasmids in nanofluidic channels, which provides detailed information about the plasmids present in a bacterial isolate. In a single experiment, we obtain the number of different plasmids in the sample, the size of each plasmid, an optical barcode that can be used to identify and trace the plasmid of interest and information about which plasmid that carries a specific resistance gene. Gene identification is done using CRISPR/Cas9 loaded with a guide-RNA (gRNA) complementary to the gene of interest that linearizes the circular plasmids at a specific location that is identified using the optical DNA maps. We demonstrate the principle on clinically relevant extended spectrum beta-lactamase (ESBL) producing isolates. We discuss how the gRNA sequence can be varied to obtain the desired information. The gRNA can either be very specific to identify a homogeneous group of genes or general to detect several groups of genes at the same time. Finally, we demonstrate an example where we use a combination of two gRNA sequences to identify carbapenemase-encoding genes in two previously not characterized clinical bacterial samples.

  10. Vibrational, structural and electronic properties investigation by DFT calculations and molecular docking studies with DNA topoisomerase II of strychnobrasiline type alkaloids: A theoretical approach for potentially bioactive molecules

    Science.gov (United States)

    Costa, Renyer A.; Oliveira, Kelson M. T.; Costa, Emmanoel Vilaça; Pinheiro, Maria L. B.

    2017-10-01

    A combined experimental and theoretical DFT study of the structural, vibrational and electronic properties of strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline is presented using the Becke three-parameter Lee-Yang-Parr function (B3LYP) and 6-311G(2d,p) basis set. The theoretical geometry optimization data were compared with the X-ray data for a similar structure in the associated literature, showing close values. The calculated HOMO-LUMO gap values showed that the presence of substituents in the benzene ring influences the quantum properties which are directly related to the reactive properties. Theoretical UV spectra agreed well with the measured experimental data, with bands assigned. In addition, Natural Bond Orbitals (NBOs), Mapped molecular electrostatic potential surface (MEPS) and NLO calculations were also performed at the same theory level. The theoretical vibrational analysis revealed several characteristic vibrations that may be used as a diagnostic tool for other strychnobrasiline type alkaloids, simplifying their identification and structural characterization. Molecular docking calculations with DNA Topoisomerase II-DNA complex showed binding free energies values of -8.0 and -9.5 kcal/mol for strychnobrasiline and 12-hydroxy-10,11-dimethoxystrychnobrasiline respectively, while for amsacrine, used for the treatment of leukemia, the binding free energy ΔG presented a value of -10.0 kcal/mol, suggesting that strychnobrasiline derivative alkaloids might exhibit an antineoplastic activity.

  11. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  12. Nonlinear microrheology and molecular imaging to map microscale deformations of entangled DNA networks

    Science.gov (United States)

    Wu, Tsai-Chin; Anderson, Rae

    We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.

  13. Inertial confinement fusion (ICF)

    International Nuclear Information System (INIS)

    Nuckolls, J.

    1977-01-01

    The principal goal of the inertial confinement fusion program is the development of a practical fusion power plant in this century. Rapid progress has been made in the four major areas of ICF--targets, drivers, fusion experiments, and reactors. High gain targets have been designed. Laser, electron beam, and heavy ion accelerator drivers appear to be feasible. Record-breaking thermonuclear conditions have been experimentally achieved. Detailed diagnostics of laser implosions have confirmed predictions of the LASNEX computer program. Experimental facilities are being planned and constructed capable of igniting high gain fusion microexplosions in the mid 1980's. A low cost long lifetime reactor design has been developed

  14. Confinement and 4-manifolds

    CERN Multimedia

    CERN. Geneva

    2014-01-01

    In this talk I will survey a connection between two very challenging problems, one in physics and one in math. The physics problem involves quantitative understanding of confinement in a system with least amount of supersymmetry that has been studied so far and that has a wide range of applications, from semi-realistic string models to qualitatively new examples of gauge-gravity duality. Surprisingly, the rich physics of this system translates into incredibly rich mathematics of the only remaining unsolved case of the Poincare conjecture.

  15. Hadrosynthesis and Quark Confinement

    Directory of Open Access Journals (Sweden)

    Satz Helmut

    2014-04-01

    Full Text Available Multihadron production in high energy collisions, from e+e− annihilation to heavy ion interactions, shows remarkable thermal behaviour, specified by a universal “Hagedorn” temperature. We argue that this hadronic radiation is formed by tunnelling through the event horizon of colour confinement, i.e., that it is the QCD counterpart of Hawking-Unruh radiation from black holes. It is shown to be emitted at a universal temperature TH ≃ (σ/2π1/2, where σ denotes the string tension. Since the event horizon does not allow information transfer, the radiation is thermal “at birth”.

  16. Minimal quantization and confinement

    International Nuclear Information System (INIS)

    Ilieva, N.P.; Kalinowskij, Yu.L.; Nguyen Suan Han; Pervushin, V.N.

    1987-01-01

    A ''minimal'' version of the Hamiltonian quantization based on the explicit solution of the Gauss equation and on the gauge-invariance principle is considered. By the example of the one-particle Green function we show that the requirement for gauge invariance leads to relativistic covariance of the theory and to more proper definition of the Faddeev - Popov integral that does not depend on the gauge choice. The ''minimal'' quantization is applied to consider the gauge-ambiguity problem and a new topological mechanism of confinement

  17. Strand Invasion Based Amplification (SIBA®): a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Science.gov (United States)

    Hoser, Mark J; Mansukoski, Hannu K; Morrical, Scott W; Eboigbodin, Kevin E

    2014-01-01

    Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR) in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA). SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO) into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  18. Strand Invasion Based Amplification (SIBA®: a novel isothermal DNA amplification technology demonstrating high specificity and sensitivity for a single molecule of target analyte.

    Directory of Open Access Journals (Sweden)

    Mark J Hoser

    Full Text Available Isothermal nucleic acid amplification technologies offer significant advantages over polymerase chain reaction (PCR in that they do not require thermal cycling or sophisticated laboratory equipment. However, non-target-dependent amplification has limited the sensitivity of isothermal technologies and complex probes are usually required to distinguish between non-specific and target-dependent amplification. Here, we report a novel isothermal nucleic acid amplification technology, Strand Invasion Based Amplification (SIBA. SIBA technology is resistant to non-specific amplification, is able to detect a single molecule of target analyte, and does not require target-specific probes. The technology relies on the recombinase-dependent insertion of an invasion oligonucleotide (IO into the double-stranded target nucleic acid. The duplex regions peripheral to the IO insertion site dissociate, thereby enabling target-specific primers to bind. A polymerase then extends the primers onto the target nucleic acid leading to exponential amplification of the target. The primers are not substrates for the recombinase and are, therefore unable to extend the target template in the absence of the IO. The inclusion of 2'-O-methyl RNA to the IO ensures that it is not extendible and that it does not take part in the extension of the target template. These characteristics ensure that the technology is resistant to non-specific amplification since primer dimers or mis-priming are unable to exponentially amplify. Consequently, SIBA is highly specific and able to distinguish closely-related species with single molecule sensitivity in the absence of complex probes or sophisticated laboratory equipment. Here, we describe this technology in detail and demonstrate its use for the detection of Salmonella.

  19. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  20. Nanoscale Trapping and Squeeze-Out of Confined Alkane Monolayers.

    Science.gov (United States)

    Gosvami, N N; O'Shea, S J

    2015-12-01

    We present combined force curve and conduction atomic force microscopy (AFM) data for the linear alkanes CnH2n+2 (n = 10, 12, 14, 16) confined between a gold-coated AFM tip and a graphite surface. Solvation layering is observed in the force curves for all liquids, and conduction AFM is used to study in detail the removal of the confined (mono)layer closest to the graphite surface. The squeeze-out behavior of the monolayer can be very different depending upon the temperature. Below the monolayer melting transition temperatures the molecules are in an ordered state on the graphite surface, and fast and complete removal of the confined molecules is observed. However, above the melting transition temperature the molecules are in a disordered state, and even at large applied pressure a few liquid molecules are trapped within the tip-sample contact zone. These findings are similar to a previous study for branched alkanes [ Gosvami Phys. Rev. Lett. 2008, 100, 076101 ], but the observation for the linear alkane homologue series demonstrates clearly the dependence of the squeeze-out and trapping on the state of the confined material.

  1. Greater-confinement disposal

    International Nuclear Information System (INIS)

    Trevorrow, L.E.; Schubert, J.P.

    1989-01-01

    Greater-confinement disposal (GCD) is a general term for low-level waste (LLW) disposal technologies that employ natural and/or engineered barriers and provide a degree of confinement greater than that of shallow-land burial (SLB) but possibly less than that of a geologic repository. Thus GCD is associated with lower risk/hazard ratios than SLB. Although any number of disposal technologies might satisfy the definition of GCD, eight have been selected for consideration in this discussion. These technologies include: (1) earth-covered tumuli, (2) concrete structures, both above and below grade, (3) deep trenches, (4) augered shafts, (5) rock cavities, (6) abandoned mines, (7) high-integrity containers, and (8) hydrofracture. Each of these technologies employ several operations that are mature,however, some are at more advanced stages of development and demonstration than others. Each is defined and further described by information on design, advantages and disadvantages, special equipment requirements, and characteristic operations such as construction, waste emplacement, and closure

  2. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  3. Spectrally resolved single-molecule electrometry

    Science.gov (United States)

    Ruggeri, F.; Krishnan, M.

    2018-03-01

    Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.

  4. Some Aspects of Nonlinearity and Self-Organization In Biosystems on Examples of Localized Excitations in the DNA Molecule and Generalized Fisher–KPP Model

    Directory of Open Access Journals (Sweden)

    A. V. Shapovalov

    2018-02-01

    Full Text Available This review deals with ideas and approaches to nonlinear phenomena, based on different branches of physics and related to biological systems, that focus on how small impacts can significantly change the state of the system at large spatial scales. This problem is very extensive, and it cannot be fully resolved in this paper. Instead, some selected physical effects are briefly reviewed. We consider sine-Gordon solitons and nonlinear Schrodinger solitons in some models of DNA as examples of self-organization at the molecular level, as well as examine features of their formation and dynamics under the influence of external influences. In addition, the formation of patterns in the generalized Fisher–KPP model is viewed as a simple example of self-organization in a system with nonlocal interaction at the cellular level. Symmetries of model equations are employed to analyze the considered nonlinear phenomena. In this context the possible relations between phenomena considered and released activity effect, which is assessed differently in the literature, are discussed.

  5. A novel small molecule inhibits STAT3 phosphorylation and DNA binding activity and exhibits potent growth suppressive activity in human cancer cells

    Directory of Open Access Journals (Sweden)

    Lin Li

    2010-08-01

    Full Text Available Abstract Background Targeting Signal Transducer and Activator of Transcription 3 (STAT3 signaling is an attractive therapeutic approach for most types of human cancers with constitutively activated STAT3. A novel small molecular STAT3 inhibitor, FLLL32 was specifically designed from dietary agent, curcumin to inhibit constitutive STAT3 signaling in multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells. Results FLLL32 was found to be a potent inhibitor of STAT3 phosphorylation, STAT3 DNA binding activity, and the expression of STAT3 downstream target genes in vitro, leading to the inhibition of cell proliferation as well as the induction of Caspase-3 and PARP cleavages in human multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cell lines. However, FLLL32 exhibited little inhibition on some tyrosine kinases containing SH2 or both SH2 and SH3 domains, and other protein and lipid kinases using a kinase profile assay. FLLL32 was also more potent than four previously reported JAK2 and STAT3 inhibitors as well as curcumin to inhibit cell viability in these cancer cells. Furthermore, FLLL32 selectively inhibited the induction of STAT3 phosphorylation by Interleukin-6 but not STAT1 phosphorylation by IFN-γ. Conclusion Our findings indicate that FLLL32 exhibits potent inhibitory activity to STAT3 and has potential for targeting multiple myeloma, glioblastoma, liver cancer, and colorectal cancer cells expressing constitutive STAT3 signaling.

  6. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  7. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  8. Regulating DNA Self-assembly by DNA-Surface Interactions.

    Science.gov (United States)

    Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

    2017-12-14

    DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Inertial confinement fusion target

    International Nuclear Information System (INIS)

    Bourdier, A.

    2001-12-01

    A simple, zero-dimensional model describing the temporal behaviour of an imploding-shell, magnetized fuel inertial confinement fusion target is formulated. The addition of a magnetic field to the fuel reduces thermal conduction losses. As a consequence, it might lead to high gains and reduce the driver requirements. This beneficial effect of the magnetic field on thermonuclear gains is confirmed qualitatively by the zero-dimensional model results. Still, the extent of the initial-condition space for which significant gains can occur is not, by far, as large as previously reported. One-dimensional CEA code simulations which confirm this results are also presented. Finally, we suggest to study the approach proposed by Hasegawa. In this scheme, the laser target is not imploded, and the life-time of the plasma can be very much increased. (author)

  10. Femtochemistry of confined water

    Science.gov (United States)

    Douhal, A.; Carranza, M. A.; Sanz, M.; Organero, J. A.; Santos, L.

    In this contribution, we applied ultrafast spectroscopy to study the H-bond network of water confined in nanostructures (Cyclodextrins and Micelles). We examine the effect of caging on ultrafast reaction dynamics and discuss the related processes under different experimental conditions. The results show an ultrafast dynamic giving birth to intermediates of the probe, which show femtosecond and picosecond dynamics leading to the final structure at the excited state. The results show the high sensitivity of the used technique in detecting small of water. This work was supported by the Ministry of Science and Technology (MCYT, Spain) and ``Conserjería de Ciencia y Tecnologia de la JCCM, Spain'' through projects MAT2002-01829 and PAI-02-004.

  11. Section 1. Confinement systems

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    Major experimental and theoretical results achieved by the Controlled Thermonuclear Research (CTR) program at Lawrence Livermore Laboratory during FY 1975 gave the greatest encouragement to date that the ultimate goal of a deuterium-tritium-fueled mirror reactor can be reached. In the experimental program, the year was characterized by unusually important physics results from the 2XIIB experiment and by significant steps in the plan to change the Baseball II mode of operation. The stabilization of ion-cyclotron instabilities in the 2XIIB experiment by the introduction of an auxiliary warm plasma permitted the buildup of a high-temperature, high-density plasma with an n tau parameter an order of magnitude larger than the 2XII experiment.I In the Baseball II experiment, preliminary tests and computer predictions indicated that a dense, transient, target plasma can be created by laser irradiation of a pellet in midflight through the center of the Baseball confinement zone

  12. Superfluid response of two-dimensional parahydrogen clusters in confinement

    Energy Technology Data Exchange (ETDEWEB)

    Idowu, Saheed; Boninsegni, Massimo [Department of Physics, University of Alberta, Edmonton, Alberta T6G 2E7 (Canada)

    2015-04-07

    We study by computer simulations the effect of confinement on the superfluid properties of small two-dimensional (2D) parahydrogen clusters. For clusters of fewer than twenty molecules, the superfluid response in the low temperature limit is found to remain comparable in magnitude to that of free clusters, within a rather wide range of depth and size of the confining well. The resilience of the superfluid response is attributable to the “supersolid” character of these clusters. We investigate the possibility of establishing a bulk 2D superfluid “cluster crystal” phase of p-H{sub 2}, in which a global superfluid response would arise from tunnelling of molecules across adjacent unit cells. The computed energetics suggests that for clusters of about ten molecules, such a phase may be thermodynamically stable against the formation of the equilibrium insulating crystal, for values of the cluster crystal lattice constant possibly allowing tunnelling across adjacent unit cells.

  13. Single Molecule Nano-Metronome

    OpenAIRE

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2006-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

  14. Fiscal 1999 project for research and development of industrial and scientific technologies. Report on the achievements on the 'research and development of an ultimate atom and molecule manipulation technology' (Development of a technology to analyze and manipulate DNAs at high efficiency); 1999 nendo genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho. DNA nado kokoritsu kaiseki sosa gijutsu kaihatsu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    In the 'research and development of an ultimate atom and molecule manipulation technology', research has been made on an organic atom and molecule identification and manipulation technology and a dynamic organic molecule simulation technology. This paper summarizes the achievements in fiscal 1999. In the magnetic force controlling AFM for the force spectroscopy aimed at non-destructive atom and molecule identification, a prototype cantilever was fabricated that can excite and detect displacement in lateral direction and is suitable for friction measurement. The SrO surface and TiO2 surface of SrTiO{sub 3}. A carbon nano-tube was employed as a probe. In addition, the molecule inserting SAM technology was used to have developed a technology to measure electric conductivity inside and between molecules. With an aim at realizing a high-speed DNA base arrangement analyzing method, research is being performed upon noticing the single molecule method based on the light measuring method using the single molecule imaging as the base and the scanning probe microscope method. For the dynamic organic molecule simulation technology, theoretical analysis was advanced on synthesis of methanol on copper surface. (NEDO)

  15. Confinement at large-N

    International Nuclear Information System (INIS)

    Klinkhamer, F.R.

    1985-06-01

    Recent numerical results indicate that QCD in the limit of an infinite number (N) of colors also has confinement and moreover that it looks rather similar to normal QCD with N = 3 colors. This imposes severe restrictions on what the mechanism of confinement can be

  16. Nucleic Acids as Information Molecules.

    Science.gov (United States)

    McInerney, Joseph D.

    1996-01-01

    Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)

  17. Layering of confined water between two graphene sheets and its liquid–liquid transition

    International Nuclear Information System (INIS)

    Zhou Xuyan; Duan Yunrui; Wang Long; Liu Sida; Li Tao; Li Yifan; Li Hui

    2017-01-01

    Molecular dynamics (MD) simulations are performed to explore the layering structure and liquid–liquid transition of liquid water confined between two graphene sheets with a varied distance at different pressures. Both the size of nanoslit and pressure could cause the layering and liquid–liquid transition of the confined water. With increase of pressure and the nanoslit’s size, the confined water could have a more obvious layering. In addition, the neighboring water molecules firstly form chain structure, then will transform into square structure, and finally become triangle with increase of pressure. These results throw light on layering and liquid–liquid transition of water confined between two graphene sheets. (paper)

  18. Fiscal 1997 R an D project on industrial science and technology under a consignment from NEDO. R and D of the ultimate manipulation technology of atoms and molecules (high-efficiency and analysis and manipulation technology for DNA); 1997 nendo sangyo kagaku gijutsu kenkyu kaihatsu jigyo Shin energy Sangyo gijutsu Sogo Kaihatsu Kiko itaku. Genshi bunshi kyokugen sosa gijutsu no kenkyu kaihatsu seika hokokusho (DNA nado kokoritsu kaiseki sosa gijutsu kaihatsu)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This paper describes R and D of the ultimate manipulation technology of atoms and molecules (atom technology). Through the observation of super spiral DNA fixed on a spermin or spermidine treated mica substrate by AFM (atomic force microscope), fixation of DNA without any deformation in solution was clarified, and visualization of the spiral structure of DNA were successfully achieved. Manipulation of Xe atoms adsorbed on an Si(111) surface was certainly possible by using STM (scanning tunneling microscope)/atom probe equipment. A nucleation mechanism in crystal growth was studied for various organic source-molecules/GaAs(001) surface systems, and formation of high-density nuclei on the GaAs surface was achieved by accelerating the translational energy of Ga material molecules up to 6eV or more. Ziegler- Natta catalysis important for industrial polymerization of olefin molecules was precisely analyzed by first-principle dynamic simulation. A large-scale simulation of zeolite catalyst is also in promotion for methanol to gasoline conversion. 51 refs., 87 figs., 7 tabs.

  19. Gravitationally confined relativistic neutrinos

    Science.gov (United States)

    Vayenas, C. G.; Fokas, A. S.; Grigoriou, D.

    2017-09-01

    Combining special relativity, the equivalence principle, and Newton’s universal gravitational law with gravitational rather than rest masses, one finds that gravitational interactions between relativistic neutrinos with kinetic energies above 50 MeV are very strong and can lead to the formation of gravitationally confined composite structures with the mass and other properties of hadrons. One may model such structures by considering three neutrinos moving symmetrically on a circular orbit under the influence of their gravitational attraction, and by assuming quantization of their angular momentum, as in the Bohr model of the H atom. The model contains no adjustable parameters and its solution, using a neutrino rest mass of 0.05 eV/c2, leads to composite state radii close to 1 fm and composite state masses close to 1 GeV/c2. Similar models of relativistic rotating electron - neutrino pairs give a mass of 81 GeV/c2, close to that of W bosons. This novel mechanism of generating mass suggests that the Higgs mass generation mechanism can be modeled as a latent gravitational field which gets activated by relativistic neutrinos.

  20. Inertial confinement fusion

    International Nuclear Information System (INIS)

    Nuckolls, J.H.; Wood, L.L.

    1988-01-01

    Edward Teller has been a strong proponent of harnessing nuclear explosions for peaceful purposes. There are two approaches: Plowshare, which utilizes macro- explosions, and inertial confinement fusion, which utilizes microexplosions. The development of practical fusion power plants is a principal goal of the inertial program. It is remarkable that Teller's original thermonuclear problem, how to make super high yield nuclear explosions, and the opposite problem, how to make ultra low yield nuclear explosions, may both be solved by Teller's radiation implosion scheme. This paper reports on the essential physics of these two thermonuclear domains, which are separated by nine orders of magnitude in yield, provided by Teller's similarity theorem and its exceptions. Higher density makes possible thermonuclear burn of smaller masses of fuel. The leverage is high: the scale of the explosion diminishes with the square of the increase in density. The extraordinary compressibility of matter, first noticed by Teller during the Los Alamos atomic bomb program, provides an almost incredible opportunity to harness fusion. The energy density of thermonuclear fuels isentropically compressed to super high-- -densities---even to ten thousand times solid density---is small compared to the energy density at thermonuclear ignition temperatures. In small masses of fuel imploded to these super high matter densities, the energy required to achieve ignition may be greatly reduced by exploiting thermonuclear propagation from a relatively small hot spot

  1. Thermostating highly confined fluids.

    Science.gov (United States)

    Bernardi, Stefano; Todd, B D; Searles, Debra J

    2010-06-28

    In this work we show how different use of thermostating devices and modeling of walls influence the mechanical and dynamical properties of confined nanofluids. We consider a two dimensional fluid undergoing Couette flow using nonequilibrium molecular dynamics simulations. Because the system is highly inhomogeneous, the density shows strong fluctuations across the channel. We compare the dynamics produced by applying a thermostating device directly to the fluid with that obtained when the wall is thermostated, considering also the effects of using rigid walls. This comparison involves an analysis of the chaoticity of the fluid and evaluation of mechanical properties across the channel. We look at two thermostating devices with either rigid or vibrating atomic walls and compare them with a system only thermostated by conduction through vibrating atomic walls. Sensitive changes are observed in the xy component of the pressure tensor, streaming velocity, and density across the pore and the Lyapunov localization of the fluid. We also find that the fluid slip can be significantly reduced by rigid walls. Our results suggest caution in interpreting the results of systems in which fluid atoms are thermostated and/or wall atoms are constrained to be rigid, such as, for example, water inside carbon nanotubes.

  2. Structural and mechanical properties of glassy water in nanoscale confinement.

    Science.gov (United States)

    Lombardo, Thomas G; Giovambattista, Nicolás; Debenedetti, Pablo G

    2009-01-01

    We investigate the structure and mechanical properties of glassy water confined between silica-based surfaces with continuously tunable hydrophobicity and hydrophilicity by computing and analyzing minimum energy, mechanically stable configurations (inherent structures). The structured silica substrate imposes long-range order on the first layer of water molecules under hydrophobic confinement at high density (p > or = 1.0 g cm(-3)). This proximal layer is also structured in hydrophilic confinement at very low density (p approximately 0.4 g cm(-3)). The ordering of water next to the hydrophobic surface greatly enhances the mechanical strength of thin films (0.8 nm). This leads to a substantial stress anisotropy; the transverse strength of the film exceeds the normal strength by 500 MPa. The large transverse strength results in a minimum in the equation of state of the energy landscape that does not correspond to a mechanical instability, but represents disruption of the ordered layer of water next to the wall. In addition, we find that the mode of mechanical failure is dependent on the type of confinement. Under large lateral strain, water confined by hydrophilic surfaces preferentially forms voids in the middle of the film and fails cohesively. In contrast, water under hydrophobic confinement tends to form voids near the walls and fails by loss of adhesion.

  3. Decreasing the electronic confinement in layered perovskites through intercalation.

    Science.gov (United States)

    Smith, Matthew D; Pedesseau, Laurent; Kepenekian, Mikaël; Smith, Ian C; Katan, Claudine; Even, Jacky; Karunadasa, Hemamala I

    2017-03-01

    We show that post-synthetic small-molecule intercalation can significantly reduce the electronic confinement of 2D hybrid perovskites. Using a combined experimental and theoretical approach, we explain structural, optical, and electronic effects of intercalating highly polarizable molecules in layered perovskites designed to stabilize the intercalants. Polarizable molecules in the organic layers substantially alter the optical and electronic properties of the inorganic layers. By calculating the spatially resolved dielectric profiles of the organic and inorganic layers within the hybrid structure, we show that the intercalants afford organic layers that are more polarizable than the inorganic layers. This strategy reduces the confinement of excitons generated in the inorganic layers and affords the lowest exciton binding energy for an n = 1 perovskite of which we are aware. We also demonstrate a method for computationally evaluating the exciton's binding energy by solving the Bethe-Salpeter equation for the exciton, which includes an ab initio determination of the material's dielectric profile across organic and inorganic layers. This new semi-empirical method goes beyond the imprecise phenomenological approximation of abrupt dielectric-constant changes at the organic-inorganic interfaces. This work shows that incorporation of polarizable molecules in the organic layers, through intercalation or covalent attachment, is a viable strategy for tuning 2D perovskites towards mimicking the reduced electronic confinement and isotropic light absorption of 3D perovskites while maintaining the greater synthetic tunability of the layered architecture.

  4. DNA Open states and DNA hydratation

    International Nuclear Information System (INIS)

    Lema-Larre, B. de; Martin-Landrove, M

    1995-01-01

    It is a very well-known fact that an protonic exchange exists among natural DNA filaments and synthetic polynucleotides with the solvent (1--2). The existence of DNA open states, that is to say states for which the interior of the DNA molecule is exposed to the external environment, it has been demonstrated by means of proton-deuterium exchange (3). This work has carried out experiments measuring the dispersion of the traverse relaxation rate (4), as a pulsation rate function in a Carr-Purcell-Meiboom-Gill (CPMG) pulses sequence rate, to determine changes in the moist layer of the DNA molecule. The experiments were carried out under different experimental conditions in order to vary the probability that open states occurs, such as temperature or the exposure to electromagnetic fields. Some theoretical models were supposed to adjust the experimental results including those related to DNA non linear dynamic [es

  5. BY FRUSTUM CONFINING VESSEL

    Directory of Open Access Journals (Sweden)

    Javad Khazaei

    2016-09-01

    Full Text Available Helical piles are environmentally friendly and economical deep foundations that, due to environmental considerations, are excellent additions to a variety of deep foundation alternatives available to the practitioner. Helical piles performance depends on soil properties, the pile geometry and soil-pile interaction. Helical piles can be a proper alternative in sensitive environmental sites if their bearing capacity is sufficient to support applied loads. The failure capacity of helical piles in this study was measured via an experimental research program that was carried out by Frustum Confining Vessel (FCV. FCV is a frustum chamber by approximately linear increase in vertical and lateral stresses along depth from top to bottom. Due to special geometry and applied bottom pressure, this apparatus is a proper choice to test small model piles which can simulate field stress conditions. Small scale helical piles are made with either single helix or more helixes and installed in fine grained sand with three various densities. Axial loading tests including compression and tension tests were performed to achieve pile ultimate capacity. The results indicate the helical piles behavior depends essentially on pile geometric characteristics, i.e. helix configuration and soil properties. According to the achievements, axial uplift capacity of helical model piles is about equal to usual steel model piles that have the helixes diameter. Helical pile compression bearing capacity is too sufficient to act as a medium pile, thus it can be substituted other piles in special geoenvironmental conditions. The bearing capacity also depends on spacing ratio, S/D, and helixes diameter.

  6. Changes in the Zero-Point Energy of the Protons as the Source of the Binding Energy of Water to A-Phase DNA

    International Nuclear Information System (INIS)

    Reiter, G. F.; Senesi, R.; Mayers, J.

    2010-01-01

    The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6 water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Angst .

  7. Changes in the zero-point energy of the protons as the source of the binding energy of water to A-phase DNA.

    Science.gov (United States)

    Reiter, G F; Senesi, R; Mayers, J

    2010-10-01

    The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6  water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.

  8. Trapping neutral molecules in a traveling potential well

    NARCIS (Netherlands)

    Bethlem, H. L.; G. Berden,; van Roij, A. J. A.; Crompvoets, F. M. H.; Meijer, G.

    2000-01-01

    A series of pulsed electric fields can be arranged such that it creates a traveling potential well in which neutral dipolar molecules can be confined. This provides a method to transport, to decelerate, and to cool a sample of neutral molecules while maintaining the initial phase-space density. This

  9. Physics of Complex Polymeric Molecules

    Science.gov (United States)

    Kelly, Joshua Walter

    The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.

  10. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  11. Tandem mirror plasma confinement apparatus

    International Nuclear Information System (INIS)

    Fowler, T.K.

    1978-01-01

    Apparatus and method are described for confining a plasma in a center mirror cell by use of two end mirror cells as positively charged end stoppers to minimize leakage of positive particles from the ends of the center mirror cell

  12. Tandem mirror plasma confinement apparatus

    Science.gov (United States)

    Fowler, T. Kenneth

    1978-11-14

    Apparatus and method for confining a plasma in a center mirror cell by use of two end mirror cells as positively charged end stoppers to minimize leakage of positive particles from the ends of the center mirror cell.

  13. Alternate fusion -- continuous inertial confinement

    International Nuclear Information System (INIS)

    Barnes, D.C.; Turner, L.; Nebel, R.A.

    1993-01-01

    The authors argue that alternate approaches to large tokamak confinement are appropriate for fusion applications if: (1) They do not require magnetic confinement of a much higher quality than demonstrated in tokamaks; (2) Their physics basis may be succinctly stated and experimentally tested; (3) They offer near-term applications to important technical problems; and (4) Their cost to proof-of-principle is low enough to be consistent with current budget realities. An approach satisfying all of these criteria is presented. Fusion systems based on continuous inertial confinement are described. In these approaches, the inertia of a nonequilibrium plasma is used to produce local concentrations of plasma density in space and/or time. One implementation (inertial electrostatic confinement) which has been investigated both experimentally and theoretically uses a system of electrostatic grids to accelerate plasma ions toward a spherical focus. This system produced a steady 2 x 10 10 D-T neutrons/second with an overall fusion gain of 10 -5 in a sphere of about 9 cm radius. Recent theoretical developments show how to raise the fusion gain to order unity or greater by replacing the internal grids by a combination of applied magnetic and electrostatic fields. In these approaches, useful thermonuclear conditions may be produced in a system as small as a few mm radius. Confinement is that of a nonneutralized plasma. A pure electron plasma with a radial beam velocity distribution is absolutely confined by an applied Penning trap field. Spherical convergence of the confined electrons forms a deep virtual cathode near r = 0, in which thermonuclear ions are absolutely confined at useful densities. The authors have examined the equilibrium, stability, and classical relaxation of such systems, and obtained many positive physics results. Equilibria exist for both pure electron and partially charge-neutralized systems with arbitrarily high core-plasma densities

  14. Physics of inertial confinement pellets

    International Nuclear Information System (INIS)

    Mead, W.C.

    1979-01-01

    An overview of inertial confinement fusion pellet physics is given. A discussion is presented of current estimated ICF driver requirements and a couple of pellet examples. The physics of driver/plasma coupling for two drivers which are being considered, namely a laser driver and a heavy ion accelerator driver, is described. Progress towards inertial confinement fusion that has been made using laser drivers in target experiments to date is discussed

  15. Infrared slavery and quark confinement

    CERN Document Server

    Alabiso, C

    1976-01-01

    The question is considered of whether the so-called infrared slavery mechanism as, e.g., being manifest in non-Abelian gauge theories, necessarily confines quarks. Making a specific ansatz for the long- range forces, the Schwinger-Dyson equation is solved for the quark Green function. Besides having a confining solution, it appears that quarks may by-pass the long-range forces and be produced. (20 refs).

  16. Infrared slavery and quark confinement

    International Nuclear Information System (INIS)

    Alabiso, C.; Schierholz, G.

    1976-01-01

    The question of whether the so-called infrared slavery mechanism as, e.g., being manifest in non-Abelian gauge theories, necessarily confines quarks is posed. Making a specific ansatz for the long-range forces, the Schwinger-Dyson equation is solved for the quark Green function. Besides having a confining solution, it appears that quarks may by-pass the long-range forces and be produced. (Auth.)

  17. Magnetic well for plasma confinement

    International Nuclear Information System (INIS)

    Valfells, A.; Chiu, Y.C.

    1977-01-01

    A multipole magnetic well for plasma confinement includes a plurality of current-carrying coils placed on planes corresponding to the facets of a regular polyhedron that can be symmetrically circumscribed about a sphere. The direction of current in the coils is such as to minimize the flux density at the center of the polyhedron, thereby providing a confinement well with three-dimensional symmetry having an increasing flux density in all directions from the center. 16 claims, 18 figures

  18. Neutron spectroscopy for confinement studies

    International Nuclear Information System (INIS)

    Zorn, R.

    2010-01-01

    Neutron spectroscopy is an important method for the study of microscopic dynamics because it captures the spatial as well as the temporal aspects of the atomic or molecular motion. In this article techniques will be presented which are of special importance for the study of confined systems. Many of these are based on the fact that neutron scattering is isotope-dependent. Possible sources of systematic errors in measurements of confined systems will be pointed out. (author)

  19. Heme as a danger molecule in pathogen recognition.

    Science.gov (United States)

    Wegiel, Barbara; Hauser, Carl J; Otterbein, Leo E

    2015-12-01

    Appropriate control of redox mechanisms are critical for and effective innate immune response, which employs multiple cell types, receptors and molecules that recognize danger signals when they reach the host. Recognition of pathogen-associated pattern molecules (PAMPs) is a fundamental host survival mechanism for efficient elimination of invading pathogens and resolution of the infection and inflammation. In addition to PAMPs, eukaryotic cells contain a plethora of intracellular molecules that are normally secured within the confines of the plasma membrane, but if liberated and encountered in the extracellular milieu can provoke rapid cell activation. These are known as Alarmins or Danger-Associated Molecular Patterns (DAMPs) and can be released actively by cells or passively as a result of sterile cellular injury after trauma, ischemia, or toxin-induced cell rupture. Both PAMPs and DAMPs are recognized by a series of cognate receptors that increase the generation of free radicals and activate specific signaling pathways that result in regulation of a variety of stress response, redox sensitive genes. Multiple mediators released, as cells die include, but are not limited to ATP, hydrogen peroxide, heme, formyl peptides, DNA or mitochondria provide the second signal to amplify immune responses. In this review, we will focus on how sterile and infective stimuli activate the stress response gene heme oxygenase-1 (Hmox1, HO-1), a master gene critical to an appropriate host response that is now recognized as one with enormous therapeutic potential. HO-1 gene expression is regulated in large part by redox-sensitive proteins including but not limited to nrf2. Both PAMPs and DAMPs increase the activation of nrf2 and HO-1. Heme is a powerful pro-oxidant and as such should be qualified as a DAMP. With its degradation by HO-1a molecule of carbon monoxide (CO) is generated that in turn serves as a bioactive signaling molecule. PAMPs such as bacterial endotoxin activate HO-1

  20. Non-Gaussian Distribution of DNA Barcode Extension In Nanochannels Using High-throughput Imaging

    Science.gov (United States)

    Sheats, Julian; Reinhart, Wesley; Reifenberger, Jeff; Gupta, Damini; Muralidhar, Abhiram; Cao, Han; Dorfman, Kevin

    2015-03-01

    We present experimental data for the extension of internal segments of highly confined DNA using a high-­throughput experimental setup. Barcode­-labeled E. coli genomic DNA molecules were imaged at a high areal density in square nanochannels with sizes ranging from 40 nm to 51 nm in width. Over 25,000 molecules were used to obtain more than 1,000,000 measurements for genomic distances between 2,500 bp and 100,000 bp. The distribution of extensions has positive excess kurtosis and is skew­ left due to weak backfolding in the channel. As a result, the two Odijk theories for the chain extension and variance bracket the experimental data. We compared to predictions of a harmonic approximation for the confinement free energy and show that it produces a substantial error in the variance. These results suggest an inherent error associated with any statistical analysis of barcoded DNA that relies on harmonic models for chain extension. Present address: Department of Chemical and Biological Engineering, Princeton University.

  1. Theoretical Study of the Transpore Velocity Control of Single-Stranded DNA

    Directory of Open Access Journals (Sweden)

    Weixin Qian

    2014-08-01

    Full Text Available The electrokinetic transport dynamics of deoxyribonucleic acid (DNA molecules have recently attracted significant attention in various fields of research. Our group is interested in the detailed examination of the behavior of DNA when confined in micro/nanofluidic channels. In the present study, the translocation mechanism of a DNA-like polymer chain in a nanofluidic channel was investigated using Langevin dynamics simulations. A coarse-grained bead-spring model was developed to simulate the dynamics of a long polymer chain passing through a rectangular cross-section nanopore embedded in a nanochannel, under the influence of a nonuniform electric field. Varying the cross-sectional area of the nanopore was found to allow optimization of the translocation process through modification of the electric field in the flow channel, since a drastic drop in the electric potential at the nanopore was induced by changing the cross-section. Furthermore, the configuration of the polymer chain in the nanopore was observed to determine its translocation velocity. The competition between the strength of the electric field and confinement in the small pore produces various transport mechanisms and the results of this study thus represent a means of optimizing the design of nanofluidic devices for single molecule detection.

  2. A Review of Quantum Confinement

    Science.gov (United States)

    Connerade, Jean-Patrick

    2009-12-01

    A succinct history of the Confined Atom problem is presented. The hydrogen atom confined to the centre of an impenetrable sphere counts amongst the exactly soluble problems of physics, alongside much more noted exact solutions such as Black Body Radiation and the free Hydrogen atom in absence of any radiation field. It shares with them the disadvantage of being an idealisation, while at the same time encapsulating in a simple way particular aspects of physical reality. The problem was first formulated by Sommerfeld and Welker [1]—henceforth cited as SW—in connection with the behaviour of atoms at very high pressures, and the solution was published on the occasion of Pauli's 60th birthday celebration. At the time, it seemed that there was not much other connection with physical reality beyond a few simple aspects connected to the properties of atoms in solids, for which more appropriate models were soon developed. Thus, confined atoms attracted little attention until the advent of the metallofullerene, which provided the first example of a confined atom with properties quite closely related to those originally considered by SW. Since then, the problem has received much more attention, and many more new features of quantum confinement, quantum compression, the quantum Faraday cage, electronic reorganisation, cavity resonances, etc have been described, which are relevant to real systems. Also, a number of other situations have been uncovered experimentally to which quantum confinement is relevant. Thus, studies of the confined atom are now more numerous, and have been extended both in terms of the models used and the systems to which they can be applied. Connections to thermodynamics are explored through the properties of a confined two-level atom adapted from Einstein's celebrated model, and issues of dynamical screening of electromagnetic radiation by the confining shell are discussed in connection with the Faraday cage produced by a confining conducting shell

  3. A Review of Quantum Confinement

    International Nuclear Information System (INIS)

    Connerade, Jean-Patrick

    2009-01-01

    A succinct history of the Confined Atom problem is presented. The hydrogen atom confined to the centre of an impenetrable sphere counts amongst the exactly soluble problems of physics, alongside much more noted exact solutions such as Black Body Radiation and the free Hydrogen atom in absence of any radiation field. It shares with them the disadvantage of being an idealisation, while at the same time encapsulating in a simple way particular aspects of physical reality. The problem was first formulated by Sommerfeld and Welker - henceforth cited as SW - in connection with the behaviour of atoms at very high pressures, and the solution was published on the occasion of Pauli's 60th birthday celebration. At the time, it seemed that there was not much other connection with physical reality beyond a few simple aspects connected to the properties of atoms in solids, for which more appropriate models were soon developed. Thus, confined atoms attracted little attention until the advent of the metallofullerene, which provided the first example of a confined atom with properties quite closely related to those originally considered by SW. Since then, the problem has received much more attention, and many more new features of quantum confinement, quantum compression, the quantum Faraday cage, electronic reorganisation, cavity resonances, etc have been described, which are relevant to real systems. Also, a number of other situations have been uncovered experimentally to which quantum confinement is relevant. Thus, studies of the confined atom are now more numerous, and have been extended both in terms of the models used and the systems to which they can be applied. Connections to thermodynamics are explored through the properties of a confined two-level atom adapted from Einstein's celebrated model, and issues of dynamical screening of electromagnetic radiation by the confining shell are discussed in connection with the Faraday cage produced by a confining conducting shell. The

  4. BMP4 density gradient in disk-shaped confinement

    Science.gov (United States)

    Bozorgui, Behnaz; Teimouri, Hamid; Kolomeisky, Anatoly B.

    We present a quantitative model that explains the scaling of BMP4 gradients during gastrulation and the recent experimental observation that geometric confinement of human embryonic stem cells is sufficient to recapitulate much of germ layer patterning. Based on a assumption that BMP4 diffusion rate is much smaller than the diffusion rate of it's inhibitor molecules, our results confirm that the length-scale which defines germ layer territories does not depend on system size.

  5. Momentum confinement at low torque

    Energy Technology Data Exchange (ETDEWEB)

    Solomon, W M [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States); Burrell, K H [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); De Grassie, J S [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Budny, R [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States); Groebner, R J [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Kinsey, J E [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Kramer, G J [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States); Luce, T C [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Makowski, M A [Lawrence Livermore National Laboratory, Livermore, CA 94550 (United States); Mikkelsen, D [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States); Nazikian, R [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States); Petty, C C [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Politzer, P A [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Scott, S D [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States); Zeeland, M A Van [General Atomics, PO Box 85608, San Diego, CA 92186-5608 (United States); Zarnstorff, M C [Princeton Plasma Physics Laboratory, Princeton University, Princeton, NJ 08543 (United States)

    2007-12-15

    Momentum confinement was investigated on DIII-D as a function of applied neutral beam torque at constant normalized beta {beta}{sub N}, by varying the mix of co (parallel to the plasma current) and counter neutral beams. Under balanced neutral beam injection (i.e. zero total torque to the plasma), the plasma maintains a significant rotation in the co-direction. This 'intrinsic' rotation can be modeled as being due to an offset in the applied torque (i.e. an 'anomalous torque'). This anomalous torque appears to have a magnitude comparable to one co neutral beam source. The presence of such an anomalous torque source must be taken into account to obtain meaningful quantities describing momentum transport, such as the global momentum confinement time and local diffusivities. Studies of the mechanical angular momentum in ELMing H-mode plasmas with elevated q{sub min} show that the momentum confinement time improves as the torque is reduced. In hybrid plasmas, the opposite effect is observed, namely that momentum confinement improves at high torque/rotation. GLF23 modeling suggests that the role of E x B shearing is quite different between the two plasmas, which may help to explain the different dependence of the momentum confinement on torque.

  6. Phenomenology and theory of confinement

    International Nuclear Information System (INIS)

    Pervushin, V.N.

    1987-01-01

    Phenomenological and theoretical arguments of the separation of the hadronization dynamics from confinement and the idea of the ''kinematic'' confinement are discussed. The recent theory contains results which point out that the Wilson criterion and the confinement potentials are not sufficient for explaining the phenomenological confinement in the sense of zero color amplitudes or Green functions. However, these potentials well explain the hadron spectrum and spontaneous breaking of chiral symmetry, i.e., the hadronization dynamics. The ''kinematic'' confinement can be explained by the topological degeneration of all color-particle physical states in QCD. This degeneration arises if the theory is quantized by explicitly solving the gauge and dynamic constraints: all color states are defined up to gauge(phase) factors describing the map of the three-dimensional space onto SU(3) c -group (π 3 (SU(3) c =Z). The total probability of the color particle generation is equal to zero due to the destructive interference of these phase factors. As a result, in QCD there remains only a hadron sector used in the phenomenology

  7. Ground state energy of an hydrogen atom confined in carbon nano-structures: a diffusion quantum Monte Carlo study

    International Nuclear Information System (INIS)

    Molayem, M.; Tayebi-Rad, Gh.; Esmaeli, L.; Namiranian, A.; Fouladvand, M. E.; Neek-Amal, M.

    2006-01-01

    Using the diffusion quantum monte Carlo method, the ground state energy of an Hydrogen atom confined in a carbon nano tube and a C60 molecule is calculated. For Hydrogen atom confined in small diameter tubes, the ground state energy shows significant deviation from a free Hydrogen atom, while with increasing the diameter this deviation tends to zero.

  8. Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers

    KAUST Repository

    Sun, Lu

    2014-10-16

    © 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions. Here, we investigate if conformational changes induced in surface-attached DNA molecules upon ligand binding can be monitored by the quartz crystal microbalance with dissipation (QCM-D) technique. DNA duplexes containing 59-184 base pairs were formed on QCM-D crystals by stepwise assembly of synthetic oligonucleotides of designed base sequences. The DNA films were exposed to the cationic polyamines spermidine and spermine, known to condense DNA molecules in bulk experiments, or to the recombination protein Rad51, known to extend the DNA helix. The binding and dissociation of the ligands to the DNA films were monitored in real time by measurements of the shifts in resonance frequency (Δf) and in dissipation (ΔD). The QCM-D data were analyzed using a Voigt-based model for the viscoelastic properties of polymer films in order to evaluate how the ligands affect thickness and shear viscosity of the DNA layer. Binding of spermine shrinks all DNA layers and increases their viscosity in a reversible fashion, and so does spermidine, but to a smaller extent, in agreement with its lower positive charge. SPR was used to measure the amount of bound polyamines, and when combined with QCM-D, the data indicate that the layer condensation leads to a small release of water from the highly hydrated DNA films. The binding of Rad51 increases the effective layer thickness of a 59bp film, more than expected from the know 50% DNA helix extension. The combined results provide guidelines for a QCM-D biosensor based on ligand-induced structural changes in DNA films. The QCM-D approach provides high discrimination between ligands affecting the thickness and the structural properties of the DNA layer differently. The reversibility of the film

  9. Fluctuations and confinement in ATF

    International Nuclear Information System (INIS)

    Isler, R.C.; Harris, J.H.; Murakami, M.

    1993-01-01

    In the period immediately prior to the suspension of ATF operation in November, 1991, a great deal of emphasis was palced on investigations of the fundamental mechanisms controlling confinement in this device. At that time, measurements of the density fluctuations throughout the plasma volume indicated the existence of theoretically predicted dissipative trapped electron and resistive interchange instabilities. These identifications were supported by results of dynamic configuration scans of the magnetic fields during which the extent of the magnetic well, shear, and fraction of confined trapped particles were changed continuously. Interpretation of the data from these experiments has been an ongoing exercise. Most recently, analysis of discharges employing strong gas puffing to change density gradients and fluctuation levels have strengthened the view that dissipative trapped electron modes may be present but do not play a significant direct role in energy transport. The present paper summarizes the current understanding concerning the identification of instabilities and their relationship to confinement in ATF

  10. Correlations In Confined Quantum Plasmas

    International Nuclear Information System (INIS)

    Dufty, J.W.

    2012-01-01

    This is the final report for the project 'Correlations in Confined Quantum Plasmas', NSF-DOE Partnership Grant DE FG02 07ER54946, 8/1/2007 - 7/30/2010. The research was performed in collaboration with a group at Christian Albrechts University (CAU), Kiel, Germany. That collaboration, almost 15 years old, was formalized during the past four years under this NSF-DOE Partnership Grant to support graduate students at the two institutions and to facilitate frequent exchange visits. The research was focused on exploring the frontiers of charged particle physics evolving from new experimental access to unusual states associated with confinement. Particular attention was paid to combined effects of quantum mechanics and confinement. A suite of analytical and numerical tools tailored to the specific inquiry has been developed and employed

  11. Finite temperature approach to confinement

    International Nuclear Information System (INIS)

    Gave, E.; Jengo, R.; Omero, C.

    1980-06-01

    The finite temperature treatment of gauge theories, formulated in terms of a gauge invariant variable as in a Polyakov method, is used as a device for obtaining an effective theory where the confinement test takes the form of a correlation function. The formalism is discussed for the abelian CPsup(n-1) model in various dimensionalities and for the pure Yang-Mills theory in the limit of zero temperature. In the latter case a class of vortex like configurations of the effective theory which induce confinement correspond in particular to the instanton solutions. (author)

  12. Some aspects of geometrical confinement

    Energy Technology Data Exchange (ETDEWEB)

    Novello, M.; De Lorenci, V.A. [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rio de Janeiro, RJ (Brazil); Elbaz, E. [Lyon-1 Univ., 69 - Villeurbanne (France)

    1998-04-01

    In this paper we present a toy model for the dynamics of a gauge field theory in such way that spin-one particles can be confined in a compact domain. We show that the property of confinement can be associated to the formation of a null surface identified to a horizon. This is due to the presence of an effective geometry generated by the self-interaction of the gauge field that guides the wave propagation of the field. This phenomenon has a striking analogy to the gravitational black hole in Einstein general theory of relativity, separating two domains of spacetime that can be trespassed only into one direction. (author) 4 refs.

  13. Hermitian relativity, chromodynamics and confinement

    International Nuclear Information System (INIS)

    Treder, H.J.

    1983-01-01

    The extension of the Riemann metrics of General Relativity to the complex domain (substitution of the symmetry conditions for the fundamental tensor, the affinity and the Ricci curvature by the conditions of hermicity) leads to a 'Generalized Theory of Gravity' (Einstein) describing the Newton-Einstein gravodynamics combined with the chromodynamics of quarks. The interaction of gravodynamics and chromodynamics implied by the Einstein-Schroedinger field equations of the hermitian relativity theory enforces the 'confinement'. The 'confinement' prevents the gravitational potential from divergence which would result in the lack of a Riemann space-time metric

  14. Pellet injection and toroidal confinement

    International Nuclear Information System (INIS)

    1989-12-01

    The proceedings of a technical committee meeting on pellet injection and toroidal confinement, held in Gut Ising, Federal Republic of Germany, 24-26 October, 1988, are given in this report. Most of the major fusion experiments are using pellet injectors; these were reported at this meeting. Studies of confinement, which is favorably affected, impurity transport, radiative energy losses, and affects on the ion temperature gradient instability were given. Studies of pellet ablation and effects on plasma profiles were presented. Finally, several papers described present and proposed injection guns. Refs, figs and tabs

  15. CONFINEMENT OF HIGH TEMPERATURE PLASMA

    Science.gov (United States)

    Koenig, H.R.

    1963-05-01

    The confinement of a high temperature plasma in a stellarator in which the magnetic confinement has tended to shift the plasma from the center of the curved, U-shaped end loops is described. Magnetic means are provided for counteracting this tendency of the plasma to be shifted away from the center of the end loops, and in one embodiment this magnetic means is a longitudinally extending magnetic field such as is provided by two sets of parallel conductors bent to follow the U-shaped curvature of the end loops and energized oppositely on the inside and outside of this curvature. (AEC)

  16. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  17. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  18. The vibrational dynamics of carbon monoxide in a confined space-CO in zeolites.

    Science.gov (United States)

    Nachtigallová, Dana; Bludský, Ota; Otero Areán, Carlos; Bulánek, Roman; Nachtigall, Petr

    2006-11-14

    Based on theoretical calculations, and a survey of infrared spectra of CO adsorbed on different cation exchanged zeolites, a model is proposed to explain the influence of the zeolite framework on the vibrational behaviour of CO confined into small void spaces (zeolite channels and cavities). The concepts developed should help to understand a number of details relevant to both, precise interpretation of IR spectra and a better understanding of the vibrational dynamics of small molecules in a confined space.

  19. Local structural ordering in surface-confined liquid crystals

    Science.gov (United States)

    Śliwa, I.; Jeżewski, W.; Zakharov, A. V.

    2017-06-01

    The effect of the interplay between attractive nonlocal surface interactions and attractive pair long-range intermolecular couplings on molecular structures of liquid crystals confined in thin cells with flat solid surfaces has been studied. Extending the McMillan mean field theory to include finite systems, it has been shown that confining surfaces can induce complex orientational and translational ordering of molecules. Typically, local smectic A, nematic, and isotropic phases have been shown to coexist in certain temperature ranges, provided that confining cells are sufficiently thick, albeit finite. Due to the nonlocality of surface interactions, the spatial arrangement of these local phases can display, in general, an unexpected complexity along the surface normal direction. In particular, molecules located in the vicinity of surfaces can still be organized in smectic layers, even though nematic and/or isotropic order can simultaneously appear in the interior of cells. The resulting surface freezing of smectic layers has been confirmed to occur even for rather weak surface interactions. The surface interactions cannot, however, prevent smectic layers from melting relatively close to system boundaries, even when molecules are still arranged in layers within the central region of the system. The internal interfaces, separating individual liquid-crystal phases, are demonstrated here to form fronts of local finite-size transitions that move across cells under temperature changes. Although the complex molecular ordering in surface confined liquid-crystal systems can essentially be controlled by temperature variations, specific thermal properties of these systems, especially the nature of the local transitions, are argued to be strongly conditioned to the degree of molecular packing.

  20. Enhancement of confinement in tokamaks

    International Nuclear Information System (INIS)

    Furth, H.P.

    1986-05-01

    A plausible interpretation of the experimental evidence is that energy confinement in tokamaks is governed by two separate considerations: (1) the need for resistive MHD kink-stability, which limits the permissible range of current profiles - and therefore normally also the range of temperature profiles; and (2) the presence of strongly anomalous microscopic energy transport near the plasma edge, which calibrates the amplitude of the global temperature profile, thus determining the energy confinement time tau/sub E/. Correspondingly, there are two main paths towards the enhancement of tokamak confinement: (1) Configurational optimization, to increase the MHD-stable energy content of the plasma core, can evidently be pursued by varying the cross-sectional shape of the plasma and/or finding stable radial profiles with central q-values substantially below unity - but crossing from ''first'' to ''second'' stability within the peak-pressure region would have the greatest ultimate potential. (2) Suppression of edge turbulence, so as to improve the heat insulation in the outer plasma shell, can be pursued by various local stabilizing techniques, such as use of a poloidal divertor. The present confinement model and initial TFTR pellet-injection results suggest that the introduction of a super-high-density region within the plasma core should be particularly valuable for enhancing ntau/subE/. In D-T operation, a centrally peaked plasma pressure profile could possibly lend itself to alpha-particle-driven entry into the second-stability regime

  1. Frictional properties of confined polymers

    DEFF Research Database (Denmark)

    Sivebæk, Ion Marius; Samoilov, Vladimir N; Persson, Bo N J

    2008-01-01

    We present molecular dynamics friction calculations for confined hydrocarbon solids with molecular lengths from 20 to 1400 carbon atoms. Two cases are considered: a) polymer sliding against a hard substrate, and b) polymer sliding on polymer. In the first setup the shear stresses are relatively i...

  2. String theory and quark confinement

    International Nuclear Information System (INIS)

    Polyakov, A.M.

    1998-01-01

    This article is based on a talk given at the ''Strings '97'' conference. It discusses the search for the universality class of confining strings. The key ingredients include the loop equations, the zigzag symmetry, the non-linear renormalization group. Some new tests for the equivalence between gauge fields and strings are proposed. (orig.)

  3. Mirror Confinement Systems: project summaries

    International Nuclear Information System (INIS)

    1980-07-01

    This report contains descriptions of the projects supported by the Mirror Confinement Systems (MCS) Division of the Office of Fusion Energy. The individual project summaries were prepared by the principal investigators, in collaboration with MCS staff office, and include objectives and milestones for each project. In addition to project summaries, statements of Division objectives and budget summaries are also provided

  4. Effective viscosity of confined hydrocarbons

    DEFF Research Database (Denmark)

    Sivebæk, Ion Marius; Samoilov, V.N.; Persson, B.N.J.

    2012-01-01

    We present molecular dynamics friction calculations for confined hydrocarbon films with molecular lengths from 20 to 1400 carbon atoms. We find that the logarithm of the effective viscosity ηeff for nanometer-thin films depends linearly on the logarithm of the shear rate: log ηeff=C-nlog γ̇, where...

  5. Is confinement the ultimate truth

    International Nuclear Information System (INIS)

    Thirrring, W.

    1980-01-01

    This seminar discusses a field theory which leads to a r-potential and therefore to a confinement. By comparison to the instability due to a resonance phenomenon, the author concentrates on the theory's ghost problem and concludes that for some couplings this does not occur and the theory behaves reasonably

  6. Confined flow of polymer blends

    NARCIS (Netherlands)

    Tufano, C.; Peters, G.W.M.; Meijer, H.E.H.

    2008-01-01

    The influence of confinement on the steady-state morphology of two different emulsions is investigated. The blends, made from polybutene (PB) in polydimethylsiloxane (PDMS) and polybutadiene (PBD) in PDMS, are sheared between two parallel plates, mostly with a standard gap spacing of 40 m, in the

  7. Two flavor QCD and Confinement

    DEFF Research Database (Denmark)

    D'Elia, M.; Di Giacomo, A.; Pica, Claudio

    2005-01-01

    We argue that the order of the chiral transition for N_f=2 is a sensitive probe of the QCD vacuum, in particular of the mechanism of color confinement. A strategy is developed to investigate the order of the transition by use of finite size scaling analysis. An in-depth numerical investigation is...

  8. Turbulent jet in confined counterflow

    Indian Academy of Sciences (India)

    The mean flowfield of a turbulent jet issuing into a confined, uniform counterflow was investigated computationally. Based on dimensional analysis, the jet penetration length was shown to scale with jet-to-counterflow momentum flux ratio. This scaling and the computational results reproduce the well-known correct limit of ...

  9. Momentum Confinement at Low Torque

    International Nuclear Information System (INIS)

    Solomon, W.M.; Burrell, K.H.; deGrassie, J.S.; Budny, R.; Groebner, R.J.; Heidbrink, W.W.; Kinsey, J.E.; Kramer, G.J.; Makowski, M.A.; Mikkelsen, D.; Nazikian, R.; Petty, C.C.; Politzer, P.A.; Scott, S.D.; Van Zeeland, M.A.; Zarnstorff, M.C.

    2007-01-01

    Momentum confinement was investigated on DIII-D as a function of applied neutral beam torque at constant normalized β N , by varying the mix of co (parallel to the plasma current) and counter neutral beams. Under balanced neutral beam injection (i.e. zero total torque to the plasma), the plasma maintains a significant rotation in the co-direction. This 'intrinsic' rotation can be modeled as being due to an offset in the applied torque (i.e. an 'anomalous torque'). This anomalous torque appears to have a magnitude comparable to one co-neutral beam source. The presence of such an anomalous torque source must be taken into account to obtain meaningful quantities describing momentum transport, such as the global momentum confinement time and local diffusivities. Studies of the mechanical angular momentum in ELMing H-mode plasmas with elevated q min show that the momentum confinement time improves as the torque is reduced. In hybrid plasmas, the opposite effect is observed, namely that momentum confinement improves at high torque/rotation. The relative importance of E x B shearing between the two is modeled using GLF23 and may suggest a possible explanation.

  10. On the implications of confinement

    International Nuclear Information System (INIS)

    Roberts, C.D.

    1992-01-01

    In this paper, the authors consider some implications of confinement starting from the basic observation that cross-sections for the production of colored asymptotic states, such as free quarks and gluons, from color singlet initial states must be zero if QCD is to be confining. The authors discuss two pictures of confinement: the failure of the cluster decomposition property and the absence of a pole at timelike momenta in the propagator of a confined particle. The authors use QCD-based models as a framework to relate the failure of the cluster decomposition property to other ideas, such as the role of a nonzero gluon condensate. The authors' primary interest is to address the question of the absence of a mass pole through a study of model Schwinger-Dyson equations. These equations contain some of the dynamical information that is present in the study of the cluster decomposition property. The authors discuss the problems within this idea and its study using the Schwinger-Dyson equations

  11. Baryon observables and color confinement

    International Nuclear Information System (INIS)

    Jackson, A.D.

    1987-01-01

    Calculations of baryon observables within the framework of the chiral bag model are reviewed. The results of such calculations are found to be remarkably insensitive to the radius of color confinement and indicate the difficulty of finding unambiguous evidence for quarks in nuclei. 13 refs.; 5 figs

  12. DNA nanotechnology: On-command molecular Trojans

    Science.gov (United States)

    Niemeyer, Christof M.

    2017-12-01

    Lipid-motif-decorated DNA nanocapsules filled with photoresponsive polymers are capable of delivering signalling molecules into target organisms for biological perturbations at high spatiotemporal resolution.

  13. Capillary condensation of short-chain molecules.

    Science.gov (United States)

    Bryk, Paweł; Pizio, Orest; Sokolowski, Stefan

    2005-05-15

    A density-functional study of capillary condensation of fluids of short-chain molecules confined to slitlike pores is presented. The molecules are modeled as freely jointed tangent spherical segments with a hard core and with short-range attractive interaction between all the segments. We investigate how the critical parameters of capillary condensation of the fluid change when the pore width decreases and eventually becomes smaller than the nominal linear dimension of the single-chain molecule. We find that the dependence of critical parameters for a fluid of dimers and of tetramers on pore width is similar to that of the monomer fluid. On the other hand, for a fluid of chains consisting of a larger number of segments we observe an inversion effect. Namely, the critical temperature of capillary condensation decreases with increasing pore width for a certain interval of values of the pore width. This anomalous behavior is also influenced by the interaction between molecules and pore walls. We attribute this behavior to the effect of conformational changes of molecules upon confinement.

  14. Application of quasi-elastic neutron scattering to dynamics study of confined water

    International Nuclear Information System (INIS)

    Li Hua; Zhang Lili; Yi Zhou

    2014-01-01

    Background: Quasi-elastic neutron scattering (QENS) is an important experiment for dynamics study of confined water. It is significant to study the dynamics of confined water in cement paste. Purpose: In this paper, we have two aims. One is to present a reviewer of QENS study on dynamics of confined water in cement paste in recent years. The other is to illustrate the QENS application to the study on dynamics of confined water based on cement paste. Method: Relaxing cage model (RCM) is specially introduced for the analyses of QENS spectra. Results: Based on RCM, several parameters for describing the dynamics of confined water in cement paste, can be obtained from the analyses of QENS spectra: a fraction of mobile 'glassy' water molecules embedded in amorphous gel region surrounding the hydration products, 1-p, the capture time of confined water molecule in some place-τ 0 , the average translational relaxation time-<τ>, the self-diffusion coefficient-D, and a phenomenological shape parameter describing the uniform of amorphous in cement paste-β. Conclusion: All these provide a practical method for QENS study on dynamics of confined water in cement paste. (authors)

  15. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Alternative end-joining of DNA breaks

    NARCIS (Netherlands)

    Schendel, Robin van

    2016-01-01

    DNA is arguably the most important molecule found in any organism, as it contains all information to perform cellular functions and enables continuity of species. It is continuously exposed to DNA-damaging agents both from endogenous and exogenous sources. To protect DNA against these sources of DNA

  17. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  18. DNA Knots: Theory and Experiments

    Science.gov (United States)

    Sumners, D. W.

    Cellular DNA is a long, thread-like molecule with remarkably complex topology. Enzymes that manipulate the geometry and topology of cellular DNA perform many vital cellular processes (including segregation of daughter chromosomes, gene regulation, DNA repair, and generation of antibody diversity). Some enzymes pass DNA through itself via enzyme-bridged transient breaks in the DNA; other enzymes break the DNA apart and reconnect it to different ends. In the topological approach to enzymology, circular DNA is incubated with an enzyme, producing an enzyme signature in the form of DNA knots and links. By observing the changes in DNA geometry (supercoiling) and topology (knotting and linking) due to enzyme action, the enzyme binding and mechanism can often be characterized. This paper will discuss some personal research history, and the tangle model for the analysis of site-specific recombination experiments on circular DNA.

  19. Surface motion and confinement potential for a microwave confined corona

    International Nuclear Information System (INIS)

    Ensley, D.L.

    1979-07-01

    Approximate time dependent solutions for surface velocities and potentials are given for a plane polarized microwave field confining a hot, over-dense plasma corona. Steady state solutions to Poissons' equation can be applied to the time dependent case, provided transit time effects are included. The product of ion pressure and potential wave (surface) velocity gives an average heating rate approx. 7/32 NKT 0 V/sub theta/ directly to the ions

  20. Chapter 8: Selective Stoichiometric and Catalytic Reactivity in the Confines of a Chiral Supramolecular Assembly

    Energy Technology Data Exchange (ETDEWEB)

    University of California, Berkeley; Lawrence Berkeley National Laboratory; Raymond, Kenneth; Pluth, Michael D.; Bergman, Robert G.; Raymond, Kenneth N.

    2007-09-27

    Nature uses enzymes to activate otherwise unreactive compounds in remarkable ways. For example, DNases are capable of hydrolyzing phosphate diester bonds in DNA within seconds,[1-3]--a reaction with an estimated half-life of 200 million years without an enzyme.[4] The fundamental features of enzyme catalysis have been much discussed over the last sixty years in an effort to explain the dramatic rate increases and high selectivities of enzymes. As early as 1946, Linus Pauling suggested that enzymes must preferentially recognize and stabilize the transition state over the ground state of a substrate.[5] Despite the intense study of enzymatic selectivity and ability to catalyze chemical reactions, the entire nature of enzyme-based catalysis is still poorly understood. For example, Houk and co-workers recently reported a survey of binding affinities in a wide variety of enzyme-ligand, enzyme-transition-state, and synthetic host-guest complexes and found that the average binding affinities were insufficient to generate many of the rate accelerations observed in biological systems.[6] Therefore, transition-state stabilization cannot be the sole contributor to the high reactivity and selectivity of enzymes, but rather, other forces must contribute to the activation of substrate molecules. Inspired by the efficiency and selectivity of Nature, synthetic chemists have admired the ability of enzymes to activate otherwise unreactive molecules in the confines of an active site. Although much less complex than the evolved active sites of enzymes, synthetic host molecules have been developed that can carry out complex reactions with their cavities. While progress has been made toward highly efficient and selective reactivity inside of synthetic hosts, the lofty goal of duplicating enzymes specificity remains.[7-9] Pioneered by Lehn, Cram, Pedersen, and Breslow, supramolecular chemistry has evolved well beyond the crown ethers and cryptands originally studied.[10-12] Despite the

  1. Sensing Conformational Changes in DNA upon Ligand Binding Using QCM-D. Polyamine Condensation and Rad51 Extension of DNA Layers

    KAUST Repository

    Sun, Lu; Frykholm, Karolin; Fornander, Louise H.; Svedhem, Sofia; Westerlund, Fredrik; Å kerman, Bjö rn

    2014-01-01

    © 2014 American Chemical Society. Biosensors, in which binding of ligands is detected through changes in the optical or electrochemical properties of a DNA layer confined to the sensor surface, are important tools for investigating DNA interactions

  2. Inertial Electrostatic Confinement (IEC) devices

    International Nuclear Information System (INIS)

    Nebel, R.A.; Turner, L.; Tiouririne, T.N.; Barnes, D.C.; Nystrom, W.D.; Bussard, R.W.; Miley, G.H.; Javedani, J.; Yamamoto, Y.

    1994-01-01

    Inertial Electrostatic Confinement (IEC) is one of the earliest plasma confinement concepts, having first been suggested by P. T. Farnsworth in the 1950s. The concept involves a simple apparatus of concentric spherical electrostatic grids or a combination of grids and magnetic fields. An electrostatic structure is formed from the confluence of electron or ion beams. Gridded IEC systems have demonstrated neutron yields as high as 2 * 10 10 neutrons/sec. These systems have considerable potential as small, inexpensive, portable neutron sources for assaying applications. Neutron tomography is also a potential application. Atomic physics effects strongly influence the performance of all of these systems. Important atomic effects include elastic scattering, ionization, excitation, and charge exchange. This paper discusses how an IEC system is influenced by these effects and how to design around them. Theoretical modeling and experimental results are presented

  3. Making the Tg-Confinement Effect Disappear in Thin Polystyrene Films: Good Physics vs. Inappropriate Analysis

    Science.gov (United States)

    Torkelson, John; Chen, Lawrence

    2013-03-01

    The Tg-confinement effect in polymers was first characterized in supported polystyrene (PS) films by Keddie et al. in 1994. Since then, many researchers have shown that (pseudo-)thermodynamic Tg measurements of supported PS films taken on cooling consistently yield the same qualitative results, with a decrease from bulk Tg beginning at 40-60 nm thickness and becoming very strong below 20 nm thickness. Some quantitative differences have been noted between studies, which may be ascribed to measurement method or the analysis employed. In 2004, we showed that the Tg-confinement effect in PS may be suppressed by adding several wt% of small-molecule diluents such as dioctyl phthalate. Recently, Kremer and co-workers (Macromolecules 2010, 43, 9937) reported that there was no Tg-confinement in supported PS films based on an analysis of the second derivative of ellipsometry data and use of a ninth order polynomial fit. Here, we demonstrate a new method for suppressing the Tg-confinement effect. In particular, PS made by emulsion polymerization yields no Tg-confinement effect as measured by ellipsometry or fluorescence, while PS made by anionic or conventional free radical polymerization yield strong Tg-confinement effects. The difference is hypothesized to result from surfactant in the emulsion polymerized PS. We also show that the absence of the Tg-confinement effect reported by Kremer is due to inappropriate analysis of ellipsometry data and that correct analysis yields Tg-confinement effects.

  4. Extra dimensions and color confinement

    Energy Technology Data Exchange (ETDEWEB)

    Pleitez, V

    1995-04-01

    An extension of the ordinary four dimensional Minkowski space by introducing additional dimensions which have their own Lorentz transformation is considered. Particles can transform in a different way under each Lorentz group. It is shown that only quark interactions are slightly modified and that color confinement automatic since these degrees of freedom run only in the extra dimensions. No compactification of the extra dimensions is needed. (author). 4 refs.

  5. Confinement facilities for handling plutonium

    International Nuclear Information System (INIS)

    Maraman, W.J.; McNeese, W.D.; Stafford, R.G.

    1975-01-01

    Plutonium handling on a multigram scale began in 1944. Early criteria, equipment, and techniques for confining contamination have been superseded by more stringent criteria and vastly improved equipment and techniques for in-process contamination control, effluent air cleaning and treatment of liquid wastes. This paper describes the evolution of equipment and practices to minimize exposure of workers and escape of contamination into work areas and into the environment. Early and current contamination controls are compared. (author)

  6. Inertial-confinement-fusion targets

    International Nuclear Information System (INIS)

    Hendricks, C.D.

    1981-01-01

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques have been devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented

  7. Confinement and diffusion in tokamaks

    International Nuclear Information System (INIS)

    McWilliams, R.

    1988-01-01

    The effect of electric field fluctuations on confinement and diffusion in tokamak is discussed. Based on the experimentally determined cross-field turbolent diffusion coefficient, D∼3.7*cT e /eB(δn i /n i ) rms which is also derived by a simple theory, the cross-field diffusion time, tp=a 2 /D, is calculated and compared to experimental results from 51 tokamak for standard Ohmic operation

  8. Enhancement of confinement in tokamaks

    International Nuclear Information System (INIS)

    Furth, H.P.

    1986-01-01

    The analysis begins by identifying a hypothetical model of tokamak confinement that is designed to take into account the conflict between Tsub(e)(r)-profile shapes arising from microscopic transport and J(r)-profile shapes required for gross stability. On the basis of this model, a number of hypothetical lines of advance are developed. Some TFTR experiments that may point the way to a particularly attractive type of tokamak reactor regime are discussed. (author)

  9. Capillary Condensation in Confined Media

    OpenAIRE

    Charlaix, Elisabeth; Ciccotti, Matteo

    2009-01-01

    28 pages - To appear in 2010 in the Handbook of Nanophysics - Vol 1 - Edited by Klaus Sattler - CRC Press; We review here the physics of capillary condensation of liquids in confined media, with a special regard to the application in nanotechnologies. The thermodynamics of capillary condensation and thin film adsorption are first exposed along with all the relevant notions. The focus is then shifted to the modelling of capillary forces, to their measurements techniques (including SFA, AFM and...

  10. Metastability in Magnetically Confined Plasmas

    International Nuclear Information System (INIS)

    Fong, B.H.; Cowley, S.C.; Hurricane, O.A.

    1999-01-01

    The parameter space of magnetically confined plasmas near marginal instability for interchange-type modes is divided into three regions according to qualitative stability properties. Region I is linearly stable though nonlinearly unstable to large excitations. Region II is linearly unstable, nonlinearly stable to small excitations, and nonlinearly unstable to large excitations. Region III is linearly and nonlinearly unstable. For an equilibrium evolving through marginal stability, region III and therefore explosive instability are inevitably encountered. copyright 1999 The American Physical Society

  11. Confinement and strings in MQCD

    International Nuclear Information System (INIS)

    Hanany, A.; Strassler, M.J.; Zaffaroni, A.

    1998-01-01

    We study aspects of confinement in the M-theory fivebrane version of QCD (MQCD). We show heavy quarks are confined in hadrons (which take the form of membrane-fivebrane bound states) for N=1 and softly broken N=2 SU(N) MQCD. We explore and clarify the transition from the exotic physics of the latter to the standard physics of the former. In particular, the many strings and quark-antiquark mesons found in N=2 field theory by Douglas and Shenker are reproduced. It is seen that in the N=1 limit all but one such meson disappears while all of the strings survive. The strings of softly broken N=2, N=1, and even non-supersymmetric SU(N) MQCD have a common ratio for their tensions as a function of the amount of flux they carry. We also comment on the almost BPS properties of the Douglas-Shenker strings and discuss the brane picture for monopole confinement on N=2 QCD Higgs branches. (orig.)

  12. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  13. The growth of the mean average crossing number of equilateral polygons in confinement

    International Nuclear Information System (INIS)

    Arsuaga, J; Borgo, B; Scharein, R; Diao, Y

    2009-01-01

    The physical and biological properties of collapsed long polymer chains as well as of highly condensed biopolymers (such as DNA in all organisms) are known to be determined, at least in part, by their topological and geometrical properties. With this purpose of characterizing the topological properties of such condensed systems equilateral random polygons restricted to confined volumes are often used. However, very few analytical results are known. In this paper, we investigate the effect of volume confinement on the mean average crossing number (ACN) of equilateral random polygons. The mean ACN of knots and links under confinement provides a simple alternative measurement for the topological complexity of knots and links in the statistical sense. For an equilateral random polygon of n segments without any volume confinement constrain, it is known that its mean ACN (ACN) is of the order 3/16 n log n + O(n). Here we model the confining volume as a simple sphere of radius R. We provide an analytical argument which shows that (ACN) of an equilateral random polygon of n segments under extreme confinement (meaning R 2 ). We propose to model the growth of (ACN) as a(R)n 2 + b(R)nln(n) under a less-extreme confinement condition, where a(R) and b(R) are functions of R with R being the radius of the confining sphere. Computer simulations performed show a fairly good fit using this model.

  14. Single-molecule dynamics in nanofabricated traps

    Science.gov (United States)

    Cohen, Adam

    2009-03-01

    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  15. 3D DNA Crystals and Nanotechnology

    Directory of Open Access Journals (Sweden)

    Paul J. Paukstelis

    2016-08-01

    Full Text Available DNA’s molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

  16. Confinement dynamics in the reversed field pinch

    International Nuclear Information System (INIS)

    Schoenberg, K.F.

    1988-01-01

    The study of basic transport and confinement dynamics is central to the development of the reversed field pinch (RFP) as a confinement concept. Thus, the goal of RFP research is to understand the connection between processes that sustain the RFP configuration and related transport/confinement properties. Recently, new insights into confinement have emerged from a detailed investigation of RFP electron and ion physics. These insights derive from the recognition that both magnetohydrodynamic (MHD) and electron kinetic effects play an important and strongly coupled role in RFP sustainment and confinement dynamics. In this paper, we summarize the results of these studies on the ZT-40M experiment. 8 refs

  17. Global confinement characteristics of Jet limiter plasmas

    International Nuclear Information System (INIS)

    Campbell, D.J.; Christiansen, J.P.; Cordey, J.G.; Thomas, P.R.; Thomsen, K.

    1989-01-01

    Data from a wide variety of plasma pulses on JET (aux. heating, current, field, minority species, plasma shape, etc) are analysed in order to assess the characteristics of global confinement. The scaling of confinement in ohmically and auxiliary heated discharges is examined. The ohmic confinement in the present new JET configuration (Belt Limiter) is essentially the same as previously. Confinement in auxiliary heated discharges shows presently a slight improvement since 1986. Both ohmic and non-ohmic data is used in a set of confinement time regression analyses and certain constraints derived from theory are imposed

  18. Semisynthetic protein nanoreactor for single-molecule chemistry

    OpenAIRE

    Lee, Joongoo; Bayley, Hagan

    2015-01-01

    The modulation of ionic current flowing through an individual protein pore provides information at the single-molecule level about chemical reactions occurring within the pore. However, chemistry investigated in this way has been largely confined to the reactions of thiolates, presented by the side chains of cysteine residues. The introduction of unnatural amino acids would provide a large variety of reactive side chains with which additional single-molecule chemistry could be investigated. H...

  19. Inertial confinement fusion at NRL

    International Nuclear Information System (INIS)

    Bodner, S.E.; Boris, J.P.; Cooperstein, G.

    1979-01-01

    The NRL Inertial Confinement Fusion Program's emphasis has moved toward pellet concepts which use longer (approximately 10ns) lower intensity driver pulses than previously assumed. For laser drivers, this change was motivated by recent experiments at NRL with enhanced stimulated Brillouin backscatter. For ion drivers, the motivation is the possibility that substantial energy at 10-ns pulse lengths may soon be available. To accept these 10-ns pulses, it may be necessary to consider pellets of larger radius and thinner shell. The computational studies of Rayleigh-Taylor instability at NRL indicate the possibility of a dynamic stabilization of these thinner shells. (author)

  20. Confinement through tensor gauge fields

    International Nuclear Information System (INIS)

    Salam, A.; Strathdee, J.

    1977-12-01

    Using the 0(3,2)-symmetric de Sitter solution of Einstein's equation describing a strongly interacting tensor field it is shown that hadronic bags confining quarks can be represented as de Sitter ''micro-universes'' with radii given 1/R 2 =lambdak 2 /6. Here k 2 and lambda are the strong coupling and the ''cosmological'' constant which apear in the Einstein equation used. Surprisingly the energy spectrum for the two-body hadronic states is the same as that for a harmonic oscillator potential, though the wave functions are completely different. The Einstein equation can be extended to include colour for the tensor fields

  1. Compact inertial confinement multireactor concepts

    International Nuclear Information System (INIS)

    Pendergrass, J.H.

    1985-01-01

    Inertial confinement fusion (ICF) commercial-applications plant-optimum driver pulse repetition rates may exceed reactor pulse-repetition-rate capabilities. Thus, more than one reactor may be required for low-cost production of electric power, process heat, fissionable fuels, etc., in ICF plants. Substantial savings in expensive reactor containment cells and blankets can be realized by placing more than one reactor in a cell and by surrounding more than one reactor cavity with a single blanket system. There are also some potential disadvantages associated with close coupling in compact multicavity blankets and multireactor cells. Tradeoffs associated with several scenarios have been studied

  2. Structural and dynamical properties of water confined between two hydrophilic surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Di Napoli, Solange, E-mail: dinapoli@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (Argentina); Gamba, Zulema, E-mail: gamba@tandar.cnea.gov.a [Depto. de Fisica - CAC, Comision Nacional de Energia Atomica, Av. Gral Paz 1499, (1650) San Martin, Buenos Aires (Argentina)

    2009-10-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n{sub W}). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  3. Structural and dynamical properties of water confined between two hydrophilic surfaces

    International Nuclear Information System (INIS)

    Di Napoli, Solange; Gamba, Zulema

    2009-01-01

    The properties of water in the vicinity of surfaces and under confinement have been extensively studied because of the relevance of a quantitative understanding of many processes that not only take place in biological systems, like cells, membranes and microemulsions, but also in many others such as confined water in rocks, ionic channels and interestellar matter. In this work we perform molecular dynamic calculations of the nanoscopic structure of TIP5P model water confined between two hydrophilic surfaces. We calculate the diffusion coefficients and the atomic density profile of water molecules and polar ions in the system as a function of the number of water molecules per amphiphilic (n W ). We also study the dependence of the water layer thickness and the profiles of water dipole orientation with this parameter.

  4. DNA nanotechnology and fluorescence applications.

    Science.gov (United States)

    Schlichthaerle, Thomas; Strauss, Maximilian T; Schueder, Florian; Woehrstein, Johannes B; Jungmann, Ralf

    2016-06-01

    Structural DNA nanotechnology allow researchers to use the unique molecular recognition properties of DNA strands to construct nanoscale objects with almost arbitrary complexity in two and three dimensions. Abstracted as molecular breadboards, DNA nanostructures enable nanometer-precise placement of guest molecules such as proteins, fluorophores, or nanoparticles. These assemblies can be used to study biological phenomena with unprecedented control over number, spacing, and molecular identity. Here, we give a general introduction to structural DNA nanotechnology and more specifically discuss applications of DNA nanostructures in the field of fluorescence and plasmonics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. LEGO-like DNA Structures

    DEFF Research Database (Denmark)

    Gothelf, Kurt Vesterager

    2012-01-01

    -dimensional (3D) DNA structures by self-assembly of single-stranded DNA “bricks.” The method opens a new route to complex self-assembled (3D) nanostructures that may serve as addressable templates for placing guest molecules with high precision, with possible applications in biophysics, medicine...

  6. The journey of DNA repair.

    Science.gov (United States)

    Saini, Natalie

    2015-12-01

    21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  7. The journey of DNA repair

    OpenAIRE

    Saini, Natalie

    2015-01-01

    21 years ago, the DNA Repair Enzyme was declared “Molecule of the Year”. Today, we are celebrating another “year of repair”, with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  8. Generation of highly confined photonic nanojet using crescent-shape refractive index profile in microsphere

    Science.gov (United States)

    Patel, H. S.; Kushwaha, P. K.; Swami, M. K.

    2018-05-01

    Photonic nanojets (PNJs) owing to their sub-wavelength near-field features have found many interesting applications like nanoscopy, nano photolithography, high density optical storage, enhancement of Raman signal and single molecule spectroscopy etc. More recently, the focus of research has been on tailoring of PNJs either for better confinement and thus higher peak intensity or for elongation of nanojet for high resolution far field applications. In this paper, we show that crescent-shape refractive index profile (CSRP) of microspheres can be used to generate highly confined PNJ. By optimizing the refractive index of different layers in CSRP microsphere, we show a free space confinement down to ∼ λ / 4 . 5 (FWHM ∼ 110 nm for excitation with 500 nm wavelength). Further, it was observed that the optical properties of substrates also modulate the PNJ characteristics and lead to a further improvement in the transverse confinement to ∼ λ / 6 . 7.

  9. Crystallization of Organic Semiconductor Molecules in Nanosized Cavities

    DEFF Research Database (Denmark)

    Milita, Silvia; Dionigi, Chiara; Borgatti, Francesco

    2008-01-01

    The crystallization of an organic semiconductor, viz., tetrahexil-sexithiophene (H4T6) molecules, confined into nanosized cavities of a self-organized polystyrene beads template, has been investigated by means of in situ grazing incidence X-ray diffraction measurements, during the solvent evapora...

  10. Holographic collisions in confining theories

    International Nuclear Information System (INIS)

    Cardoso, Vitor; Emparan, Roberto; Mateos, David; Pani, Paolo; Rocha, Jorge V.

    2014-01-01

    We study the gravitational dual of a high-energy collision in a confining gauge theory. We consider a linearized approach in which two point particles traveling in an AdS-soliton background suddenly collide to form an object at rest (presumably a black hole for large enough center-of-mass energies). The resulting radiation exhibits the features expected in a theory with a mass gap: late-time power law tails of the form t −3/2 , the failure of Huygens’ principle and distortion of the wave pattern as it propagates. The energy spectrum is exponentially suppressed for frequencies smaller than the gauge theory mass gap. Consequently, we observe no memory effect in the gravitational waveforms. At larger frequencies the spectrum has an upward-stairway structure, which corresponds to the excitation of the tower of massive states in the confining gauge theory. We discuss the importance of phenomenological cutoffs to regularize the divergent spectrum, and the aspects of the full non-linear collision that are expected to be captured by our approach

  11. Magnetic confinement fusion energy research

    International Nuclear Information System (INIS)

    Grad, H.

    1977-03-01

    Controlled Thermonuclear Fusion offers probably the only relatively clean energy solution with completely inexhaustible fuel and unlimited power capacity. The scientific and technological problem consists in magnetically confining a hot, dense plasma (pressure several to hundreds of atmospheres, temperature 10 8 degrees or more) for an appreciable fraction of a second. The scientific and mathematical problem is to describe the behavior, such as confinement, stability, flow, compression, heating, energy transfer and diffusion of this medium in the presence of electromagnetic fields just as we now can for air or steam. Some of the extant theory consists of applications, routine or ingenious, of known mathematical structures in the theory of differential equations and in traditional analysis. Other applications of known mathematical structures offer surprises and new insights: the coordination between sub-supersonic and elliptic-hyperbolic is fractured; supersonic propagation goes upstream; etc. Other completely nonstandard mathematical structures with significant theory are being rapidly uncovered (and somewhat less rapidly understood) such as non-elliptic variational equations and new types of weak solutions. It is these new mathematical structures which one should expect to supply the foundation for the next generation's pure mathematics, if history is a guide. Despite the substantial effort over a period of some twenty years, there are still basic and important scintific and mathematical discoveries to be made, lying just beneath the surface

  12. Quark cluster model and confinement

    International Nuclear Information System (INIS)

    Koike, Yuji; Yazaki, Koichi

    2000-01-01

    How confinement of quarks is implemented for multi-hadron systems in the quark cluster model is reviewed. In order to learn the nature of the confining interaction for fermions we first study 1+1 dimensional QED and QCD, in which the gauge field can be eliminated exactly and generates linear interaction of fermions. Then, we compare the two-body potential model, the flip-flop model and the Born-Oppenheimer approach in the strong coupling lattice QCD for the meson-meson system. Having shown how the long-range attraction between hadrons, van der Waals interaction, shows up in the two-body potential model, we discuss two distinct attempts beyond the two-body potential model: one is a many-body potential model, the flip-flop model, and the other is the Born-Oppenheimer approach in the strong coupling lattice QCD. We explain how the emergence of the long-range attraction is avoided in these attempts. Finally, we present the results of the application of the flip-flop model to the baryon-baryon scattering in the quark cluster model. (author)

  13. Multiple-mirror plasma confinement

    International Nuclear Information System (INIS)

    Lichtenberg, A.J.; Lieberman, M.A.; Logan, B.G.

    1975-01-01

    A large enhancement of the confinement time can be achieved in a straight system of multiple mirrors over an equal length uniform magnetic field. The scaling is diffusive rather than that of flow, thereby scaling the square of the system length rather than linear with system length. Probably the most economic mode of operation for a reactor occurs when lambda/M is approximately l/sub c/, where lambda is the mean free path, M the mirror ratio, and l/sub c/ the length between mirrors; but where the scale length of the mirror field l/sub m/ is much less than lambda. The axial confinement time has been calculated theoretically and numerically for all important parameter regimes, and confirmed experimentally. A typical reactor calculation gives Q/sub E/ = 2 for a 400 meter system with 3000 MW(e) output. The main concern of a multiple-mirror system is stability. Linked quadrupoles can achieve average minimum-B stabilization of flute modes, and experiments have demonstrated this stabilization. Localized instabilities at finite β and enhanced diffusion resulting from the distorted flux surfaces and possibly from turbulent higher order modes still remain to be investigated

  14. Biofunctionalization of zinc oxide nanowires for DNA sensory applications

    Directory of Open Access Journals (Sweden)

    Rudolph Bettina

    2011-01-01

    Full Text Available Abstract We report on the biofunctionalization of zinc oxide nanowires for the attachment of DNA target molecules on the nanowire surface. With the organosilane glycidyloxypropyltrimethoxysilane acting as a bifunctional linker, amino-modified capture molecule oligonucleotides have been immobilized on the nanowire surface. The dye-marked DNA molecules were detected via fluorescence microscopy, and our results reveal a successful attachment of DNA capture molecules onto the nanowire surface. The electrical field effect induced by the negatively charged attached DNA molecules should be able to control the electrical properties of the nanowires and gives way to a ZnO nanowire-based biosensing device.

  15. Concentrating and labeling genomic DNA in a nanofluidic array

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; Mir, Kalim U.

    2018-01-01

    , however, hinder the polymerase activity. We demonstrate a device and a protocol for the enzymatic labeling of genomic DNA arranged in a dense array of single molecules without attaching the enzyme or the DNA to a surface. DNA molecules accumulate in a dense array of pits embedded within a nanoslit due...... to entropic trapping. We then perform ϕ29 polymerase extension from single-strand nicks created on the trapped molecules to incorporate fluorescent nucleotides into the DNA. The array of entropic traps can be loaded with λ-DNA molecules to more than 90% of capacity at a flow rate of 10 pL min-1. The final...

  16. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  17. Conformation-dependent DNA attraction

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  18. Monitoring airborne biotic contaminants in the indoor environment of pig and poultry confinement buildings.

    Science.gov (United States)

    Hong, Pei-Ying; Li, Xiangzhen; Yang, Xufei; Shinkai, Takumi; Zhang, Yuanhui; Wang, Xinlei; Mackie, Roderick I

    2012-06-01

    Given the growing concerns over human and animal health issues related to confined animal feeding operations, an in-depth examination is required to monitor for airborne bacteria and associated antibiotic resistance genes. Our 16S rRNA-based pyrosequencing revealed that the airborne microbial community skewed towards a higher abundance of Firmicutes (> 59.2%) and Bacteroidetes (4.2-31.4%) within the confinement buildings, while the office environment was predominated by Proteobacteria (55.2%). Furthermore, bioaerosols in the confinement buildings were sporadically associated with genera of potential pathogens, and these genera were more frequently observed in the bioaerosols of pig and layer hen confinement than the turkey confinement buildings and office environment. High abundances of tetracycline resistance genes (9.55 × 10(2) to 1.69 × 10(6) copies ng(-1) DNA) were also detected in the bioaerosols sampled from confinement buildings. Bacterial lineages present in the poultry bioaerosols clustered apart from those present in the pig bioaerosols and among the different phases of pig production, suggesting that different livestock as well as production phase were associated with a distinct airborne microbial community. By understanding the diversity of biotic contaminants associated with the different confinement buildings, this study facilitates the implementation of better management strategies to minimize potential health impacts on both livestock and humans working in this environment. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  19. Superstable Ultrathin Water Film Confined in a Hydrophilized Carbon Nanotube.

    Science.gov (United States)

    Tomo, Yoko; Askounis, Alexandros; Ikuta, Tatsuya; Takata, Yasuyuki; Sefiane, Khellil; Takahashi, Koji

    2018-03-14

    Fluids confined in a nanoscale space behave differently than in the bulk due to strong interactions between fluid molecules and solid atoms. Here, we observed water confined inside "open" hydrophilized carbon nanotubes (CNT), with diameter of tens of nanometers, using transmission electron microscopy (TEM). A 1-7 nm water film adhering to most of the inner wall surface was observed and remained stable in the high vacuum (order of 10 -5 Pa) of the TEM. The superstability of this film was attributed to a combination of curvature, nanoroughness, and confinement resulting in a lower vapor pressure for water and hence inhibiting its vaporization. Occasional, suspended ultrathin water film with thickness of 3-20 nm were found and remained stable inside the CNT. This film thickness is 1 order of magnitude smaller than the critical film thickness (about 40 nm) reported by the Derjaguin-Landau-Verwey-Overbeek theory and previous experimental investigations. The stability of the suspended ultrathin water film is attributed to the additional molecular interactions due to the extended water meniscus, which balances the rest of the disjoining pressures.

  20. Elmo bumpy square plasma confinement device

    Science.gov (United States)

    Owen, L.W.

    1985-01-01

    The invention is an Elmo bumpy type plasma confinement device having a polygonal configuration of closed magnet field lines for improved plasma confinement. In the preferred embodiment, the device is of a square configuration which is referred to as an Elmo bumpy square (EBS). The EBS is formed by four linear magnetic mirror sections each comprising a plurality of axisymmetric assemblies connected in series and linked by 90/sup 0/ sections of a high magnetic field toroidal solenoid type field generating coils. These coils provide corner confinement with a minimum of radial dispersion of the confined plasma to minimize the detrimental effects of the toroidal curvature of the magnetic field. Each corner is formed by a plurality of circular or elliptical coils aligned about the corner radius to provide maximum continuity in the closing of the magnetic field lines about the square configuration confining the plasma within a vacuum vessel located within the various coils forming the square configuration confinement geometry.

  1. DNA nanotechnology-enabled biosensors.

    Science.gov (United States)

    Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

    2016-02-15

    Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. The formation and interactions of cold and ultracold molecules: new challenges for interdisciplinary physics

    Energy Technology Data Exchange (ETDEWEB)

    Dulieu, O [Laboratoire Aime Cotton, CNRS, Bat. 505, Univ Paris-Sud 11, F-91405 Orsay Cedex (France); Gabbanini, C [Istituto per i processi chimico-fisici del C.N.R., Via Moruzzi 1, 56124 Pisa (Italy)], E-mail: olivier.dulieu@lac.u-psud.fr, E-mail: carlo@ipcf.cnr.it

    2009-08-15

    Progress on research in the field of molecules at cold and ultracold temperatures is reported in this review. It covers extensively the experimental methods to produce, detect and characterize cold and ultracold molecules including association of ultracold atoms, deceleration by external fields and kinematic cooling. Confinement of molecules in different kinds of traps is also discussed. The basic theoretical issues related to the knowledge of the molecular structure, the atom-molecule and molecule-molecule mutual interactions, and to their possible manipulation and control with external fields, are reviewed. A short discussion on the broad area of applications completes the review.

  3. Conformation-dependent DNA attraction.

    Science.gov (United States)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-06-21

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

  4. Quark confinement in a constituent quark model

    International Nuclear Information System (INIS)

    Langfeld, K.; Rho, M.

    1995-01-01

    On the level of an effective quark theory, we define confinement by the absence of quark anti-quark thresholds in correlation function. We then propose a confining Nambu-Jona-Lasinio-type model. The confinement is implemented in analogy to Anderson localization in condensed matter systems. We study the model's phase structure as well as its behavior under extreme conditions, i.e. high temperature and/or high density

  5. Combined confinement system applied to tokamaks

    International Nuclear Information System (INIS)

    Ohkawa, Tihiro

    1986-01-01

    From particle orbit point of view, a tokamak is a combined confinement configuration where a closed toroidal volume is surrounded by an open confinement system like a magnetic mirror. By eliminating a cold halo plasma, the energy loss from the plasma becomes convective. The H-mode in diverted tokamaks is an example. Because of the favorable scaling of the energy confinement time with temperature, the performance of the tokamak may be significantly improved by taking advantage of this effect. (author)

  6. Combination of intratumoral injections of vaccinia virus MVA expressing GM-CSF and immunization with DNA vaccine prolongs the survival of mice bearing HPV16 induced tumors with downregulated expression of MHC class I molecules

    Czech Academy of Sciences Publication Activity Database

    Němečková, Š.; Šmahel, M.; Hainz, P.; Macková, J.; Zurková, K.; Gabriel, P.; Indrová, Marie; Kutinová, L.

    2007-01-01

    Roč. 54, č. 4 (2007), s. 326-333 ISSN 0028-2685 R&D Projects: GA MZd NR8004 Institutional research plan: CEZ:AV0Z50520514 Keywords : vaccinia virus MVA expressing GM- CSF * DNA vaccine * HPV16 induced tumors Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.208, year: 2007

  7. Summary on inertial confinement fusion

    International Nuclear Information System (INIS)

    Meyer-Ter-Vehn, J.

    1995-01-01

    Highlights on inertial confinement during the fifteenth international conference on plasma physics and controlled nuclear fusion are briefly summarized. Specifically the following topics are discussed: the US National Ignition Facility presently planned by the US Department of Energy; demonstration of diagnostics for hot spot formation; declassification of Hohlraum target design; fusion targets, in particular, the Hohlraum target design for the National Ignition Facility (NIF), Hohlraum experiments, direct drive implosions, ablative Rayleigh-Taylor instabilities, laser imprinting (of perturbations by the laser on the laser target surface), hot spot formation and mixing, hot spot implosion experiments at Lawrence Livermore National Laboratory, Livermore, USA, time resolving hot spot dynamics at the Institute of Laser Engineering (ILE), Osaka, Japan, laser-plasma interaction

  8. Confined subdiffusion in three dimensions

    International Nuclear Information System (INIS)

    Qin Shan-Lin; He Yong

    2014-01-01

    Three-dimensional (3D) Fick's diffusion equation and fractional diffusion equation are solved for different reflecting boundaries. We use the continuous time random walk model (CTRW) to investigate the time-averaged mean square displacement (MSD) of a 3D single particle trajectory. Theoretical results show that the ensemble average of the time-averaged MSD can be expressed analytically by a Mittag—Leffler function. Our new expression is in agreement with previous formulas in two limiting cases: <δ 2 -bar> ∼ Δ in short lag time and <δ 2 -bar> ∼ Δ 1-α in long lag time. We also simulate the experimental data of mRNA diffusion in living E. coli using a 3D CTRW model under confined and crowded conditions. The simulation results are well consistent with experimental results. The calculations of power spectral density (PSD) further indicate the subdiffsive behavior of an individual trajectory. (general)

  9. Colour screening and quark confinement

    International Nuclear Information System (INIS)

    Mack, G.

    1978-03-01

    It is proposed that in Quantum Chromodynamics the colour charge of gluons and of anything with zero triality is screened by a dynamical Higgs mechanism with Higgs scalars made out of gluons. The center Z 3 of the gauge group SU(3) is left unbroken in this way, and single quarks, which have nonzero triality, cannot be screened. Long range forces between them persist therefore. Given that the Higgs mechanism produces a mass gap, the most favorable configuration of field lines between e.g. quark and antiquark will be in strings analogous to magnetic field lines in a superconductor. The strings confine the quarks. The screening mechanism, on the other hand, produces not only the mass gap (which leads to string formation) but is also responsible for saturation of forces, i.e. absence of bound states of six quarks etc. (orig.) [de

  10. Colour screening and quark confinement

    International Nuclear Information System (INIS)

    Mack, G.

    1978-01-01

    It is proposed that in quantum chromodynamics the colour charge of gluons and of anything with zero triality is screened by a dynamic Higgs mechanism with Higgs scalars made out of gluons, but the center Z 3 of the gauge group SU(3) is left unbroken, and single quarks, which have nonzero triality, are not screened. Long range forces between them persist therefore. Given that the Higgs mechanism produces a mass gap, the most favourable configuration of field lines between e.g., quark and antiquark will be in strings analogous to magnetic field lines in a superconductor. The string confine the quarks. The screening mechanism, on the other hand, produces not only the mass gap (which leads to string formation) but is also responsible for saturation of forces, i.e. absence of bound states of six quarks, etc. (Auth.)

  11. Tormac confinement, theory, and experiment

    International Nuclear Information System (INIS)

    Berk, H.L.; Brown, I.G.; Feinberg, B.

    1978-01-01

    Tormac is a stuffed toroidal line cusp: the magnetic field is divided into two distinct regions, i.e., an outside ''sheath'' layer where the plasma is mirror-confined on open field lines and an internal high-β region of closed nested flux surfaces. The sheath is arranged with the appropriate curvature to ensure absolute MHD stability everywhere. The bulk of the plasma is maintained on closed flux surfaces as in a typical toroidal configuration, but with enhanced MHD stability due to the external field shaping. Experimental results on a toroidal ''bicusp'' (Tormac IV) will be reported. This device has a boro-silicate glass chamber and holds a plasma with an aspect ratio of 4 and a major diameter of 35 cm

  12. Planning for greater confinement disposal

    International Nuclear Information System (INIS)

    Gilbert, T.L.; Luner, C.; Meshkov, N.K.; Trevorrow, L.E.; Yu, C.

    1985-01-01

    A report that provides guidance for planning for greater-confinement disposal (GCD) of low-level radioactive waste is being prepared. The report addresses procedures for selecting a GCD technology and provides information for implementing these procedures. The focus is on GCD; planning aspects common to GCD and shallow-land burial are covered by reference. Planning procedure topics covered include regulatory requirements, waste characterization, benefit-cost-risk assessment and pathway analysis methodologies, determination of need, waste-acceptance criteria, performance objectives, and comparative assessment of attributes that support these objectives. The major technologies covered include augered shafts, deep trenches, engineered structures, hydrofracture, improved waste forms, and high-integrity containers. Descriptive information is provided, and attributes that are relevant for risk assessment and operational requirements are given. 10 refs., 3 figs., 2 tabs

  13. 2XIIB plasma confinement experiments

    International Nuclear Information System (INIS)

    Coensgen, F.H.; Clauser, J.F.; Correll, D.L.

    1976-01-01

    This paper reports results of 2XIIB neutral-beam injection experiments with plasma-stream stabilization. The plasma stream is provided either by a pulsed plasma generator located on the field lines outside the plasma region or by ionization of neutral gas introduced at the mirror throat. In the latter case, the gas is ionized by the normal particle flux through the magnetic mirror. A method of plasma startup and sustenance in a steady-state magnetic field is reported in which the plasma stream from the pulsed plasma generator serves as the initial target for the neutral beams. After an energetic plasma of sufficient density is established, the plasma generator stream is replaced by the gas-fed stream. Lifetimes of the stabilized plasma increase with plasma temperature in agreement with the plasma stabilization of the drift-cyclotron loss-cone mode. The following plasma parameters are attained using the pulsed plasma generator for stabilization: n approximately 5 x 10 13 cm -3 , anti W/sub i/ approximately 13 keV, T/sub e/ = 140 eV, and ntau/sub p/ approximately 7 x 10 10 cm -3 .s. With the gas feed, the mean deuterium ion energy is 9 keV and the peak density n approximately 10 14 cm -3 . In the latter case, the energy confinement parameter reaches ntau/sub E/ = 7 x 10 10 cm -3 .s, and the particle confinement parameter reaches ntau/sub p/ = 1 x 10 11 cm -3 .s

  14. Thermal characterization of static and dynamical properties of the confined molecular systems interacting through dispersion force.

    Science.gov (United States)

    Ramos, Sergio Luis L M; Ogino, Michihiko; Oguni, Masaharu

    2015-01-28

    We investigated the thermal properties of liquid methylcyclohexane and racemic sec-butylcyclohexane, as representatives of a molecular system with only dispersion-force intermolecular interactions, confined in the pores (thickness/diameter d = 12, 6, 1.1 nm) of silica gels by adiabatic calorimetry. The results imply a heterogeneous picture for molecular aggregate under confinement consisting of an interfacial region and an inner pore one. In the vicinity of a glass-transition temperature T(g,bulk) of bulk liquid, two distinguishable relaxation phenomena were observed for the confined systems and their origins were attributed to the devitrification, namely glass transition, processes of (1) a layer of interfacial molecules adjacent to the pore walls and (2) the molecules located in the middle of the pore. A third glass-transition phenomenon was observed at lower temperatures and ascribed to a secondary relaxation process. The glass transition of the interfacial-layer molecules was found to proceed at temperatures rather above T(g,bulk), whereas that of the molecules located in the inner pore region occurred at temperatures below T(g,bulk). We discuss the reason why the molecules located in different places in the pores reveal the respectively different dynamical properties.

  15. Electrochemical proton relay at the single-molecule level

    DEFF Research Database (Denmark)

    Kuznetsov, A. M.; Medvedev, I. G.; Ulstrup, Jens

    2009-01-01

    A scheme for the experimental study of single-proton transfer events, based on proton-coupled two-electron transfer between a proton donor and a proton acceptor molecule confined in the tunneling gap between two metal leads in electrolyte solution is suggested. Expressions for the electric current...... are derived and compared with formalism for electron tunneling through redox molecules. The scheme allows studying the kinetics of proton and hydrogen atom transfer as well as kinetic isotope effects at the single-molecule level under electrochemical potential control....

  16. Electron Scattering From Atoms, Molecules, Nuclei, and Bulk Matter

    CERN Document Server

    Whelan, Colm T

    2005-01-01

    Topics that are covered include electron scattering in the scanning TEM; basic theory of inelastic electron imaging; study of confined atoms by electron excitation; helium bubbles created in extreme pressure with application to nuclear safety; lithium ion implantation; electron and positron scattering from clusters; electron scattering from physi- and chemi-absorbed molecules on surfaces; coincidence studies; electron scattering from biological molecules; electron spectroscopy as a tool for environmental science; electron scattering in the presence of intense fields; electron scattering from astrophysical molecules; electon interatctions an detection of x-ray radiation.

  17. cGAS Conducts Micronuclei DNA Surveillance.

    Science.gov (United States)

    de Oliveira Mann, Carina C; Kranzusch, Philip J

    2017-10-01

    DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. The interplay between polymerase organization and nucleosome occupancy along DNA : How dynamic roadblocks on the DNA induce the formation of RNA polymerase pelotons

    NARCIS (Netherlands)

    van den Berg, A.A.

    2017-01-01

    During transcription RNA polymerase (RNAP) moves along a DNA molecule to copy the information on the DNA to an RNA molecule. Many textbook pictures show an RNAP sliding along empty DNA, but in reality it is crowded on the DNA and RNAP competes for space with many proteins such as other RNAP’s and

  19. Structural plasticity in Mycobacterium tuberculosis uracil-DNA glycosylase (MtUng) and its functional implications.

    Science.gov (United States)

    Arif, S M; Geethanandan, K; Mishra, P; Surolia, A; Varshney, U; Vijayan, M

    2015-07-01

    17 independent crystal structures of family I uracil-DNA glycosylase from Mycobacterium tuberculosis (MtUng) and its complexes with uracil and its derivatives, distributed among five distinct crystal forms, have been determined. Thermodynamic parameters of binding in the complexes have been measured using isothermal titration calorimetry. The two-domain protein exhibits open and closed conformations, suggesting that the closure of the domain on DNA binding involves conformational selection. Segmental mobility in the enzyme molecule is confined to a 32-residue stretch which plays a major role in DNA binding. Uracil and its derivatives can bind to the protein in two possible orientations. Only one of them is possible when there is a bulky substituent at the 5' position. The crystal structures of the complexes provide a reasonable rationale for the observed thermodynamic parameters. In addition to providing fresh insights into the structure, plasticity and interactions of the protein molecule, the results of the present investigation provide a platform for structure-based inhibitor design.

  20. Generating equilateral random polygons in confinement III

    International Nuclear Information System (INIS)

    Diao, Y; Ernst, C; Montemayor, A; Ziegler, U

    2012-01-01

    In this paper we continue our earlier studies (Diao et al 2011 J. Phys. A: Math. Theor. 44 405202, Diao et al J. Phys. A: Math. Theor. 45 275203) on the generation methods of random equilateral polygons confined in a sphere. The first half of this paper is concerned with the generation of confined equilateral random walks. We show that if the selection of a vertex is uniform subject to the position of its previous vertex and the confining condition, then the distributions of the vertices are not uniform, although there exists a distribution such that if the initial vertex is selected following this distribution, then all vertices of the random walk follow this same distribution. Thus in order to generate a confined equilateral random walk, the selection of a vertex cannot be uniform subject to the position of its previous vertex and the confining condition. We provide a simple algorithm capable of generating confined equilateral random walks whose vertex distribution is almost uniform in the confinement sphere. In the second half of this paper we show that any process generating confined equilateral random walks can be turned into a process generating confined equilateral random polygons with the property that the vertex distribution of the polygons approaches the vertex distribution of the walks as the polygons get longer and longer. In our earlier studies, the starting point of the confined polygon is fixed at the center of the sphere. The new approach here allows us to move the starting point of the confined polygon off the center of the sphere. (paper)