WorldWideScience

Sample records for dna molecular markers

  1. Molecular Identification of Date Palm Cultivars Using Random Amplified Polymorphic DNA (RAPD) Markers.

    Science.gov (United States)

    Al-Khalifah, Nasser S; Shanavaskhan, A E

    2017-01-01

    Ambiguity in the total number of date palm cultivars across the world is pointing toward the necessity for an enumerative study using standard morphological and molecular markers. Among molecular markers, DNA markers are more suitable and ubiquitous to most applications. They are highly polymorphic in nature, frequently occurring in genomes, easy to access, and highly reproducible. Various molecular markers such as restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), simple sequence repeats (SSR), inter-simple sequence repeats (ISSR), and random amplified polymorphic DNA (RAPD) markers have been successfully used as efficient tools for analysis of genetic variation in date palm. This chapter explains a stepwise protocol for extracting total genomic DNA from date palm leaves. A user-friendly protocol for RAPD analysis and a table showing the primers used in different molecular techniques that produce polymorphisms in date palm are also provided.

  2. Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.

    2013-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

  3. DNA-based molecular markers as tools for the discovery of γ-induced mutants in cereals and soybean

    International Nuclear Information System (INIS)

    Bondarenco, E.; Bondarenco, V.; Barbacar, N.; Coretchi, L.

    2009-01-01

    γ-induced mutagenesis is one of the present techniques effective in producing crops with enhanced quality and novel properties. The fast detection of mutants can be nowadays assured by the employment of DNA-based molecular markers. Different kinds of molecular markers are being widely used all over the world to monitor DNA sequence variation and identification of desired traits. In the given paper we present a short overview of the types of molecular markers and the first steps of the attempt of their use for mutants' characterization in the Republic of Moldova (authors)

  4. Assessing Date Palm Genetic Diversity Using Different Molecular Markers.

    Science.gov (United States)

    Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S

    2017-01-01

    Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.

  5. Intelligent DNA-based molecular diagnostics using linked genetic markers

    Energy Technology Data Exchange (ETDEWEB)

    Pathak, D.K.; Perlin, M.W.; Hoffman, E.P.

    1994-12-31

    This paper describes a knowledge-based system for molecular diagnostics, and its application to fully automated diagnosis of X-linked genetic disorders. Molecular diagnostic information is used in clinical practice for determining genetic risks, such as carrier determination and prenatal diagnosis. Initially, blood samples are obtained from related individuals, and PCR amplification is performed. Linkage-based molecular diagnosis then entails three data analysis steps. First, for every individual, the alleles (i.e., DNA composition) are determined at specified chromosomal locations. Second, the flow of genetic material among the individuals is established. Third, the probability that a given individual is either a carrier of the disease or affected by the disease is determined. The current practice is to perform each of these three steps manually, which is costly, time consuming, labor-intensive, and error-prone. As such, the knowledge-intensive data analysis and interpretation supersede the actual experimentation effort as the major bottleneck in molecular diagnostics. By examining the human problem solving for the task, we have designed and implemented a prototype knowledge-based system capable of fully automating linkage-based molecular diagnostics in X-linked genetic disorders, including Duchenne Muscular Dystrophy (DMD). Our system uses knowledge-based interpretation of gel electrophoresis images to determine individual DNA marker labels, a constraint satisfaction search for consistent genetic flow among individuals, and a blackboard-style problem solver for risk assessment. We describe the system`s successful diagnosis of DMD carrier and affected individuals from raw clinical data.

  6. Prospects of molecular markers in Fusarium species diversity

    DEFF Research Database (Denmark)

    Nayaka, S. Chandra; Wulff, Ednar Gadelha; Udayashankar, A.C.

    2011-01-01

    focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well...... for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole......-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates...

  7. Molecular markers for use in plant molecular breeding and germplasm evaluation

    International Nuclear Information System (INIS)

    Edwards, J.D.; McCouch, S.R.

    2007-01-01

    A number of molecular marker technologies exist, each with different advantages and disadvantages. When available, genome sequence allows for the development of greater numbers and higher quality molecular markers. When genome sequence is limited in the organism of interest, related species may serve as sources of molecular markers. Some molecular marker technologies combine the discovery and assay of DNA sequence variations, and therefore can be used in species without the need for prior sequence information and up-front investment in marker development. As a prerequisite for marker-assisted selection (MAS), there must be a known association between genetic markers and genes affecting the phenotype to be modified. Comparative databases can facilitate the transfer of knowledge of genetic marker-phenotype association across species so that discoveries in one species may be applied to many others. Further genomics research and reductions in the costs associated with molecular markers will continue to provide new opportunities to employ MAS. (author)

  8. An overview of molecular marker methods for plants | Semagn ...

    African Journals Online (AJOL)

    The development and use of molecular markers for the detection and exploitation of DNA polymorphism is one of the most significant developments in the field of molecular genetics. The presence of various types of molecular markers, and differences in their principles, methodologies, and applications require careful ...

  9. Detection of Variation in Long-Term Micropropagated Mature Pistachio via DNA-Based Molecular Markers.

    Science.gov (United States)

    Akdemir, Hülya; Suzerer, Veysel; Tilkat, Engin; Onay, Ahmet; Çiftçi, Yelda Ozden

    2016-12-01

    Determination of genetic stability of in vitro-grown plantlets is needed for safe and large-scale production of mature trees. In this study, genetic variation of long-term micropropagated mature pistachio developed through direct shoot bud regeneration using apical buds (protocol A) and in vitro-derived leaves (protocol B) was assessed via DNA-based molecular markers. Randomly amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), and amplified fragment length polymorphism (AFLP) were employed, and the obtained PIC values from RAPD (0.226), ISSR (0.220), and AFLP (0.241) showed that micropropagation of pistachio for different periods of time resulted in "reasonable polymorphism" among donor plant and its 18 clones. Mantel's test showed a consistence polymorphism level between marker systems based on similarity matrices. In conclusion, this is the first study on occurrence of genetic variability in long-term micropropagated mature pistachio plantlets. The obtained results clearly indicated that different marker approaches used in this study are reliable for assessing tissue culture-induced variations in long-term cultured pistachio plantlets.

  10. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    Science.gov (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  11. Development and Molecular Characterization of Novel Polymorphic Genomic DNA SSR Markers in Lentinula edodes.

    Science.gov (United States)

    Moon, Suyun; Lee, Hwa-Yong; Shim, Donghwan; Kim, Myungkil; Ka, Kang-Hyeon; Ryoo, Rhim; Ko, Han-Gyu; Koo, Chang-Duck; Chung, Jong-Wook; Ryu, Hojin

    2017-06-01

    Sixteen genomic DNA simple sequence repeat (SSR) markers of Lentinula edodes were developed from 205 SSR motifs present in 46.1-Mb long L. edodes genome sequences. The number of alleles ranged from 3-14 and the major allele frequency was distributed from 0.17-0.96. The values of observed and expected heterozygosity ranged from 0.00-0.76 and 0.07-0.90, respectively. The polymorphic information content value ranged from 0.07-0.89. A dendrogram, based on 16 SSR markers clustered by the paired hierarchical clustering' method, showed that 33 shiitake cultivars could be divided into three major groups and successfully identified. These SSR markers will contribute to the efficient breeding of this species by providing diversity in shiitake varieties. Furthermore, the genomic information covered by the markers can provide a valuable resource for genetic linkage map construction, molecular mapping, and marker-assisted selection in the shiitake mushroom.

  12. Trends in plant research using molecular markers.

    Science.gov (United States)

    Garrido-Cardenas, Jose Antonio; Mesa-Valle, Concepción; Manzano-Agugliaro, Francisco

    2018-03-01

    A deep bibliometric analysis has been carried out, obtaining valuable parameters that facilitate the understanding around the research in plant using molecular markers. The evolution of the improvement in the field of agronomy is fundamental for its adaptation to the new exigencies that the current world context raises. In addition, within these improvements, this article focuses on those related to the biotechnology sector. More specifically, the use of DNA markers that allow the researcher to know the set of genes associated with a particular quantitative trait or QTL. The use of molecular markers is widely extended, including: restriction fragment length polymorphism, random-amplified polymorphic DNA, amplified fragment length polymorphism, microsatellites, and single-nucleotide polymorphisms. In addition to classical methodology, new approaches based on the next generation sequencing are proving to be fundamental. In this article, a historical review of the molecular markers traditionally used in plants, since its birth and how the new molecular tools facilitate the work of plant breeders is carried out. The evolution of the most studied cultures from the point of view of molecular markers is also reviewed and other parameters whose prior knowledge can facilitate the approach of researchers to this field of research are analyzed. The bibliometric analysis of molecular markers in plants shows that top five countries in this research are: US, China, India, France, and Germany, and from 2013, this research is led by China. On the other hand, the basic research using Arabidopsis is deeper in France and Germany, while other countries focused its efforts in their main crops as the US for wheat or maize, while China and India for wheat and rice.

  13. Application of random amplified polymorphic DNA (RAPD) markers ...

    African Journals Online (AJOL)

    The random amplified polymorphic DNA (RAPD) technique has been widely applied to identify different varieties of plants for molecular breeding. However, application of RAPD markers to identify parthenogenesis in plants has not been reported. In this investigation, we used pedigree and RAPD markers to differentiate ...

  14. Viral-Cellular DNA Junctions as Molecular Markers for Assessing Intra-Tumor Heterogeneity in Cervical Cancer and for the Detection of Circulating Tumor DNA

    Directory of Open Access Journals (Sweden)

    Katrin Carow

    2017-09-01

    Full Text Available The development of cervical cancer is frequently accompanied by the integration of human papillomaviruses (HPV DNA into the host genome. Viral-cellular junction sequences, which arise in consequence, are highly tumor specific. By using these fragments as markers for tumor cell origin, we examined cervical cancer clonality in the context of intra-tumor heterogeneity. Moreover, we assessed the potential of these fragments as molecular tumor markers and analyzed their suitability for the detection of circulating tumor DNA in sera of cervical cancer patients. For intra-tumor heterogeneity analyses tumors of 8 patients with up to 5 integration sites per tumor were included. Tumor islands were micro-dissected from cryosections of several tissue blocks representing different regions of the tumor. Each micro-dissected tumor area served as template for a single junction-specific PCR. For the detection of circulating tumor-DNA (ctDNA junction-specific PCR-assays were applied to sera of 21 patients. Samples were collected preoperatively and during the course of disease. In 7 of 8 tumors the integration site(s were shown to be homogenously distributed throughout different tumor regions. Only one tumor displayed intra-tumor heterogeneity. In 5 of 21 analyzed preoperative serum samples we specifically detected junction fragments. Junction-based detection of ctDNA was significantly associated with reduced recurrence-free survival. Our study provides evidence that HPV-DNA integration is as an early step in cervical carcinogenesis. Clonality with respect to HPV integration opens new perspectives for the application of viral-cellular junction sites as molecular biomarkers in a clinical setting such as disease monitoring.

  15. Molecular markers in bladder cancer: Novel research frontiers.

    Science.gov (United States)

    Sanguedolce, Francesca; Cormio, Antonella; Bufo, Pantaleo; Carrieri, Giuseppe; Cormio, Luigi

    2015-01-01

    Bladder cancer (BC) is a heterogeneous disease encompassing distinct biologic features that lead to extremely different clinical behaviors. In the last 20 years, great efforts have been made to predict disease outcome and response to treatment by developing risk assessment calculators based on multiple standard clinical-pathological factors, as well as by testing several molecular markers. Unfortunately, risk assessment calculators alone fail to accurately assess a single patient's prognosis and response to different treatment options. Several molecular markers easily assessable by routine immunohistochemical techniques hold promise for becoming widely available and cost-effective tools for a more reliable risk assessment, but none have yet entered routine clinical practice. Current research is therefore moving towards (i) identifying novel molecular markers; (ii) testing old and new markers in homogeneous patients' populations receiving homogeneous treatments; (iii) generating a multimarker panel that could be easily, and thus routinely, used in clinical practice; (iv) developing novel risk assessment tools, possibly combining standard clinical-pathological factors with molecular markers. This review analyses the emerging body of literature concerning novel biomarkers, ranging from genetic changes to altered expression of a huge variety of molecules, potentially involved in BC outcome and response to treatment. Findings suggest that some of these indicators, such as serum circulating tumor cells and tissue mitochondrial DNA, seem to be easily assessable and provide reliable information. Other markers, such as the phosphoinositide-3-kinase (PI3K)/AKT (serine-threonine kinase)/mTOR (mammalian target of rapamycin) pathway and epigenetic changes in DNA methylation seem to not only have prognostic/predictive value but also, most importantly, represent valuable therapeutic targets. Finally, there is increasing evidence that the development of novel risk assessment tools

  16. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  17. The use of DNA markers for rapid improvement of crops in Africa ...

    African Journals Online (AJOL)

    Genetic engineering and biotechnology are providing new tools for genetic improvement of food crops. Molecular DNA markers are some of these tools which can be used in various fields of plant breeding and germplasm management. For example, molecular markers have been used to confirm the identity of hybrids in ...

  18. Reconciling patterns of inter-ocean molecular variance from four classes of molecular markers in blue marlin (Makaira nigricans).

    Science.gov (United States)

    Buonaccorsi, V P; McDowell, J R; Graves, J E

    2001-05-01

    Different classes of molecular markers occasionally yield discordant views of population structure within a species. Here, we examine the distribution of molecular variance from 14 polymorphic loci comprising four classes of molecular markers within approximately 400 blue marlin individuals (Makaira nigricans). Samples were collected from the Atlantic and Pacific Oceans over 5 years. Data from five hypervariable tetranucleotide microsatellite loci and restriction fragment length polymorphism (RFLP) analysis of whole molecule mitochondrial DNA (mtDNA) were reported and compared with previous analyses of allozyme and single-copy nuclear DNA (scnDNA) loci. Temporal variance in allele frequencies was nonsignificant in nearly all cases. Mitochondrial and microsatellite loci revealed striking phylogeographic partitioning among Atlantic and Pacific Ocean samples. A large cluster of alleles was present almost exclusively in Atlantic individuals at one microsatellite locus and for mtDNA, suggesting that, if gene flow occurs, it is likely to be unidirectional from Pacific to Atlantic oceans. Mitochondrial DNA inter-ocean divergence (FST) was almost four times greater than microsatellite or combined nuclear divergences including allozyme and scnDNA markers. Estimates of Neu varied by five orders of magnitude among marker classes. Using mathematical and computer simulation approaches, we show that substantially different distributions of FST are expected from marker classes that differ in mode of inheritance and rate of mutation, without influence of natural selection or sex-biased dispersal. Furthermore, divergent FST values can be reconciled by quantifying the balance between genetic drift, mutation and migration. These results illustrate the usefulness of a mitochondrial analysis of population history, and relative precision of nuclear estimates of gene flow based on a mean of several loci.

  19. GEOGRAPHIC DISTRIBUTION OF MOLECULAR VARIANCE WITHIN THE BLUE MARLIN (MAKAIRA NIGRICANS): A HIERARCHICAL ANALYSIS OF ALLOZYME, SINGLE-COPY NUCLEAR DNA, AND MITOCHONDRIAL DNA MARKERS.

    Science.gov (United States)

    Buonaccorsi, Vincent P; Reece, Kimberly S; Morgan, Lee W; Graves, John E

    1999-04-01

    This study presents a comparative hierarchical analysis of variance applied to three classes of molecular markers within the blue marlin (Makaira nigricans). Results are reported from analyses of four polymorphic allozyme loci, four polymorphic anonymously chosen single-copy nuclear DNA (scnDNA) loci, and previously reported restriction fragment length polymorphisms (RFLPs) of mitochondrial DNA (mtDNA). Samples were collected within and among the Atlantic and Pacific Oceans over a period of several years. Although moderate levels of genetic variation were detected at both polymorphic allozyme (H = 0.30) and scnDNA loci (H = 0.37), mtDNA markers were much more diverse (h = 0.85). Allele frequencies were significantly different between Atlantic and Pacific Ocean samples at three of four allozyme loci and three of four scnDNA loci. Estimates of allozyme genetic differentiation (θ O ) ranged from 0.00 to 0.15, with a mean of 0.08. The θ O values for scnDNA loci were similar to those of allozymes, ranging from 0.00 to 0.12 with a mean of 0.09. MtDNA RFLP divergence between oceans (θ O = 0.39) was significantly greater than divergence detected at nuclear loci (95% nuclear confidence interval = 0.04-0.11). The fourfold smaller effective population size of mtDNA and male-mediated gene flow may account for the difference observed between nuclear and mitochondrial divergence estimates. © 1999 The Society for the Study of Evolution.

  20. Genetic Confirmation of Mungbean (Vigna radiata) and Mashbean (Vigna mungo) Interspecific Recombinants using Molecular Markers.

    Science.gov (United States)

    Abbas, Ghulam; Hameed, Amjad; Rizwan, Muhammad; Ahsan, Muhammad; Asghar, Muhammad J; Iqbal, Nayyer

    2015-01-01

    Molecular confirmation of interspecific recombinants is essential to overcome the issues like self-pollination, environmental influence, and inadequacy of morphological characteristics during interspecific hybridization. The present study was conducted for genetic confirmation of mungbean (female) and mashbean (male) interspecific crosses using molecular markers. Initially, polymorphic random amplified polymorphic DNA (RAPD), universal rice primers (URP), and simple sequence repeats (SSR) markers differentiating parent genotypes were identified. Recombination in hybrids was confirmed using these polymorphic DNA markers. The NM 2006 × Mash 88 was most successful interspecific cross. Most of true recombinants confirmed by molecular markers were from this cross combination. SSR markers were efficient in detecting genetic variability and recombination with reference to specific chromosomes and particular loci. SSR (RIS) and RAPD identified variability dispersed throughout the genome. In conclusion, DNA based marker assisted selection (MAS) efficiently confirmed the interspecific recombinants. The results provided evidence that MAS can enhance the authenticity of selection in mungbean improvement program.

  1. Mutant germplasm characterization using molecular markers. A manual

    International Nuclear Information System (INIS)

    2002-01-01

    Plant biotechnology applications must not only respond to the challenge of improving food security and fostering socio-economic development, but in doing so, promote the conservation, diversification and sustainable use of plant genetic resources for food and agriculture. Nowadays the biotechnology toolbox available to plant breeders offers several new possibilities for increasing productivity, crop diversification and production, while developing a more sustainable agriculture. This training course focuses on one of the most promising set of techniques used in modern crop improvement programmes, i.e. on molecular markers. These are rapidly being adopted by plant breeders and molecular biologists as effective and appropriate tools for basic and applied studies addressing biological components in agricultural production systems. Their use in applied breeding programmes can range from facilitating the appropriate choice of parents for crosses, to mapping/tagging of gene blocks associated with economically important traits (often termed 'quantitative trait loci' (QTLs)). Gene tagging and QTL mapping in turn permit marker-assisted selection (MAS) in backcross, pedigree, and population improvement programmes, thereby facilitating more efficient incremental improvement of specific individual target traits. And through comparative genomics, molecular markers can be used in ways that allow us to more effectively discover and efficiently exploit biodiversity and the evolutionary relationships between organisms. Substantial progress has been made in recent years in mapping, tagging and isolating many agriculturally important genes using molecular markers due in large part to improvements in the techniques that have been developed to help find markers of interest. Among the techniques that are particularly promising are Restriction Fragment Length Polymorphism (RFLPs), Amplified Fragment Length Polymorphism (AFLPs), Random Amplified Polymorphic DNA (RAPDs), Microsatellites

  2. Development of cost-effective Hordeum chilense DNA markers: molecular aids for marker-assisted cereal breeding.

    Science.gov (United States)

    Hernández, P; Dorado, G; Ramírez, M C; Laurie, D A; Snape, J W; Martín, A

    2003-01-01

    Hordeum chilense is a potential source of useful genes for wheat breeding. The use of this wild species to increase genetic variation in wheat will be greatly facilitated by marker-assisted introgression. In recent years, the search for the most suitable DNA marker system for tagging H. chilense genomic regions in a wheat background has lead to the development of RAPD and SCAR markers for this species. RAPDs represent an easy way of quickly generating suitable introgression markers, but their use is limited in heterogeneous wheat genetic backgrounds. SCARs are more specific assays, suitable for automatation or multiplexing. Direct sequencing of RAPD products is a cost-effective approach that reduces labour and costs for SCAR development. The use of SSR and STS primers originally developed for wheat and barley are additional sources of genetic markers. Practical applications of the different marker approaches for obtaining derived introgression products are described.

  3. Molecular marker analysis of 'Shatangju' and 'Wuzishatangju ...

    African Journals Online (AJOL)

    'Wuzishatangju'(Citrus reticulata Blanco) is an excellent cultivar derived from a bud sport of a seedy 'Shatangju' cultivar found in Guangdong Province in the 1980s. In this study, six molecular markers including random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR), simple sequence repeat (SSR) ...

  4. CHRONICITY OF DEPRESSION AND MOLECULAR MARKERS IN A LARGE SAMPLE OF HAN CHINESE WOMEN.

    Science.gov (United States)

    Edwards, Alexis C; Aggen, Steven H; Cai, Na; Bigdeli, Tim B; Peterson, Roseann E; Docherty, Anna R; Webb, Bradley T; Bacanu, Silviu-Alin; Flint, Jonathan; Kendler, Kenneth S

    2016-04-25

    Major depressive disorder (MDD) has been associated with changes in mean telomere length and mitochondrial DNA (mtDNA) copy number. This study investigates if clinical features of MDD differentially impact these molecular markers. Data from a large, clinically ascertained sample of Han Chinese women with recurrent MDD were used to examine whether symptom presentation, severity, and comorbidity were related to salivary telomere length and/or mtDNA copy number (maximum N = 5,284 for both molecular and phenotypic data). Structural equation modeling revealed that duration of longest episode was positively associated with mtDNA copy number, while earlier age of onset of most severe episode and a history of dysthymia were associated with shorter telomeres. Other factors, such as symptom presentation, family history of depression, and other comorbid internalizing disorders, were not associated with these molecular markers. Chronicity of depressive symptoms is related to more pronounced telomere shortening and increased mtDNA copy number among individuals with a history of recurrent MDD. As these molecular markers have previously been implicated in physiological aging and morbidity, individuals who experience prolonged depressive symptoms are potentially at greater risk of adverse medical outcomes. © 2016 Wiley Periodicals, Inc.

  5. Gender Identification in Date Palm Using Molecular Markers.

    Science.gov (United States)

    Awan, Faisal Saeed; Maryam; Jaskani, Muhammad J; Sadia, Bushra

    2017-01-01

    Breeding of date palm is complicated because of its long life cycle and heterozygous nature. Sexual propagation of date palm does not produce true-to-type plants. Sex of date palms cannot be identified until the first flowering stage. Molecular markers such as random amplified polymorphic DNA (RAPD), sequence-characterized amplified regions (SCAR), and simple sequence repeats (SSR) have successfully been used to identify the sex-linked loci in the plant genome and to isolate the corresponding genes. This chapter highlights the use of three molecular markers including RAPD, SCAR, and SSR to identify the gender of date palm seedlings.

  6. Application of DNA markers against illegal logging as a new tool for the Forest Guard Service

    OpenAIRE

    Nowakowska, Justyna A.

    2011-01-01

    DNA markers are currently the most precise tool for forest tree species identification and can be used for comparative analyses of plant material. Molecular diagnosis of evidence and reference material is based on comparing the structure of DNA markers duplicated in the PCR reaction and estimation of the DNA profiles obtained in studied wood samples. For this purpose, the microsatellite DNA markers are the most suitable tool because of their high polymorphism and accurate detection of structu...

  7. Development and use of molecular markers: past and present.

    Science.gov (United States)

    Grover, Atul; Sharma, P C

    2016-01-01

    Molecular markers, due to their stability, cost-effectiveness and ease of use provide an immensely popular tool for a variety of applications including genome mapping, gene tagging, genetic diversity diversity, phylogenetic analysis and forensic investigations. In the last three decades, a number of molecular marker techniques have been developed and exploited worldwide in different systems. However, only a handful of these techniques, namely RFLPs, RAPDs, AFLPs, ISSRs, SSRs and SNPs have received global acceptance. A recent revolution in DNA sequencing techniques has taken the discovery and application of molecular markers to high-throughput and ultrahigh-throughput levels. Although, the choice of marker will obviously depend on the targeted use, microsatellites, SNPs and genotyping by sequencing (GBS) largely fulfill most of the user requirements. Further, modern transcriptomic and functional markers will lead the ventures onto high-density genetic map construction, identification of QTLs, breeding and conservation strategies in times to come in combination with other high throughput techniques. This review presents an overview of different marker technologies and their variants with a comparative account of their characteristic features and applications.

  8. Molecular markers for drought tolerance in bread wheat

    African Journals Online (AJOL)

    aghomotsegin

    2013-05-22

    May 22, 2013 ... Molecular markers for drought tolerance in bread wheat. Tharwat El Ameen. Department of Genetics, South Valley University, Qena, 83523, Egypt. Accepted 3 May, 2013. Random amplified polymorphic DNA (RAPD) primers associated with drought tolerance was used in this study to characterize drought ...

  9. Usefulness of molecular markers in the diagnosis of occupational and recreational histoplasmosis outbreaks.

    Science.gov (United States)

    Frías-De-León, María Guadalupe; Ramírez-Bárcenas, José Antonio; Rodríguez-Arellanes, Gabriela; Velasco-Castrejón, Oscar; Taylor, Maria Lucia; Reyes-Montes, María Del Rocío

    2017-03-01

    Histoplasmosis is considered the most important systemic mycosis in Mexico, and its diagnosis requires fast and reliable methodologies. The present study evaluated the usefulness of PCR using Hcp100 and 1281-1283 (220) molecular markers in detecting Histoplasma capsulatum in occupational and recreational outbreaks. Seven clinical serum samples of infected individuals from three different histoplasmosis outbreaks were processed by enzyme-linked immunosorbent assay (ELISA) to titre anti-H. capsulatum antibodies and to extract DNA. Fourteen environmental samples were also processed for H. capsulatum isolation and DNA extraction. Both clinical and environmental DNA samples were analysed by PCR with Hcp100 and 1281-1283 (220) markers. Antibodies to H. capsulatum were detected by ELISA in all serum samples using specific antigens, and in six of these samples, the PCR products of both molecular markers were amplified. Four environmental samples amplified one of the two markers, but only one sample amplified both markers and an isolate of H. capsulatum was cultured from this sample. All PCR products were sequenced, and the sequences for each marker were analysed using the Basic Local Alignment Search Tool (BLASTn), which revealed 95-98 and 98-100 % similarities with the reference sequences deposited in the GenBank for Hcp100 and 1281-1283 (220) , respectively. Both molecular markers proved to be useful in studying histoplasmosis outbreaks because they are matched for pathogen detection in either clinical or environmental samples.

  10. Molecular marker analysis of heading date Hd1 locus in Egyptian ...

    African Journals Online (AJOL)

    Nine molecular markers derived from the heading date QTL Hd1 DNA sequence for cultivated rice were used to study the heading date allelic diversity of the cultivated Egyptian rice varieties. The results showed that among the nine simple sequence repeats (SSR) and sequence tagged-sites (STS) markers used, one SSR ...

  11. Identification of body fluid-specific DNA methylation markers for use in forensic science.

    Science.gov (United States)

    Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

    2014-11-01

    DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  13. NABIC marker database: A molecular markers information network of agricultural crops.

    Science.gov (United States)

    Kim, Chang-Kug; Seol, Young-Joo; Lee, Dong-Jun; Jeong, In-Seon; Yoon, Ung-Han; Lee, Gang-Seob; Hahn, Jang-Ho; Park, Dong-Suk

    2013-01-01

    In 2013, National Agricultural Biotechnology Information Center (NABIC) reconstructs a molecular marker database for useful genetic resources. The web-based marker database consists of three major functional categories: map viewer, RSN marker and gene annotation. It provides 7250 marker locations, 3301 RSN marker property, 3280 molecular marker annotation information in agricultural plants. The individual molecular marker provides information such as marker name, expressed sequence tag number, gene definition and general marker information. This updated marker-based database provides useful information through a user-friendly web interface that assisted in tracing any new structures of the chromosomes and gene positional functions using specific molecular markers. The database is available for free at http://nabic.rda.go.kr/gere/rice/molecularMarkers/

  14. Applications of molecular markers in the discrimination of Panax species and Korean ginseng cultivars (Panax ginseng

    Directory of Open Access Journals (Sweden)

    Ick Hyun Jo

    2017-10-01

    Full Text Available The development of molecular markers is one of the most useful methods for molecular breeding and marker-based molecular associated selections. Even though there is less information on the reference genome, molecular markers are indispensable tools for determination of genetic variation and identification of species with high levels of accuracy and reproducibility. The demand for molecular approaches for marker-based breeding and genetic discriminations in Panax species has greatly increased in recent times and has been successfully applied for various purposes. However, owing to the existence of diverse molecular techniques and differences in their principles and applications, there should be careful consideration while selecting appropriate marker types. In this review, we outline the recent status of different molecular marker applications in ginseng research and industrial fields. In addition, we discuss the basic principles, requirements, and advantages and disadvantages of the most widely used molecular markers, including restriction fragment length polymorphism, random amplified polymorphic DNA, sequence tag sites, simple sequence repeats, and single nucleotide polymorphisms.

  15. Applications of molecular markers in the discrimination of Panax species and Korean ginseng cultivars (Panax ginseng).

    Science.gov (United States)

    Jo, Ick Hyun; Kim, Young Chang; Kim, Dong Hwi; Kim, Kee Hong; Hyun, Tae Kyung; Ryu, Hojin; Bang, Kyong Hwan

    2017-10-01

    The development of molecular markers is one of the most useful methods for molecular breeding and marker-based molecular associated selections. Even though there is less information on the reference genome, molecular markers are indispensable tools for determination of genetic variation and identification of species with high levels of accuracy and reproducibility. The demand for molecular approaches for marker-based breeding and genetic discriminations in Panax species has greatly increased in recent times and has been successfully applied for various purposes. However, owing to the existence of diverse molecular techniques and differences in their principles and applications, there should be careful consideration while selecting appropriate marker types. In this review, we outline the recent status of different molecular marker applications in ginseng research and industrial fields. In addition, we discuss the basic principles, requirements, and advantages and disadvantages of the most widely used molecular markers, including restriction fragment length polymorphism, random amplified polymorphic DNA, sequence tag sites, simple sequence repeats, and single nucleotide polymorphisms.

  16. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  17. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers.

    Science.gov (United States)

    Wei, Jingli; Hu, Xiaorong; Yang, Jingjing; Yang, Wencai

    2012-01-01

    The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG) Release2.3 Predicted CDS (SL2.40) discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2%) of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.

  18. Application of next-generation sequencing for rapid marker development in molecular plant breeding: a case study on anthracnose disease resistance in Lupinus angustifolius L.

    Directory of Open Access Journals (Sweden)

    Yang Huaan

    2012-07-01

    Full Text Available Abstract Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM, and are now replacing the markers previously developed by a traditional DNA

  19. Development, distribution and application of DNA markers for cereal research

    International Nuclear Information System (INIS)

    Qi, X.; Stephenson, P.; Devos, K.M.; Gale, M.D.

    2001-01-01

    DNA probes and primers are important resources for molecular genetic research and molecular breeding. Presently, more than 2500 wheat probes, 400 barley probes, 800 foxtail, pearl millet and finger millet probes, and approximately 150 wheat microsatellite (SSR) primer pairs have been developed and maintained in our DNA Resource Centre at the John Innes Centre (JIC). To accelerate probe and primer distribution, an 'anchor set' and a 'supplementary anchor set', containing 73 and 31 wheat RFLP probes, respectively, and a standard set of 42 primer pairs for wheat SSR markers were selected. Similarly, a set of 52 pearl millet probes has been selected for distribution. More than 8000 wheat RFLP probes, 2000 wheat SSR primer pairs, 700 millet probes and 200 barley probes have been distributed to more than 250 research groups in 40 countries. Our wheat and millet probes and other grass cDNA probes have been used for comparative genetic studies. The revealed conservation of gene content and gene order has been used to construct maps of many grass species and to predict the locations of key genes from one crop species to another. Developed SSR and AFLP markers in wheat, barley and millet are particularly suited for genetic diversity analyses and map construction. (author)

  20. Molecular markers shared by diverse apomictic Pennisetum species.

    Science.gov (United States)

    Lubbers, E L; Arthur, L; Hanna, W W; Ozias-Akins, P

    1994-11-01

    Two molecular markers, a RAPD (randomly amplified polymorphic DNA) and a RFLP/STS (restriction fragment length polymorphism/sequence-tagged site), previously were found associated with apomictic reproductive behavior in a backcross population produced to transfer apomixis from Pennisetum squamulatum to pearl millet. The occurrence of these molecular markers in a range of 29 accessions of Pennisetum comprising 11 apomictic and 8 sexual species was investigated. Both markers were specific for apomictic species in Pennisetum. The RFLP/STS marker, UGT 197, was found to be associated with all taxa that displayed apomictic reproductive behavior except those in section Brevivalvula. Neither UGT197 nor the cloned RAPD fragment OPC-04600 hybridized with any sexually reproducing representatives of the genus. The cloned C04600 was associated with 3 of the 11 apomictic species, P. ciliare, P. massaicum, and P. squamulatum. UGT197 was more consistently associated with apomictic reproductive behavior than OPC04600 or cloned C04600, thus it could be inferred that UGT197 is more closely linked to the gene(s) for apomixis than the cloned C04600. The successful use of these probes to survey other Pennisetum species indicates that apomixis is a trait that can be followed across species by using molecular means. This technique of surveying species within a genus will be useful in determining the relative importance of newly isolated markers and may facilitate the identification of the apomixis gene(s).

  1. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  2. Molecular studies in olive (Olea europaea L.): overview on DNA markers applications and recent advances in genome analysis.

    Science.gov (United States)

    Bracci, T; Busconi, M; Fogher, C; Sebastiani, L

    2011-04-01

    Olive (Olea europaea L.) is one of the oldest agricultural tree crops worldwide and is an important source of oil with beneficial properties for human health. This emblematic tree crop of the Mediterranean Basin, which has conserved a very wide germplasm estimated in more than 1,200 cultivars, is a diploid species (2n = 2x = 46) that is present in two forms, namely wild (Olea europaea subsp. europaea var. sylvestris) and cultivated (Olea europaea subsp. europaea var. europaea). In spite of its economic and nutritional importance, there are few data about the genetic of olive if compared with other fruit crops. Available molecular data are especially related to the application of molecular markers to the analysis of genetic variability in Olea europaea complex and to develop efficient molecular tools for the olive oil origin traceability. With regard to genomic research, in the last years efforts are made for the identification of expressed sequence tag, with particular interest in those sequences expressed during fruit development and in pollen allergens. Very recently the sequencing of chloroplast genome provided new information on the olive nucleotide sequence, opening the olive genomic era. In this article, we provide an overview of the most relevant results in olive molecular studies. A particular attention was given to DNA markers and their application that constitute the most part of published researches. The first important results in genome analysis were reported.

  3. Identification of single-copy orthologous genes between Physalis and Solanum lycopersicum and analysis of genetic diversity in Physalis using molecular markers.

    Directory of Open Access Journals (Sweden)

    Jingli Wei

    Full Text Available The genus Physalis includes a number of commercially important edible and ornamental species. Its high nutritional value and potential medicinal properties leads to the increased commercial interest in the products of this genus worldwide. However, lack of molecular markers prevents the detailed study of genetics and phylogeny in Physalis, which limits the progress of breeding. In the present study, we compared the DNA sequences between Physalis and tomato, and attempted to analyze genetic diversity in Physalis using tomato markers. Blasting 23180 DNA sequences derived from Physalis against the International Tomato Annotation Group (ITAG Release2.3 Predicted CDS (SL2.40 discovered 3356 single-copy orthologous genes between them. A total of 38 accessions from at least six species of Physalis were subjected to genetic diversity analysis using 97 tomato markers and 25 SSR markers derived from P. peruviana. Majority (73.2% of tomato markers could amplify DNA fragments from at least one accession of Physalis. Diversity in Physalis at molecular level was also detected. The average Nei's genetic distance between accessions was 0.3806 with a range of 0.2865 to 0.7091. These results indicated Physalis and tomato had similarity at both molecular marker and DNA sequence levels. Therefore, the molecular markers developed in tomato can be used in genetic study in Physalis.

  4. MOLECULAR GENETIC MARKERS AND METHODS OF THEIR IDENTIFICATION IN MODERN FISH-FARMING

    Directory of Open Access Journals (Sweden)

    I. Hrytsyniak

    2014-03-01

    Full Text Available Purpose. The application of molecular genetic markers has been widely used in modern experimental fish-farming in recent years. This methodology is currently presented by a differentiated approach with individual mechanisms and clearly defined possibilities. Numerous publications in the scientific literature that are dedicated to molecular genetic markers for the most part offer purely practical data. Thus, the synthesis and analysis of existing information on the general principles of action and the limits of the main methods of using molecular genetic markers is an actual problem. In particular, such a description will make it possible to plan more effectively the experiment and to obtain the desired results with high reliability. Findings. The main types of variable parts of DNA that can be used as molecular genetic markers in determining the level of stock hybridization, conducting genetic inventory of population and solving other problems in modern fish-farming are described in this paper. Also, the article provides an overview of principal modern methods that can be used to identify molecular genetic markers. Originality. This work is a generalization of modern ideas about the mechanisms of experiments with molecular genetic markers in fish-farming. Information is provided in the form of consistent presentation of the principles and purpose of each method, as well as significant advances during their practical application. Practical value. The proposed review of classic and modern literature data on molecular genetic markers can be used for planning, modernization and correction of research activity in modern fish-farming.

  5. Biological (molecular and cellular) markers of toxicity

    International Nuclear Information System (INIS)

    Shugart, L.R.; D'Surney, S.J.; Gettys-Hull, C.; Greeley, M.S. Jr.

    1991-01-01

    Several molecular and cellular markers of genotoxicity were adapted for measurement in the Medaka (Oryzias latipes), and were used to describe the effects of treatment of the organism with diethylnitrosamine (DEN). NO 6 -ethyl guanine adducts were detected, and a slight statistically significant, increase in DNA strand breaks was observed. These results are consistent with the hypothesis that prolonged exposure to high levels of DEN induced alkyltransferase activity which enzymatically removes any O 6 -ethyl guanine adducts but does not result in strand breaks or hypomethylation of the DNA such as might be expected from excision repair of chemically modified DNA. Following a five week continuous DEN exposure with 100 percent renewal of DEN-water every third day, the F values (DNA double strandedness) increased considerably and to similar extent in fish exposed to 25, 50, and 100 ppM DEN. This has been observed also in medaka exposed to BaP

  6. Functional molecular markers for crop improvement.

    Science.gov (United States)

    Kage, Udaykumar; Kumar, Arun; Dhokane, Dhananjay; Karre, Shailesh; Kushalappa, Ajjamada C

    2016-10-01

    A tremendous decline in cultivable land and resources and a huge increase in food demand calls for immediate attention to crop improvement. Though molecular plant breeding serves as a viable solution and is considered as "foundation for twenty-first century crop improvement", a major stumbling block for crop improvement is the availability of a limited functional gene pool for cereal crops. Advancement in the next generation sequencing (NGS) technologies integrated with tools like metabolomics, proteomics and association mapping studies have facilitated the identification of candidate genes, their allelic variants and opened new avenues to accelerate crop improvement through development and use of functional molecular markers (FMMs). The FMMs are developed from the sequence polymorphisms present within functional gene(s) which are associated with phenotypic trait variations. Since FMMs obviate the problems associated with random DNA markers, these are considered as "the holy grail" of plant breeders who employ targeted marker assisted selections (MAS) for crop improvement. This review article attempts to consider the current resources and novel methods such as metabolomics, proteomics and association studies for the identification of candidate genes and their validation through virus-induced gene silencing (VIGS) for the development of FMMs. A number of examples where the FMMs have been developed and used for the improvement of cereal crops for agronomic, food quality, disease resistance and abiotic stress tolerance traits have been considered.

  7. DNA-based genetic markers for Rapid Cycling Brassica rapa (Fast Plants type designed for the teaching laboratory.

    Directory of Open Access Journals (Sweden)

    Eryn E. Slankster

    2012-06-01

    Full Text Available We have developed DNA-based genetic markers for rapid-cycling Brassica rapa (RCBr, also known as Fast Plants. Although markers for Brassica rapa already exist, ours were intentionally designed for use in a teaching laboratory environment. The qualities we selected for were robust amplification in PCR, polymorphism in RCBr strains, and alleles that can be easily resolved in simple agarose slab gels. We have developed two single nucleotide polymorphism (SNP based markers and 14 variable number tandem repeat (VNTR-type markers spread over four chromosomes. The DNA sequences of these markers represent variation in a wide range of genomic features. Among the VNTR-type markers, there are examples of variation in a nongenic region, variation within an intron, and variation in the coding sequence of a gene. Among the SNP-based markers there are examples of polymorphism in intronic DNA and synonymous substitution in a coding sequence. Thus these markers can serve laboratory exercises in both transmission genetics and molecular biology.

  8. Circulating cell-free DNA: an up-coming molecular marker in exercise physiology.

    Science.gov (United States)

    Breitbach, Sarah; Tug, Suzan; Simon, Perikles

    2012-07-01

    The phenomenon of circulating cell-free DNA (cfDNA) concentrations is of importance for many biomedical disciplines including the field of exercise physiology. Increases of cfDNA due to exercise are described to be a potential hallmark for the overtraining syndrome and might be related to, or trigger adaptations of, immune function induced by strenuous exercise. At the same time, exercise provides a practicable model for studying the phenomenon of cfDNA that is described to be of pathophysiological relevance for different topics in clinical medicine like autoimmune diseases and cancer. In this review, we are summarizing the current knowledge of exercise-based acute and chronic alterations in cfDNA levels and their physiological significance. The effects of acute exercise on cfDNA concentrations have been investigated in resistance exercises and in continuous, stepwise and interval endurance exercises of different durations. cfDNA concentrations peaked immediately after acute exercise and showed a rapid return to baseline levels. Typical markers of skeletal muscle damage (creatine kinase, uric acid, C-reactive protein) show delayed kinetics compared with the cfDNA peak response. Exercise parameters such as intensity, duration or average energy expenditure do not explain the extent of increasing cfDNA concentrations after strenuous exercise. This could be due to complex processes inside the human organism during and after physical activity. Therefore, we hypothesize composite effects of different physiological stress parameters that come along with exercise to be responsible for increasing cfDNA concentrations. We suggest that due to acute stress, cfDNA levels increase rapidly by a spontaneous active or passive release mechanism that is not yet known. As a result of the rapid and parallel increase of cfDNA and lactate in an incremental treadmill test leading to exhaustion within 15-20 minutes, it is unlikely that cfDNA is released into the plasma by typical necrosis

  9. Molecular markers in disease detection and follow-up of patients with non-muscle invasive bladder cancer.

    Science.gov (United States)

    Maas, Moritz; Walz, Simon; Stühler, Viktoria; Aufderklamm, Stefan; Rausch, Steffen; Bedke, Jens; Stenzl, Arnulf; Todenhöfer, Tilman

    2018-05-01

    Diagnosis and surveillance of non-muscle invasive bladder cancer (NMIBC) is mainly based on endoscopic bladder evaluation and urine cytology. Several assays for determining additional molecular markers (urine-, tissue- or blood-based) have been developed in recent years but have not been included in clinical guidelines so far. Areas covered: This review gives an update on different molecular markers in the urine and evaluates their role in patients with NMIBC in disease detection and surveillance. Moreover, the potential of recent approaches such as DNA methylation assays, multi-panel RNA gene expression assays and cell-free DNA analysis is assessed. Expert commentary: Most studies on various molecular urine markers have mainly focused on a potential replacement of cystoscopy. New developments in high throughput technologies and urine markers may offer further advantages as they may represent a non-invasive approach for molecular characterization of the disease. This opens new options for individualized surveillance strategies and may help to choose the best therapeutic option. The implementation of these technologies in well-designed clinical trials is essential to further promote the use of urine diagnostics in the management of patients with NMIBC.

  10. DNA Fingerprinting of Olive Varieties by Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Dunja Bandelj

    2002-01-01

    Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.

  11. Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning.

    Science.gov (United States)

    Fu, J J; Mei, Z Q; Tania, M; Yang, L Q; Cheng, J L; Khan, M A

    2015-05-25

    The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

  12. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari

    2014-01-01

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  13. Identification of Paramecium bursaria syngens through molecular markers--comparative analysis of three loci in the nuclear and mitochondrial DNA.

    Science.gov (United States)

    Greczek-Stachura, Magdalena; Potekhin, Alexey; Przyboś, Ewa; Rautian, Maria; Skoblo, Inna; Tarcz, Sebastian

    2012-09-01

    This is the first attempt to resolve the phylogenetic relationship between different syngens of Paramecium bursaria and to investigate at a molecular level the intraspecific differentiation of strains originating from very distant geographical locations. Herein we introduce a new collection of five P. bursaria syngens maintained at St Petersburg State University, as the international collection of syngens was lost in the 1960s. To analyze the degree of speciation within Paramecium bursaria, we examined 26 strains belonging to five different syngens from distant and geographically isolated localities using rDNA (ITS1-5.8S-ITS2-5'LSU) fragments, mitochondrial cytochrome c oxidase subunit I (COI), and H4 gene fragments. It was shown that P. bursaria strains of the same syngens cluster together in all three inferred molecular phylogenies. The genetic diversity among the studied P. bursaria strains based on rDNA sequences was rather low. The COI divergence of Paramecium bursaria was also definitely lower than that observed in the Paramecium aurelia complex. The nucleotide sequences of the H4 gene analyzed in the present study indicate the extent of genetic differences between the syngens of Paramecium bursaria. Our study demonstrates the diagnostic value of molecular markers, which are important tools in the identification of Paramecium bursaria syngens. Copyright © 2011 Elsevier GmbH. All rights reserved.

  14. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants

    Science.gov (United States)

    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki

    2014-01-01

    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase (http://marker.kazusa.or.jp). This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops. PMID:25320561

  15. Use of radioisotopes in agriculture: DNA based molecular markers in crop improvement

    International Nuclear Information System (INIS)

    Sivaramakrishnan, S.; Seetharama, N.; Kannan, Seetha

    2001-01-01

    Agriculture has always benefited from the use of radioisotopes in many ways. In the beginning radioisotopes were mostly used for physiological studies to measure photosynthetic efficiency, nutrient uptake, and for mutation breeding. Radioisotopes have now become a part of the biotechnological tools that are being increasingly used in improving crops and production systems. The tools of biotechnology are being increasingly used to hasten breeding and address problems of biotic and abiotic stresses. Some of the non-radioactive methods have replaced radiotracer techniques and thus led to automation often at high cost. However, still there remain many applications where radioisotopes seem almost indispensable. For some of the applications like comparative genome mapping, the confirmation of transgenics, and establishment of gene copy number, use of RFLP with radioisotopes is essential. The following research areas at ICRISAT use radioisotopes: (1) physiological basis of adaptation to abiotic stresses (ii) development and use of appropriate DNA markers crop improvement; (iii) characterization of cytoplasmic male sterile systems and genetic diversity of breeding materials, land races and the wild relatives and (iv) molecular basis of disease resistance; (v) comparative genome mapping across cereals, (vi) isolation and characterization of genes of potential value to genetic improvement and (vii) verification of genetic transformation events. (author)

  16. Natural hybridization in tropical spikerushes of Eleocharis subgenus Limnochloa (Cyperaceae): Evidence from morphology and DNA markers

    Czech Academy of Sciences Publication Activity Database

    Košnar, J.; Košnar, Ji.; Macek, Petr; Herbstová, Miroslava; Rejmánková, E.; Stech, M.

    2010-01-01

    Roč. 97, č. 7 (2010), s. 1229-1240 ISSN 0002-9122 Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z50510513 Keywords : Belize * Cyperaceae * DNA markers * hybridization Subject RIV: EB - Genetics ; Molecular Biology; EB - Genetics ; Molecular Biology (BU-J) Impact factor: 3.052, year: 2010

  17. Advances in Carcinogenic Metal Toxicity and Potential Molecular Markers

    Directory of Open Access Journals (Sweden)

    Preeyaporn Koedrith

    2011-12-01

    Full Text Available Metal compounds such as arsenic, cadmium, chromium, cobalt, lead, mercury, and nickel are classified as carcinogens affecting human health through occupational and environmental exposure. However, the underlying mechanisms involved in tumor formation are not well clarified. Interference of metal homeostasis may result in oxidative stress which represents an imbalance between production of free radicals and the system’s ability to readily detoxify reactive intermediates. This event consequently causes DNA damage, lipid peroxidation, protein modification, and possibly symptomatic effects for various diseases including cancer. This review discusses predominant modes of action and numerous molecular markers. Attention is paid to metal-induced generation of free radicals, the phenomenon of oxidative stress, damage to DNA, lipid, and proteins, responsive signal transduction pathways with major roles in cell growth and development, and roles of antioxidant enzymatic and DNA repair systems. Interaction of non-enzymatic antioxidants (carotenoids, flavonoids, glutathione, selenium, vitamin C, vitamin E, and others with cellular oxidative stress markers (catalase, glutathione peroxidase, and superoxide dismutase as well as certain regulatory factors, including AP-1, NF-κB, Ref-1, and p53 is also reviewed. Dysregulation of protective pathways, including cellular antioxidant network against free radicals as well as DNA repair deficiency is related to oncogenic stimulation. These observations provide evidence that emerging oxidative stress-responsive regulatory factors and DNA repair proteins are putative predictive factors for tumor initiation and progression.

  18. Molecular Markers for Food Traceability

    Directory of Open Access Journals (Sweden)

    Paula Martins-Lopes

    2013-01-01

    Full Text Available DNA analysis with molecular markers has opened a way to understand complex organism's genome. It is presently being widely applied across different fields, where food takes a preeminent position. Constant outbreaks of foodborne illnesses are increasing consumer's attention towards more detailed information related to what they are consuming. This overview reports on the areas where food traceability has been considered, and the problems that still remain to be bypassed in order to be widely applied. An outline of the most broadly used PCR-based methods for food traceability is described. Applications in the area of detection of genetically modified organisms, protected denomination of origin, allergenic and intolerance reactions are detailed in order to understand the dimension of the performed studies.

  19. The efficiency of mitochondrial DNA markers in constructing genetic ...

    African Journals Online (AJOL)

    The efficiency of mitochondrial DNA markers in constructing genetic relationship among Oryx species. ... These data were used to provide the genetic kinship among different Oryx species. The complete cytochrome b gene ... Key words: Conservation, endangered species, Oryx, mitochondrial DNA (mtDNA) markers.

  20. Molecular markers of carcinogenesis for risk stratification of individuals with colorectal polyps: a case-control study.

    Science.gov (United States)

    Gupta, Samir; Sun, Han; Yi, Sang; Storm, Joy; Xiao, Guanghua; Balasubramanian, Bijal A; Zhang, Song; Ashfaq, Raheela; Rockey, Don C

    2014-10-01

    Risk stratification using number, size, and histology of colorectal adenomas is currently suboptimal for identifying patients at increased risk for future colorectal cancer. We hypothesized that molecular markers of carcinogenesis in adenomas, measured via immunohistochemistry, may help identify high-risk patients. To test this hypothesis, we conducted a retrospective, 1:1 matched case-control study (n = 216; 46% female) in which cases were patients with colorectal cancer and synchronous adenoma and controls were patients with adenoma but no colorectal cancer at baseline or within 5 years of follow-up. In phase I of analyses, we compared expression of molecular markers of carcinogenesis in case and control adenomas, blind to case status. In phase II of analyses, patients were randomly divided into independent training and validation groups to develop a model for predicting case status. We found that seven markers [p53, p21, Cox-2, β-catenin (BCAT), DNA-dependent protein kinase (DNApkcs), survivin, and O6-methylguanine-DNA methyltransferase (MGMT)] were significantly associated with case status on unadjusted analyses, as well as analyses adjusted for age and advanced adenoma status (P marker component). When applied to the validation set, a predictive model using these seven markers showed substantial accuracy for identifying cases [area under the receiver operation characteristic curve (AUC), 0.83; 95% confidence interval (CI), 0.74-0.92]. A parsimonious model using three markers performed similarly to the seven-marker model (AUC, 0.84). In summary, we found that molecular markers of carcinogenesis distinguished adenomas from patients with and without colorectal cancer. Furthermore, we speculate that prospective studies using molecular markers to identify individuals with polyps at risk for future neoplasia are warranted. ©2014 American Association for Cancer Research.

  1. Trend of different molecular markers in the last decades for studying human migrations.

    Science.gov (United States)

    Kundu, Sharbadeb; Ghosh, Sankar Kumar

    2015-02-10

    Anatomically modern humans are known to have widely migrated throughout history. Different scientific evidences suggest that the entire human population descended from just several thousand African migrants. About 85,000 years ago, the first wave of human migration was out of Africa, that followed the coasts through the Middle East, into Southern Asia via Sri Lanka, and in due course around Indonesia and into Australia. Another wave of migration between 40,000 and 12,000 years ago brought humans northward into Europe. However, the frozen north limited human expansion in Europe, and created a land bridge, "Bering land bridge", connecting Asia with North America about 25,000 years ago. Although fossil data give the most direct information about our past, it has certain anomalies. So, molecular archeologists are now using different molecular markers to trace the "most recent common ancestor" and also the migration pattern of modern humans. In this study, we have studied the trend of molecular markers and also the methodologies implemented in the last decades (2003-2014). From our observation, we can say that D-loop region of mtDNA and Y chromosome based markers are predominant. Nevertheless, mtDNA, especially the D-loop region, has some unique features, which makes it a more effective marker for tracing prehistoric footprints of modern human populations. Although, natural selection should also be taken into account in studying mtDNA based human migration. As per technology is concerned, Sanger sequencing is the major technique that is being used in almost all studies. But, the emergence of different cost-effective-and-easy-to-handle NGS platforms has increased its popularity over Sanger sequencing in studying human migration. Copyright © 2014. Published by Elsevier B.V.

  2. Molecular Markers Useful for Intraspecies Subtyping and Strain Differentiation of Dermatophytes.

    Science.gov (United States)

    Mochizuki, Takashi; Takeda, Kiminobu; Anzawa, Kazushi

    2017-02-01

    Dermatophytosis is a very common skin disorder and the most frequent infection encountered by practicing dermatologists. The identification, pathogenicity, biology, and epidemiology of dermatophytes, the causative agents of dermatophytosis, are of interest for both dermatologists and medical mycologists. Recent advances in molecular methods have provided new techniques for identifying dermatophytes, including intraspecies variations. Intraspecies subtyping and strain differentiation have made possible the tracking of infections, the identification of common sources of infections, recurrence or reinfection after treatment, and analysis of strain virulence and drug resistance. This review describes molecular methods of intraspecies subtyping and strain differentiation, including analyses of mitochondrial DNA and non-transcribed spacer regions of ribosomal RNA genes, random amplification of polymorphic DNA, and microsatellite markers, along with their advantages and limitations.

  3. Identification of molecular markers associated with fruit traits in olive and assessment of olive core collection with AFLP markers and fruit traits.

    Science.gov (United States)

    Ipek, M; Seker, M; Ipek, A; Gul, M K

    2015-03-31

    The purpose of this study was to characterize olive core collection with amplified fragment length polymorphism (AFLP) markers and fruit traits and to determine AFLP markers significantly associated with these fruit characters in olive. A total of 168 polymorphic AFLP markers generated by five primer combinations and nine fruit traits were used to characterize relationships between 18 olive cultivars. Although all olive cultivars were discriminated from each other by either AFLP markers (markers and fruit traits was not significantly correlated (r = 0.13). Partial clustering of olive cultivars by AFLP markers according to their geographical origin was observed. Associations of AFLP markers with fruits were determined using a multiple-regression analysis with stepwise addition of AFLP markers. Significant associations between eight AFLP markers and fruit traits were identified. While five AFLP markers demonstrated significant negative correlation with fruit and stone weight, width and length and total polyphenols (P markers displayed significant positive correlation with α-tocopherol and γ-tocopherol (P molecular markers with fruit traits in olive. Molecular markers associated with morphological and agronomic traits could be utilized for the breeding of olive cultivars. However, the association power of these markers needs to be confirmed in larger populations, and highly correlated markers should then be converted to PCR-based DNA markers such as sequence-characterized amplified region markers for better utilization.

  4. Assessment of four molecular markers as potential DNA barcodes for red algae Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta).

    Science.gov (United States)

    Tan, Ji; Lim, Phaik-Eem; Phang, Siew-Moi; Hong, Dang Diem; Sunarpi, H; Hurtado, Anicia Q

    2012-01-01

    DNA barcoding has been a major advancement in the field of taxonomy, seeing much effort put into the barcoding of wide taxa of organisms, macro and microalgae included. The mitochondrial-encoded cox1 and plastid-encoded rbcL has been proposed as potential DNA barcodes for rhodophytes, but are yet to be tested on the commercially important carrageenophytes Kappaphycus and Eucheuma. This study gauges the effectiveness of four markers, namely the mitochondrial cox1, cox2, cox2-3 spacer and the plastid rbcL in DNA barcoding on selected Kappaphycus and Eucheuma from Southeast Asia. Marker assessments were performed using established distance and tree-based identification criteria from earlier studies. Barcoding patterns on a larger scale were simulated by empirically testing on the commonly used cox2-3 spacer. The phylogeny of these rhodophytes was also briefly described. In this study, the cox2 marker which satisfies the prerequisites of DNA barcodes was found to exhibit moderately high interspecific divergences with no intraspecific variations, thus a promising marker for the DNA barcoding of Kappaphycus and Eucheuma. However, the already extensively used cox2-3 spacer was deemed to be in overall more appropriate as a DNA barcode for these two genera. On a wider scale, cox1 and rbcL were still better DNA barcodes across the rhodophyte taxa when practicality and cost-efficiency were taken into account. The phylogeny of Kappaphycus and Eucheuma were generally similar to those earlier reported. Still, the application of DNA barcoding has demonstrated our relatively poor taxonomic comprehension of these seaweeds, thus suggesting more in-depth efforts in taxonomic restructuring as well as establishment.

  5. Genotyping and Molecular Identification of Date Palm Cultivars Using Inter-Simple Sequence Repeat (ISSR) Markers.

    Science.gov (United States)

    Ayesh, Basim M

    2017-01-01

    Molecular markers are credible for the discrimination of genotypes and estimation of the extent of genetic diversity and relatedness in a set of genotypes. Inter-simple sequence repeat (ISSR) markers rapidly reveal high polymorphic fingerprints and have been used frequently to determine the genetic diversity among date palm cultivars. This chapter describes the application of ISSR markers for genotyping of date palm cultivars. The application involves extraction of genomic DNA from the target cultivars with reliable quality and quantity. Subsequently the extracted DNA serves as a template for amplification of genomic regions flanked by inverted simple sequence repeats using a single primer. The similarity of each pair of samples is measured by calculating the number of mono- and polymorphic bands revealed by gel electrophoresis. Matrices constructed for similarity and genetic distance are used to build a phylogenetic tree and cluster analysis, to determine the molecular relatedness of cultivars. The protocol describes 3 out of 9 tested primers consistently amplified 31 loci in 6 date palm cultivars, with 28 polymorphic loci.

  6. Molecular markers in glioma.

    Science.gov (United States)

    Ludwig, Kirsten; Kornblum, Harley I

    2017-09-01

    Gliomas are the most malignant and aggressive form of brain tumors, and account for the majority of brain cancer related deaths. Malignant gliomas, including glioblastoma are treated with radiation and temozolomide, with only a minor benefit in survival time. A number of advances have been made in understanding glioma biology, including the discovery of cancer stem cells, termed glioma stem cells (GSC). Some of these advances include the delineation of molecular heterogeneity both between tumors from different patients as well as within tumors from the same patient. Such research highlights the importance of identifying and validating molecular markers in glioma. This review, intended as a practical resource for both clinical and basic investigators, summarizes some of the more well-known molecular markers (MGMT, 1p/19q, IDH, EGFR, p53, PI3K, Rb, and RAF), discusses how they are identified, and what, if any, clinical relevance they may have, in addition to discussing some of the specific biology for these markers. Additionally, we discuss identification methods for studying putative GSC's (CD133, CD15, A2B5, nestin, ALDH1, proteasome activity, ABC transporters, and label-retention). While much research has been done on these markers, there is still a significant amount that we do not yet understand, which may account for some conflicting reports in the literature. Furthermore, it is unlikely that the investigator will be able to utilize one single marker to prospectively identify and isolate GSC from all, or possibly, any gliomas.

  7. Multiple-clone infections of Plasmodium vivax: definition of a panel of markers for molecular epidemiology.

    Science.gov (United States)

    de Souza, Aracele M; de Araújo, Flávia C F; Fontes, Cor J F; Carvalho, Luzia H; de Brito, Cristiana F A; de Sousa, Taís N

    2015-08-25

    Plasmodium vivax infections commonly contain multiple genetically distinct parasite clones. The detection of multiple-clone infections depends on several factors, such as the accuracy of the genotyping method, and the type and number of the molecular markers analysed. Characterizing the multiplicity of infection has broad implications that range from population genetic studies of the parasite to malaria treatment and control. This study compared and evaluated the efficiency of neutral and non-neutral markers that are widely used in studies of molecular epidemiology to detect the multiplicity of P. vivax infection. The performance of six markers was evaluated using 11 mixtures of DNA with well-defined proportions of two different parasite genotypes for each marker. These mixtures were generated by mixing cloned PCR products or patient-derived genomic DNA. In addition, 51 samples of natural infections from the Brazil were genotyped for all markers. The PCR-capillary electrophoresis-based method was used to permit direct comparisons among the markers. The criteria for differentiating minor peaks from artifacts were also evaluated. The analysis of DNA mixtures showed that the tandem repeat MN21 and the polymorphic blocks 2 (msp1B2) and 10 (msp1B10) of merozoite surface protein-1 allowed for the estimation of the expected ratio of both alleles in the majority of preparations. Nevertheless, msp1B2 was not able to detect the majority of multiple-clone infections in field samples; it identified only 6 % of these infections. The merozoite surface protein-3 alpha and microsatellites (PvMS6 and PvMS7) did not accurately estimate the relative clonal proportions in artificial mixtures, but the microsatellites performed well in detecting natural multiple-clone infections. Notably, the use of a less stringent criterion to score rare alleles significantly increased the sensitivity of the detection of multi-clonal infections. Depending on the type of marker used, a considerable

  8. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    Energy Technology Data Exchange (ETDEWEB)

    Caetano-Anolles, G [Department of Biology, University of Oslo, Oslo (Norway)

    2001-11-01

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  9. Arbitrarily amplified DNA: New molecular approaches to plant breeding, ecology and evolution

    International Nuclear Information System (INIS)

    Caetano-Anolles, G.

    2001-01-01

    Several DNA fingerprinting techniques that use arbitrary primers to characterize, scan and tag genomic DNA were optimized and used to study plants and microbial pathogens. The generated arbitrarily amplified DNA (AAD) profiles could be tailored in their complexity and polymorphic content, allowing analysis of closely related organisms, such as vegetatively-propagated horticultural crops or clonal fungal populations. AAD markers were used in cultivar and strain identification, map-based cloning, and marker-assisted breeding, sometimes as sequence-tagged sites. Phenetic analysis using parsimony, cluster, and numerical methods was applied successfully to the identification of genetic relationships in turfgrass species such as bermudagrass, woody plants such as dogwoods, and floricultural species such as petunia and chrysanthemum. AAD profiles were used to measure for the first time a genome-wide mutation rate, directly in a plant. Mutation rates in vegetatively propagated bermudagrass were comparable to those in human, mice, fruit flies, and worms. In combination with established tools used in molecular systematics (e.g. rDNA sequence analysis), AAD markers tracked the introduction of exotic dogwood anthracnose-causing fungi in North America. As part of a breeding effort to combat dogwood diseases, AAD was used in pseudo-testcross mapping of the tree at the intra-specific level. Markers were efficiently generated despite the close relatedness of parental dogwood material. Finally, DNA markers and tags were also generated in soybean, and were used to construct high density maps and walk towards defined genomic regions in the positional cloning of the supernodulation nts-1 symbiotic gene. (author)

  10. Molecular genetic diversity of Punica granatum L. (pomegranate) as revealed by microsatellite DNA markers

    Science.gov (United States)

    Pomegranate (Punica granatum L.) is one of the oldest known edible fruits and more and more it arouse interest of scientific community given its numerous biological activities. However, information about its genetic resources and characterization using reliable molecular markers are still scarce. In...

  11. Application of DNA based marker mutations for improvement of cereals and other sexually reproduced crop plants. Proceedings of a final research co-ordination meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    The Co-ordinated Research Programme (CRP) on the Application of DNA Based Marker Mutations for Improvement of Cereals and Other Sexually Reproduced Crop Plants represents the first of three CRPs dealing with the application of molecular markers to mutations and plant breeding and was implemented between 1992 and 1996. A second companion CRP entitled Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops devoted to the application of molecular markers in vegetatively propagated crops species was implemented between 1993 and 1997. One positive consequence of these two CRPs has been the implementation of a third CRP entitled Radioactively Labeled DNA Probes for Crop Improvement, which began in 1995 and aims to provide enabling technologies, in the form of probes and primers, to laboratories in developing countries. The rapid development of molecular marker technologies has also resulted in a dramatic increase in request from developing Member States for technical co-operation projects utilizing molecular markers to improve local varieties for biotic and abiotic stresses and other traits of relevance. With the intensified use of induced mutations in genetic studies, it will be important to continue the important work of understanding induced mutations at the molecular level. Evidence of the progress made in implementing molecular marker technologies in laboratories around the world is presented in this publication, which contains the results presented by the participants at the fourth and final Research Co-ordination Meeting of the CRP held in Vienna, 4-8 November 1996. The FAO and IAEA wish to express their sincere appreciation to the participants of the meeting for their work during the project period resulting in the summary and scientific reports presented in this publication. Refs, figs, tabs.

  12. Application of DNA based marker mutations for improvement of cereals and other sexually reproduced crop plants. Proceedings of a final research co-ordination meeting

    International Nuclear Information System (INIS)

    1998-03-01

    The Co-ordinated Research Programme (CRP) on the Application of DNA Based Marker Mutations for Improvement of Cereals and Other Sexually Reproduced Crop Plants represents the first of three CRPs dealing with the application of molecular markers to mutations and plant breeding and was implemented between 1992 and 1996. A second companion CRP entitled Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops devoted to the application of molecular markers in vegetatively propagated crops species was implemented between 1993 and 1997. One positive consequence of these two CRPs has been the implementation of a third CRP entitled Radioactively Labeled DNA Probes for Crop Improvement, which began in 1995 and aims to provide enabling technologies, in the form of probes and primers, to laboratories in developing countries. The rapid development of molecular marker technologies has also resulted in a dramatic increase in request from developing Member States for technical co-operation projects utilizing molecular markers to improve local varieties for biotic and abiotic stresses and other traits of relevance. With the intensified use of induced mutations in genetic studies, it will be important to continue the important work of understanding induced mutations at the molecular level. Evidence of the progress made in implementing molecular marker technologies in laboratories around the world is presented in this publication, which contains the results presented by the participants at the fourth and final Research Co-ordination Meeting of the CRP held in Vienna, 4-8 November 1996. The FAO and IAEA wish to express their sincere appreciation to the participants of the meeting for their work during the project period resulting in the summary and scientific reports presented in this publication

  13. Statistics of DNA Markers - RGP gmap | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us RGP gmap Statistics of DNA Markers Data detail Data name Statistics of DNA Markers DOI 10.18...908/lsdba.nbdc00318-01-001 Description of data contents Statistics of DNA markers that were used to create t...iption Download License Update History of This Database Site Policy | Contact Us Statistics of DNA Markers - RGP gmap | LSDB Archive ...

  14. Characterization of genetic diversity in chickpea using SSR markers, Start Codon Targeted Polymorphism (SCoT) and Conserved DNA-Derived Polymorphism (CDDP).

    Science.gov (United States)

    Hajibarat, Zahra; Saidi, Abbas; Hajibarat, Zohreh; Talebi, Reza

    2015-07-01

    To evaluate the genetic diversity among 48 genotypes of chickpea comprising cultivars, landraces and internationally developed improved lines genetic distances were evaluated using three different molecular marker techniques: Simple Sequence Repeat (SSR); Start Codon Targeted (SCoT) and Conserved DNA-derived Polymorphism (CDDP). Average polymorphism information content (PIC) for SSR, SCoT and CDDP markers was 0.47, 0.45 and 0.45, respectively, and this revealed that three different marker types were equal for the assessment of diversity amongst genotypes. Cluster analysis for SSR and SCoT divided the genotypes in to three distinct clusters and using CDDP markers data, genotypes grouped in to five clusters. There were positive significant correlation (r = 0.43, P SSR markers. These results suggest that efficiency of SSR, SCOT and CDDP markers was relatively the same in fingerprinting of chickpea genotypes. To our knowledge, this is the first detailed report of using targeted DNA region molecular marker (CDDP) for genetic diversity analysis in chickpea in comparison with SCoT and SSR markers. Overall, our results are able to prove the suitability of SCoT and CDDP markers for genetic diversity analysis in chickpea for their high rates of polymorphism and their potential for genome diversity and germplasm conservation.

  15. A suite of microsatellite markers optimized for amplification of DNA from Addax (Addax nasomaculatus) blood preserved on FTA cards.

    Science.gov (United States)

    Heim, Brett C; Ivy, Jamie A; Latch, Emily K

    2012-01-01

    The addax (Addax nasomaculatus) is a critically endangered antelope that is currently maintained in zoos through regional, conservation breeding programs. As for many captive species, incomplete pedigree data currently impedes the ability of addax breeding programs to confidently manage the genetics of captive populations and to select appropriate animals for reintroduction. Molecular markers are often used to improve pedigree resolution, thereby improving the long-term effectiveness of genetic management. When developing a suite of molecular markers, it is important to consider the source of DNA, as the utility of markers may vary across DNA sources. In this study, we optimized a suite of microsatellite markers for use in genotyping captive addax blood samples collected on FTA cards. We amplified 66 microsatellite loci previously described in other Artiodactyls. Sixteen markers amplified a single product in addax, but only 5 of these were found to be polymorphic in a sample of 37 addax sampled from a captive herd at Fossil Rim Wildlife Center in the US. The suite of microsatellite markers developed in this study provides a new tool for the genetic management of captive addax, and demonstrates that FTA cards can be a useful means of sample storage, provided appropriate loci are used in downstream analyses. © 2011 Wiley Periodicals, Inc.

  16. Development of Insertion and Deletion Markers for Bottle Gourd Based on Restriction Site-associated DNA Sequencing Data

    Directory of Open Access Journals (Sweden)

    Xinyi WU

    2017-01-01

    Full Text Available Bottle gourd is an important cucurbit crop worldwide. To provide more available molecular markers for this crop, a bioinformatic approach was employed to develop insertion–deletions (InDels markers in bottle gourd based on restriction site-associated DNA sequencing (RAD-Seq data. A total of 892 Indels were predicted, with the length varying from 1 bp to 167 bp. Single-nucleotide InDels were the predominant types of InDels. To validate these InDels, PCR primers were designed from 162 loci where InDels longer than 2 bp were predicated. A total of 112 InDels were found to be polymorphic among 9 bottle gourd accessions under investigation. The rate of prediction accuracy was thus at a high level of 72.7%. DNA fingerprinting for 4 cultivars were performed using 8 selected Indels markers, demonstrating the usefulness of these markers.

  17. Multi-locus DNA barcoding identifies matK as a suitable marker for species identification in Hibiscus L.

    Science.gov (United States)

    Poovitha, Sundar; Stalin, Nithaniyal; Balaji, Raju; Parani, Madasamy

    2016-12-01

    The genus Hibiscus L. includes several taxa of medicinal value and species used for the extraction of natural dyes. These applications require the use of authentic plant materials. DNA barcoding is a molecular method for species identification, which helps in reliable authentication by using one or more DNA barcode marker. In this study, we have collected 44 accessions, representing 16 species of Hibiscus, distributed in the southern peninsular India, to evaluate the discriminatory power of the two core barcodes rbcLa and matK together with the suggested additional regions trnH-psbA and ITS2. No intraspecies divergence was observed among the accessions studied. Interspecies divergence was 0%-9.6% with individual markers, which increased to 0%-12.5% and 0.8%-20.3% when using two- and three-marker combinations, respectively. Differentiation of all the species of Hibiscus was possible with the matK DNA barcode marker. Also, in two-marker combinations, only those combinations with matK differentiated all the species. Though all the three-marker combinations showed 100% species differentiation, species resolution was consistently better when the matK marker formed part of the combination. These results clearly showed that matK is more suitable when compared to rbcLa, trnH-psbA, and ITS2 for species identification in Hibiscus.

  18. Preoperative Molecular Markers in Thyroid Nodules.

    Science.gov (United States)

    Sahli, Zeyad T; Smith, Philip W; Umbricht, Christopher B; Zeiger, Martha A

    2018-01-01

    The need for distinguishing benign from malignant thyroid nodules has led to the pursuit of differentiating molecular markers. The most common molecular tests in clinical use are Afirma ® Gene Expression Classifier (GEC) and Thyroseq ® V2. Despite the rapidly developing field of molecular markers, several limitations exist. These challenges include the recent introduction of the histopathological diagnosis "Non-Invasive Follicular Thyroid neoplasm with Papillary-like nuclear features", the correlation of genetic mutations within both benign and malignant pathologic diagnoses, the lack of follow-up of molecular marker negative nodules, and the cost-effectiveness of molecular markers. In this manuscript, we review the current published literature surrounding the diagnostic value of Afirma ® GEC and Thyroseq ® V2. Among Afirma ® GEC studies, sensitivity (Se), specificity (Sp), positive predictive value (PPV), and negative predictive value (NPV) ranged from 75 to 100%, 5 to 53%, 13 to 100%, and 20 to 100%, respectively. Among Thyroseq ® V2 studies, Se, Sp, PPV, and NPV ranged from 40 to 100%, 56 to 93%, 13 to 90%, and 48 to 97%, respectively. We also discuss current challenges to Afirma ® GEC and Thyroseq ® V2 utility and clinical application, and preview the future directions of these rapidly developing technologies.

  19. Self-Assembling Molecular Logic Gates Based on DNA Crossover Tiles.

    Science.gov (United States)

    Campbell, Eleanor A; Peterson, Evan; Kolpashchikov, Dmitry M

    2017-07-05

    DNA-based computational hardware has attracted ever-growing attention due to its potential to be useful in the analysis of complex mixtures of biological markers. Here we report the design of self-assembling logic gates that recognize DNA inputs and assemble into crossover tiles when the output signal is high; the crossover structures disassemble to form separate DNA stands when the output is low. The output signal can be conveniently detected by fluorescence using a molecular beacon probe as a reporter. AND, NOT, and OR logic gates were designed. We demonstrate that the gates can connect to each other to produce other logic functions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  1. Molecular markers of neuropsychological functioning and Alzheimer's disease.

    Science.gov (United States)

    Edwards, Melissa; Balldin, Valerie Hobson; Hall, James; O'Bryant, Sid

    2015-03-01

    The current project sought to examine molecular markers of neuropsychological functioning among elders with and without Alzheimer's disease (AD) and determine the predictive ability of combined molecular markers and select neuropsychological tests in detecting disease presence. Data were analyzed from 300 participants (n = 150, AD and n = 150, controls) enrolled in the Texas Alzheimer's Research and Care Consortium. Linear regression models were created to examine the link between the top five molecular markers from our AD blood profile and neuropsychological test scores. Logistical regressions were used to predict AD presence using serum biomarkers in combination with select neuropsychological measures. Using the neuropsychological test with the least amount of variance overlap with the molecular markers, the combined neuropsychological test and molecular markers was highly accurate in detecting AD presence. This work provides the foundation for the generation of a point-of-care device that can be used to screen for AD.

  2. Molecular performance of commercial MTG variety oil palm based on RAPD markers

    Science.gov (United States)

    Putri, L. A. P.; Setyo, I. E.; Basyuni, M.; Bayu, E. S.; Setiado, H.; Reynaldi, N. F.; Laia, H.; Puteri, S. A. K.; Arifiyanto, D.; Syahputra, I.

    2018-02-01

    The oil palm, an economically important tree in Indonesia, has been one of the world’s major sources of edible oil and a significant precursor of biodiesel fuel. This research is conducted by taking individual tree sample of commercial MTG variety germplasm oil palm one years old. The purpose of this research is to analyse molecular performance of some oil palm MTG variety based on RAPD markers. In this experiment, the DNA profile diversity was assessed using markers of oil palm’s random RAPD markers (OPD-20, SB-19, OPM-01 and OPO-11). A total of 15 trees commercial MTG oil palm variety were used for analysis. The results of the experiment indicated out of 4 RAPD markers (OPD-20, SB-19, OPM-01 and OPO-11) showed polymorphic of PCR product. These preliminary results demonstrated RAPD marker can be used to evaluate genetic relatedness among trees of commercial MTG variety oil palm and detecting either genetic variants or mislabelled.

  3. Prognostic DNA Methylation Markers for Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Siri H. Strand

    2014-09-01

    Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.

  4. IMPLEMENTATION OF DNA MARKERS TO IMPROVE BREEDING OF FORAGE LEGUMES

    Directory of Open Access Journals (Sweden)

    S. Grljušić

    2008-09-01

    Full Text Available The low rates of estimated genetic gains in forage legumes breeding have emphasized the need for new breeding methods that would increase efficiency in forage selection and provide reliable improvement. Information on application of molecular methodologies and tools for the enhancement of the current empirical phenotype-based selection moved us toward implementation of DNA markers to our breeding activities. Firstly, attention was given to identification of genetic variability within the forage species involved in program and comparison of conventional and molecular marker efficiency in variability evaluation. RAPDs were used (i to estimate availability of alfalfa (Medicago sativa L. and Medicago falcata L. genetic variation and (ii to identify changes of red clover (Trifolium pratense L. variability after natural selection. SSRs were applied to evaluate diversity within and among field pea (Pisum sativum L. var. arvense and sativum groups/varieties. A total of 90 (alfalfa or 92 (red clover polymorphic bands was found by RAPDs. Total number of SSR alleles recorded was 118. The average Roger's distance per species/genus estimated was 0.29 (red clover, 0.33 (alfalfa and 0.51 (field pea. 2D PCo analysis of each species/genus separated materials into respective groups. A high degree of genetic variation within populations/varieties of each investigated species was found by AMOVA. The correspondence between pairs of matrices based on the morphological and molecular data was significant (p=0.95 only for red clover. RAPD and SSR data have given valuable information on genetic structure of materials and provided a description that determines heterogeneity. Further studies will be focused on identifying quantitative trait loci and marker assisted selection.

  5. A set of 14 DIP-SNP markers to detect unbalanced DNA mixtures.

    Science.gov (United States)

    Liu, Zhizhen; Liu, Jinding; Wang, Jiaqi; Chen, Deqing; Liu, Zidong; Shi, Jie; Li, Zeqin; Li, Wenyan; Zhang, Gengqian; Du, Bing

    2018-03-04

    Unbalanced DNA mixture is still a difficult problem for forensic practice. DIP-STRs are useful markers for detection of minor DNA but they are not widespread in the human genome and having long amplicons. In this study, we proposed a novel type of genetic marker, termed DIP-SNP. DIP-SNP refers to the combination of INDEL and SNP in less than 300bp length of human genome. The multiplex PCR and SNaPshot assay were established for 14 DIP-SNP markers in a Chinese Han population from Shanxi, China. This novel compound marker allows detection of the minor DNA contributor with sensitivity from 1:50 to 1:1000 in a DNA mixture of any gender with 1 ng-10 ng DNA template. Most of the DIP-SNP markers had a relatively high probability of informative alleles with an average I value of 0.33. In all, we proposed DIP-SNP as a novel kind of genetic marker for detection of minor contributor from unbalanced DNA mixture and established the detection method by associating the multiplex PCR and SNaPshot assay. DIP-SNP polymorphisms are promising markers for forensic or clinical mixture examination because they are shorter, widespread and higher sensitive. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Effect of lifelong football training on the expression of muscle molecular markers involved in healthy longevity

    DEFF Research Database (Denmark)

    Mancini, A; Vitucci, D; Labruna, G

    2017-01-01

    PURPOSE: We investigated whether lifelong football training affects the expression of healthy longevity-related muscle molecular markers. METHODS: Biopsies were collected from the vastus lateralis muscle of 10 lifelong football-trained men (68.2 ± 3.0 years) and of 10 active untrained healthy men...... the expression of key markers involved in muscle oxidative metabolism, and in the DNA repair and senescence suppression pathways, thus providing the molecular basis for healthy longevity....... (66.7 ± 1.3 years). Gene and protein expression was measured by RTqPCR on RNA and by western blotting on protein extracts from muscle biopsies, respectively. RESULTS: The expression of AMPKα1/α2, NAMPT, TFAM and PGC1α, which are markers of oxidative metabolism, and MyHC β isoform expression was higher...

  7. Molecular markers to assess genetic diversity and mutant identifications in Jatropha curcas

    International Nuclear Information System (INIS)

    Azhar Mohamad; Yie Min Kwan; Fatin Mastura Derani; Abdul Rahim Harun

    2010-01-01

    Jatropha curcas (Linnaeus) belongs to the Euphorbiaceae family, is a multipurpose use, drought resistant and perennial plant. It is an economic important crop, which generates wide interest in understanding the genetic diversity of the species towards selection and breeding of superior genotypes. Jatropha accessions are closely related family species. Thus, better understanding of the effectiveness of the different DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of marker techniques in breeding programs. Inter-simple sequence repeats (ISSRs) has shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. These markers were used to understand diversity and differentiate amongst accessions of Jatropha population and mutant lines generated by acute gamma radiation. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of bio-diesel production and medication substances. A total of 62 ISSR primers were optimized for polymorphism evaluations on five foreign accessions (Africa, India, Myanmar, Indonesia, Thailand), nine local accessions and two mutants of Jatropha. Optimization was resulted 54 ISSR primers affirmative for the polymorphism evaluation study, which encountered 12 ISSR primers, showed significance polymorphism amongst the accessions and mutants. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Jatropha from accession to generated mutant varieties. (author)

  8. Sequence-Related Amplified Polymorphism (SRAP Markers: A Potential Resource for Studies in Plant Molecular Biology

    Directory of Open Access Journals (Sweden)

    Daniel W. H. Robarts

    2014-07-01

    Full Text Available In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR, random-amplified polymorphic DNA (RAPD, and amplified fragment length polymorphism (AFLP to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use. highly variable marker with inherent biological significance.

  9. [Prognostic and predictive molecular markers for urologic cancers].

    Science.gov (United States)

    Hartmann, A; Schlomm, T; Bertz, S; Heinzelmann, J; Hölters, S; Simon, R; Stoehr, R; Junker, K

    2014-04-01

    Molecular prognostic factors and genetic alterations as predictive markers for cancer-specific targeted therapies are used today in the clinic for many malignancies. In recent years, many molecular markers for urogenital cancers have also been identified. However, these markers are not clinically used yet. In prostate cancer, novel next-generation sequencing methods revealed a detailed picture of the molecular changes. There is growing evidence that a combination of classical histopathological and validated molecular markers could lead to a more precise estimation of prognosis, thus, resulting in an increasing number of patients with active surveillance as a possible treatment option. In patients with urothelial carcinoma, histopathological factors but also the proliferation of the tumor, mutations in oncogenes leading to an increasing proliferation rate and changes in genes responsible for invasion and metastasis are important. In addition, gene expression profiles which could distinguish aggressive tumors with high risk of metastasis from nonmetastasizing tumors have been recently identified. In the future, this could potentially allow better selection of patients needing systemic perioperative treatment. In renal cell carcinoma, many molecular markers that are associated with metastasis and survival have been identified. Some of these markers were also validated as independent prognostic markers. Selection of patients with primarily organ-confined tumors and increased risk of metastasis for adjuvant systemic therapy could be clinically relevant in the future.

  10. MOLECULAR MARKERS FOR METASTATIC PROSTATE ADENOCARCINOMA

    Directory of Open Access Journals (Sweden)

    I. S. Kunin

    2012-01-01

    Full Text Available The search of molecular markers of metastasing and prognosis in prostate cancer remains an urgent task. In this study, we investigated the relationship of gene expression heparanase-1 (HPSE1 and D-glucuronil C5-epimerase (GLCE with early disease relapse and metastasis of a 2,5−3 years after diagnosis. It was shown that the ratio of the expression levels of genes HPSE1/GLCE > 1 may serve as a prognostic relapse marker and trends of the tumour to metastasis. The data obtained suggest to use this option as a molecular marker for the diagnostics of metastatic process and the disease prognosis.

  11. Investigation of the somaclonal and mutagen induced variability in barley by the application of protein and DNA markers

    International Nuclear Information System (INIS)

    Atanassov, A.; Todorovska, E.; Trifonova, A.; Petrova, M.; Marinova, E.; Gramatikova, M.; Valcheva, D.; Zaprianov, S.; Mersinkov, N.

    1998-01-01

    Barley, Hordeum vulgare L., is one of the most important crop species for Bulgaria. The characterisation of the genetic pool is of great necessity for the Bulgarian barley breeding programme which is directed toward improving quantitative and qualitative traits. Molecular markers [protein, restriction fragment length polymorphisms (RFLP) and randomly amplified polymorphic DNA (RAPD)] have been applied to characterise the Bulgarian barley cultivars and their regenerants. The changes in DNA loci coding for 26S, 5.8S and 18S rRNA repeats, C hordein locus and mitochondrial DNA organisation have been investigated. The potential for ribosomal DNA length polymorphism in Bulgarian barley cultivars appear to be limited to three different repeat lengths (10.2, 9.5 and 9.0kb) and three plant rDNA phenotypes. Polymorphism was not observed in ribosomal DNA repeat units in somaclonal variants. Variation concerning C hordein electrophoretic pattern was observed in one line from cultivar Jubiley. Analysis of the HorI locus reveals RFLPs in sequences coding for C hordeins in this line. Mitochondrial molecular markers are convenient for detection of DNA polymorphisms in the variant germplasm as well as for the somaclonal variants derived from it. Two lines from Ruen revealed polymorphic bands after hybridisation with mitochondrial DNA probe. RAPD assays have been carried out by using 20 different 10-mer primers. Heritable polymorphism in several tissue culture derived (TCD) lines was observed. RAPD assay is a sensitive and representative approach to distinguish the variability created by tissue culture and mutagenesis

  12. Molecular marker studies in riverine buffaloes, for characterization and diagnosis of genetic defects

    International Nuclear Information System (INIS)

    Yadav, B.R.

    2005-01-01

    The buffalo is probably the last livestock species to have been domesticated, with many genetic, physiological and behavioural traits not yet well understood. Molecular markers have been used for characterizing animals and breeds, diagnosing diseases and identifying anatomical and physiological anomalies. RFLP studies showed low heterozygosity, but genomic and oligonucleotide probes showed species-specific bands useful for identification of carcass or other unknown samples. Use of RAPD revealed band frequencies, band sharing frequencies, genetic distances, and genetic and identity indexes in different breeds. Bovine microsatellite primers indicate that 70.9% of bovine loci were conserved in buffalo. Allele numbers, sizes, frequencies, heterozygosity and polymorphism information content showed breed-specific patterns. Different marker types - genomic and oligonucleotide probes, RAPD and microsatellites - are useful in parent identification. Individual specific DNA fingerprinting techniques were applied with twin-born animal (XX/XY) chimerism, sex identification, anatomically defective and XO individuals. Molecular markers are a potential tool for geneticists and breeders to evaluate existing germplasm and to manipulate it to develop character-specific strains and to provide the basis for effective genetic conservation. (author)

  13. Random amplified polymorphic DNA (RAPD) markers reveal genetic ...

    African Journals Online (AJOL)

    The present study evaluated genetic variability of superior bael genotypes collected from different parts of Andaman Islands, India using fruit characters and random amplified polymorphic DNA (RAPD) markers. Genomic DNA extracted from leaf material using cetyl trimethyl ammonium bromide (CTAB) method was ...

  14. Molecular analysis of commercial date palm cultivars in Lybia using ISSR and SRAP PCR-based markers

    Directory of Open Access Journals (Sweden)

    Khalifa Noha S.

    2016-01-01

    Full Text Available Little is known about the molecular structure of the date palm (Phoenix dactylifera L. despite its importance as invaluable drought tolerant crop. Intervarietal variation and cultivar identification are crucial for breeding and gene bank conservation of this plant worldwide. In this work, two PCR based marker systems (ISSR and SRAP were applied on top quality eight commercial cultivars in Libya (Umfetity, Bekrary, Alhamraya, Sufeer Genab, Alsaeedy Show, Farag Barameel, Majhool Alheelo and Alkhadraya. DNA variations were explored using eleven ISSR and nine combinations of SRAP markers. All markers used generated polymorphic bands among the different cultivars that can be used as molecular markers for their differentiation. The genetic distance between cultivars was also estimated from banding patterns. Our results indicate that ISSR and SRAP systems can efficiently identify and differentiate between the selected cultivars. This work can be used as a model to establish a road map for all date palm cultivars worldwide.

  15. Prenatal exclusion of Norrie disease with flanking DNA markers.

    Science.gov (United States)

    Gal, A; Uhlhaas, S; Glaser, D; Grimm, T

    1988-10-01

    Three polymorphic DNA markers linked to the locus of Norrie disease were used for indirect genotype analysis in a ten-wk-old fetus at risk for the disease. When haplotypes of the family members and the estimated recombination frequency between Norrie gene and each of the DNA marker loci DXS7, DXS84, and DXS146 were taken into account, the risk that the fetus had inherited the mutation was about 1%.

  16. Molecular markers: a potential resource for ginger genetic diversity studies.

    Science.gov (United States)

    Ismail, Nor Asiah; Rafii, M Y; Mahmud, T M M; Hanafi, M M; Miah, Gous

    2016-12-01

    Ginger is an economically important and valuable plant around the world. Ginger is used as a food, spice, condiment, medicine and ornament. There is available information on biochemical aspects of ginger, but few studies have been reported on its molecular aspects. The main objective of this review is to accumulate the available molecular marker information and its application in diverse ginger studies. This review article was prepared by combing material from published articles and our own research. Molecular markers allow the identification and characterization of plant genotypes through direct access to hereditary material. In crop species, molecular markers are applied in different aspects and are useful in breeding programs. In ginger, molecular markers are commonly used to identify genetic variation and classify the relatedness among varieties, accessions, and species. Consequently, it provides important input in determining resourceful management strategies for ginger improvement programs. Alternatively, a molecular marker could function as a harmonizing tool for documenting species. This review highlights the application of molecular markers (isozyme, RAPD, AFLP, SSR, ISSR and others such as RFLP, SCAR, NBS and SNP) in genetic diversity studies of ginger species. Some insights on the advantages of the markers are discussed. The detection of genetic variation among promising cultivars of ginger has significance for ginger improvement programs. This update of recent literature will help researchers and students select the appropriate molecular markers for ginger-related research.

  17. The role of molecular markers and marker assisted selection in breeding for organic agriculture

    DEFF Research Database (Denmark)

    Lammerts van Bueren, E.T.; Backes, G.; de Vriend, H.

    2010-01-01

    markers is not self-evident and is often debated. Organic and low-input farming conditions require breeding for robust and flexible varieties, which may be hampered by too much focus on the molecular level. Pros and contras for application of molecular markers in breeding for organic agriculture...... was the topic of a recent European plant breeding workshop. The participants evaluated strengths, weaknesses, opportunities, and threats of the use of molecular markers and we formalized their inputs into breeder’s perspectives and perspectives seen from the organic sector’s standpoint. Clear strengths were...

  18. Variable expression of molecular markers in juvenile nasopharyngeal angiofibroma.

    Science.gov (United States)

    Mishra, A; Pandey, A; Mishra, S C

    2017-09-01

    Molecular categorisation may explain the wide variation in the clinical characteristics of juvenile nasopharyngeal angiofibroma. Variations in molecular markers in juvenile nasopharyngeal angiofibroma in an Indian population were investigated and compared with global reports. Variable molecular marker expression was demonstrated at the regional and global levels. A wide variation in molecular characteristics is evident. Molecular data have been reported for only 11 countries, indicating a clear geographical bias. Only 58 markers have been studied, and most are yet to be validated. Research into the molecular epidemiology of juvenile nasopharyngeal angiofibroma is still in its infancy. Although the molecular variation is not well understood, data obtained so far have prompted important research questions. Hence, multicentre collaborative molecular studies are needed to establish the aetiopathogenesis and establish molecular surrogates for clinical characteristics.

  19. cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications.

    Science.gov (United States)

    Wani, Gowher A; Shah, Manzoor A; Reshi, Zafar A; Atangana, Alain R; Khasa, Damase P

    2014-07-01

    A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

  20. Marcadores moleculares na predição do sexo em plantas de mamoeiro Molecular markers for sex identification in papaya

    Directory of Open Access Journals (Sweden)

    Eder Jorge de Oliveira

    2007-12-01

    Full Text Available O objetivo deste trabalho foi validar marcadores moleculares, previamente identificados como ligados ao sexo do mamoeiro, para utilização na seleção indireta em genótipos comerciais. Foram analisadas duas variedades do grupo Solo e dois híbridos do grupo Formosa, com utilização de 20 plantas por genótipo, quatro marcadores do tipo SCAR (Sequence Characterized Amplified Region e um RAPD (Random Amplified Polymorphic DNA. O RAPD BC210 permitiu a identificação de todas as plantas femininas e hermafroditas, o que revela grande potencial para ser usado na seleção assistida em alguns dos genótipos mais cultivados no Brasil. Os marcadores do tipo SCAR não permitiram a identificação correta do sexo dos genótipos, pois detectou-se a presença de falso-positivos e falso-negativos nas análises.The objective of this work was the validation of previous discovered sex related molecular markers of papaya, aiming at the indirect selection of Brazilian commercial genotypes. Two varieties of the Solo group and two hybrids of the Formosa group (20 plants for genotype, four SCAR (Sequence Characterized Amplified Region and one RAPD (Random Amplified Polymorphic DNA markers were used. All hermaphrodite and female plants were correctly predicted by RAPD BC210, showing its high potential for marker assisted selection in important commercial genotypes used in Brazil. The SCAR markers did not show the true sex identification of these genotypes, revealing the presence of false positives and negatives in the analyses.

  1. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

    Science.gov (United States)

    Robarts, Daniel W. H.; Wolfe, Andrea D.

    2014-01-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

  2. Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

    Science.gov (United States)

    Robarts, Daniel W H; Wolfe, Andrea D

    2014-07-01

    In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

  3. The role of Molecular Markers in Improvement of Fruit Crops

    Directory of Open Access Journals (Sweden)

    Zahoor Ahmad BHAT

    2010-06-01

    Full Text Available Markers have been used over the years for the classification of plants. Markers are any trait of an organism that can be identified with confidence and relative easy, and can be followed in a mapping population on another hand markers be defined as heritable entities associated with the economically important trait under the control of polygenes. Morphological markers can be detected with naked eye (naked eye polymorphism or as difference in physical or chemical properties of the macromolecules. In other words, there are two types of genetic markers viz. morphological markers or naked eye polymorphism and non-morphological markers or molecular markers. Morphological markers include traits such as plant height, disease response, photoperiod, sensitivity, shape or colour of flowers, fruits or seeds etc. Molecular markers include biochemical constituents. Morphological markers have many limitations for being used as markers particularly in fruit crops because of long generation time and large size of fruit trees besides being influenced by environment. Consequently, molecular markers could be appropriate choice to study and preserve the diversity in any germplasm. Molecular markers have diverse applications in fruit crop improvement, particularly in the areas of genetic diversity and varietal identification studies, gene tagging, disease diagnostics, pedigree analysis, hybrid detection, sex differentiation and marker assisted selection.

  4. [Genetic polymorphism of flax Linum usitatissimum based on use of molecular cytogenetic markers].

    Science.gov (United States)

    Rachinskaia, O A; Lemesh, V A; Muravenko, O V; Iurkevich, O Iu; Guzenko, E V; Bol'sheva, N L; Bogdanova, M V; Samatadze, T E; Popov, K V; Malyshev, S V; Shostak, N G; Heller, K; Khotyleva, L V; Zelenin, A V

    2011-01-01

    Using a set of approaches based on the use of molecular cytogenetic markers (DAPI/C-banding, estimation of the total area of DAPI-positive regions in prophase nuclei, FISH with 26S and 5S rDNA probes) and the microsatellite (SSR-PCR) assay, we studied genomic polymorphism in 15 flax (Linum usitatissimum L.) varieties from different geographic regions belonging to three directions of selection (oil, fiber, and intermediate flaxes) and in the k-37 x Viking hybrid. All individual chromosomes have been identified in the karyotypes of these varieties on the basis of the patterns of differential DAPI/C-banding and the distribution of 26S and 5S rDNA, and idiograms of the chromosomes have been generated. Unlike the oil flax varieties, the chromosomes in the karyotypes of the fiber flax varieties have, as a rule, pericentromeric and telomeric DAPI-positive bands of smaller size, but contain larger intercalary regions. Two chromosomal rearrangements (chromosome 3 inversions) were discovered in the variety Luna and in the k-37 x Viking hybrid. In both these forms, no colocalization of 26S rDNA and 5S rDNA on the satellite chromosome was detected. The SSR assay with the use of 20 polymorphic pairs of primers revealed 22 polymorphic loci. Based on the SSR data, we analyzed genetic similarity of the flax forms studied and constructed a genetic similarity dendrogram. The genotypes studied here form three clusters. The oil varieties comprise an independent cluster. The genetically related fiber flax varieties Vita and Luna, as well as the landrace Lipinska XIII belonging to the intermediate type, proved to be closer to the oil varieties than the remaining fiber flax varieties. The results of the molecular chromosomal analysis in the fiber and oil flaxes confirm their very close genetic similarity. In spite of this, the combined use of the chromosomal and molecular markers has opened up unique possibilities for describing the genotypes of flax varieties and creating their genetic

  5. Molecular markers: Implications for cytopathology and specimen collection.

    Science.gov (United States)

    VanderLaan, Paul A

    2015-08-01

    Cytologic specimens obtained through minimally invasive biopsy techniques are increasingly being used as principle diagnostic specimens for tumors arising in multiple sites. The number and scope of ancillary tests performed on these specimens have grown substantially over the past decade, including many molecular markers that not only can aid in formulating accurate and specific diagnoses but also can provide prognostic or therapeutic information to help direct clinical decisions. Thus, the cytopathologist needs to ensure that adequate material is collected and appropriately processed for the study of relevant molecular markers, many of which are specific to tumor site. This brief review covers considerations for effective cytologic specimen collection and processing to ensure diagnostic and testing success. In addition, a general overview is provided of molecular markers pertinent to tumors from a variety of sites. The recognition of these established and emerging molecular markers by cytopathologists is an important step toward realizing the promise of personalized medicine. © 2015 American Cancer Society.

  6. cpDNA Microsatellite Markers for Lemna minor (Araceae: Phylogeographic Implications

    Directory of Open Access Journals (Sweden)

    Gowher A. Wani

    2014-07-01

    Full Text Available Premise of the study: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. Methods and Results: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. Conclusions: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

  7. Molecular markers for urothelial bladder cancer prognosis: toward implementation in clinical practice.

    Science.gov (United States)

    van Rhijn, Bas W G; Catto, James W; Goebell, Peter J; Knüchel, Ruth; Shariat, Shahrokh F; van der Poel, Henk G; Sanchez-Carbayo, Marta; Thalmann, George N; Schmitz-Dräger, Bernd J; Kiemeney, Lambertus A

    2014-10-01

    To summarize the current status of clinicopathological and molecular markers for the prediction of recurrence or progression or both in non-muscle-invasive and survival in muscle-invasive urothelial bladder cancer, to address the reproducibility of pathology and molecular markers, and to provide directions toward implementation of molecular markers in future clinical decision making. Immunohistochemistry, gene signatures, and FGFR3-based molecular grading were used as molecular examples focussing on prognostics and issues related to robustness of pathological and molecular assays. The role of molecular markers to predict recurrence is limited, as clinical variables are currently more important. The prediction of progression and survival using molecular markers holds considerable promise. Despite a plethora of prognostic (clinical and molecular) marker studies, reproducibility of pathology and molecular assays has been understudied, and lack of reproducibility is probably the main reason that individual prediction of disease outcome is currently not reliable. Molecular markers are promising to predict progression and survival, but not recurrence. However, none of these are used in the daily clinical routine because of reproducibility issues. Future studies should focus on reproducibility of marker assessment and consistency of study results by incorporating scoring systems to reduce heterogeneity of reporting. This may ultimately lead to incorporation of molecular markers in clinical practice. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. A molecular marker map for roses

    NARCIS (Netherlands)

    Debener, T.; Mattiesch, L.; Vosman, B.

    2001-01-01

    n addition to an existing core map for diploid roses which comprised 305 molecular markers 60 additional markers were mapped to extend the map. As a first application of the information contained in the map, the map position of a resistance gene from roses, Rdr1, was determined by identifying

  9. Tri-allelic SNP markers enable analysis of mixed and degraded DNA samples.

    Science.gov (United States)

    Westen, Antoinette A; Matai, Anuska S; Laros, Jeroen F J; Meiland, Hugo C; Jasper, Mandy; de Leeuw, Wiljo J F; de Knijff, Peter; Sijen, Titia

    2009-09-01

    For the analysis of degraded DNA in disaster victim identification (DVI) and criminal investigations, single nucleotide polymorphisms (SNPs) have been recognized as promising markers mainly because they can be analyzed in short sized amplicons. Most SNPs are bi-allelic and are thereby ineffective to detect mixtures, which may lead to incorrect genotyping. We developed an algorithm to find non-binary (i.e. tri-allelic or tetra-allelic) SNPs in the NCBI dbSNP database. We selected 31 potential tri-allelic SNPs with a minor allele frequency of at least 10%. The tri-allelic nature was confirmed for 15 SNPs residing on 14 different chromosomes. Multiplex SNaPshot assays were developed, and the allele frequencies of 16 SNPs were determined among 153 Dutch and 111 Netherlands Antilles reference samples. Using these multiplex SNP assays, the presence of a mixture of two DNA samples in a ratio up to 1:8 could be recognized reliably. Furthermore, we compared the genotyping efficiency of the tri-allelic SNP markers and short tandem repeat (STR) markers by analyzing artificially degraded DNA and DNA from 30 approximately 500-year-old bone and molar samples. In both types of degraded DNA samples, the larger sized STR amplicons failed to amplify whereas the tri-allelic SNP markers still provided valuable information. In conclusion, tri-allelic SNP markers are suited for the analysis of degraded DNA and enable the detection of a second DNA source in a sample.

  10. Evaluation of white spot syndrome virus variable DNA loci as molecular markers of virus spread at intermediate spatiotemporal scales

    NARCIS (Netherlands)

    Bui Thi Minh Dieu,; Marks, H.; Zwart, M.P.; Vlak, J.M.

    2010-01-01

    Variable genomic loci have been employed in a number of molecular epidemiology studies of white spot syndrome virus (WSSV), but it is unknown which loci are suitable molecular markers for determining WSSV spread on different spatiotemporal scales. Although previous work suggests that multiple

  11. Promise and pitfalls of molecular markers of thyroid nodules

    Science.gov (United States)

    Jadhav, S.; Lila, Anurag; Bandgar, Tushar; Shah, Nalini

    2012-01-01

    Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG) and fine needle aspiration biopsy (FNAB). The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly being studied for their diagnostic utility in assessing thyroid nodules. The various molecular markers consist of gene mutations, gene re arrangements, RNA based assays and immunohistochemical markers. The molecular markers definitely would help to optimise the management of such patients. PMID:23565369

  12. Promise and pitfalls of molecular markers of thyroid nodules

    Directory of Open Access Journals (Sweden)

    S Jadhav

    2012-01-01

    Full Text Available Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG and fine needle aspiration biopsy (FNAB. The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly being studied for their diagnostic utility in assessing thyroid nodules. The various molecular markers consist of gene mutations, gene re arrangements, RNA based assays and immunohistochemical markers. The molecular markers definitely would help to optimise the management of such patients.

  13. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.

    Science.gov (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José

    2018-04-01

    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  14. Molecular markers for thyroid cancer

    International Nuclear Information System (INIS)

    Marrero Rodriguez, Maria Teresa; Sinconegui Gomez, Belkys; Cruz Cruz, Anaisa

    2015-01-01

    The importance of the study of the thyroid nodule lies in excluding the possibility of a malignant lesion because the majority of lesions are benign but there is a malignancy risk of 5 to 10%. Most of them are well differentiated carcinomas originating in the follicular epithelium. In spite of the fact that the majority are benign lesions, distinguishing them from carcinomas is crucial to treatment and adequate follow-up. Fine-needle biopsy allows making the diagnosis in most of cases. However, this method is restricted, particularly when diagnosing follicular lesions. In an effort to improve the diagnostic accuracy of biopsy and to provide new diagnosing criteria, a number of molecular markers have been put forward, some of which has wide range of approval whereas others still awaits to be validated for further implementation. This article presented an updated review of molecular markers with higher number of evidence, more accessible and potentially usable from a methodological viewpoint for diagnosis of the thyroid nodule before surgery. The importance of the study of the thyroid nodule lies in excluding the possibility of a malignant lesion because the majority of lesions are benign but there is a malignancy risk of 5 to 10%. Most of them are well differentiated carcinomas originating in the follicular epithelium. In spite of the fact that the majority are benign lesions, distinguishing them from carcinomas is crucial to treatment and adequate follow-up. Fine-needle biopsy allows making the diagnosis in most of cases. However, this method is restricted, particularly when diagnosing follicular lesions. In an effort to improve the diagnostic accuracy of biopsy and to provide new diagnosing criteria, a number of molecular markers have been put forward, some of which has wide range of approval whereas others still awaits to be validated for further implementation. This article presented an updated review of molecular markers with higher number of evidence, more

  15. Short tandem repeat (STR) DNA markers are hypervariable and informative in Cannabis sativa: implications for forensic investigations.

    Science.gov (United States)

    Gilmore, Simon; Peakall, Rod; Robertson, James

    2003-01-09

    Short tandem repeat (STR) markers are the DNA marker of choice in forensic analysis of human DNA. Here we extend the application of STR markers to Cannabis sativa and demonstrate their potential for forensic investigations. Ninety-three individual cannabis plants, representing drug and fibre accessions of widespread origin were profiled with five STR makers. A total of 79 alleles were detected across the five loci. All but four individuals from a single drug-type accession had a unique multilocus genotype. An analysis of molecular variance (AMOVA) revealed significant genetic variation among accessions, with an average of 25% genetic differentiation. By contrast, only 6% genetic difference was detected between drug and fibre crop accessions and it was not possible to unequivocally assign plants as either drug or fibre type. However, our results suggest that drug strains may typically possess lower genetic diversity than fibre strains, which may ultimately provide a means of genetic delineation. Our findings demonstrate the promise of cannabis STR markers to provide information on: (1) agronomic type, (2) the geographical origin of drug seizures, and (3) evidence of conspiracy in production of clonally propagated drug crops.

  16. Molecular markers in well-differentiated thyroid cancer.

    Science.gov (United States)

    D'Cruz, Anil K; Vaish, Richa; Vaidya, Abhishek; Nixon, Iain J; Williams, Michelle D; Vander Poorten, Vincent; López, Fernando; Angelos, Peter; Shaha, Ashok R; Khafif, Avi; Skalova, Alena; Rinaldo, Alessandra; Hunt, Jennifer L; Ferlito, Alfio

    2018-06-01

    Thyroid nodules are of common occurrence in the general population. About a fourth of these nodules are indeterminate on aspiration cytology placing many a patient at risk of unwanted surgery. The purpose of this review is to discuss various molecular markers described to date and place their role in proper perspective. This review covers the fundamental role of the signaling pathways and genetic changes involved in thyroid carcinogenesis. The current literature on the prognostic significance of these markers is also described. PubMed was used to search relevant articles. The key terms "thyroid nodules", "thyroid cancer papillary", "carcinoma papillary follicular", "carcinoma papillary", "adenocarcinoma follicular" were searched in MeSH, and "molecular markers", "molecular testing", mutation, BRAF, RAS, RET/PTC, PAX 8, miRNA, NIFTP in title and abstract fields. Multiple combinations were done and a group of experts in the subject from the International Head and Neck Scientific Group extracted the relevant articles and formulated the review. There has been considerable progress in the understanding of thyroid carcinogenesis and the emergence of numerous molecular markers in the recent years with potential to be used in the diagnostic algorithm of these nodules. However, their precise role in routine clinical practice continues to be a contentious issue. Majority of the studies in this context are retrospective and impact of these mutations is not independent of other prognostic factors making the interpretation difficult. The prevalence of these mutations in thyroid nodule is high and it is a continuously evolving field. Clinicians should stay informed as recommendation on the use of these markers is expected to evolve.

  17. Applicability of SCAR markers to food genomics: olive oil traceability.

    Science.gov (United States)

    Pafundo, Simona; Agrimonti, Caterina; Maestri, Elena; Marmiroli, Nelson

    2007-07-25

    DNA analysis with molecular markers has opened a shortcut toward a genomic comprehension of complex organisms. The availability of micro-DNA extraction methods, coupled with selective amplification of the smallest extracted fragments with molecular markers, could equally bring a breakthrough in food genomics: the identification of original components in food. Amplified fragment length polymorphisms (AFLPs) have been instrumental in plant genomics because they may allow rapid and reliable analysis of multiple and potentially polymorphic sites. Nevertheless, their direct application to the analysis of DNA extracted from food matrixes is complicated by the low quality of DNA extracted: its high degradation and the presence of inhibitors of enzymatic reactions. The conversion of an AFLP fragment to a robust and specific single-locus PCR-based marker, therefore, could extend the use of molecular markers to large-scale analysis of complex agro-food matrixes. In the present study is reported the development of sequence characterized amplified regions (SCARs) starting from AFLP profiles of monovarietal olive oils analyzed on agarose gel; one of these was used to identify differences among 56 olive cultivars. All the developed markers were purposefully amplified in olive oils to apply them to olive oil traceability.

  18. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  19. Relative profile analysis of molecular markers for identification and genetic discrimination of loaches (Pisces, Nemacheilidae).

    Science.gov (United States)

    Patil, Tejas Suresh; Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Bhosale, Amrut Ravindra; Govindwar, Sanjay Prabhu; Muley, Dipak Vishwanathrao

    2016-01-01

    Genus Nemacheilus, Nemachilichthys and Schistura belong to the family Nemacheilidae of the order Cypriniformes. The present investigation was undertaken to observe genetic diversity, phylogenetic relationship and to develop a molecular-based tool for taxonomic identification. For this purpose, four different types of molecular markers were utilized in which 29 random amplified polymorphic DNA (RAPD), 25 inter-simple sequence repeat (ISSR) markers, and 10 amplified fragment length polymorphism (AFLP) marker sets were screened and mitochondrial COI gene was sequenced. This study added COI barcodes for the identification of Nemacheilus anguilla, Nemachilichthys rueppelli and Schistura denisoni. RAPD showed higher polymorphism (100%) than the ISSR (93.75-100%) and AFLP (93.86-98.96%). The polymorphic information content (PIC), heterozygosity, multiplex ratio, and gene diversity was observed highest for AFLP primers, whereas the major allele frequency was observed higher for RAPD (0.5556) and lowest for AFLP (0.1667). The COI region of all individuals was successfully amplified and sequenced, which gave a 100% species resolution. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  20. Prognostic molecular markers in early breast cancer

    International Nuclear Information System (INIS)

    Esteva, Francisco J; Hortobagyi, Gabriel N

    2004-01-01

    A multitude of molecules involved in breast cancer biology have been studied as potential prognostic markers. In the present review we discuss the role of established molecular markers, as well as potential applications of emerging new technologies. Those molecules used routinely to make treatment decisions in patients with early-stage breast cancer include markers of proliferation (e.g. Ki-67), hormone receptors, and the human epidermal growth factor receptor 2. Tumor markers shown to have prognostic value but not used routinely include cyclin D 1 and cyclin E, urokinase-like plasminogen activator/plasminogen activator inhibitor, and cathepsin D. The level of evidence for other molecular markers is lower, in part because most studies were retrospective and not adequately powered, making their findings unsuitable for choosing treatments for individual patients. Gene microarrays have been successfuly used to classify breast cancers into subtypes with specific gene expression profiles and to evaluate prognosis. RT-PCR has also been used to evaluate expression of multiple genes in archival tissue. Proteomics technologies are in development

  1. Greek PDO saffron authentication studies using species specific molecular markers.

    Science.gov (United States)

    Bosmali, I; Ordoudi, S A; Tsimidou, M Z; Madesis, P

    2017-10-01

    Saffron, the spice produced from the red stigmas of the flower of Crocus sativus L. is a frequent target of fraud and mislabeling practices that cannot be fully traced using the ISO 3632 trade standard specifications and test methods. A molecular approach is proposed herein as a promising branding strategy for the authentication of highly esteemed saffron brands such as the Greek Protected Designation of Origin (PDO) "Krokos Kozanis". Specific ISSR (inter-simple sequence repeat) markers were used to assess for the first time, the within species variability of several populations of C. sativus L. from the cultivation area of "Krokos Kozanis" as well as the potential differences with the band pattern produced by other Crocus species. Then, species-specific markers were developed taking advantage of an advanced molecular technique such as the HRM analysis coupled with universal DNA barcoding regions (trnL) (Bar-HRM) and applied to saffron admixtures with some of the most common plant adulterants (Calendula officinalis, Carthamus tinctorius, Gardenia jasminoides, Zea mays and Curcuma longa). The sensitivity of the procedure was tested for turmeric as a case study whereas HPLC-fluorescence determination of secondary metabolites was also employed for comparison. The overall results indicated that the Bar-HRM approach is quite effective in terms of specificity and sensitivity. Its effectiveness regarding the detection of turmeric was comparable to that of a conventional HPLC method (0.5% vs 1.0%, w/w). Yet, the proposed DNA-based method is much faster, cost-effective and can be used even by non-geneticists, in any laboratory having access to an HRM-capable real-time PCR instrumentation. It can be, thus, regarded as a strong analytical tool in saffron authentication studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Rust resistance evaluation of advanced wheat (triticum aestivum l.) genotypes using pcr-based dna markers

    International Nuclear Information System (INIS)

    Rahman, S.U.; Younis, M.; Iqbal, M.Z.; Nawaz, M.

    2014-01-01

    The most effective and environmental friendly approach for the control of wheat rust disease is the use of resistant genotypes. The present study was conducted to explore rust resistance potential of 85 elite wheat genotypes (36 varieties and 49 advanced lines) using various types of DNA markers like STS, SCAR and SSR. DNA markers linked with different genes conferring resistance to rusts (Leaf rust=Lr, Yellow rust=Yr and Stem rust=Sr) were employed in this study. A total of 18 genes, consisting of eleven Lr (lr1, lr10, lr19, lr21, lr28, lr34, lr39, lr46, lr47, lr51 and lr52), four Yr (yr5, yr18, yr26 and yr29) and three Sr genes (sr2, sr29, and sr36) were studied through linked DNA markers. Maximum number of Lr genes was found in 17 advanced lines and 9 varieties, Yr genes in 26 advanced lines and 20 wheat varieties, and Sr genes in 43 advanced lines and 27 varieties. Minimum number of Lr genes was found in advanced line D-97 and variety Kohinoor-83, Yr genes in wheat variety Bwp-97 and Sr genes in 6 advanced lines and 8 varieties. Molecular data revealed that genotypes having same origin, from a specified area showed resistance for similar type of genes. In this study, an average similarity of 84% was recorded among wheat genotypes. Out of 18 loci, 15 were found to be polymorphic. (author)

  3. Prognostic Value of Molecular Markers and Implication for Molecular Targeted Therapies in Nasopharyngeal Carcinoma: An Update in an Era of New Targeted Molecules Development.

    Science.gov (United States)

    Liu, Mu-Tai; Chen, Mu-Kuan; Huang, Chia-Chun; Huang, Chao-Yuan

    2015-02-01

    The aim of the study was to evaluate the prognostic significance of molecular biomarkers which could provide information for more accurate prognostication and development of novel therapeutic strategies for nasopharyngeal carcinoma (NPC). NPC is a unique malignant epithelial carcinoma of head and neck region, with an intimate association with the Epstein-Barr virus (EBV). Currently, the prediction of NPC prognosis is mainly based on the clinical TNM staging; however, NPC patients with the same clinical stage often present different clinical outcomes, suggesting that the TNM stage is insufficient to precisely predict the prognosis of this disease. In this review, we give an overview of the prognostic value of molecular markers in NPC and discuss potential strategies of targeted therapies for treatment of NPC. Molecular biomarkers, which play roles in abnormal proliferation signaling pathways (such as Wnt/β-catenin pathway), intracellular mitogenic signal aberration (such as hypoxia-inducible factor (HIF)-1α), receptor-mediated aberrations (such as vascular endothelial growth factor (VEGF)), tumor suppressors (such as p16 and p27 activity), cell cycle aberrations (such as cyclin D1 and cyclin E), cell adhesion aberrations (such as E-cadherin), apoptosis dysregualtion (such as survivin) and centromere aberration (centromere protein H), are prognostic markers for NPC. Plasma EBV DNA concentrations and EBV-encoded latent membrane proteins are also prognostic markers for NPC. Implication of molecular targeted therapies in NPC was discussed. Such therapies could have potential in combination with different cytotoxic agents to combat and eradicate tumor cells. In order to further improve overall survival for patients with loco-regionally advanced NPC, the development of innovative strategies, including prognostic molecular markers and molecular targeted agents is needed.

  4. Use of molecular markers for the study of wild fungus basidiomycetes

    Directory of Open Access Journals (Sweden)

    Blanca Estela Gómez Luna

    2012-09-01

    Full Text Available Molecular marker techniques in the study of wild basidiomycete, are increasingly applied to ecology projects, with special focus on analysis of genetic diversity. Often require specialized methods for extracting the DNA of organisms of natural environments, because of the complex compounds that are (carbohydrate polymers and contaminants from the environment (soil particles. Biological materials used were basidiocarps collected in the forest of Santa Rosa, Guanajuato. And mycelium isolated from these basidiocarps. In this work we used a DNA extraction method that allowed the PCR amplification, restriction enzyme digestion and Southern hybridization by non-radioactive method. The results were obtained: Amplification of the ITS1 region of ribosomal unit of the different species of Basidiomycetes. It was possible to observe the genetic diversity among different species of basidiomycetes and the mycelia. Furthermore, the results also suggest differences in DNA methylation between the vegetative mycelium and mycelium of basidiocarp. Finally it is noteworthy that there were no previous work on the application of methods of non-radioactive Southern hybridization for analysis of wild Basidiomycetes and this pioneering work in applying this technique.

  5. Advance of molecular marker application in the tobacco research ...

    African Journals Online (AJOL)

    Tobacco (Nicotiana spp.) is one of the most important commercial crops in the world. During the last two decades, molecular markers have entered the scene of genetic improvement in different fields of agricultural research. The principles and characteristics of several molecular markers such as RFLP, RAPD, AFLP, ...

  6. cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications1

    Science.gov (United States)

    Wani, Gowher A.; Shah, Manzoor A.; Reshi, Zafar A.; Atangana, Alain R.; Khasa, Damase P.

    2014-01-01

    • Premise of the study: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • Methods and Results: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • Conclusions: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation. PMID:25202636

  7. Validation and use of DNA markers for sex determination in papaya (Carica papaya)

    International Nuclear Information System (INIS)

    Ejaz, M.; Iqbal, M.; Ahmed, I.

    2015-01-01

    Profitable papaya production requires female and hermaphrodite plants in higher number than male plants. This is only possible if sex of plants is determined at an early growth stage. The present study was conducted to validate sex-linked DNA markers using plants from two Pakistani papaya varieties and subsequently utilize them for determination of sex in juvenile papaya plants. One hundred and five plants (including 49 male and 56 female) of two Pakistani Papaya varieties at flowering stage were screened with six DNA markers viz., W-11, T12, SDP, Napf-76Napf-76, PKBT4 and PKBT5. All male plants exhibited amplification of sex-linked alleles with markers T12 and W11, whereas, 96% and 95% of female plants showed the absence of sex-linked allele with these markers, respectively. Markers SDP, PKBT5 and Napf-76 showed the presence of sex-linked alleles in 98%, 96% and 93% of male plants, respectively, whereas the same markers showed the absence of sex-linked alleles in 100%, 96% and 94% of female plants. One marker, PKBT4 could not produce expected PCR amplification reported previously. The five DNA markers were further used to screen 171 papaya seedlings. These markers clearly differentiated male and female sex types in the studied papaya plants. Results of our study are likely to facilitate Pakistani papaya breeders and growers to incorporate DNA based screening at juvenile stage to determine sex at early stage and to ensure profitable papaya production. (author)

  8. Tagging genes for drought resistance by DNA markers in wheat (abstract)

    International Nuclear Information System (INIS)

    Malik, T.A.; Rahman, S.; Zafar, Y.

    2005-01-01

    Wheat families (F/sub 3) raised from the seed of drought resistant and susceptible F/sub 2/ plants developed from the cross of drought resistant and susceptible parents were grown under greenhouse conditions in polyethylene tubes filled with soil and sand mixture. Drought stress was imposed and monitored at the seedling stage. The relative water content and net photosynthesis was recorded with increasing drought stress until a significant part of the seedling population had zero or negative net photosynthesis. The seedling with zero or negative net photosynthesis were named as drought susceptible and the seedlings at the same drought stress showing net photosynthesis were named as drought resistance. Twenty each of the most susceptible and resistant seedlings were selected for DNA extraction. Random Amplified Polymorphic DNA (RAPD) technique using bulked segregant analysis was used to identify DNA markers linked to drought resistance. The primers OPJ-05, OPJ-14, OPI-20 and OPA-19 produced polymorphic DNA fragments between the contrasting bulks. The polymorphic DNA fragment of 1.55kb produced by the primer OPA-19 was found linked to drought resistance. This DNA marker can be used in markers-assisted selection for drought resistance or to clone drought resistance gene. (author)

  9. Identification of molecular performance from oil palm clones based on SSR markers

    Science.gov (United States)

    Putri, Lollie Agustina P.; Basyuni, M.; Bayu, Eva S.; Arvita, D.; Arifiyanto, D.; Syahputra, I.

    2018-03-01

    In Indonesia, the oil palms are an important economic crop, producing food and raw materials for the food, confectionary, cosmetics and oleo-chemical industrial demands of oil palm products. Clonal oil palm offers the potential for greater productivity because it is possible to establish uniform tree stands comprising identical copies (clones) of a limited number of highly productive oil palms. Unfortunately, tissue culture sometimes accentuates the expression of detects in oil palm, particularly when embryogenesis is induced in particullar callus for prolonged periods. This research is conducted by taking individual tree sample of clone germplasm two years old. The purpose of this research is to molecular performance analysis of some oil palm clones based on SSR markers. A total of 30 trees oil palm clones were used for analysis. In this experiment, the DNA profile diversity was assessed using five loci of oil palm’s specific SSR markers. The results of the experiment indicated out of 3 SSR markers (FR-0779, FR-3663 and FR-0782) showed monomorphic of PCR product and 2 SSR markers (FR-0783 and FR- 3745) showed polymorphic of PCR product. There are 10 total number of PCR product. These preliminary results demonstrated SSR marker can be used to evaluate genetic relatedness among trees of oil palm clones.

  10. Evaluation of molecular markers for Phytophthora ramorum detection and identification: Testing for specificity using a standardized library of isolates

    Science.gov (United States)

    F.N. Martin; M.D. Coffey; K. Zeller; R.C. Hamelin; P. Tooley; M. Garbelotto; K.J.D. Hughes; T. Kubisiak; G.J. Bilodeau; L. Levy; C. Blomquist; P.H. Berger

    2009-01-01

    Given the importance of Phytophthora ramorum from a regulatory standpoint, it is imperative that molecular markers for pathogen detection are fully tested to evaluate their specificity in detection of the pathogen. In an effort to evaluate 11 reported diagnostic techniques, we assembled a standardized DNA library using accessions from the World...

  11. Control of DNA hybridization by photoswitchable molecular glue.

    Science.gov (United States)

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  12. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  13. Development of Thinopyrum ponticum-specific molecular markers and FISH probes based on SLAF-seq technology.

    Science.gov (United States)

    Liu, Liqin; Luo, Qiaoling; Teng, Wan; Li, Bin; Li, Hongwei; Li, Yiwen; Li, Zhensheng; Zheng, Qi

    2018-05-01

    Based on SLAF-seq, 67 Thinopyrum ponticum-specific markers and eight Th. ponticum-specific FISH probes were developed, and these markers and probes could be used for detection of alien chromatin in a wheat background. Decaploid Thinopyrum ponticum (2n = 10x = 70) is a valuable gene reservoir for wheat improvement. Identification of Th. ponticum introgression would facilitate its transfer into diverse wheat genetic backgrounds and its practical utilization in wheat improvement. Based on specific-locus-amplified fragment sequencing (SLAF-seq) technology, 67 new Th. ponticum-specific molecular markers and eight Th. ponticum-specific fluorescence in situ hybridization (FISH) probes have been developed from a tiny wheat-Th. ponticum translocation line. These newly developed molecular markers allowed the detection of Th. ponticum DNA in a variety of materials specifically and steadily at high throughput. According to the hybridization signal pattern, the eight Th. ponticum-specific probes could be divided into two groups. The first group including five dispersed repetitive sequence probes could identify Th. ponticum chromatin more sensitively and accurately than genomic in situ hybridization (GISH). Whereas the second group having three tandem repetitive sequence probes enabled the discrimination of Th. ponticum chromosomes together with another clone pAs1 in wheat-Th. ponticum partial amphiploid Xiaoyan 68.

  14. Elucidating polyploidization of bermudagrasses as assessed by organelle and nuclear DNA markers.

    Science.gov (United States)

    Gulsen, Osman; Ceylan, Ahmet

    2011-12-01

    Clarification of relationships among ploidy series of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to elucidate polyploidization among Cynodon accessions with different ploidy series collected from Turkey based on chloroplast and nuclear DNA. Forty Cynodon accessions including 7 diploids, 3 triploids, 10 tetraploids, 11 pentaploids, and 9 hexaploids were analyzed using chloroplast DNA restriction fragment-length polymorphism (cpDNA RFLP), chloroplast DNA simple sequence repeat (cpDNA SSR), and nuclear DNA markers based on neighbor-joining (NJ) and principle component analyses (PCA). All three-marker systems with two statistical algorithms clustered the diploids apart from the other ploidy levels. Assuming autopolyploidy, spontaneous polyploidization followed by rapid diversification among the higher ploidy levels than the diploids is likely in Cynodon's evolution. Few tetraploid and hexaploid accessions were clustered with or closely to the group of diploids, supporting the hypothesis above. Eleven haplotypes as estimated by cpDNA RFLP and SSR markers were detected. This study indicated that the diploids had different organelle genome from the rest of the ploidy series and provided valuable insight into relationships among ploidy series of Cynodon accessions based on cp and nuclear DNAs.

  15. Polymorphic DNA microsatellite markers for forensic individual identification and parentage analyses of seven threatened species of parrots (family Psittacidae).

    Science.gov (United States)

    Jan, Catherine; Fumagalli, Luca

    2016-01-01

    The parrot family represents one of the bird group with the largest number of endangered species, as a result of habitat destruction and illegal trade. This illicit traffic involves the smuggling of eggs and animals, and the laundering through captive breeding facilities of wild-caught animals. Despite the huge potential of wildlife DNA forensics to determine with conclusive evidence illegal trade, current usage of DNA profiling approaches in parrots has been limited by the lack of suitable molecular markers specifically developed for the focal species and by low cross-species polymorphism. In this study, we isolated DNA microsatellite markers in seven parrot species threatened with extinction (Amazona brasiliensis, A. oratrix, A. pretrei, A. rhodocorytha, Anodorhynchus leari, Ara rubrogenys and Primolius couloni). From an enriched genomic library followed by 454 pyrosequencing, we characterized a total of 106 polymorphic microsatellite markers (mostly tetranucleotides) in the seven species and tested them across an average number of 19 individuals per species. The mean number of alleles per species and across loci varied from 6.4 to 8.3, with the mean observed heterozygosities ranging from 0.65 to 0.84. Identity and parentage exclusion probabilities were highly discriminatory. The high variability displayed by these microsatellite loci demonstrates their potential utility to perform individual genotyping and parentage analyses, in order to develop a DNA testing framework to determine illegal traffic in these threatened species.

  16. Determination of molecular markers associated with anthesis-silking interval in maize

    International Nuclear Information System (INIS)

    Simpson, J.

    1998-01-01

    Maize lines contrasting in anthesis-silking, interval (ASI), a trait strongly linked to drought tolerance, have been analyzed under different water stress conditions in the field and with molecular markers. Correlation of marker and field data has revealed molecular markers strongly associated with flowering and yield traits. (author)

  17. Marcadores moleculares em estudos de caracterização de erva-mate (Ilex paraguariensis St.Hil.: o sabor Molecular markers in erva-mate (Ilex paraguariensis araguariensis St.Hil. characterization studies: the taste

    Directory of Open Access Journals (Sweden)

    Mario Angelo Vidor

    2002-06-01

    Full Text Available A Epagri (Empresa de Pesquisa Agropecuária e Extensão Rural de Santa Catarina S.A possui uma das maiores coleções brasileiras de erva-mate (Ilex paraguariensis St.Hil.. A partir de ensaios agronômicos preliminares, apresentaram destaque as procedências Barão de Cotegipe e Água Doce. Dentre essas, verificaram-se diferentes sabores (mais amargo e menos amargo, aparentemente, em função do tipo de folha (CL - curta e larga; LE - longa e estreita. O objetivo deste trabalho foi o de tentar associar os padrões obtidos mediante marcadores moleculares, com as procedências ou acessos e características fenotípicas desejáveis - altura de planta, diâmetro de copa, densidade folhar, sobrevivência das plantas e comportamento de rebrota -, dentro do caráter sabor em erva-mate. Para isto, utilizaram-se marcadores moleculares que amplificam DNA, do tipo RAPD (Random Amplified Polymorphic DNA. Os resultados indicaram não ser possível, com o número de iniciadores utlizados como marcadores moleculares, definir geneticamente o caráter sabor, ainda que os mesmos tenham indicado tendência para tal.The Santa Catarina State Agricultural Research and Extensios Organization - Epagri SA, owns one of the largest Brazilian colletions or erva-mate (Ilex paraguariensis St.Hil.. Preliminary agronomic trials identified two promissing erva-mate materials named Barão de Cotegipe and Água Doce. Different tastes within each material were also identified, i.e. tastes with different grades of bitterness, apparently associated with the shape of leaves (CL - short and wide; LE - long and narrow. This study aimed to associate this plant patterns using molecular markers with plant origins and desirable fenotipic characteristics such as plant height, crown diameter, leaf density, plant survival, regrowth behaviour, within each taste group. For this molecular markers which amplify DNA of RAPD type (Random Amplified Polimorphic DNA was used. The results did not allow

  18. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  19. Molecular markers linked to apomixis in Panicum maximum Jacq.

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... The objective of this work was to identify molecular markers linked to apomixis in ... Four RAPD markers linked to apomixis were identified and mapped in this .... Data analysis. The amplification of the potential markers was analyzed as binary, with 1 for presence and 0 for absence of the marker. The binary.

  20. Salivary DNA and markers of oxidative stress in patients with chronic periodontitis.

    Science.gov (United States)

    Baňasová, Lenka; Kamodyová, Natália; Janšáková, Katarína; Tóthová, Ľubomíra; Stanko, Peter; Turňa, Ján; Celec, Peter

    2015-03-01

    Previous observational studies have shown that periodontal status is associated with salivary markers of oxidative damage. A direct comparison of periodontitis patients and controls using a wide palette of salivary markers of oxidative stress is lacking. Characteristics of salivary DNA in periodontitis are unknown. The aim of this study was to compare the salivary markers of oxidative stress and characteristics of salivary DNA between patients with chronic periodontitis and periodontitis-free controls. Saliva was collected from 23 patients with chronic periodontitis and 19 periodontitis-free controls. All participants underwent a clinical periodontal examination. Markers of oxidative and carbonyl stress were measured in saliva. Human and bacterial DNA was quantified, and human DNA integrity was assessed. Salivary thiobarbituric acid-reacting substances were higher in patients than in controls; at least in men, the difference was significant (p periodontitis patients. The results confirmed the association of salivary thiobarbituric acid-reacting substances with periodontitis. Lipid peroxidation in periodontitis seems to be caused by increased production of reactive oxygen species in men and by decreased antioxidant status in women. Whether lower salivary DNA integrity is involved in the pathogenesis of periodontitis remains to be elucidated. Salivary thiobarbituric acid-reacting substances are associated with periodontitis at least on a population level. Sex-specific causes of lipid peroxidation might point towards different pathogenic mechanisms.

  1. Molecular characterization of UV-treated sugar beet somaclones using RFLP markers

    International Nuclear Information System (INIS)

    Levall, M.W.; Bengtsson, K.; Nilsson, N.-O.; Hjerdin, A.; Hallden, C.

    1994-01-01

    Sugar beet plants regenerated from UV-treated calluses were examined by restriction fragment length polymorphism (RFLP) analysis to determine the extent of somaclonal variation occurring at the DNA level. In total, 50 random sugar beet DNA sequences were used to screen 42 somaclones for genetic alterations. Three polymorphisms were detected among the 7 644 alleles analysed. From these data a mutation frequency of 0.03 ± 0.02% per allele was estimated. This frequency is in agreement with similar studies of somaclonal DNA variation using molecular markers and lies in the upper range of the spontaneous gene mutation frequencies found in plants. The two probegenotype combinations showing independent polymorphisms, were further analysed using the restriction enzymes Bam HI, Eco RI, Eco RV and Hind III. Both polymorphisms are likely to result from structural rearrangements rather than from point mutations. Differences in methylation among 10 of the investigated somaclones were tested for by comparing Hpa II and Msp I generated RFLP patterns. The somaclones showed extensive methylation, but no differences in their degree of methylation. Cytological analysis revealed 34 diploid, 8 tetraploid, but no aneuploid plants. (author)

  2. Cancer molecular markers: A guide to cancer detection and management.

    Science.gov (United States)

    Nair, Meera; Sandhu, Sardul Singh; Sharma, Anil Kumar

    2018-02-08

    Cancer is generally caused by the molecular alterations which lead to specific mutations. Advances in molecular biology have provided an impetus to the study of cancers with valuable prognostic and predictive significance. Over the hindsight various attempts have been undertaken by scientists worldwide, in the management of cancer; where, we have witnessed a number of molecular markers which allow the early detection of cancers and lead to a decrease in its mortality rate. Recent advances in oncology have led to the discovery of cancer markers that has allowed early detection and targeted therapy of tumors. In this context, current review provides a detail outlook on various molecular markers for diagnosis, prognosis and management of therapeutic response in cancer patients. Copyright © 2018 Elsevier Ltd. All rights reserved.

  3. De novo DNA sequence driven bulk segregant analysis can pinpoint candicate loci for Total Glycoalkaloid (TGA) content in potato without prior knowledge of molecular markers

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Sønderkær, Mads; Petersen, Annabeth Høgh

    is discarded based on the absence of desired molecular marker already at the seed or seedling stage. However, the number of molecular markers known in potato with appropriate linkage to agronomical traits is presently insufficient to establish a comprehensive MAS breeding platform for potato....

  4. DOMINO: development of informative molecular markers for phylogenetic and genome-wide population genetic studies in non-model organisms.

    Science.gov (United States)

    Frías-López, Cristina; Sánchez-Herrero, José F; Guirao-Rico, Sara; Mora, Elisa; Arnedo, Miquel A; Sánchez-Gracia, Alejandro; Rozas, Julio

    2016-12-15

    The development of molecular markers is one of the most important challenges in phylogenetic and genome wide population genetics studies, especially in studies with non-model organisms. A highly promising approach for obtaining suitable markers is the utilization of genomic partitioning strategies for the simultaneous discovery and genotyping of a large number of markers. Unfortunately, not all markers obtained from these strategies provide enough information for solving multiple evolutionary questions at a reasonable taxonomic resolution. We have developed Development Of Molecular markers In Non-model Organisms (DOMINO), a bioinformatics tool for informative marker development from both next generation sequencing (NGS) data and pre-computed sequence alignments. The application implements popular NGS tools with new utilities in a highly versatile pipeline specifically designed to discover or select personalized markers at different levels of taxonomic resolution. These markers can be directly used to study the taxa surveyed for their design, utilized for further downstream PCR amplification in a broader set taxonomic scope, or exploited as suitable templates to bait design for target DNA enrichment techniques. We conducted an exhaustive evaluation of the performance of DOMINO via computer simulations and illustrate its utility to find informative markers in an empirical dataset. DOMINO is freely available from www.ub.edu/softevol/domino CONTACT: elsanchez@ub.edu or jrozas@ub.eduSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  5. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  6. DNA adducts as molecular dosimeters

    International Nuclear Information System (INIS)

    Lucier, G.W.

    1990-01-01

    There is compelling evidence that DNA adducts play an important role in the actions of many pulmonary carcinogens. During the last ten years sensitive methods (antibodies and 32 P-postlabeling) have been developed that permit detection of DNA adducts in tissues of animals or humans exposed to low levels of some genotoxic carcinogens. This capability has led to approaches designed to more reliably estimate the shape of the dose-response curve in the low dose region for a few carcinogens. Moreover, dosimetry comparisions can, in some cases, be made between animals and humans which help in judging the adequacy of animal models for human risk assessments. There are several points that need to be considered in the evaluation of DNA adducts as a molecular dosimeter. For example, DNA adduct formation is only one of many events that are needed for tumor development and some potent carcinogens do not form DNA adducts; i.e., TCDD. Other issues that need to be considered are DNA adduct heterogeneity, DNA repair, relationship of DNA adducts to somatic mutation and cell specificity in DNA adduct formation and persistence. Molecular epidemiology studies often require quantitation of adducts in cells such as lymphocytes which may or may not be reliable surrogates for adduct concentrations in target issues. In summary, accurate quantitation of low levels of DNA adducts may provide data useful in species to species extrapolation of risk including the development of more meaningful human monitoring programs

  7. Supplementary data: Development of nuclear DNA markers for ...

    Indian Academy of Sciences (India)

    Supplementary data: Development of nuclear DNA markers for evolutionary studies in Plasmodium falciparum. Celia Thomas, Sneh Shalini, N. Raghavendra, Meenakshi Choudhary, Anju Verma, Hema Joshi,. A. P. Dash and Aparup Das. J. Genet. 86, 65–68. Primer sequences for amplification of putatively neutral ...

  8. Molecular Combing of DNA: Methods and Applications

    DEFF Research Database (Denmark)

    Nazari, Zeniab Esmail; Gurevich, Leonid

    2013-01-01

    studies to nanoelectronics. While molecular combing has been applied in a variety of DNA-related studies, no comprehensive review has been published on different combing methods proposed so far. In this review, the underlying mechanisms of molecular combing of DNA are described followed by discussion...

  9. Application of molecular markers in germplasm enhancement of Cassava (Manihot esculenta L. Crantz) and Yams (Dioscorea spp.) at IITA

    International Nuclear Information System (INIS)

    Mignouna, H.D.; Asiedu, R.; Dixon, A.G.O.; Tonukari, J.; Ng, N.Q.; Thottappilly, G.; Knox, M.; Ellis, T.H.N.

    1998-01-01

    The genetic variation among 28 varieties of cassava (Manihot esculenta L. Crantz), collected from different parts of the Republic of Benin was determined using random amplified polymorphic DNA (RAPD) markers. A set of ten primers out of the one hundred that were screened, detected polymorphisms. Thirty-five cassava landraces from three countries of West Africa, along with five improved varieties and one genetic stock (58308), were analysed using both micro satellite markers and nine selected random primers which generated fifty-four polymorphic markers. Based on the unweighted pair group method with arithmetic averages (UPGMA) and Principal Component Analysis (PCA), six major groups of clusters were identified among the forty one genotypes. Clone 58308, the original source of resistance to African Cassava Mosaic Disease (ACMD) in IITA's cassava breeding program, and TMS 30572, an improved cultivar derived from clone 58308, were found in the same cluster group. All 34 of the landraces that are known to be resistant to ACMD were genetically distant from 58308 and TMS 30572. A diallel mating programme has been initiated to elucidate the genetics of these new sources of resistance to ACMD and determine their complementarity as well as allellism for resistance. A set of eight random primers for RAPD and two combinations of enzymes and specific primers for AFLP were used to generate DNA fingerprinting of twenty varietal groups among the 32 described for cultivated yams in the region. The results obtained confirm that a given varietal group is a mixture of different genotypes. The molecular taxonomy of 30 accessions of cultivated yams, D. rotundata and D. cayenensis, and 35 accessions of wild yams from Nigeria was established using RAPD and micro satellite markers. The cultivated yams separated into two distinct groups corresponding to the two species. D. rotundata genotypes showed relationship to the wild species D. abyssinica and D. praehensilis, whereas D. cayenensis

  10. Application of molecular markers in germplasm enhancement of Cassava (Manihot esculenta L. Crantz) and Yams (Dioscorea spp.) at IITA

    Energy Technology Data Exchange (ETDEWEB)

    Mignouna, H D; Asiedu, R; Dixon, A G.O.; Tonukari, J; Ng, N Q; Thottappilly, G [International Institute of Tropical Agriculture, Ibadan (Nigeria); Knox, M; Ellis, T H.N. [John Innes Centre, Norwich (United Kingdom)

    1998-10-01

    The genetic variation among 28 varieties of cassava (Manihot esculenta L. Crantz), collected from different parts of the Republic of Benin was determined using random amplified polymorphic DNA (RAPD) markers. A set of ten primers out of the one hundred that were screened, detected polymorphisms. Thirty-five cassava landraces from three countries of West Africa, along with five improved varieties and one genetic stock (58308), were analysed using both micro satellite markers and nine selected random primers which generated fifty-four polymorphic markers. Based on the unweighted pair group method with arithmetic averages (UPGMA) and Principal Component Analysis (PCA), six major groups of clusters were identified among the forty one genotypes. Clone 58308, the original source of resistance to African Cassava Mosaic Disease (ACMD) in IITA`s cassava breeding program, and TMS 30572, an improved cultivar derived from clone 58308, were found in the same cluster group. All 34 of the landraces that are known to be resistant to ACMD were genetically distant from 58308 and TMS 30572. A diallel mating programme has been initiated to elucidate the genetics of these new sources of resistance to ACMD and determine their complementarity as well as allellism for resistance. A set of eight random primers for RAPD and two combinations of enzymes and specific primers for AFLP were used to generate DNA fingerprinting of twenty varietal groups among the 32 described for cultivated yams in the region. The results obtained confirm that a given varietal group is a mixture of different genotypes. The molecular taxonomy of 30 accessions of cultivated yams, D. rotundata and D. cayenensis, and 35 accessions of wild yams from Nigeria was established using RAPD and micro satellite markers. The cultivated yams separated into two distinct groups corresponding to the two species. D. rotundata genotypes showed relationship to the wild species D. abyssinica and D. praehensilis, whereas D. cayenensis

  11. Molecular markers in the epidemiology and diagnosis of coccidioidomycosis.

    Science.gov (United States)

    Duarte-Escalante, Esperanza; Frías-De-León, María Guadalupe; Zúñiga, Gerardo; Martínez-Herrera, Erick; Acosta-Altamirano, Gustavo; Reyes-Montes, María Del Rocío

    2014-01-01

    The prevalence of coccidioidomycosis in endemic areas has been observed to increase daily. To understand the causes of the spread of the disease and design strategies for fungal detection in clinical and environmental samples, scientists have resorted to molecular tools that allow fungal detection in a natural environment, reliable identification in clinical cases and the study of biological characteristics, such as reproductive and genetic structure, demographic history and diversification. We conducted a review of the most important molecular markers in the epidemiology of Coccidioides spp. and the diagnosis of coccidioidomycosis. A literature search was performed for scientific publications concerning the application of molecular tools for the epidemiology and diagnosis of coccidioidomycosis. The use of molecular markers in the epidemiological study and diagnosis of coccidioidomycosis has allowed for the typing of Coccidioides spp. isolates, improved understanding of their mode of reproduction, genetic variation and speciation and resulted in the development specific, rapid and sensitive strategies for detecting the fungus in environmental and clinical samples. Molecular markers have revealed genetic variability in Coccidioides spp. This finding influences changes in the epidemiology of coccidioidomycosis, such as the emergence of more virulent or antifungal resistant genotypes. Furthermore, the molecular markers currently used to identify Coccidioides immitis and Coccidioides posadasii are specific and sensitive. However, they must be validated to determine their application in diagnosis. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  12. Polymorphic DNA microsatellite markers for forensic individual identification and parentage analyses of seven threatened species of parrots (family Psittacidae

    Directory of Open Access Journals (Sweden)

    Catherine Jan

    2016-09-01

    Full Text Available The parrot family represents one of the bird group with the largest number of endangered species, as a result of habitat destruction and illegal trade. This illicit traffic involves the smuggling of eggs and animals, and the laundering through captive breeding facilities of wild-caught animals. Despite the huge potential of wildlife DNA forensics to determine with conclusive evidence illegal trade, current usage of DNA profiling approaches in parrots has been limited by the lack of suitable molecular markers specifically developed for the focal species and by low cross-species polymorphism. In this study, we isolated DNA microsatellite markers in seven parrot species threatened with extinction (Amazona brasiliensis, A. oratrix, A. pretrei, A. rhodocorytha, Anodorhynchus leari, Ara rubrogenys and Primolius couloni. From an enriched genomic library followed by 454 pyrosequencing, we characterized a total of 106 polymorphic microsatellite markers (mostly tetranucleotides in the seven species and tested them across an average number of 19 individuals per species. The mean number of alleles per species and across loci varied from 6.4 to 8.3, with the mean observed heterozygosities ranging from 0.65 to 0.84. Identity and parentage exclusion probabilities were highly discriminatory. The high variability displayed by these microsatellite loci demonstrates their potential utility to perform individual genotyping and parentage analyses, in order to develop a DNA testing framework to determine illegal traffic in these threatened species.

  13. Application of molecular markers for variety protection of ryegrass (Lolium perenne L.)

    DEFF Research Database (Denmark)

    Jensen, Louise Bach; Deneken, Gerhard; Roulund, N

    2008-01-01

    registration systems. Although DUS testing currently employs mostly visually observable characteristics that are expressions of the phenotype of a variety, there is much interest in the use of molecular markers. The overall objective of this project is to examine the potential use of molecular markers...... with 140 alleles gives the same level of information. Furthermore, number of genotypes per variety can be reduced to 20 compared to the original dataset containing 60 genotypes when using all 18 SSR markers but not when using only six SSR markers. Significant association was found between the molecular...... on the morphological characterization from the DUS trial. 18 SSR markers were selected based on their genome distribution, reproducibility, level of information and ease of scoring. It was found, that for variety discrimination, reducing the number of SSR markers from 18 SSR markers with 262 alleles to six SSR markers...

  14. Circulating tumour DNA methylation markers for diagnosis and prognosis of hepatocellular carcinoma

    Science.gov (United States)

    Xu, Rui-Hua; Wei, Wei; Krawczyk, Michal; Wang, Wenqiu; Luo, Huiyan; Flagg, Ken; Yi, Shaohua; Shi, William; Quan, Qingli; Li, Kang; Zheng, Lianghong; Zhang, Heng; Caughey, Bennett A.; Zhao, Qi; Hou, Jiayi; Zhang, Runze; Xu, Yanxin; Cai, Huimin; Li, Gen; Hou, Rui; Zhong, Zheng; Lin, Danni; Fu, Xin; Zhu, Jie; Duan, Yaou; Yu, Meixing; Ying, Binwu; Zhang, Wengeng; Wang, Juan; Zhang, Edward; Zhang, Charlotte; Li, Oulan; Guo, Rongping; Carter, Hannah; Zhu, Jian-Kang; Hao, Xiaoke; Zhang, Kang

    2017-11-01

    An effective blood-based method for the diagnosis and prognosis of hepatocellular carcinoma (HCC) has not yet been developed. Circulating tumour DNA (ctDNA) carrying cancer-specific genetic and epigenetic aberrations may enable a noninvasive `liquid biopsy' for diagnosis and monitoring of cancer. Here, we identified an HCC-specific methylation marker panel by comparing HCC tissue and normal blood leukocytes and showed that methylation profiles of HCC tumour DNA and matched plasma ctDNA are highly correlated. Using cfDNA samples from a large cohort of 1,098 HCC patients and 835 normal controls, we constructed a diagnostic prediction model that showed high diagnostic specificity and sensitivity (P < 0.001) and was highly correlated with tumour burden, treatment response, and stage. Additionally, we constructed a prognostic prediction model that effectively predicted prognosis and survival (P < 0.001). Together, these findings demonstrate in a large clinical cohort the utility of ctDNA methylation markers in the diagnosis, surveillance, and prognosis of HCC.

  15. Regression Association Analysis of Yield-Related Traits with RAPD Molecular Markers in Pistachio (Pistacia vera L.

    Directory of Open Access Journals (Sweden)

    Saeid Mirzaei

    2017-10-01

    Full Text Available Introduction: The pistachio (Pistacia vera, a member of the cashew family, is a small tree originating from Central Asia and the Middle East. The tree produces seeds that are widely consumed as food. Pistacia vera often is confused with other species in the genus Pistacia that are also known as pistachio. These other species can be distinguished by their geographic distributions and their seeds which are much smaller and have a soft shell. Continual advances in crop improvement through plant breeding are driven by the available genetic diversity. Therefore, the recognition and measurement of such diversity is crucial to breeding programs. In the past 20 years, the major effort in plant breeding has changed from quantitative to molecular genetics with emphasis on quantitative trait loci (QTL identification and marker assisted selection (MAS. The germplasm-regression-combined association studies not only allow mapping of genes/QTLs with higher level of confidence, but also allow detection of genes/QTLs, which will otherwise escape detection in linkage-based QTL studies based on the planned populations. The development of the marker-based technology offers a fast, reliable, and easy way to perform multiple regression analysis and comprise an alternative approach to breeding in diverse species of plants. The availability of many makers and morphological traits can help to regression analysis between these markers and morphological traits. Materials and Methods: In this study, 20 genotypes of Pistachio were studied and yield related traits were measured. Young well-expanded leaves were collected for DNA extraction and total genomic DNA was extracted. Genotyping was performed using 15 RAPD primers and PCR amplification products were visualized by gel electrophoresis. The reproducible RAPD fragments were scored on the basis of present (1 or absent (0 bands and a binary matrix constructed using each molecular marker. Association analysis between

  16. Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

    2017-11-01

    Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

  17. Molecular Pathology: Predictive, Prognostic, and Diagnostic Markers in Uterine Tumors.

    Science.gov (United States)

    Ritterhouse, Lauren L; Howitt, Brooke E

    2016-09-01

    This article focuses on the diagnostic, prognostic, and predictive molecular biomarkers in uterine malignancies, in the context of morphologic diagnoses. The histologic classification of endometrial carcinomas is reviewed first, followed by the description and molecular classification of endometrial epithelial malignancies in the context of histologic classification. Taken together, the molecular and histologic classifications help clinicians to approach troublesome areas encountered in clinical practice and evaluate the utility of molecular alterations in the diagnosis and subclassification of endometrial carcinomas. Putative prognostic markers are reviewed. The use of molecular alterations and surrogate immunohistochemistry as prognostic and predictive markers is also discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Epigenetic markers in circulating cell-free DNA as prognostic markers for survival of castration-resistant prostate cancer patients.

    Science.gov (United States)

    Hendriks, Rianne J; Dijkstra, Siebren; Smit, Frank P; Vandersmissen, Johan; Van de Voorde, Hendrik; Mulders, Peter F A; van Oort, Inge M; Van Criekinge, Wim; Schalken, Jack A

    2018-04-01

    Noninvasive biomarkers to guide personalized treatment for castration-resistant prostate cancer (CRPC) are needed. In this study, we analyzed hypermethylation patterns of two genes (GSTP1 and APC) in plasma cell-free DNA (cfDNA) of CRPC patients. The aim of this study was to analyze the cfDNA concentrations and levels of the epigenetic markers and to assess the value of these biomarkers for prognosis. In this prospective study, patients were included before starting new treatment after developing CRPC. The blood samples were collected prior to start of the treatment and at three time points thereafter. cfDNA was extracted from 1.5 mL of plasma and before performing a methylation-specific PCR, bisulfate modification was carried out. The median levels of cfDNA, GSTP1, and APC copies in the baseline samples of CRPC patients (n = 47) were higher than in controls (n = 30). In the survival analysis, the group with baseline marker levels below median had significant less PCa-related deaths (P-values Prostate Published by Wiley Periodicals, Inc.

  19. Leaf margin phenotype-specific restriction-site-associated DNA-derived markers for pineapple (Ananas comosus L.).

    Science.gov (United States)

    Urasaki, Naoya; Goeku, Satoko; Kaneshima, Risa; Takamine, Tomonori; Tarora, Kazuhiko; Takeuchi, Makoto; Moromizato, Chie; Yonamine, Kaname; Hosaka, Fumiko; Terakami, Shingo; Matsumura, Hideo; Yamamoto, Toshiya; Shoda, Moriyuki

    2015-06-01

    To explore genome-wide DNA polymorphisms and identify DNA markers for leaf margin phenotypes, a restriction-site-associated DNA sequencing analysis was employed to analyze three bulked DNAs of F1 progeny from a cross between a 'piping-leaf-type' cultivar, 'Yugafu', and a 'spiny-tip-leaf-type' variety, 'Yonekura'. The parents were both Ananas comosus var. comosus. From the analysis, piping-leaf and spiny-tip-leaf gene-specific restriction-site-associated DNA sequencing tags were obtained and designated as PLSTs and STLSTs, respectively. The five PLSTs and two STSLTs were successfully converted to cleaved amplified polymorphic sequence (CAPS) or simple sequence repeat (SSR) markers using the sequence differences between alleles. Based on the genotyping of the F1 with two SSR and three CAPS markers, the five PLST markers were mapped in the vicinity of the P locus, with the closest marker, PLST1_SSR, being located 1.5 cM from the P locus. The two CAPS markers from STLST1 and STLST3 perfectly assessed the 'spiny-leaf type' as homozygotes of the recessive s allele of the S gene. The recombination value between the S locus and STLST loci was 2.4, and STLSTs were located 2.2 cM from the S locus. SSR and CAPS markers are applicable to marker-assisted selection of leaf margin phenotypes in pineapple breeding.

  20. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

    Science.gov (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

    2015-10-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology

  1. Calibration of denaturing agarose gels for molecular weight estimation of DNA: size determination of the single-stranded genomes of parvoviruses

    Energy Technology Data Exchange (ETDEWEB)

    Snyder, C.E. (Oak Ridge National Lab., TN); Schmoyer, R.L.; Bates, R.C.; Mitra, S.

    1982-01-01

    Vertical slab gel electrophoresis of DNA with CH/sub 3/HgOH-containing agarose produces sharp bands whose mobilities are suitable for size estimation of single-stranded DNA containing 600 to 20,000 bases. The relationship of electrophoretic mobility to size of DNA over this range is a smooth, S-shaped function, and an empirical model was developed to express the relationship. The model involves terms in squared and reciprocal mobilities, and produced excellent fit of known standard markers to measured mobilities. It was used to estimate the sizes of six parvovirus DNAs: Kilham rat virus (KRV), H-1, LuIII, and minute virus of mice (MVM) DNAs had molecular weights of 1.66 to 1.70 x 10/sup 6/, while the molecular weight of bovine parvovirus (BPV) DNA was 1.84 x 10/sup 6/ and that of adenoassociated virus (AAV) DNA was 1.52 x 10/sup 6/.

  2. De novo DNA sequence driven bulk segregant analysis can pinpoint candicate loci for Total Glycoalkaloid (TGA) content in potato without prior knowledge of molecular markers

    DEFF Research Database (Denmark)

    Kaminski, Kacper Piotr; Sønderkær, Mads; Petersen, Annabeth Høgh

    is discarded based on the absence of desired molecular marker already at the seed or seedling stage. However, the number of molecular markers known in potato with appropriate linkage to agronomical traits is presently insufficient to establish a comprehensive MAS breeding platform for potato.......Potato breeding is a slow and costly affair, primarily done as a classical "mate and phenotype" approach using relatively small populations. In contrast, Marker Assisted Selection (MAS) allows cost-effective screening of much larger effective populations sizes because most of the offspring...

  3. Molecular Markers of Metastasis in Ductal Mammary Carcinoma

    National Research Council Canada - National Science Library

    Achary, Patnala

    2002-01-01

    ...% of those patients, however, the disease spreads, and they are at risk of death. Our goal is to develop DNA markers that could be reliably used to identify the ductal mammary carcinomas that are prone to develop metastasis...

  4. An assessment of the use of molecular markers in developing countries

    International Nuclear Information System (INIS)

    Sonnino, A.; Carena, M.J.; Guimaraes, E.P.; Baumung, R.; Pilling, D.; Rischkowsky, B.

    2007-01-01

    Four different sources of information were analysed to assess the current uses of molecular markers in crops, forest trees and livestock in developing countries: the FAO Biotechnology in Developing Countries (FAO-BioDeC) database of biotechnology in developing countries; country reports evaluating the current status of applied plant breeding and related biotechnologies; country reports on animal genetic resources management for preparing the First Report on the State of the World's Animal Genetic Resources (SoW-AnGR); and the results of a questionnaire survey on animal genetic diversity studies. Even if still largely incomplete, the current data show that molecular markers are widely used for plant breeding in the developing world and most probably their use will increase in the future. In the animal sector the use of molecular markers seems less developed and limited or absent in most developing countries. Major differences exist among and within regions regarding the application of molecular marker techniques in plant and animal breeding and genetics. These can be explained by the relatively high investments in infrastructure and human resources necessary to undertake research in these fields. The spectrum of application of molecular markers in crop plants is quite wide, covering many plants relevant to the enhancement of food security, but other important plant species are still neglected. The practical results of marker-assisted selection (MAS) in the field are disappointingly modest, possibly due to: low levels of investment; limited coordination between biotechnologists and practical breeders; instable, non-focused or ill-addressed research projects; and the lack of linkages between research and farmers. Partnerships between developed and developing countries may be a means of better realizing the potential of molecular marker techniques for improving both animal and crop production. (author)

  5. Selection Of Drought Resistant Mutants In Rice Using DNA Markers

    International Nuclear Information System (INIS)

    Nguyen Duc Thanh; Le Thi Bich Thuy; Dang Thi Minh Lua

    2008-01-01

    In recent years, the marker - assisted selection (MAS) strategy have been used for selection of traits that are difficult and costly performed measurement and score. Selection for a well-developed root system could improve the drought resistance of rice as the plant would avoid water stress by absorbing water from the soil. There were several reports on map construction and identification of the markers tightly linked to morphological and physiological traits related to drought resistance in rice, in particular, root traits in upland and lowland rice (Champoux et al., 1995; Ray et al., 1996; Price et al., 1997, 2000; Yadav et al., 1997). In this report, we present the results on selection of drought resistance mutants in rice using the DNA markers tightly linked to root traits favorable for drought resistance. The mutant rice lines were obtained from irradiated seeds and calluses by gamma ray. The selection was performed at M2 mutants using the DNA markers linked to maximum root length (MRL), root weight to shoot weight ratio (RW/SR), and weight of deep root to shoot weight ratio (DRW/SR). The obtained results showed that there were many lines possessed drought resistant markers. In addition, there is a number of lines have altered genome. Several lines having drought markers proved to be more resistant to drought in green-house test. These lines could be useful for further test and development of drought resistant varieties. (author)

  6. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  7. Gliomatosis cerebri: Prognosis based on current molecular markers.

    Science.gov (United States)

    Maharaj, Monish M; Phan, Kevin; Xu, Joshua; Fairhall, Jacob; Reddy, Rajesh; Rao, Prashanth J V

    2017-09-01

    This study aims to review the literature and identify key molecular markers affecting the prognosis of Gliomatosis cerebri (2) to evaluate the level of evidence and identify outstanding markers requiring further study. A literature search was conducted across 5 major databases using the key terms: "Molecular markers" AND "Gliomatosis cerebri" OR "diffuse astrocytoma." Critical appraisal and data presentation was performed inline with the PRISMA guidelines. Following search strategy implementation, 11 studies were included in the final review process. Our data demonstrates significant prognostic value associated with IDH1 132H mutation and variable evidence surrounding the role of INA expression, MGMT promoter methylation and other factors. However, there are significant limitations in the level of evidence obtained. As the genetic basis for the pathogenesis of Gliomatosis cerebri continues to widen, there is little data on markers aside from IDH1 mutation available. IDH1 132H mutation has been demonstrated to have significant effect on survival, particularly in patients with Gliomatosis cerebri type 2. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

    Science.gov (United States)

    Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

    2011-06-01

    Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

  9. A case study characterizing animal fecal sources in surface water using a mitochondrial DNA marker.

    Science.gov (United States)

    Bucci, John P; Shattuck, Michelle D; Aytur, Semra A; Carey, Richard; McDowell, William H

    2017-08-01

    Water quality impairment by fecal waste in coastal watersheds is a public health issue. The present study provided evidence for the use of a mitochondrial (mtDNA) marker to detect animal fecal sources in surface water. The accurate identification of fecal pollution is based on the notion that fecal microorganisms preferentially inhabit a host animal's gut environment. In contrast, mtDNA host-specific markers are inherent to eukaryotic host cells, which offers the advantage by detecting DNA from the host rather than its fecal bacteria. The present study focused on sampling water presumably from non-point sources (NPS), which can increase bacterial and nitrogen concentrations to receiving water bodies. Stream sampling sites located within the Piscataqua River Watershed (PRW), New Hampshire, USA, were sampled from a range of sites that experienced nitrogen inputs such as sewer and septic systems and suburban runoff. Three mitochondrial (mtDNA) gene marker assays (human, bovine, and canine) were tested from surface water. Nineteen sites were sampled during an 18-month period. Analyses of the combined single and multiplex assay results showed that the proportion of occurrence was highest for bovine (15.6%; n = 77) compared to canine (5.6%; n = 70) and human (5.7%; n = 107) mtDNA gene markers. For the human mtDNA marker, there was a statistically significant relationship between presence vs. absence and land use (Fisher's test p = 0.0031). This result was evident particularly for rural suburban septic, which showed the highest proportion of presence (19.2%) compared to the urban sewered (3.3%), suburban sewered (0%), and agricultural (0%) as well as forested septic (0%) sites. Although further testing across varied land use is needed, our study provides evidence for using the mtDNA marker in large watersheds.

  10. Molecular approaches for forensic cell type identification: On mRNA, miRNA, DNA methylation and microbial markers.

    Science.gov (United States)

    Sijen, Titia

    2015-09-01

    Human biological traces have the potential to present strong evidence for placing a suspect at a crime scene. In cases, the activity that led to deposition of an individual's cellular material is increasingly disputed, for which the identification of cell types could be crucial. This review aims to give an overview of the possibilities of the employment of mRNA, miRNA, DNA methylation and microbial markers for tissue identification in a forensic context. The biological background that renders these markers tissue-specificity is considered, as this can affect data interpretation. Furthermore, the forensic relevance of inferring certain cell types is discussed, as are the various methodologies that can be applied. Forensic stains can carry minute amounts of cell material that may be degraded or polluted and most likely cell material of multiple sources will be present. The interpretational challenges that are imposed by this compromised state will be discussed as well. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Application of molecular markers to find out classificatory ...

    African Journals Online (AJOL)

    The present communication is aimed to find out determinants of molecular marker based classification of rice (Oryza sativa L) germplasm using the available data from an experiment conducted for development of molecular fingerprints of diverse varieties of Basmati and non Basmati rice adapted to irrigated and aerobic ...

  12. DNA: Polymer and molecular code

    Science.gov (United States)

    Shivashankar, G. V.

    1999-10-01

    The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes

  13. Validation of eDNA markers for New Zealand mudsnail surveillance and initial eDNA monitoring at Mississippi River Basin sites

    Science.gov (United States)

    Merkes, Christopher; Turnquist, Keith N.; Rees, Christopher B.; Amberg, Jon J.

    2015-01-01

    The performance of newly developed New Zealand mudsnail (Potamopyrgus antipodarum; NZMS) genetic markers for environmental (eDNA) analysis of water were compared across two laboratories. The genetic markers were tested in four quantitative polymerase chain reaction assays targeting two regions of the NZMS mitochondrial genome, specifically the cytochrome c oxidase subunit 1 (coi) and cytochrome b (cytb) genes. In a blind study, analysts tested each sample eight times with each assay. There were 10 expected-negative samples from the Black River in La Crosse, Wisconsin, 10 expected-positive samples from the Black Earth Creek in Black Earth, Wisconsin, and 10 known-positive samples from the Black River spiked with NZMS DNA. Previously extracted samples, kept at the Upper Midwest Environmental Sciences Center, were pooled by sample location and then equal quantities were distributed between the Upper Midwest Environmental Sciences Center and the Molecular Conservation Genetics Laboratory at the University of Wisconsin-Stevens Point for analysis. The assays tested were (1) the assay targeting cytb with a minor groove binder probe described by Goldberg and others (2013), (2) the cytb assay with a modified double-quenched probe, (3) an assay targeting coi with a double-quenched probe, and (4) a duplex reaction combining the modified cytb assay and the coi assay. Samples were considered positive for the presence of NZMS DNA when quantitative polymerase chain reaction amplification and probe signal was higher than the normalized threshold value above baseline fluorescence. For the duplex assay, samples were considered positive only when both probe signals were higher than the normalized threshold value above baseline fluorescence. Positive results were then confirmed by sequencing the products.

  14. Application of molecular markers in wheat breeding: Reality or delusion?

    Directory of Open Access Journals (Sweden)

    Kobiljski Borislav

    2004-01-01

    Full Text Available Conventional plant breeding use morphological and phenotypic markers for the identification of important agronomic traits. Plant breeders and scientists continuously seek to develop new techniques, which can be used for faster and more accurate introgression of desirable traits into plants. Over the last several years there has been significant increase in the application of molecular markers in the breeding programmes of different species. So far, detected level of polymorphism and informatitivnes of different molecular marker methods applied in MAS (Marker Assisted Selection studies (RFLP, AFLP, etc. were insufficient either to validate their further use or there were very expensive and of huge healthy risk. Fortunately for wheat (and other crops breeders, the new class of molecular markers - microsatellites have prove recently to be most powerful for MAS. But, due to lack of the knowledge, experience, valid informations and even tradition and habits, many breeders have either negative or repulsive attitude towards implementation of MAS in breeding programes. In this paper the relevant facts regarding implementation of MAS in breeding are discussed in general, and for wheat breeding in particular, in order to summarize merits and limitations in application of microsatellites in MAS selection. .

  15. An environmental DNA marker for detecting nonnative brown trout (Salmo trutta)

    Science.gov (United States)

    K. J. Carim; T. M. Wilcox; M. Anderson; D. Lawrence; Michael Young; Kevin McKelvey; Michael Schwartz

    2016-01-01

    Brown trout (Salmo trutta) are widely introduced in western North America where their presence has led to declines of several native species. To assist conservation efforts aimed at early detection and eradication of this species, we developed a quantitative PCR marker to detect the presence of brown trout DNA in environmental samples. The marker strongly...

  16. Development of swine-specific DNA markers for biosensor-based halal authentication.

    Science.gov (United States)

    Ali, M E; Hashim, U; Kashif, M; Mustafa, S; Che Man, Y B; Abd Hamid, S B

    2012-06-29

    The pig (Sus scrofa) mitochondrial genome was targeted to design short (15-30 nucleotides) DNA markers that would be suitable for biosensor-based hybridization detection of target DNA. Short DNA markers are reported to survive harsh conditions in which longer ones are degraded into smaller fragments. The whole swine mitochondrial-genome was in silico digested with AluI restriction enzyme. Among 66 AluI fragments, five were selected as potential markers because of their convenient lengths, high degree of interspecies polymorphism and intraspecies conservatism. These were confirmed by NCBI blast analysis and ClustalW alignment analysis with 11 different meat-providing animal and fish species. Finally, we integrated a tetramethyl rhodamine-labeled 18-nucleotide AluI fragment into a 3-nm diameter citrate-tannate coated gold nanoparticle to develop a swine-specific hybrid nanobioprobe for the determination of pork adulteration in 2.5-h autoclaved pork-beef binary mixtures. This hybrid probe detected as low as 1% pork in deliberately contaminated autoclaved pork-beef binary mixtures and no cross-species detection was recorded, demonstrating the feasibility of this type of probe for biosensor-based detection of pork adulteration of halal and kosher foods.

  17. Temperature effects on multiphase reactions of organic molecular markers: A modeling study

    Science.gov (United States)

    Pratap, Vikram; Chen, Ying; Yao, Guangming; Nakao, Shunsuke

    2018-04-01

    Various molecular markers are used in source apportionment studies. In early studies, molecular markers were assumed to be inert. However, recent studies suggest that molecular markers can decay rapidly through multiphase reactions, which makes interpretation of marker measurements challenging. This study presents a simplified model to account for the effects of temperature and relative humidity on the lifetime of molecular markers through a shift in gas-particle partitioning as well as a change in viscosity of the condensed phase. As a model case, this study examines the stability of levoglucosan, a key marker species of biomass burning, over a wide temperature range relevant to summertime and wintertime. Despite the importance of wood combustion for space heating in winter, the lifetime of levoglucosan in wintertime is not well understood. The model predicts that in low-temperature conditions, levoglucosan predominantly remains in the particle phase, and therefore its loss due to gas-phase oxidation reactions is significantly reduced. Furthermore, the movement of the levoglucosan from the bulk of the particle to the particle surface is reduced due to low diffusivity in the semi-solid state. The simplified model developed in this study reasonably reproduces upper and lower bounds of the lifetime of levoglucosan investigated in previous studies. The model results show that the levoglucosan depletion after seven days reduces significantly from ∼98% at 25 °C to marker (lifetime > 1 week) even at 60% relative humidity irrespective of the assumed fragility parameter D that controls estimated diffusivity. The model shows that lifetime of an organic molecular marker strongly depends on assumed D especially when a semi-volatile marker is in semi-solid organic aerosol.

  18. The chloroplast DNA locus psbZ-trnfM as a potential barcode marker in Phoenix L. (Arecaceae

    Directory of Open Access Journals (Sweden)

    Marco Ballardini

    2013-12-01

    Full Text Available The genus Phoenix (Arecaceae comprises 14 species distributed from Cape Verde Islands to SE Asia. It includes the economically important species Phoenix dactylifera. The paucity of differential morphological and anatomical useful characters, and interspecific hybridization, make identification of Phoenix species difficult. In this context, the development of reliable DNA markers for species and hybrid identification would be of great utility. Previous studies identified a 12 bp polymorphic chloroplast minisatellite in the trnG(GCC-trnfM(CAU spacer, and showed its potential for species identification in Phoenix. In this work, in order to develop an efficient DNA barcode marker for Phoenix, a longer cpDNA region (700 bp comprising the mentioned minisatellite, and located between the psbZ and trnfM(CAU genes, was sequenced. One hundred and thirty-six individuals, representing all Phoenix species except P. andamanensis, were analysed. The minisatellite showed 2-7 repetitions of the 12 bp motif, with 1-3 out of seven haplotypes per species. Phoenix reclinata and P. canariensis had species-specific haplotypes. Additional polymorphisms were found in the flanking regions of the minisatellite, including substitutions, indels and homopolymers. All this information allowed us to identify unambiguously eight out of the 13 species, and overall 80% of the individuals sampled. Phoenix rupicola and P. theophrasti had the same haplotype, and so had P. atlantica, P. dactylifera, and P. sylvestris (the “date palm complex” sensu Pintaud et al. 2013. For these species, additional molecular markers will be required for their unambiguous identification. The psbZ-trnfM(CAU region therefore could be considered as a good basis for the establishment of a DNA barcoding system in Phoenix, and is potentially useful for the identification of the female parent in Phoenix hybrids.

  19. Advance of molecular marker application in the tobacco research

    African Journals Online (AJOL)

    STORAGESEVER

    2008-12-29

    Dec 29, 2008 ... nature, codominant inheritance, easy access, easy and ... available DNA marker types employed in tobacco research, the second .... and organization of mitochondrial and chloroplast genomes ... maternal genome of tobacco.

  20. DNA damage markers in dermal fibroblasts in vitro reflect chronological donor age

    DEFF Research Database (Denmark)

    Waaijer, Mariëtte E C; Croco, Eleonora; Westendorp, Rudi G J

    2016-01-01

    The aging process is accompanied by an accumulation of cellular damage, which compromises the viability and function of cells and tissues. We aim to further explore the association between in vitro DNA damage markers and the chronological age of the donor, as well as long-lived family membership...... markers and long-lived family membership or cardiovascular disease. Results were comparable when fibroblasts were stressed in vitro with rotenone. In conclusion, we found that DNA damage foci of cultured fibroblasts are significantly associated with the chronological age, but not biological age...

  1. Effectiveness of ITS and sub-regions as DNA barcode markers for the identification of Basidiomycota (Fungi).

    Science.gov (United States)

    Badotti, Fernanda; de Oliveira, Francislon Silva; Garcia, Cleverson Fernando; Vaz, Aline Bruna Martins; Fonseca, Paula Luize Camargos; Nahum, Laila Alves; Oliveira, Guilherme; Góes-Neto, Aristóteles

    2017-02-23

    Fungi are among the most abundant and diverse organisms on Earth. However, a substantial amount of the species diversity, relationships, habitats, and life strategies of these microorganisms remain to be discovered and characterized. One important factor hindering progress is the difficulty in correctly identifying fungi. Morphological and molecular characteristics have been applied in such tasks. Later, DNA barcoding has emerged as a new method for the rapid and reliable identification of species. The nrITS region is considered the universal barcode of Fungi, and the ITS1 and ITS2 sub-regions have been applied as metabarcoding markers. In this study, we performed a large-scale analysis of all the available Basidiomycota sequences from GenBank. We carried out a rigorous trimming of the initial dataset based in methodological principals of DNA Barcoding. Two different approaches (PCI and barcode gap) were used to determine the performance of the complete ITS region and sub-regions. For most of the Basidiomycota genera, the three genomic markers performed similarly, i.e., when one was considered a good marker for the identification of a genus, the others were also; the same results were observed when the performance was insufficient. However, based on barcode gap analyses, we identified genomic markers that had a superior identification performance than the others and genomic markers that were not indicated for the identification of some genera. Notably, neither the complete ITS nor the sub-regions were useful in identifying 11 of the 113 Basidiomycota genera. The complex phylogenetic relationships and the presence of cryptic species in some genera are possible explanations of this limitation and are discussed. Knowledge regarding the efficiency and limitations of the barcode markers that are currently used for the identification of organisms is crucial because it benefits research in many areas. Our study provides information that may guide researchers in choosing

  2. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Kárita Cláudia Freitas-Lidani

    2014-07-01

    Full Text Available The aim of the present study was to detect natural infection by Leishmania (Leishmania infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA, the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.

  3. DNA methylome profiling of maternal peripheral blood and placentas reveal potential fetal DNA markers for non-invasive prenatal testing.

    Science.gov (United States)

    Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi

    2014-09-01

    Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  4. Molecular marker to identify radiolarian species -toward establishment of paleo-environmental proxy-

    Science.gov (United States)

    Ishitani, Y.

    2017-12-01

    Marine fossilized unicellular plankton are known to have many genetically divergent species (biological species) in the single morphological species and these biological species show the species-specific environments much more precisely than that of morphological species. Among these plankton, Radiolaria are one of the best candidates for time- and environmental-indicators in the modern and past oceans, because radiolarians are the only group which represent entire water column from shallow to deep waters. However, the ecology and evolution of radiolarian were traditionally studied in paleontology and paleoceanography by morphological species. Even Radiolaria has a huge potential for novel proxy of wide and deep environments, there is no criterion to identify the biological species. The motivation for this study is setting the quantitative delimitation to establish the biological species of radiolarians based on molecular data, for leading the future ecological and paleo-environmental study. Identification of the biological species by ribosomal DNA sequences are mainly based on two ways: one is the evolutionary distance of the small subunit (SSU) rDNA, the internal transcribed spacer region of ribosomal DNA (ITS1 and 2), and the large subunit (LSU) rDNA; and the other is the secondary structure of ITS2. In the present study, all four possible genetic markers (SSU, ITS1, ITS2, and LSU rDNA) were amplified from 232 individuals of five radiolarian morphological species and applied to examine the evolutionary distance and secondary structure of rDNA. Comprehensive survey clearly shows that evolutionary distance of ITS1 rDNA and the secondary structure of ITS2 is good to identify the species. Notably, evolutionary distance of ITS1 rDNA is possible to set the common delimitation to identify the biological species, as 0.225 substitution per site. The results show that the ITS1 and ITS 2 rDNA could be the criterion for radiolarian species identification.

  5. Development of a core set of SSR markers for the characterization of Gossypium germplasm

    Science.gov (United States)

    Molecular markers such as simple sequence repeats (SSR) are a useful tool for characterizing genetic diversity of Gossypium germplasm collections. Genetic profiles by DNA fingerprinting of cotton accessions can only be compared among different collections if a common set of molecular markers are us...

  6. Caracterização molecular de butiazeiro por marcadores RAPD Molecular characterization of Pindo palm by RAPD markers

    Directory of Open Access Journals (Sweden)

    Adrise Medeiros Nunes

    2008-09-01

    Full Text Available O grupo botânico Arecaceae é de extremo interesse por compreender plantas em extinção e por apresentar um grande potencial de exploração econômica. O butiazeiro (Butia capitata (Mart. Becc. ocorre naturalmente no Sul do Brasil. Sua caracterização molecular é de extremo interesse para futuros trabalhos de melhoramento genético. Assim sendo, verificou-se a variabilidade genética existente entre vinte e dois genótipos de butiazeiro da espécie (Butia capitata, pertencentes ao BAG (Banco Ativo de Germoplasma de frutíferas nativas do Centro Agropecuário da Palma - UFPel. Esses genótipos foram analisados usando marcadores do tipo RAPD (Random Amplified Polymorphic DNA. Um total de 136 fragmentos foram obtidos, sendo 77 polimórficos. O primer OPA11 apresentou maior polimorfismo, produzindo 9 perfis diferentes. A análise de agrupamento, realizada pelo método UPGMA, produziu um dendrograma que permitiu a clara separação dos genótipos em dois grupos principais. Verificou-se que, com a técnica de marcadores de RAPD, foi possível obter um perfil molecular único e uma estimativa da variabilidade existente entre os genótipos de butiazeiro avaliados.The study of the botanical group Arecaceae is of extreme interest for evolving several endangered species of plants and for presenting a great potential of economical exploration. The Pindo palm (or wine palm, jelly palm (Butia capitata (Mart. Becc. is natural from the south of Brazil. Its molecular characterization is of extreme interest for future researches of genetic improvement. Since little is known about the variability of the species, the existent genetic variability was verified among twenty-two genotypes of Pindo palm (or wine palm, jelly palm, from BAG (Germoplasm Assets Bank of fruit trees native from the Agricultural Center of the Palma - UFPEL, which were analyzed using markers RAPD (Random Amplified Polymorphic DNA with Operon Technologies' decamers primers. With 21 primers

  7. Molecular markers for genetic diversity and phylogeny research of ...

    African Journals Online (AJOL)

    Brazilian sheep descended from several breeds brought to the New World by Portuguese and Spanish colonists, and they have evolved and adapted to local climatic variations and acquired tolerance or resistance to many diseases. Molecular markers are widely used in analyzing genetic variability, and markers such as ...

  8. Development of genomic SSR and potential EST-SSR markers in ...

    African Journals Online (AJOL)

    In addition, forty four EST-SSRs which can be amplified with expected sizes were identified from a B. chinense root cDNA library. The genomic SSR markers and potential EST-SSR markers developed in the present study should be useful for genetic diversity and molecular marker assistant selection breeding research in ...

  9. Fecal Molecular Markers for Colorectal Cancer Screening

    Directory of Open Access Journals (Sweden)

    Rani Kanthan

    2012-01-01

    Full Text Available Despite multiple screening techniques, including colonoscopy, flexible sigmoidoscopy, radiological imaging, and fecal occult blood testing, colorectal cancer remains a leading cause of death. As these techniques improve, their sensitivity to detect malignant lesions is increasing; however, detection of precursor lesions remains problematic and has generated a lack of general acceptance for their widespread usage. Early detection by an accurate, noninvasive, cost-effective, simple-to-use screening technique is central to decreasing the incidence and mortality of this disease. Recent advances in the development of molecular markers in faecal specimens are encouraging for its use as a screening tool. Genetic mutations and epigenetic alterations that result from the carcinogenetic process can be detected by coprocytobiology in the colonocytes exfoliated from the lesion into the fecal matter. These markers have shown promising sensitivity and specificity in the detection of both malignant and premalignant lesions and are gaining popularity as a noninvasive technique that is representative of the entire colon. In this paper, we summarize the genetic and epigenetic fecal molecular markers that have been identified as potential targets in the screening of colorectal cancer.

  10. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica.

    Science.gov (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong

    2015-01-01

    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the "candidate genes" and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops.

  11. Molecular breeding in Brassica for salt tolerance: importance of microsatellite (SSR) markers for molecular breeding in Brassica

    Science.gov (United States)

    Kumar, Manu; Choi, Ju-Young; Kumari, Nisha; Pareek, Ashwani; Kim, Seong-Ryong

    2015-01-01

    Salinity is one of the important abiotic factors for any crop management in irrigated as well as rainfed areas, which leads to poor harvests. This yield reduction in salt affected soils can be overcome by improving salt tolerance in crops or by soil reclamation. Salty soils can be reclaimed by leaching the salt or by cultivation of salt tolerance crops. Salt tolerance is a quantitative trait controlled by several genes. Poor knowledge about mechanism of its inheritance makes slow progress in its introgression into target crops. Brassica is known to be a good reclamation crop. Inter and intra specific variation within Brassica species shows potential of molecular breeding to raise salinity tolerant genotypes. Among the various molecular markers, SSR markers are getting high attention, since they are randomly sparsed, highly variable and show co-dominant inheritance. Furthermore, as sequencing techniques are improving and softwares to find SSR markers are being developed, SSR markers technology is also evolving rapidly. Comparative SSR marker studies targeting Arabidopsis thaliana and Brassica species which lie in the same family will further aid in studying the salt tolerance related QTLs and subsequent identification of the “candidate genes” and finding out the origin of important QTLs. Although, there are a few reports on molecular breeding for improving salt tolerance using molecular markers in Brassica species, usage of SSR markers has a big potential to improve salt tolerance in Brassica crops. In order to obtain best harvests, role of SSR marker driven breeding approaches play important role and it has been discussed in this review especially for the introgression of salt tolerance traits in crops. PMID:26388887

  12. An annotated genetic map of loblolly pine based on microsatellite and cDNA markers

    Directory of Open Access Journals (Sweden)

    Wimalanathan Kokulapalan

    2011-01-01

    Full Text Available Abstract Background Previous loblolly pine (Pinus taeda L. genetic linkage maps have been based on a variety of DNA polymorphisms, such as AFLPs, RAPDs, RFLPs, and ESTPs, but only a few SSRs (simple sequence repeats, also known as simple tandem repeats or microsatellites, have been mapped in P. taeda. The objective of this study was to integrate a large set of SSR markers from a variety of sources and published cDNA markers into a composite P. taeda genetic map constructed from two reference mapping pedigrees. A dense genetic map that incorporates SSR loci will benefit complete pine genome sequencing, pine population genetics studies, and pine breeding programs. Careful marker annotation using a variety of references further enhances the utility of the integrated SSR map. Results The updated P. taeda genetic map, with an estimated genome coverage of 1,515 cM(Kosambi across 12 linkage groups, incorporated 170 new SSR markers and 290 previously reported SSR, RFLP, and ESTP markers. The average marker interval was 3.1 cM. Of 233 mapped SSR loci, 84 were from cDNA-derived sequences (EST-SSRs and 149 were from non-transcribed genomic sequences (genomic-SSRs. Of all 311 mapped cDNA-derived markers, 77% were associated with NCBI Pta UniGene clusters, 67% with RefSeq proteins, and 62% with functional Gene Ontology (GO terms. Duplicate (i.e., redundant accessory and paralogous markers were tentatively identified by evaluating marker sequences by their UniGene cluster IDs, clone IDs, and relative map positions. The average gene diversity, He, among polymorphic SSR loci, including those that were not mapped, was 0.43 for 94 EST-SSRs and 0.72 for 83 genomic-SSRs. The genetic map can be viewed and queried at http://www.conifergdb.org/pinemap. Conclusions Many polymorphic and genetically mapped SSR markers are now available for use in P. taeda population genetics, studies of adaptive traits, and various germplasm management applications. Annotating mapped

  13. DNA-Enabled Integrated Molecular Systems for Computation and Sensing

    Science.gov (United States)

    2014-05-21

    Computational devices can be chemically conjugated to different strands of DNA that are then self-assembled according to strict Watson − Crick binding rules... DNA -Enabled Integrated Molecular Systems for Computation and Sensing Craig LaBoda,† Heather Duschl,† and Chris L. Dwyer*,†,‡ †Department of...guided folding of DNA , inspired by nature, allows designs to manipulate molecular-scale processes unlike any other material system. Thus, DNA can be

  14. Molecular analysis of expansion, differentiation, and growth factor treatment of human chondrocytes identifies differentiation markers and growth-related genes.

    Science.gov (United States)

    Benz, Karin; Breit, Stephen; Lukoschek, Martin; Mau, Hans; Richter, Wiltrud

    2002-04-26

    This study is intended to optimise expansion and differentiation of cultured human chondrocytes by growth factor application and to identify molecular markers to monitor their differentiation state. We dissected the molecular consequences of matrix release, monolayer, and 3D-alginate culture, growth factor optimised expansion, and re-differentiation protocols by gene expression analysis. Among 19 common cartilage molecules assessed by cDNA array, six proved best to monitor differentiation. Instant down-regulation at release of cells from the matrix was strongest for COL 2A1, fibromodulin, and PRELP while LUM, CHI3L1, and CHI3L2 were expansion-related. Both gene sets reflected the physiologic effects of the most potent growth-inducing (PDGF-BB) and proteoglycan-inducing (BMP-4) factors. Only CRTAC1 expression correlated with 2D/3D switches while the molecular phenotype of native chondrocytes was not restored. The markers and optimised protocols we suggest can help to improve cell therapy of cartilage defects and chondrocyte differentiation from stem cell sources.

  15. Analysis of relationship between tumor markers and quantification of free DNA in serum of lung cancer patients

    International Nuclear Information System (INIS)

    Yang Shunfang; Zhang Peiling; Cao Jie; Zeng Jun; Dong Qianggang

    2006-01-01

    To evaluate the diagnostic value and relationship between five tumor markers (CA19- 9,CA125,CYFRA21-1 ,CEA,NSE) and free DNA in serum for lung cancer detection and try to find a new and more efficient tumor marker, the amounts of CA19-9, CA125, CYFRA21-1, CEA, NSE were determined by RIA and free DNA was determined by the use of quantitative real time PCR amplification of the human epidermal growth factor receptor (EGFR) in 52 lung cancer patients and 8 cases of benign pulmonary disease and 10 healthy controls. The resulls showed that average concentration of free DNA in serum of lung cancer patients, benign pulmo- nary disease and healthy controls was 107.6ng/mL, 76.86ng/mL and 18.8ng/mL, respective- ly. The diagnostic sensitivity, specificity and accuracy of free DNA for lung cancer were 71. 2%, 50% and 68.3%, same as the diagnostic value of combined detection of five tumor markers. The sensitivity, specificity and accuracy of the five tumor markers and free DNA combinend detection for lung cancer were 94.2%, 25% and 85%, respectively. The free DNA in the serum of lung cancer patients may be a new and better tumor marker. (authors)

  16. Molecular Pathogenesis and Diagnostic, Prognostic and Predictive Molecular Markers in Sarcoma.

    Science.gov (United States)

    Mariño-Enríquez, Adrián; Bovée, Judith V M G

    2016-09-01

    Sarcomas are infrequent mesenchymal neoplasms characterized by notable morphological and molecular heterogeneity. Molecular studies in sarcoma provide refinements to morphologic classification, and contribute diagnostic information (frequently), prognostic stratification (rarely) and predict therapeutic response (occasionally). Herein, we summarize the major molecular mechanisms underlying sarcoma pathogenesis and present clinically useful diagnostic, prognostic and predictive molecular markers for sarcoma. Five major molecular alterations are discussed, illustrated with representative sarcoma types, including 1. the presence of chimeric transcription factors, in vascular tumors; 2. abnormal kinase signaling, in gastrointestinal stromal tumor; 3. epigenetic deregulation, in chondrosarcoma, chondroblastoma, and other tumors; 4. deregulated cell survival and proliferation, due to focal copy number alterations, in dedifferentiated liposarcoma; 5. extreme genomic instability, in conventional osteosarcoma as a representative example of sarcomas with highly complex karyotype. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Clinical Relevance of Prognostic and Predictive Molecular Markers in Gliomas.

    Science.gov (United States)

    Siegal, Tali

    2016-01-01

    Sorting and grading of glial tumors by the WHO classification provide clinicians with guidance as to the predicted course of the disease and choice of treatment. Nonetheless, histologically identical tumors may have very different outcome and response to treatment. Molecular markers that carry both diagnostic and prognostic information add useful tools to traditional classification by redefining tumor subtypes within each WHO category. Therefore, molecular markers have become an integral part of tumor assessment in modern neuro-oncology and biomarker status now guides clinical decisions in some subtypes of gliomas. The routine assessment of IDH status improves histological diagnostic accuracy by differentiating diffuse glioma from reactive gliosis. It carries a favorable prognostic implication for all glial tumors and it is predictive for chemotherapeutic response in anaplastic oligodendrogliomas with codeletion of 1p/19q chromosomes. Glial tumors that contain chromosomal codeletion of 1p/19q are defined as tumors of oligodendroglial lineage and have favorable prognosis. MGMT promoter methylation is a favorable prognostic marker in astrocytic high-grade gliomas and it is predictive for chemotherapeutic response in anaplastic gliomas with wild-type IDH1/2 and in glioblastoma of the elderly. The clinical implication of other molecular markers of gliomas like mutations of EGFR and ATRX genes and BRAF fusion or point mutation is highlighted. The potential of molecular biomarker-based classification to guide future therapeutic approach is discussed and accentuated.

  18. Hybrid Origins of Citrus Varieties Inferred from DNA Marker Analysis of Nuclear and Organelle Genomes

    Science.gov (United States)

    Kitajima, Akira; Nonaka, Keisuke; Yoshioka, Terutaka; Ohta, Satoshi; Goto, Shingo; Toyoda, Atsushi; Fujiyama, Asao; Mochizuki, Takako; Nagasaki, Hideki; Kaminuma, Eli; Nakamura, Yasukazu

    2016-01-01

    Most indigenous citrus varieties are assumed to be natural hybrids, but their parentage has so far been determined in only a few cases because of their wide genetic diversity and the low transferability of DNA markers. Here we infer the parentage of indigenous citrus varieties using simple sequence repeat and indel markers developed from various citrus genome sequence resources. Parentage tests with 122 known hybrids using the selected DNA markers certify their transferability among those hybrids. Identity tests confirm that most variant strains are selected mutants, but we find four types of kunenbo (Citrus nobilis) and three types of tachibana (Citrus tachibana) for which we suggest different origins. Structure analysis with DNA markers that are in Hardy–Weinberg equilibrium deduce three basic taxa coinciding with the current understanding of citrus ancestors. Genotyping analysis of 101 indigenous citrus varieties with 123 selected DNA markers infers the parentages of 22 indigenous citrus varieties including Satsuma, Temple, and iyo, and single parents of 45 indigenous citrus varieties, including kunenbo, C. ichangensis, and Ichang lemon by allele-sharing and parentage tests. Genotyping analysis of chloroplast and mitochondrial genomes using 11 DNA markers classifies their cytoplasmic genotypes into 18 categories and deduces the combination of seed and pollen parents. Likelihood ratio analysis verifies the inferred parentages with significant scores. The reconstructed genealogy identifies 12 types of varieties consisting of Kishu, kunenbo, yuzu, koji, sour orange, dancy, kobeni mikan, sweet orange, tachibana, Cleopatra, willowleaf mandarin, and pummelo, which have played pivotal roles in the occurrence of these indigenous varieties. The inferred parentage of the indigenous varieties confirms their hybrid origins, as found by recent studies. PMID:27902727

  19. Circulating, cell-free DNA as a marker for exercise load in intermittent sports.

    Directory of Open Access Journals (Sweden)

    Nils Haller

    Full Text Available Attempts to establish a biomarker reflecting individual player load in intermittent sports such as football have failed so far. Increases in circulating DNA (cfDNA have been demonstrated in various endurance sports settings. While it has been proposed that cfDNA could be a suitable marker for player load in intermittent sports, the effects on cfDNA of repeated sprinting as an essential feature in intermittent sports are unknown. For the first time, we assessed both alterations of cfDNA due to repeated maximal sprints and due to a professional football game.Nine participants were subjected to a standardised sprint training session with cross-over design of five maximal sprints of 40 meters with either "short" (1 minute or "long" pauses (5 minutes. Capillary cfDNA and lactate were measured after every sprint and venous cfDNA before and after each series of sprints. Moreover, capillary cfDNA and lactate values were taken in 23 professional football players before and after incremental exercise testing, during the course of a training week at rest (baseline and in all 17 enrolled players following a season game.Lactate and venous cfDNA increased more pronounced during "short" compared to "long" (1.4-fold, p = 0.032 and 1.7-fold, p = 0.016 and cfDNA correlated significantly with lactate (r = 0.69; p<0.001. Incremental exercise testing increased cfDNA 7.0-fold (p<0.001. The season game increased cfDNA 22.7-fold (p<0.0001, while lactate showed a 2.0-fold (p = 0.09 increase compared to baseline. Fold-changes in cfDNA correlated with distance covered during game (spearman's r = 0.87, p = 0.0012, while no correlation between lactate and the tracking data could be found.We show for the first time that cfDNA could be an objective marker for distance covered in elite intermittent sports. In contrast to the potential of more established blood-based markers like IL-6, CK, or CRP, cfDNA shows by far the strongest fold-change and a high correlation with a

  20. Development of identification process for insect group using radiation marker DNA

    International Nuclear Information System (INIS)

    Muraji, M.; Tamura, T.

    2004-01-01

    Detection of a band pattern for insect groups was tried by using radiation marked DNA clone. A rapid segregation process for poly-type DNA segment was investigated. A band pattern of silkworm was detected by analysis using DNA type transposon, K1.4. The exon regions on genes of hemiptera insect were segregated by in vitro cloning. Band patterns of the silkworm and the other insects were detected by identification process of DNA clone and radiation marker. Family singularity mutation existed in the inserted position of transposon. The family of insect was identified easily by the difference of the detection band patterns. Effective band pattern for family discrimination were obtained by analysis for a part of mitochondria DNA and ribosomal DNA. DNA segregation process was investigated by using the enriched library, also. (M. Suetake)

  1. How to measure separation and angles between inter-molecular fluorescent markers

    DEFF Research Database (Denmark)

    Flyvbjerg, Henrik

    Structure and function of an individual biomolecule can be explored with minimum two fluorescent markers of different colors. Since the light of such markers can be spec- trally separated and imaged simultaneously, the markers can be colocalized. Here, we describe the method used for such two......-color colocalization microscopy. Then we extend it to fluorescent markers with fixed orientations and in intramolecular proximity. Our benchmarking of this extension produced two extra results: (a) we established short double-labeled DNA molecules as probes of 3D orientation of anything to which one can attach them...

  2. DNA Vaccine Electroporation and Molecular Adjuvants

    Science.gov (United States)

    2016-03-16

    Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K

  3. Alterations in mtDNA, gastric carcinogenesis and early diagnosis.

    Science.gov (United States)

    Rodrigues-Antunes, S; Borges, B N

    2018-05-26

    Gastric cancer remains one of the most prevalent cancers in the world. Due to this, efforts are being made to improve the diagnosis of this neoplasm and the search for molecular markers that may be involved in its genesis. Within this perspective, the mitochondrial DNA is considered as a potential candidate, since it has several well documented changes and is readily accessible. However, numerous alterations have been reported in mtDNA, not facilitating the visualization of which alterations and molecular markers are truly involved with gastric carcinogenesis. This review presents a compilation of the main known changes relating mtDNA to gastric cancer and their clinical significance.

  4. Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers

    Directory of Open Access Journals (Sweden)

    MEMEN SURAHMAN

    2010-07-01

    Full Text Available Abbas B, Renwarin Y, Bintoro MH, Sudarsono, Surahman M, Ehara H (2010 Genetic diversity of sago palm in Indonesia based on chloroplast DNA (cpDNA markers. Biodiversitas 11: 112-117. Sago palm (Metroxylon sagu Rottb. was believed capable to accumulate high carbohydrate content in its trunk. The capability of sago palm producing high carbohydrate should be an appropriate criterion for defining alternative crops in anticipating food crisis. The objective of this research was to study genetic diversity of sago palm in Indonesia based on cpDNA markers. Total genome extraction was done following the Qiagen DNA isolation protocols 2003. Single Nucleotide Fragments (SNF analyses were performed by using ABI Prism GeneScanR 3.7. SNF analyses detected polymorphism revealing eleven alleles and ten haplotypes from total 97 individual samples of sago palm. Specific haplotypes were found in the population from Papua, Sulawesi, and Kalimantan. Therefore, the three islands will be considered as origin of sago palm diversities in Indonesia. The highest haplotype numbers and the highest specific haplotypes were found in the population from Papua suggesting this islands as the centre and the origin of sago palm diversities in Indonesia. The research had however no sufficient data yet to conclude the Papua origin of sago palm. Genetic hierarchies and differentiations of sago palm samples were observed significantly different within populations (P=0.04574, among populations (P=0.04772, and among populations within the island (P=0.03366, but among islands no significant differentiations were observed (P= 0.63069.

  5. Molecular DNA identification of medicinal plants used by traditional healers in Malaysia.

    Science.gov (United States)

    Aziz, N A A; Ahmad, M I; Naim, D M

    2015-12-07

    Plants have been used throughout human history for food and medicine. However, many plants are toxic, and cannot easily be morphologically distinguished from non-toxic plants. DNA identification solves this problem and is widely used. Nonetheless, plant DNA barcode identification faces a number of challenges, and many studies have been conducted to find suitable barcodes. The present study was conducted to test the efficiency of commonly used primers, namely ITS2, rpoC1, and trnH-psbA, in order to find the best DNA barcode markers for the identification of medicinal plants in Malaysia. Fresh leaves from 12 medicinal plants that are commonly used by Malay traditional healers were collected from the Tropical Spice Garden, Pulau Pinang, and subjected to polymerase chain reaction amplification using ITS2, rpoC1, and trnH-psbA DNA markers. We found that trnH-psbA is the best DNA marker for the species-level identification of medicinal plants in Malaysia.

  6. Molecular marker screening of peanut ( Arachis hypogaea L ...

    African Journals Online (AJOL)

    Molecular marker screening of peanut (Arachis hypogaea L.) germplasm for Meloidogyne arenaria resistance. V Carpentieri-Pipolo, M Gallo-Meagher, DW Dickson, DW Gorbet, M de Lurdes Mendes, SG Hulse de Souza ...

  7. Genetic molecular analysis of Coffea arabica (Rubiaceae hybrids using SRAP markers

    Directory of Open Access Journals (Sweden)

    Manoj Kumar Mishra

    2011-06-01

    Full Text Available In Coffea arabica (arabica coffee, the phenotypic as well as genetic variability has been found low because of the narrow genetic basis and self fertile nature of the species. Because of high similarity in phenotypic appearance among the majority of arabica collections, selection of parental lines for inter-varietals hybridization and identification of resultant hybrids at an early stage of plant growth is difficult. DNA markers are known to be reliable in identifying closely related cultivars and hybrids. Sequence Related Amplified Polymorphism (SRAP is a new molecular marker technology developed based on PCR. In this paper, sixty arabica-hybrid progenies belonging to six crosses were analyzed using 31 highly polymorphic SRAP markers. The analysis revealed seven types of SRAP marker profiles which are useful in discriminating the parents and hybrids. The number of bands amplified per primer pair ranges from 6.13 to 8.58 with average number of seven bands. Among six hybrid combinations, percentage of bands shared between hybrids and their parents ranged from 66.29% to 85.71% with polymorphic bands varied from 27.64% to 60.0%. Percentage of hybrid specific fragments obtained in various hybrid combinations ranged from 0.71% to 10.86% and ascribed to the consequence of meiotic recombination. Based on the similarity index calculation, it was observed that F1 hybrids share maximum number of bands with the female parent compared to male parent. The results obtained in the present study revealed the effectiveness of SRAP technique in cultivar identification and hybrid analysis in this coffee species. Rev. Biol. Trop. 59 (2: 607-617. Epub 2011 June 01.

  8. Nanomechanical molecular devices made of DNA origami.

    Science.gov (United States)

    Kuzuya, Akinori; Ohya, Yuichi

    2014-06-17

    CONSPECTUS: Eight years have passed since the striking debut of the DNA origami technique ( Rothemund, P. W. K. Nature 2006 , 440 , 297 - 302 ), in which long single-stranded DNA is folded into a designed nanostructure, in either 2D or 3D, with the aid of many short staple strands. The number of proposals for new design principles for DNA origami structures seems to have already reached a peak. It is apparent that DNA origami study is now entering the second phase of creating practical applications. The development of functional nanomechanical molecular devices using the DNA origami technique is one such application attracting significant interest from researchers in the field. Nanomechanical DNA origami devices, which maintain the characteristics of DNA origami structures, have various advantages over conventional DNA nanomachines. Comparatively high assembly yield, relatively large size visible via atomic force microscopy (AFM) or transmission electron microscopy (TEM), and the capability to assemble multiple functional groups with precision using multiple staple strands are some of the advantages of the DNA origami technique for constructing sophisticated molecular devices. This Account describes the recent developments of such nanomechanical DNA origami devices and reviews the emerging target of DNA origami studies. First, simple "dynamic" DNA origami structures with transformation capability, such as DNA origami boxes and a DNA origami hatch with structure control, are briefly summarized. More elaborate nanomechanical DNA origami devices are then reviewed. The first example describes DNA origami pinching devices that can be used as "single-molecule" beacons to detect a variety of biorelated molecules, from metal ions at the size of a few tens of atomic mass number units to relatively gigantic proteins with a molecular mass greater than a hundred kilodaltons, all on a single platform. Clamshell-like DNA nanorobots equipped with logic gates can discriminate

  9. Identification of Amazonian trees with DNA barcodes.

    Science.gov (United States)

    Gonzalez, Mailyn Adriana; Baraloto, Christopher; Engel, Julien; Mori, Scott A; Pétronelli, Pascal; Riéra, Bernard; Roger, Aurélien; Thébaud, Christophe; Chave, Jérôme

    2009-10-16

    Large-scale plant diversity inventories are critical to develop informed conservation strategies. However, the workload required for classic taxonomic surveys remains high and is particularly problematic for megadiverse tropical forests. Based on a comprehensive census of all trees in two hectares of a tropical forest in French Guiana, we examined whether plant DNA barcoding could contribute to increasing the quality and the pace of tropical plant biodiversity surveys. Of the eight plant DNA markers we tested (rbcLa, rpoC1, rpoB, matK, ycf5, trnL, psbA-trnH, ITS), matK and ITS had a low rate of sequencing success. More critically, none of the plastid markers achieved a rate of correct plant identification greater than 70%, either alone or combined. The performance of all barcoding markers was noticeably low in few species-rich clades, such as the Laureae, and the Sapotaceae. A field test of the approach enabled us to detect 130 molecular operational taxonomic units in a sample of 252 juvenile trees. Including molecular markers increased the identification rate of juveniles from 72% (morphology alone) to 96% (morphology and molecular) of the individuals assigned to a known tree taxon. We conclude that while DNA barcoding is an invaluable tool for detecting errors in identifications and for identifying plants at juvenile stages, its limited ability to identify collections will constrain the practical implementation of DNA-based tropical plant biodiversity programs.

  10. Characterization of Haemaphysalis flava (Acari: Ixodidae from Qingling subspecies of giant panda (Ailuropoda melanoleuca qinlingensis in Qinling Mountains (Central China by morphology and molecular markers.

    Directory of Open Access Journals (Sweden)

    Wen-yu Cheng

    Full Text Available Tick is one of important ectoparasites capable of causing direct damage to their hosts and also acts as vectors of relevant infectious agents. In the present study, the taxa of 10 ticks, collected from Qinling giant pandas (Ailuropoda melanoleuca qinlingensis in Qinling Mountains of China in April 2010, were determined using morphology and molecular markers (nucleotide ITS2 rDNA and mitochondrial 16S. Microscopic observation demonstrated that the morphological features of these ticks were similar to Haemaphysalis flava. Compared with other Haemaphysalis species, genetic variations between Haemaphysalis collected from A. m. qinlingensis and H. flava were the lowest in ITS2 rDNA and mitochondrial 16S, with sequence differences of 2.06%-2.40% and 1.30%-4.70%, respectively. Phylogenetic relationships showed that all the Haemaphysalis collected from A. m. qinlingensis were grouped with H. flava, further confirmed that the Haemaphysalis sp. is H. flava. This is the first report of ticks in giant panda by combining with morphology and molecular markers. This study also provided evidence that combining morphology and molecular tools provide a valuable and efficient tool for tick identification.

  11. Nuclear internal transcribed spacer-1 as a sensitive genetic marker for environmental DNA studies in common carp Cyprinus carpio.

    Science.gov (United States)

    Minamoto, Toshifumi; Uchii, Kimiko; Takahara, Teruhiko; Kitayoshi, Takumi; Tsuji, Satsuki; Yamanaka, Hiroki; Doi, Hideyuki

    2017-03-01

    The recently developed environmental DNA (eDNA) analysis has been used to estimate the distribution of aquatic vertebrates by using mitochondrial DNA (mtDNA) as a genetic marker. However, mtDNA markers have certain drawbacks such as variable copy number and maternal inheritance. In this study, we investigated the potential of using nuclear DNA (ncDNA) as a more reliable genetic marker for eDNA analysis by using common carp (Cyprinus carpio). We measured the copy numbers of cytochrome b (CytB) gene region of mtDNA and internal transcribed spacer 1 (ITS1) region of ribosomal DNA of ncDNA in various carp tissues and then compared the detectability of these markers in eDNA samples. In the DNA extracted from the brain and gill tissues and intestinal contents, CytB was detected at 95.1 ± 10.7 (mean ± 1 standard error), 29.7 ± 1.59 and 24.0 ± 4.33 copies per cell, respectively, and ITS1 was detected at 1760 ± 343, 2880 ± 503 and 1910 ± 352 copies per cell, respectively. In the eDNA samples from mesocosm, pond and lake water, the copy numbers of ITS1 were about 160, 300 and 150 times higher than those of CytB, respectively. The minimum volume of pond water required for quantification was 33 and 100 mL for ITS1 and CytB, respectively. These results suggested that ITS1 is a more sensitive genetic marker for eDNA studies of C. carpio. © 2016 John Wiley & Sons Ltd.

  12. Molecular pathology in adult gliomas: diagnostic, prognostic, and predictive markers.

    LENUS (Irish Health Repository)

    Jansen, Michael

    2010-07-01

    Over the past 10 years, there has been an increasing use of molecular markers in the assessment and management of adult malignant gliomas. Some molecular signatures are used diagnostically to help pathologists classify tumours, whereas others are used to estimate prognosis for patients. Most crucial, however, are those markers that are used to predict response to certain therapies, thereby directing clinicians to a particular treatment while avoiding other potentially deleterious therapies. Recently, large-scale genome-wide surveys have been used to identify new biomarkers that have been rapidly developed as diagnostic and prognostic tools. Given these developments, the pace of discovery of new molecular assays will quicken to facilitate personalised medicine in the setting of malignant glioma.

  13. DNA marker mining of ILSTS035 microsatellite locus on ...

    Indian Academy of Sciences (India)

    Unknown

    We describe tests for detecting and locating quantitative trait loci (QTL) for traits in Hanwoo cattle. From results of a permutation test to detect QTL for marbling, we selected the microsatellite locus ILSTS035 on chromosome 6 for further analysis. K-means clustering analysis applied to five traits and nine DNA markers in ...

  14. From traditional biochemical signals to molecular markers for detection of sepsis after burn injuries.

    Science.gov (United States)

    Muñoz, Balam; Suárez-Sánchez, Rocío; Hernández-Hernández, Oscar; Franco-Cendejas, Rafael; Cortés, Hernán; Magaña, Jonathan J

    2018-05-22

    Sepsis is a life-threatening organ-dysfunction condition caused by a dysregulated response to an infectious condition that can cause complications in patients with major trauma. Burns are one of the most destructive forms of trauma; despite the improvements in medical care, infections remain an important cause of burn injury-related mortality and morbidity, and complicated sepsis predisposes patients to diverse complications such as organ failure, lengthening of hospital stays, and increased costs. Accurate diagnosis and early treatment of sepsis may have a beneficial impact on clinical outcome of burn-injured patients. In this review, we offer a comprehensive description of the current and traditional markers used as indicative of sepsis in burned patients. However, although these are markers of the inflammatory post-burn response, they usually fail to predict sepsis in severely burned patients due to that they do not reflect the severity of the infection. Identification and measurement of biomarkers in early stages of infection is important in order to provide timely response and effective treatment of burned patients. Therefore, we compiled important experimental evidence, demonstrating novel biomarkers, including molecular markers such as genomic DNA variations, alterations of transcriptome profiling (mRNA, miRNAs, lncRNAs and circRNAs), epigenetic markers, and advances in proteomics and metabolomics. Finally, this review summarizes next-generation technologies for the identification of markers for detection of sepsis after burn injuries. Copyright © 2018 Elsevier Ltd and ISBI. All rights reserved.

  15. Assessment of genome origins and genetic diversity in the genus Eleusine with DNA markers.

    Science.gov (United States)

    Salimath, S S; de Oliveira, A C; Godwin, I D; Bennetzen, J L

    1995-08-01

    Finger millet (Eleusine coracana), an allotetraploid cereal, is widely cultivated in the arid and semiarid regions of the world. Three DNA marker techniques, restriction fragment length polymorphism (RFLP), randomly amplified polymorphic DNA (RAPD), and inter simple sequence repeat amplification (ISSR), were employed to analyze 22 accessions belonging to 5 species of Eleusine. An 8 probe--3 enzyme RFLP combination, 18 RAPD primers, and 6 ISSR primers, respectively, revealed 14, 10, and 26% polymorphism in 17 accessions of E. coracana from Africa and Asia. These results indicated a very low level of DNA sequence variability in the finger millets but did allow each line to be distinguished. The different Eleusine species could be easily identified by DNA marker technology and the 16% intraspecific polymorphism exhibited by the two analyzed accessions of E. floccifolia suggested a much higher level of diversity in this species than in E. coracana. Between species, E. coracana and E. indica shared the most markers, while E. indica and E. tristachya shared a considerable number of markers, indicating that these three species form a close genetic assemblage within the Eleusine. Eleusine floccifolia and E. compressa were found to be the most divergent among the species examined. Comparison of RFLP, RAPD, and ISSR technologies, in terms of the quantity and quality of data output, indicated that ISSRs are particularly promising for the analysis of plant genome diversity.

  16. Genetic diversity analyses of Lasiodiplodia theobromae on Morus alba and Agave sisalana based on RAPD and ISSR molecular markers

    Directory of Open Access Journals (Sweden)

    Hong-hui Xie

    2016-10-01

    Full Text Available Genetic diversity of 23 Lasiodiplodia theobromae isolates on Morus alba and 6 isolates on Agave sisalana in Guangxi province, China, was studied by using random amplified polymorphic DNA and inter-simple sequence repeat molecular markers. Results of two molecular markers showed that the average percentage of polymorphic loci of all isolates was more than 93%. Both dendrograms of two molecular markers showed obvious relationship between groups and the geographical locations where those strains were collected, among which, the 23 isolates on M. alba were divided into 4 populations and the 6 isolates on A. sisalana were separated as a independent population. The average genetic identity and genetic distance of 5 populations were 0.7215, 0.3284 and 0.7915, 0.2347, respectively, which indicated that the genetic identity was high and the genetic distance was short in the 5 populations. Average value of the gene diversity index (H and the Shannon’s information index (I of 29 isolates were significantly higher than 5 populations which showed that genetic diversity of those isolates was richer than the populations and the degree of genetic differentiation of the isolates was higher. The Gst and Nm of 29 isolates were 0.4411, 0.6335 and 0.4756, 0.5513, respectively, which showed that the genetic diversity was rich in those isolates.

  17. Molecular marker-assisted selection for resistance to pathogens in tomato

    International Nuclear Information System (INIS)

    Barone, A.; Frusciante, L.

    2007-01-01

    Since the 1980s, the use of molecular markers has been suggested to improve the efficiency of releasing resistant varieties, thus overcoming difficulties met with classical breeding. For tomato, a high-density molecular map is available in which more than 40 resistance genes are localized. Markers linked to these genes can be used to speed up gene transfer and pyramiding. Suitable PCR markers targeting resistance genes were constructed directly on the sequences of resistance genes or on restriction fragment length polymorphisms (RFLPs) tightly linked to them, and used to select resistant genotypes in backcross schemes. In some cases, the BC 5 generation was reached, and genotypes that cumulated two homozygous resistant genes were also obtained. These results supported the feasibility of using marker-assisted selection (MAS) in tomato and reinforcing the potential of this approach for other genes, which is today also driven by the development of new techniques and increasing knowledge about the tomato genome. (author)

  18. Classification of plant associated bacteria using RIF, a computationally derived DNA marker.

    Directory of Open Access Journals (Sweden)

    Kevin L Schneider

    Full Text Available A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF. Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS. Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF

  19. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  20. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  1. Circulating, cell-free DNA as a marker for exercise load in intermittent sports

    OpenAIRE

    Haller, Nils; Helmig, Susanne; Taenny, Pascal; Petry, Julian; Schmidt, Sebastian; Simon, Perikles

    2018-01-01

    Background Attempts to establish a biomarker reflecting individual player load in intermittent sports such as football have failed so far. Increases in circulating DNA (cfDNA) have been demonstrated in various endurance sports settings. While it has been proposed that cfDNA could be a suitable marker for player load in intermittent sports, the effects on cfDNA of repeated sprinting as an essential feature in intermittent sports are unknown. For the first time, we assessed both alterations of ...

  2. Molecular markers unravel intraspecific and interspecific genetic ...

    Indian Academy of Sciences (India)

    [Kotwal S., Dhar M. K., Kour B., Raj K. and Kaul S. 2013 Molecular markers unravel intraspecific and interspecific genetic variability in ... of bowel problems including chronic constipation, amoebic ..... while to select parents from accessions, Pov80 and Pov79 ... nology (DBT), Govt. of India, for financial assistance in the form.

  3. A combination of molecular markers and clinical features improve the classification of pancreatic cysts.

    Science.gov (United States)

    Springer, Simeon; Wang, Yuxuan; Dal Molin, Marco; Masica, David L; Jiao, Yuchen; Kinde, Isaac; Blackford, Amanda; Raman, Siva P; Wolfgang, Christopher L; Tomita, Tyler; Niknafs, Noushin; Douville, Christopher; Ptak, Janine; Dobbyn, Lisa; Allen, Peter J; Klimstra, David S; Schattner, Mark A; Schmidt, C Max; Yip-Schneider, Michele; Cummings, Oscar W; Brand, Randall E; Zeh, Herbert J; Singhi, Aatur D; Scarpa, Aldo; Salvia, Roberto; Malleo, Giuseppe; Zamboni, Giuseppe; Falconi, Massimo; Jang, Jin-Young; Kim, Sun-Whe; Kwon, Wooil; Hong, Seung-Mo; Song, Ki-Byung; Kim, Song Cheol; Swan, Niall; Murphy, Jean; Geoghegan, Justin; Brugge, William; Fernandez-Del Castillo, Carlos; Mino-Kenudson, Mari; Schulick, Richard; Edil, Barish H; Adsay, Volkan; Paulino, Jorge; van Hooft, Jeanin; Yachida, Shinichi; Nara, Satoshi; Hiraoka, Nobuyoshi; Yamao, Kenji; Hijioka, Susuma; van der Merwe, Schalk; Goggins, Michael; Canto, Marcia Irene; Ahuja, Nita; Hirose, Kenzo; Makary, Martin; Weiss, Matthew J; Cameron, John; Pittman, Meredith; Eshleman, James R; Diaz, Luis A; Papadopoulos, Nickolas; Kinzler, Kenneth W; Karchin, Rachel; Hruban, Ralph H; Vogelstein, Bert; Lennon, Anne Marie

    2015-11-01

    The management of pancreatic cysts poses challenges to both patients and their physicians. We investigated whether a combination of molecular markers and clinical information could improve the classification of pancreatic cysts and management of patients. We performed a multi-center, retrospective study of 130 patients with resected pancreatic cystic neoplasms (12 serous cystadenomas, 10 solid pseudopapillary neoplasms, 12 mucinous cystic neoplasms, and 96 intraductal papillary mucinous neoplasms). Cyst fluid was analyzed to identify subtle mutations in genes known to be mutated in pancreatic cysts (BRAF, CDKN2A, CTNNB1, GNAS, KRAS, NRAS, PIK3CA, RNF43, SMAD4, TP53, and VHL); to identify loss of heterozygozity at CDKN2A, RNF43, SMAD4, TP53, and VHL tumor suppressor loci; and to identify aneuploidy. The analyses were performed using specialized technologies for implementing and interpreting massively parallel sequencing data acquisition. An algorithm was used to select markers that could classify cyst type and grade. The accuracy of the molecular markers was compared with that of clinical markers and a combination of molecular and clinical markers. We identified molecular markers and clinical features that classified cyst type with 90%-100% sensitivity and 92%-98% specificity. The molecular marker panel correctly identified 67 of the 74 patients who did not require surgery and could, therefore, reduce the number of unnecessary operations by 91%. We identified a panel of molecular markers and clinical features that show promise for the accurate classification of cystic neoplasms of the pancreas and identification of cysts that require surgery. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

  4. Reviewing and Updating the Major Molecular Markers for Stem Cells

    Science.gov (United States)

    Calloni, Raquel; Cordero, Elvira Alicia Aparicio; Henriques, João Antonio Pêgas

    2013-01-01

    Stem cells (SC) are able to self-renew and to differentiate into many types of committed cells, making SCs interesting for cellular therapy. However, the pool of SCs in vivo and in vitro consists of a mix of cells at several stages of differentiation, making it difficult to obtain a homogeneous population of SCs for research. Therefore, it is important to isolate and characterize unambiguous molecular markers that can be applied to SCs. Here, we review classical and new candidate molecular markers that have been established to show a molecular profile for human embryonic stem cells (hESCs), mesenchymal stem cells (MSCs), and hematopoietic stem cells (HSCs). The commonly cited markers for embryonic ESCs are Nanog, Oct-4, Sox-2, Rex-1, Dnmt3b, Lin-28, Tdgf1, FoxD3, Tert, Utf-1, Gal, Cx43, Gdf3, Gtcm1, Terf1, Terf2, Lefty A, and Lefty B. MSCs are primarily identified by the expression of CD13, CD29, CD44, CD49e, CD54, CD71, CD73, CD90, CD105, CD106, CD166, and HLA-ABC and lack CD14, CD31, CD34, CD45, CD62E, CD62L, CD62P, and HLA-DR expression. HSCs are mainly isolated based on the expression of CD34, but the combination of this marker with CD133 and CD90, together with a lack of CD38 and other lineage markers, provides the most homogeneous pool of SCs. Here, we present new and alternative markers for SCs, along with microRNA profiles, for these cells. PMID:23336433

  5. Genetic studies and a search for molecular markers that are linked ...

    African Journals Online (AJOL)

    SERVER

    Instead, linkage analysis resulted in the construction of a molecular marker linkage map consisting of 45 ..... This limits the application of this marker type, particularly in ... primer design when one uses RAPDs. .... Concepts of Genetics. Fourth.

  6. Transcriptome survey of Patagonian southern beech Nothofagus nervosa (= N. Alpina: assembly, annotation and molecular marker discovery

    Directory of Open Access Journals (Sweden)

    Torales Susana L

    2012-07-01

    Full Text Available Abstract Background Nothofagus nervosa is one of the most emblematic native tree species of Patagonian temperate forests. Here, the shotgun RNA-sequencing (RNA-Seq of the transcriptome of N. nervosa, including de novo assembly, functional annotation, and in silico discovery of potential molecular markers to support population and associations genetic studies, are described. Results Pyrosequencing of a young leaf cDNA library generated a total of 111,814 high quality reads, with an average length of 447 bp. De novo assembly using Newbler resulted into 3,005 tentative isotigs (including alternative transcripts. The non-assembled sequences (singletons were clustered with CD-HIT-454 to identify natural and artificial duplicates from pyrosequencing reads, leading to 21,881 unique singletons. 15,497 out of 24,886 non-redundant sequences or unigenes, were successfully annotated against a plant protein database. A substantial number of simple sequence repeat markers (SSRs were discovered in the assembled and annotated sequences. More than 40% of the SSR sequences were inside ORF sequences. To confirm the validity of these predicted markers, a subset of 73 SSRs selected through functional annotation evidences were successfully amplified from six seedlings DNA samples, being 14 polymorphic. Conclusions This paper is the first report that shows a highly precise representation of the mRNAs diversity present in young leaves of a native South American tree, N. nervosa, as well as its in silico deduced putative functionality. The reported Nothofagus transcriptome sequences represent a unique resource for genetic studies and provide a tool to discover genes of interest and genetic markers that will greatly aid questions involving evolution, ecology, and conservation using genetic and genomic approaches in the genus.

  7. DNA markers for forensic identification of non-human biological traces

    NARCIS (Netherlands)

    Wesselink, M.

    2018-01-01

    In this thesis, DNA markers are described that enable forensically relevant classification of three groups of non-human biological traces: fungi (Chapter 1), domestic cats (Chapters 2, 3 an d 4) and birch trees (Chapters 5 and 6). Because the forensic questions associated with these traces require

  8. ROLE OF MOLECULAR MARKERS IN THYROID NODULE MANAGEMENT: THEN AND NOW.

    Science.gov (United States)

    Nikiforov, Yuri E

    2017-08-01

    To describe the evolution and clinical utility of molecular testing for thyroid nodules and cancer achieved over the last 2 decades. Scientific reports on thyroid cancer genetics and molecular diagnostics in thyroid nodules. Over the last 2 decades, our understanding of the genetic mechanisms of thyroid cancer has dramatically expanded, such that most thyroid cancers now have known gene driver events. This knowledge provides the basis for establishing and further improving molecular tests for thyroid nodules and cancer and for the introduction of new entities such as noninvasive follicular thyroid neoplasm with papillary-like nuclear features. The progress with molecular tests for thyroid nodules started in the 1990s from demonstrating feasibility of detecting various molecular alterations in fine-needle aspiration (FNA) material collected from thyroid nodules. It was followed by the introduction of the first single-gene mutational markers, such as BRAF, and a small mutational panel into clinical practice in the mid 2000s. Currently, several more advanced molecular tests are available for clinical use. They are based on multiple molecular markers and have increasing impact on the clinical management of patients with thyroid nodules. The evolution of molecular tests for thyroid nodules followed the discovery of various diagnostic and prognostic molecular markers of thyroid cancer that can be applied to thyroid FNA samples to inform more individualized management of these patients. FNA = fine-needle aspiration miRNA = micro RNA NGS = next-generation sequencing NIFTP = noninvasive follicular thyroid neoplasm with papillary-like nuclear features NPV = negative predictive value PPV = positive predictive value PTC = papillary thyroid carcinoma RAI = radioactive iodine.

  9. Recent advances in yeast molecular biology: recombinant DNA

    International Nuclear Information System (INIS)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis

  10. Molecular markers of resistance to amodiaquine plus sulfadoxine-pyrimethamine in an area with seasonal malaria chemoprevention in south central Niger.

    Science.gov (United States)

    Grais, Rebecca F; Laminou, Ibrahim M; Woi-Messe, Lynda; Makarimi, Rockyath; Bouriema, Seidou H; Langendorf, Celine; Amambua-Ngwa, Alfred; D'Alessandro, Umberto; Guérin, Philippe J; Fandeur, Thierry; Sibley, Carol H

    2018-02-27

    In Niger, malaria transmission is markedly seasonal with most of the disease burden occurring in children during the rainy season. Seasonal malaria chemoprevention (SMC) with amodiaquine plus sulfadoxine-pyrimethamine (AQ + SP) is recommended in the country to be administered monthly just before and during the rainy season. Moreover, clinical decisions on use of SP for intermittent preventive treatment in pregnancy (IPTp) now depend upon the validated molecular markers for SP resistance in Plasmodium falciparum observed in the local parasite population. However, little is known about molecular markers of resistance for either SP or AQ in the south of Niger. To address this question, clinical samples which met clinical and biological criteria, were collected in Gabi, Madarounfa district, Maradi region, Niger in 2011-2012 (before SMC implementation). Molecular markers of resistance to pyrimethamine (pfdhfr), sulfadoxine (pfdhps) and amodiaquine (pfmdr1) were assessed by DNA sequencing. Prior to SMC implementation, the samples showed a high proportion of clinical samples that carried the pfdhfr 51I/59R/108N haplotype associated with resistance to pyrimethamine and pfdhps 436A/F/H and 437G mutations associated with reduced susceptibility to sulfadoxine. In contrast mutations in codons 581G, and 613S in the pfdhps gene, and in pfmdr1, 86Y, 184Y, 1042D and 1246Y associated with resistance to amodiaquine, were less frequently observed. Importantly, pfdhfr I164L and pfdhps K540E mutations shown to be the most clinically relevant markers for high level clinical resistance to SP were not detected in Gabi. Although parasites with genotypes associated with the highest levels of resistance to AQ + SP are not yet common in this setting, their importance for deployment of SMC and IPTp dictates that monitoring of these markers of resistance should accompany these interventions. This study also highlights the parasite heterogeneity within a small spatial area and the need to

  11. Circulating, cell-free DNA as a marker for exercise load in intermittent sports.

    Science.gov (United States)

    Haller, Nils; Helmig, Susanne; Taenny, Pascal; Petry, Julian; Schmidt, Sebastian; Simon, Perikles

    2018-01-01

    Attempts to establish a biomarker reflecting individual player load in intermittent sports such as football have failed so far. Increases in circulating DNA (cfDNA) have been demonstrated in various endurance sports settings. While it has been proposed that cfDNA could be a suitable marker for player load in intermittent sports, the effects on cfDNA of repeated sprinting as an essential feature in intermittent sports are unknown. For the first time, we assessed both alterations of cfDNA due to repeated maximal sprints and due to a professional football game. Nine participants were subjected to a standardised sprint training session with cross-over design of five maximal sprints of 40 meters with either "short" (1 minute) or "long" pauses (5 minutes). Capillary cfDNA and lactate were measured after every sprint and venous cfDNA before and after each series of sprints. Moreover, capillary cfDNA and lactate values were taken in 23 professional football players before and after incremental exercise testing, during the course of a training week at rest (baseline) and in all 17 enrolled players following a season game. Lactate and venous cfDNA increased more pronounced during "short" compared to "long" (1.4-fold, p = 0.032 and 1.7-fold, p = 0.016) and cfDNA correlated significantly with lactate (r = 0.69; psports. In contrast to the potential of more established blood-based markers like IL-6, CK, or CRP, cfDNA shows by far the strongest fold-change and a high correlation with a particular load related aspect in professional football.

  12. Genetic similarity among strawberry cultivars assessed by RAPD and ISSR markers

    Directory of Open Access Journals (Sweden)

    Rafael Gustavo Ferreira Morales

    2011-12-01

    Full Text Available Most strawberry (Fragaria × ananassa Duchesne cultivars used in Brazil are developed in other countries, it became clear the need to start the strawberry breeding program in the country. To start a breeding program is necessary the genetic characterization of the germplasm available. Molecular markers are important tools that can be used for this purpose. The objectives of the present study were to assess the genetic similarity among 11 strawberry cultivars using RAPD and ISSR molecular markers and to indicate the possible promising crosses. The DNA of the eleven strawberry cultivars was extracted and amplified by PCR with RAPD and ISSR primers. The DNA fragments were separated in agarose gel for the RAPD markers and in polyacrylamide gel for the ISSR markers. The genetic similarity matrix was estimated by the Jaccard coefficient. Based on this matrix, the cultivars were grouped using the UPGMA method. The dendogram generated by the RAPD markers distributed the cultivars in three groups while the ISSR markers generated two groups. There was no direct relationship between the marker groups when the two types of markers were compared. The grouping proposed by the ISSR markers was more coherent with the origin and the genealogy of the cultivars than that proposed by the RAPD markers, and it can be considered the most efficient method for the study of genetic divergence in strawberry. The most promising crosses, based on the genetic divergence estimated from the RAPD and ISSR molecular data were between the Tudla and Ventana and the Oso Grande and Ventana cultivars, respectively.

  13. Molecular DNA Analysis in Forensic Identification.

    Science.gov (United States)

    Dumache, Raluca; Ciocan, Veronica; Muresan, Camelia; Enache, Alexandra

    2016-01-01

    Serological and biochemical identification methods used in forensics have several major disadvantages, such as: long time in processing biological sample and lack of sensitivity and specificity. In the last 30 years, DNA molecular analysis has become an important tool in forensic investigations. DNA profiling is based on the short tandem repeats (STR) and aids in human identification from biological samples. Forensic genetics, can provide information on the events which occurred at the crime scene or to supplement other methods of forensic identification. Currently, the methods used in identification are based on polymerase chain reaction (PCR) analyses. This method analyses the autosomal STRs, the Y-chromosome, and the mitochondrial DNA. Correlation of biological samples present at the crime scene with identification, selection, and the probative value factor is therefore the first aspect to be taken into consideration in the forensic genetic analysis. In the last decade, because of the advances in the field of molecular biology, new biomarkers such as: microRNAs (miR), messenger RNA (mRNA), and DNA methylation have been studied and proposed to be used in the forensic identifications of body fluids.

  14. Differential utility of the Bacteroidales DNA and RNA markers in the tiered approach for microbial source tracking in subtropical seawater.

    Science.gov (United States)

    Liu, Rulong; Cheng, Ken H F; Wong, Klaine; Cheng, Samuel C S; Lau, Stanley C K

    2015-07-01

    Source tracking of fecal pollution is an emerging component in water quality monitoring. It may be implemented in a tiered approach involving Escherichia coli and/or Enterococcus spp. as the standard fecal indicator bacteria (FIB) and the 16S rRNA gene markers of Bacteroidales as source identifiers. The relative population dynamics of the source identifiers and the FIB may strongly influence the implementation of such approach. Currently, the relative performance of DNA and RNA as detection targets of Bacteroidales markers in the tiered approach is not known. We compared the decay of the DNA and RNA of the total (AllBac) and ruminant specific (CF128) Bacteroidales markers with those of the FIB in seawater spiked with cattle feces. Four treatments of light and oxygen availability simulating the subtropical seawater of Hong Kong were tested. All Bacteroidales markers decayed significantly slower than the FIB in all treatments. Nonetheless, the concentrations of the DNA and RNA markers and E. coli correlated significantly in normoxic seawater independent of light availability, and in hypoxic seawater only under light. In hypoxic seawater without light, the concentrations of RNA but not DNA markers correlated with that of E. coli. Generally, the correlations between Enterococcus spp. and Bacteroidales were insignificant. These results suggest that either DNA or RNA markers may complement E. coli in the tiered approach for normoxic or hypoxic seawater under light. When light is absent, either DNA or RNA markers may serve for normoxic seawater, but only the RNA markers are suitable for hypoxic seawater.

  15. Molecular analysis of childhood primitive neuroectodermal tumors defines markers associated with poor outcome

    DEFF Research Database (Denmark)

    Scheurlen, W G; Schwabe, G C; Joos, S

    1998-01-01

    PURPOSE: The diagnostic and prognostic significance of well-defined molecular markers was investigated in childhood primitive neuroectodermal tumors (PNET). MATERIALS AND METHODS: Using microsatellite analysis, Southern blot analysis, and fluorescence in situ hybridization (FISH), 30 primary tumors......: In our study, amplification of c-myc was a poor-prognosis marker in PNET. LOH of chromosome 17p was associated with metastatic disease. Molecular analysis of primary tumors using these markers may be useful for stratification of children with PNET in future prospective studies. The other aberrations...... investigated were not of significant prognostic value, but may provide an entry point for future large-scale molecular studies....

  16. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  17. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding.

    Science.gov (United States)

    Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill

    2017-01-01

    Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  18. Evolution and perspectives of cultivar identification and traceability from tree to oil and table olives by means of DNA markers.

    Science.gov (United States)

    Pasqualone, Antonella; Montemurro, Cinzia; di Rienzo, Valentina; Summo, Carmine; Paradiso, Vito Michele; Caponio, Francesco

    2016-08-01

    In recent years, an increasing number of typicality marks has been awarded to high-quality olive oils produced from local cultivars. In this case, quality control requires effective varietal checks of the starting materials. Moreover, accurate cultivar identification is essential in vegetative-propagated plants distributed by nurseries and is a pre-requisite to register new cultivars. Food genomics provides many tools for cultivar identification and traceability from tree to oil and table olives. The results of the application of different classes of DNA markers to olive with the purpose of checking cultivar identity and variability of plant material are extensively discussed in this review, with special regard to repeatability issues and polymorphism degree. The characterization of olive germplasm from all countries of the Mediterranean basin and from less studied geographical areas is described and innovative high-throughput molecular tools to manage reference collections are reviewed. Then the transferability of DNA markers to processed products - virgin olive oils and table olives - is overviewed to point out strengths and weaknesses, with special regard to (i) the influence of processing steps and storage time on the quantity and quality of residual DNA, (ii) recent advances to overcome the bottleneck of DNA extraction from processed products, (iii) factors affecting whole comparability of DNA profiles between fresh plant materials and end-products, (iv) drawbacks in the analysis of multi-cultivar versus single-cultivar end-products and (v) the potential of quantitative polymerase chain reaction (PCR)-based techniques. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  19. Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

    Science.gov (United States)

    Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

    2018-01-01

    Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

  20. Biomimetic Molecular Signaling using DNA Walkers on Microparticles.

    Science.gov (United States)

    Damase, Tulsi Ram; Spencer, Adam; Samuel, Bamidele; Allen, Peter B

    2017-06-22

    We report the release of catalytic DNA walkers from hydrogel microparticles and the detection of those walkers by substrate-coated microparticles. This might be considered a synthetic biology analog of molecular signal release and reception. One type of particles was coated with components of a DNA one-step strand displacement (OSD) reaction to release the walker. A second type of particle was coated with substrate (or "track") for the molecular walker. We distinguish these particle types using fluorescence barcoding: we synthesized and distinguished multiple particle types with multicolor fluorescence microscopy and automated image analysis software. This represents a step toward amplified, multiplex, and microscopically localized detection based on DNA nanotechnology.

  1. Development of a new marker system for identifying the complex members of the low-molecular-weight glutenin subunit gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhang, Xiaofei; Liu, Dongcheng; Yang, Wenlong; Liu, Kunfan; Sun, Jiazhu; Guo, Xiaoli; Li, Yiwen; Wang, Daowen; Ling, Hongqing; Zhang, Aimin

    2011-05-01

    Low-molecular-weight glutenin subunits (LMW-GSs) play an important role in determining the bread-making quality of bread wheat. However, LMW-GSs display high polymorphic protein complexes encoded by multiple genes, and elucidating the complex LMW-GS gene family in bread wheat remains challenging. In the present study, using conventional polymerase chain reaction (PCR) with conserved primers and high-resolution capillary electrophoresis, we developed a new molecular marker system for identifying LMW-GS gene family members. Based on sequence alignment of 13 LMW-GS genes previously identified in the Chinese bread wheat variety Xiaoyan 54 and other genes available in GenBank, PCR primers were developed and assigned to conserved sequences spanning the length polymorphism regions of LMW-GS genes. After PCR amplification, 17 DNA fragments in Xiaoyan 54 were detected using capillary electrophoresis. In total, 13 fragments were identical to previously identified LMW-GS genes, and the other 4 were derived from unique LMW-GS genes by sequencing. This marker system was also used to identify LMW-GS genes in Chinese Spring and its group 1 nulli-tetrasomic lines. Among the 17 detected DNA fragments, 4 were located on chromosome 1A, 5 on 1B, and 8 on 1D. The results suggest that this marker system is useful for large-scale identification of LMW-GS genes in bread wheat varieties, and for the selection of desirable LMW-GS genes to improve the bread-making quality in wheat molecular breeding programmes.

  2. Scaffolded DNA origami of a DNA tetrahedron molecular container.

    Science.gov (United States)

    Ke, Yonggang; Sharma, Jaswinder; Liu, Minghui; Jahn, Kasper; Liu, Yan; Yan, Hao

    2009-06-01

    We describe a strategy of scaffolded DNA origami to design and construct 3D molecular cages of tetrahedron geometry with inside volume closed by triangular faces. Each edge of the triangular face is approximately 54 nm in dimension. The estimated total external volume and the internal cavity of the triangular pyramid are about 1.8 x 10(-23) and 1.5 x 10(-23) m(3), respectively. Correct formation of the tetrahedron DNA cage was verified by gel electrophoresis, atomic force microscopy, transmission electron microscopy, and dynamic light scattering techniques.

  3. Scaffolded DNA Origami of a DNA Tetrahedron Molecular Container

    DEFF Research Database (Denmark)

    Ke, Yongang; Sharma, Jaswinder; Liu, Minghui

    2009-01-01

    We describe a strategy of scaffolded DNA origami to design and construct 3D molecular cages of tetrahedron geometry with inside volume closed by triangular faces. Each edge of the triangular face is ∼54 nm in dimension. The estimated total external volume and the internal cavity of the triangular...... pyramid are about 1.8 × 10-23 and 1.5 × 10-23 m3, respectively. Correct formation of the tetrahedron DNA cage was verified by gel electrophoresis, atomic force microscopy, transmission electron microscopy, and dynamic light scattering techniques....

  4. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  5. Molecular markers associated with aluminium tolerance in Sorghum bicolor.

    Science.gov (United States)

    Too, Emily Jepkosgei; Onkware, Augustino Osoro; Were, Beatrice Ang'iyo; Gudu, Samuel; Carlsson, Anders; Geleta, Mulatu

    2018-01-01

    Sorghum ( Sorghum bicolor , L. Moench) production in many agro-ecologies is constrained by a variety of stresses, including high levels of aluminium (Al) commonly found in acid soils. Therefore, for such soils, growing Al tolerant cultivars is imperative for high productivity. In this study, molecular markers associated with Al tolerance were identified using a mapping population developed by crossing two contrasting genotypes for this trait. Four SSR ( Xtxp34 , Sb5_236 , Sb6_34 , and Sb6_342 ), one STS ( CTG29_3b ) and three ISSR ( 811_1400 , 835_200 and 884_200 ) markers produced alleles that showed significant association with Al tolerance. CTG29_3b, 811_1400 , Xtxp34 and Sb5_ 236 are located on chromosome 3 with the first two markers located close to Alt SB , a locus that underlie the Al tolerance gene ( SbMATE ) implying that their association with Al tolerance is due to their linkage to this gene. Although CTG29_3b and 811_ 1400 are located closer to Alt SB , Xtxp34 and Sb5_236 explained higher phenotypic variance of Al tolerance indices. Markers 835_200 , 884_200 , Sb6_34 and Sb6_342 are located on different chromosomes, which implies the presence of several genes involved in Al tolerance in addition to S bMATE in sorghum. These molecular markers have a high potential for use in breeding for Al tolerance in sorghum.

  6. Molecular markers of anti-malarial drug resistance in Lahj Governorate, Yemen: baseline data and implications

    Directory of Open Access Journals (Sweden)

    Chance Michael L

    2011-08-01

    Full Text Available Abstract Background This is an investigation of anti-malarial molecular markers coupled with a therapeutic efficacy test of chloroquine (CQ against falciparum malaria in an area of unstable malaria in Lahj Governorate, Yemen. The study was aimed at assessment of therapeutic response to CQ and elucidation of baseline information on molecular markers for Plasmodium falciparum resistance against CQ and sulphadoxine/pyrimethamine (SP. Methods Between 2002 and 2003 the field test was conducted according to the standard WHO protocol to evaluate the therapeutic efficacy of CQ in 124 patients with falciparum malaria in an endemic area in Lahj Governorate in Yemen. Blood samples collected during this study were analysed for P. falciparum chloroquine resistance transporter gene (pfcrt-76 polymorphisms, mutation pfcrt-S163R and the antifolate resistance-associated mutations dihydrofolate reductase (dhfr-C59R and dihydropteroate synthase (dhps-K540E. Direct DNA sequencing of the pfcrt gene from three representative field samples was carried out after DNA amplification of the 13 exons of the pfcrt gene. Results Treatment failure was detected in 61% of the 122 cases that completed the 14-day follow-up. The prevalence of mutant pfcrt T76 was 98% in 112 amplified pre-treatment samples. The presence of pfcrt T76 was poorly predictive of in vivo CQ resistance (PPV = 61.8%, 95% CI = 52.7-70.9. The prevalence of dhfr Arg-59 mutation in 99 amplified samples was 5%, while the dhps Glu-540 was not detected in any of 119 amplified samples. Sequencing the pfcrt gene confirmed that Yemeni CQ resistant P. falciparum carry the old world (Asian and African CQ resistant haplotype CVIETSESI at positions 72,73,74,75,76,220,271, 326 and 371. Conclusion This is the first study to report baseline information on the characteristics and implications of anti-malarial drug resistance markers in Yemen. It is also the first report of the haplotype associated with CQR P. falciparum

  7. Molecular markers of anti-malarial drug resistance in Lahj Governorate, Yemen: baseline data and implications.

    Science.gov (United States)

    Mubjer, Reem A; Adeel, Ahmed A; Chance, Michael L; Hassan, Amir A

    2011-08-21

    This is an investigation of anti-malarial molecular markers coupled with a therapeutic efficacy test of chloroquine (CQ) against falciparum malaria in an area of unstable malaria in Lahj Governorate, Yemen. The study was aimed at assessment of therapeutic response to CQ and elucidation of baseline information on molecular markers for Plasmodium falciparum resistance against CQ and sulphadoxine/pyrimethamine (SP). Between 2002 and 2003 the field test was conducted according to the standard WHO protocol to evaluate the therapeutic efficacy of CQ in 124 patients with falciparum malaria in an endemic area in Lahj Governorate in Yemen. Blood samples collected during this study were analysed for P. falciparum chloroquine resistance transporter gene (pfcrt)-76 polymorphisms, mutation pfcrt-S163R and the antifolate resistance-associated mutations dihydrofolate reductase (dhfr)-C59R and dihydropteroate synthase (dhps)-K540E. Direct DNA sequencing of the pfcrt gene from three representative field samples was carried out after DNA amplification of the 13 exons of the pfcrt gene. Treatment failure was detected in 61% of the 122 cases that completed the 14-day follow-up. The prevalence of mutant pfcrt T76 was 98% in 112 amplified pre-treatment samples. The presence of pfcrt T76 was poorly predictive of in vivo CQ resistance (PPV = 61.8%, 95% CI = 52.7-70.9). The prevalence of dhfr Arg-59 mutation in 99 amplified samples was 5%, while the dhps Glu-540 was not detected in any of 119 amplified samples. Sequencing the pfcrt gene confirmed that Yemeni CQ resistant P. falciparum carry the old world (Asian and African) CQ resistant haplotype CVIETSESI at positions 72,73,74,75,76,220,271, 326 and 371. This is the first study to report baseline information on the characteristics and implications of anti-malarial drug resistance markers in Yemen. It is also the first report of the haplotype associated with CQR P. falciparum parasites from Yemen. Mutant pfcrtT76 is highly prevalent but it

  8. Implication of Gastric Cancer Molecular Genetic Markers in Surgical Practice.

    Science.gov (United States)

    Nemtsova, Marina V; Strelnikov, Vladimir V; Tanas, Alexander S; Bykov, Igor I; Zaletaev, Dmitry V; Rudenko, Viktoria V; Glukhov, Alexander I; Kchorobrich, Tatiana V; Li, Yi; Tarasov, Vadim V; Barreto, George E; Aliev, Gjumrakch

    2017-10-01

    We have investigated aberrant methylation of genes CDH1, RASSF1A, MLH1, N33, DAPK, expression of genes hTERT, MMP7, MMP9, BIRC5 (survivin), PTGS2, and activity of telomerase of 106 gastric tumor samples obtained intra-operatively and 53 gastric tumor samples from the same group of patients obtained endoscopically before surgery. Biopsy specimens obtained from 50 patients with chronic calculous cholecystitis were used as a control group. Together with tissue samples obtained from different sites remote to tumors, a total of 727 samples have been studied. The selected parameters comprise a system of molecular markers that can be used in both diagnostics of gastric cancer and in dynamic monitoring of patients after surgery. Special attention was paid to the use of molecular markers for the diagnostics of malignant process in the material obtained endoscopically since the efficacy of morphological diagnostics in biopsies is compromised by intratumoral heterogeneity, which may prevent reliable identification of tumor cells in the sampling. Our data indicated that certain molecular genetic events provided more sensitive yet specific markers of the tumor. We demonstrated that molecular profiles detected in preoperative biopsies were confirmed by the material obtained intra-operatively. The use of endoscopic material facilitates gastric tumors pre-operative diagnostics, improving early detection of gastric cancer and potential effective treatment strategies.

  9. Characterization of some bread wheat genotypes using molecular markers for drought tolerance.

    Science.gov (United States)

    Ateş Sönmezoğlu, Özlem; Terzi, Begüm

    2018-02-01

    Because of its wide geographical adaptation and importance in human nutrition, wheat is one of the most important crops in the world. However, wheat yield has reduced due to drought stress posing threat to sustainability and world food security in agricultural production. The first stage of drought tolerant variety breeding occurs on the molecular and biochemical characterization and classification of wheat genotypes. The aim of the present study is characterization of widely grown bread wheat cultivars and breeding lines for drought tolerance so as to be adapted to different regions in Turkey. The genotypes were screened with molecular markers for the presence of QTLs mapped to different chromosomes. Results of the molecular studies identified and detected 15 polymorphic SSR markers which gave the clearest PCR bands among the control genotypes. At the end of the research, bread wheat genotypes which were classified for tolerance or sensitivity to drought and the genetic similarity within control varieties were determined by molecular markers. According to SSR based dendrogram, two main groups were obtained for drought tolerance. At end of the molecular screening with SSR primers, genetic similarity coefficients were obtained that ranged from 0.14 to 0.71. The ones numbered 8 and 11 were the closest genotypes to drought tolerant cultivar Gerek 79 and the furthest genotypes from this cultivar were number 16 and to drought sensitive cultivar Sultan 95. The genotypes as drought tolerance due to their SSR markers scores are expected to provide useful information for drought related molecular breeding studies.

  10. Molecular markers for analyses of intraspecific genetic diversity in the Asian Tiger mosquito, Aedes albopictus.

    Science.gov (United States)

    Manni, Mosè; Gomulski, Ludvik M; Aketarawong, Nidchaya; Tait, Gabriella; Scolari, Francesca; Somboon, Pradya; Guglielmino, Carmela R; Malacrida, Anna R; Gasperi, Giuliano

    2015-03-28

    The dramatic worldwide expansion of Aedes albopictus (the Asian tiger mosquito) and its vector competence for numerous arboviruses represent a growing threat to public health security. Molecular markers are crucially needed for tracking the rapid spread of this mosquito and to obtain a deeper knowledge of population structure. This is a fundamental requirement for the development of strict monitoring protocols and for the improvement of sustainable control measures. Wild population samples from putative source areas and from newly colonised regions were analysed for variability at the ribosomal DNA internal transcribed spacer 2 (ITS2). Moreover, a new set of 23 microsatellite markers (SSR) was developed. Sixteen of these SSRs were tested in an ancestral (Thailand) and two adventive Italian populations. Seventy-six ITS2 sequences representing 52 unique haplotypes were identified, and AMOVA indicated that most of their variation occurred within individuals (74.36%), while only about 8% was detected among populations. Spatial analyses of molecular variance revealed that haplotype genetic similarity was not related to the geographic proximity of populations and the haplotype phylogeny clearly indicated that highly related sequences were distributed across populations from different geographical regions. The SSR markers displayed a high level of polymorphism both in the ancestral and in adventive populations, and F ST estimates suggested the absence of great differentiation. The ancestral nature of the Thai population was corroborated by its higher level of variability. The two types of genetic markers here implemented revealed the distribution of genetic diversity within and between populations and provide clues on the dispersion dynamics of this species. It appears that the diffusion of this mosquito does not conform to a progressive expansion from the native Asian source area, but to a relatively recent and chaotic propagule distribution mediated by human activities

  11. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding

    Directory of Open Access Journals (Sweden)

    Yong-Bi Fu

    2017-07-01

    Full Text Available Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding.

  12. Searching for an Accurate Marker-Based Prediction of an Individual Quantitative Trait in Molecular Plant Breeding

    Science.gov (United States)

    Fu, Yong-Bi; Yang, Mo-Hua; Zeng, Fangqin; Biligetu, Bill

    2017-01-01

    Molecular plant breeding with the aid of molecular markers has played an important role in modern plant breeding over the last two decades. Many marker-based predictions for quantitative traits have been made to enhance parental selection, but the trait prediction accuracy remains generally low, even with the aid of dense, genome-wide SNP markers. To search for more accurate trait-specific prediction with informative SNP markers, we conducted a literature review on the prediction issues in molecular plant breeding and on the applicability of an RNA-Seq technique for developing function-associated specific trait (FAST) SNP markers. To understand whether and how FAST SNP markers could enhance trait prediction, we also performed a theoretical reasoning on the effectiveness of these markers in a trait-specific prediction, and verified the reasoning through computer simulation. To the end, the search yielded an alternative to regular genomic selection with FAST SNP markers that could be explored to achieve more accurate trait-specific prediction. Continuous search for better alternatives is encouraged to enhance marker-based predictions for an individual quantitative trait in molecular plant breeding. PMID:28729875

  13. Characterization of Gladiolus Germplasm Using Morphological, Physiological, and Molecular Markers.

    Science.gov (United States)

    Singh, Niraj; Pal, Ashish K; Roy, R K; Tewari, S K; Tamta, Sushma; Rana, T S

    2018-04-01

    Estimation of variability and genetic relationships among breeding materials is one of the important strategies in crop improvement programs. Morphological (plant height, spike length, a number of florets/spike), physiological (chlorophyll content, chlorophyll fluorescence, and rapid light curve parameters) and Directed amplification of minisatellite DNA (DAMD) markers were used to investigate the relationships among 50 Gladiolus cultivars. Cluster analysis based on morphological data, physiological characteristics, molecular markers, and cumulative data discriminated all cultivars into seven, five, seven, and six clusters in the unweighted pair-group method using arithmetic mean (UPGMA) dendrogram, respectively. The results of the principal coordinate analysis (PCoA) also supported UPGMA clustering. Variations among the Gladiolus cultivars at phenotypic level could be due to the changes in physiology, environmental conditions, and genetic variability. DAMD analysis using 10 primers produced 120 polymorphic bands with 80% polymorphism showing polymorphic information content (PIC = 0.28), Marker index (MI = 3.37), Nei's gene diversity (h = 0.267), and Shannon's information index (I = 0.407). Plant height showed a positive significant correlation with Spike length and Number of florets/spike (r = 0.729, p < 0.001 and r = 0.448, p = 0.001 respectively). Whereas, Spike length showed positive significant correlation with Number of florets/spike (r = 0.688, p < 0.001) and Chlorophyll content showed positive significant correlation with Electron transport rate (r = 0.863, p < 0.001). Based on significant morphological variations, high physiological performance, high genetic variability, and genetic distances between cultivars, we have been able to identify diverse cultivars of Gladiolus that could be the potential source as breeding material for further genetic improvement in this ornamental crop.

  14. Variabilidade genética de acessos de maracujá-suspiro com base em marcadores moleculares Genetic variability of wild passion fruit determined by molecular markers

    Directory of Open Access Journals (Sweden)

    Keize Pereira Junqueira

    2007-01-01

    Full Text Available Passiflora nitida é uma espécie silvestre amplamente distribuída pelo território brasileiro, constituindo-se em fonte de resistência a doenças foliares e de raízes. O objetivo deste trabalho foi avaliar a variabilidade genética entre acessos de P. nitida procedentes de diferentes tipos fitofisionômicos de Cerrado e estados brasileiros (Goiás, Distrito Federal, Tocantins, Mato Grosso e Amazonas, usando marcadores moleculares RAPD. O DNA genômico de cada acesso foi extraído, e doze iniciadores decâmeros foram utilizados para a obtenção de marcadores moleculares RAPD, que foram convertidos em matriz de dados binários, a partir da qual foram estimadas as distâncias genéticas entre os acessos e realizadas análises de agrupamento e de dispersão gráfica. Foram obtidos 196 marcadores para P. nitida, dos quais 63,81% foram polimórficos. As distâncias genéticas entre os acessos de maracujá variaram de 0,031 a 0,614 e, considerando apenas P. nitida, de 0,031 a 0,417. Os marcadores moleculares demonstraram alta variabilidade genética dos acessos de P. nitida. Menores distâncias genéticas foram verificadas entre os acessos originados do mesmo estado. Considerando-se os acessos de um mesmo estado, menores distâncias genéticas foram verificadas entre os acessos provenientes de tipos fitofisionômicos próximos. O acesso "Manaus 2" apresentou o maior distanciamento genético em relação aos demais acessos.Passiflora nitida is a wild species widely distributed in Brazilian territory. It is a source of resistance to foliar and soil borne diseases. The objective of this work was to evaluate the genetic variability among accessions of P. nitida proceeding from different types of Cerrado (Brazilian savannah vegetation and brazilian states (Goiás, Distrito Federal, Tocantins, Mato Grosso and Amazonas using RAPD molecular markers. The genomic DNA of each origin was extracted and amplified using 12 decamer primers to obtain RAPD

  15. Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ

    DEFF Research Database (Denmark)

    Euro, Liliya; Haapanen, Outi; Róg, Tomasz

    2017-01-01

    of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable......DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site...... changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform...

  16. Radioactively labelled DNA probes for crop improvement. Proceedings of a final research co-ordination meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-11-01

    With the advent of DNA molecular marker technology in the 1980s plant breeding had a new and powerful tool with which to increase its efficacy. Such markers are abundant and directly reveal information about the genotype and therefore are more useful than simple phenotypic markers. In plant breeding applications, molecular markers reveal information about variability and genetic relationships, and enable genetic mapping, which greatly assists the breeder in selection of parents and progeny, as well as in management of breeding strategies. Furthermore, molecular markers linked to phenotypic traits permit very early selection of superior progenies from breeding populations, therefore significantly reducing the need for field testing and greatly increasing efficiency of plant breeding programmes. For this to occur the oligonucleotide probes for labelling genetic markers and/or the primers for polymerase chain reactions to amplify genetic markers needed to be also accessible to scientists in developing Member States. In addition, technical information, training and troubleshooting were needed to support the utilization of DNA markers. In the early 1990s there was a dramatic increase in requests for access to this technology. This co-ordinated research project (CRP) facilitated the transfer of molecular marker technology, in terms of both material and information, from advanced laboratories to assist breeding programmes in developing countries. Two other CRPs were conducted concurrently in order to assist developing Member States to utilise molecular markers - Application of DNA Based Marker Mutations for Improvement of Cereals and other Sexually Reproduced Crop Plants, and Use of Novel DNA Fingerprinting Techniques for the Detection and Characterisation of Genetic Variation in Vegetatively Propagated Crops (IAEA-TECDOC-1010 and IAEA-TECDOC-1047, respectively). The present CRP built upon the success of the former projects by ensuring the availability of probes

  17. Radioactively labelled DNA probes for crop improvement. Proceedings of a final research co-ordination meeting

    International Nuclear Information System (INIS)

    2001-11-01

    With the advent of DNA molecular marker technology in the 1980s plant breeding had a new and powerful tool with which to increase its efficacy. Such markers are abundant and directly reveal information about the genotype and therefore are more useful than simple phenotypic markers. In plant breeding applications, molecular markers reveal information about variability and genetic relationships, and enable genetic mapping, which greatly assists the breeder in selection of parents and progeny, as well as in management of breeding strategies. Furthermore, molecular markers linked to phenotypic traits permit very early selection of superior progenies from breeding populations, therefore significantly reducing the need for field testing and greatly increasing efficiency of plant breeding programmes. For this to occur the oligonucleotide probes for labelling genetic markers and/or the primers for polymerase chain reactions to amplify genetic markers needed to be also accessible to scientists in developing Member States. In addition, technical information, training and troubleshooting were needed to support the utilization of DNA markers. In the early 1990s there was a dramatic increase in requests for access to this technology. This co-ordinated research project (CRP) facilitated the transfer of molecular marker technology, in terms of both material and information, from advanced laboratories to assist breeding programmes in developing countries. Two other CRPs were conducted concurrently in order to assist developing Member States to utilise molecular markers - Application of DNA Based Marker Mutations for Improvement of Cereals and other Sexually Reproduced Crop Plants, and Use of Novel DNA Fingerprinting Techniques for the Detection and Characterisation of Genetic Variation in Vegetatively Propagated Crops (IAEA-TECDOC-1010 and IAEA-TECDOC-1047, respectively). The present CRP built upon the success of the former projects by ensuring the availability of probes

  18. Use of a D17Z1 oligonucleotide probe for human DNA quantitation prior to PCR analysis of polymorphic DNA markers

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, S.; Alavaren, M.; Varlaro, J. [Roche Molecular Systems, Alameda, CA (United States)] [and others

    1994-09-01

    The alpha-satellite DNA locus D17Z1 contains primate-specific sequences which are repeated several hundred times per chromosome 17. A probe that was designed to hybridize to a subset of the D17Z1 sequence can be used for very sensitive and specific quantitation of human DNA. Sample human genomic DNA is immobilized on nylon membrane using a slot blot apparatus, and then hybridized with a biotinylated D17Z1 oligonucleotide probe. The subsequent binding of streptavidin-horseradish peroxidase to the bound probe allows for either calorimetric (TMB) or chemiluminescent (ECL) detection. Signals obtained for sample DNAs are then compared to the signals obtained for a series of human DNA standards. For either detection method, forty samples can be quantitated in less than two hours, with a sensitivity of 150 pg. As little as 20 pg of DNA can be quantitated when using chemiluminescent detection with longer film exposures. PCR analysis of several VNTR and STR markers has indicated that optimal typing results are generally obtained within a relatively narrow range of input DNA quantities. Too much input DNA can lead to PCR artifacts such as preferential amplification of smaller alleles, non-specific amplification products, and exaggeration of the DNA synthesis slippage products that are seen with STR markers. Careful quantitation of human genomic DNA prior to PCR can avoid or minimize these problems and ultimately give cleaner, more unambiguous PCR results.

  19. Prolonged decay of molecular rate estimates for metazoan mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Martyna Molak

    2015-03-01

    Full Text Available Evolutionary timescales can be estimated from genetic data using the molecular clock, often calibrated by fossil or geological evidence. However, estimates of molecular rates in mitochondrial DNA appear to scale negatively with the age of the clock calibration. Although such a pattern has been observed in a limited range of data sets, it has not been studied on a large scale in metazoans. In addition, there is uncertainty over the temporal extent of the time-dependent pattern in rate estimates. Here we present a meta-analysis of 239 rate estimates from metazoans, representing a range of timescales and taxonomic groups. We found evidence of time-dependent rates in both coding and non-coding mitochondrial markers, in every group of animals that we studied. The negative relationship between the estimated rate and time persisted across a much wider range of calibration times than previously suggested. This indicates that, over long time frames, purifying selection gives way to mutational saturation as the main driver of time-dependent biases in rate estimates. The results of our study stress the importance of accounting for time-dependent biases in estimating mitochondrial rates regardless of the timescale over which they are inferred.

  20. Ricebase: a breeding and genetics platform for rice, integrating individual molecular markers, pedigrees and whole-genome-based data.

    Science.gov (United States)

    Edwards, J D; Baldo, A M; Mueller, L A

    2016-01-01

    Ricebase (http://ricebase.org) is an integrative genomic database for rice (Oryza sativa) with an emphasis on combining datasets in a way that maintains the key links between past and current genetic studies. Ricebase includes DNA sequence data, gene annotations, nucleotide variation data and molecular marker fragment size data. Rice research has benefited from early adoption and extensive use of simple sequence repeat (SSR) markers; however, the majority of rice SSR markers were developed prior to the latest rice pseudomolecule assembly. Interpretation of new research using SNPs in the context of literature citing SSRs requires a common coordinate system. A new pipeline, using a stepwise relaxation of stringency, was used to map SSR primers onto the latest rice pseudomolecule assembly. The SSR markers and experimentally assayed amplicon sizes are presented in a relational database with a web-based front end, and are available as a track loaded in a genome browser with links connecting the browser and database. The combined capabilities of Ricebase link genetic markers, genome context, allele states across rice germplasm and potentially user curated phenotypic interpretations as a community resource for genetic discovery and breeding in rice. Published by Oxford University Press 2016. This work is written by US Government employees and is in the public domain in the United States.

  1. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  2. Molecular characterization and identification of markers for toxic and non-toxic varieties of Jatropha curcas L. using RAPD, AFLP and SSR markers.

    Science.gov (United States)

    Sudheer Pamidimarri, D V N; Singh, Sweta; Mastan, Shaik G; Patel, Jalpa; Reddy, Muppala P

    2009-07-01

    Jatropha curcas L., a multipurpose shrub has acquired significant economic importance for its seed oil which can be converted to biodiesel, is emerging as an alternative to petro-diesel. The deoiled seed cake remains after oil extraction is toxic and cannot be used as a feed despite having best nutritional contents. No quantitative and qualitative differences were observed between toxic and non-toxic varieties of J. curcas except for phorbol esters content. Development of molecular marker will enable to differentiate non-toxic from toxic variety in a mixed population and also help in improvement of the species through marker assisted breeding programs. The present investigation was undertaken to characterize the toxic and non-toxic varieties at molecular level and to develop PCR based molecular markers for distinguishing non-toxic from toxic or vice versa. The polymorphic markers were successfully identified specific to non-toxic and toxic variety using RAPD and AFLP techniques. Totally 371 RAPD, 1,442 AFLP markers were analyzed and 56 (15.09%) RAPD, 238 (16.49%) AFLP markers were found specific to either of the varieties. Genetic similarity between non-toxic and toxic verity was found to be 0.92 by RAPD and 0.90 by AFLP fingerprinting. In the present study out of 12 microsatellite markers analyzed, seven markers were found polymorphic. Among these seven, jcms21 showed homozygous allele in the toxic variety. The study demonstrated that both RAPD and AFLP techniques were equally competitive in identifying polymorphic markers and differentiating both the varieties of J. curcas. Polymorphism of SSR markers prevailed between the varieties of J. curcas. These RAPD and AFLP identified markers will help in selective cultivation of specific variety and along with SSRs these markers can be exploited for further improvement of the species through breeding and Marker Assisted Selection (MAS).

  3. Identificação molecular da uva 'Goethe' de Urussanga - SC por marcadores microssatélites Molecular identification of the grapevine 'Goethe' from Urussanga (SC with microsatellite markers

    Directory of Open Access Journals (Sweden)

    Mariane Ruzza Schuck

    2010-09-01

    Full Text Available A variedade Goethe é símbolo da vitivinicultura da região de Urussanga, sul do Estado de Santa Catarina, a qual, atualmente, busca a Indicação Geográfica da Uva e do Vinho Goethe. Para isto, um dos requisitos necessários é a identificação precisa do material genético. Os marcadores microssatélites constituem a ferramenta molecular mais utilizada para a identificação varietal de videira em todo o mundo e têm a capacidade de produzir um perfil genético único para cada material vitícola. O objetivo deste trabalho foi caracterizar duas seleções de uva 'Goethe', presentes no município de Urussanga, por meio de marcadores moleculares microssatélites, visando a atender aos requisitos de denominação de origem e indicação de procedência controlada. A extração do DNA genômico foi realizada a partir de folhas jovens e ramos de nove acessos de cada seleção de 'Goethe Classica' e 'Goethe Primo' provenientes de uma coleção pública e de oito coleções privadas da região de Urussanga. Dez loci microssatélites VVS2, VVMD5, VVMD7, VVMD27, VrZAG62, VrZAG79, VVMD25, VVMD28, VVMD31 e VVMD32 foram genotipados através de eletroforese capilar. As análises realizadas mostraram que as duas variantes da uva 'Goethe' apresentaram um perfil molecular idêntico e único, isto é, representam a mesma variedade e sem nenhuma correspondência com variedades descritas anteriormente na literatura e nos bancos de dados consultados. As diferenças fenotípicas observadas provavelmente são devidas a mutações somáticas em regiões funcionais do genoma, fenômeno que dá origem aos clones em videira.'Goethe' grape is a symbol of the viticulture of Urussanga region, South of Santa Catarina State, which is currently claiming the geographical indication of the grape and wine Goethe. Microsatellite markers are the biotechnological tool most used for molecular identification of grapevine varieties worldwide. These markers have the potential of

  4. Detection of novel polymorphisms in the mitochondrial DNA D-Loop ...

    African Journals Online (AJOL)

    aghomotsegin

    2015-04-08

    Apr 8, 2015 ... 1Department of Molecular Biology, Babylon University, Hilla City, Iraq. 2Babylon ... Mitochondrial DNA (mtDNA) is a useful genetic marker for answering .... to you for choosing the project, your enthusiasm for helping us ...

  5. Molecular Characterization of Cultivated Pawpaw (Asimina triloba) Using RAPD Markers

    Science.gov (United States)

    Hongwen Huang; Desmond R. Layne; Thomas L. Kubisiak

    2003-01-01

    Thirty-four extant pawpaw [Asimina triloba (L.) Dunal] cultivars and advanced selections representing a large portion of the gene pool of cultivated pawpaws were investigated using 71 randomly amplified polymorphic DNA (RAPD) markers to establish genetic identities and evaluate genetic relatedness. All 34 cultivated pawpaws were uniquely...

  6. Molecular mechanisms in radiation damage to DNA

    International Nuclear Information System (INIS)

    Osman, R.

    1991-01-01

    The objectives of this work are to elucidate the molecular mechanisms that are responsible for radiation-induced DNA damage. The overall goal is to understand the relationship between the chemical and structural changes produced by ionizing radiation in DNA and the resulting impairment of biological function expressed as carcinogenesis or cell death. The studies are based on theoretical explorations of possible mechanisms that link initial radiation damage in the form of base and sugar damage to conformational changes in DNA. These mechanistic explorations should lead to the formulation of testable hypothesis regarding the processes of impairment of regulation of gene expression, alternation in DNA repair, and damage to DNA structure involved in cell death or cancer

  7. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    Science.gov (United States)

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. DNA topology influences molecular machine lifetime in human serum

    Science.gov (United States)

    Goltry, Sara; Hallstrom, Natalya; Clark, Tyler; Kuang, Wan; Lee, Jeunghoon; Jorcyk, Cheryl; Knowlton, William B.; Yurke, Bernard; Hughes, William L.; Graugnard, Elton

    2015-06-01

    DNA nanotechnology holds the potential for enabling new tools for biomedical engineering, including diagnosis, prognosis, and therapeutics. However, applications for DNA devices are thought to be limited by rapid enzymatic degradation in serum and blood. Here, we demonstrate that a key aspect of DNA nanotechnology--programmable molecular shape--plays a substantial role in device lifetimes. These results establish the ability to operate synthetic DNA devices in the presence of endogenous enzymes and challenge the textbook view of near instantaneous degradation.DNA nanotechnology holds the potential for enabling new tools for biomedical engineering, including diagnosis, prognosis, and therapeutics. However, applications for DNA devices are thought to be limited by rapid enzymatic degradation in serum and blood. Here, we demonstrate that a key aspect of DNA nanotechnology--programmable molecular shape--plays a substantial role in device lifetimes. These results establish the ability to operate synthetic DNA devices in the presence of endogenous enzymes and challenge the textbook view of near instantaneous degradation. Electronic supplementary information (ESI) available: DNA sequences, fluorophore and quencher properties, equipment design, and degradation studies. See DOI: 10.1039/c5nr02283e

  9. A novel molecular marker for the study of Neotropical cichlid phylogeny.

    Science.gov (United States)

    Fabrin, T M C; Gasques, L S; Prioli, S M A P; Prioli, A J

    2015-12-22

    The use of molecular markers has contributed to phylogeny and to the reconstruction of species' evolutionary history. Each region of the genome has different evolution rates, which may or may not identify phylogenetic signal at different levels. Therefore, it is important to assess new molecular markers that can be used for phylogenetic reconstruction. Regions that may be associated with species characteristics and are subject to selective pressure, such as opsin genes, which encode proteins related to the visual system and are widely expressed by Cichlidae family members, are interesting. Our aim was to identify a new nuclear molecular marker that could establish the phylogeny of Neotropical cichlids and is potentially correlated with the visual system. We used Bayesian inference and maximum likelihood analysis to support the use of the nuclear opsin LWS gene in the phylogeny of eight Neotropical cichlid species. Their use concatenated to the mitochondrial gene COI was also tested. The LWS gene fragment comprised the exon 2-4 region, including the introns. The LWS gene provided good support for both analyses up to the genus level, distinguishing the studied species, and when concatenated to the COI gene, there was a good support up to the species level. Another benefit of utilizing this region, is that some polymorphisms are associated with changes in spectral properties of the LWS opsin protein, which constitutes the visual pigment that absorbs red light. Thus, utilization of this gene as a molecular marker to study the phylogeny of Neotropical cichlids is promising.

  10. Genotyping by sequencing (GBS, an ultimate marker-assisted selection (MAS tool to accelerate plant breeding

    Directory of Open Access Journals (Sweden)

    Jiangfeng eHe

    2014-09-01

    Full Text Available Marker-assisted selection (MAS refers to the use of molecular markers to assist phenotypic selections in crop improvement. Several types of molecular markers, such as single nucleotide polymorphism (SNP, have been identified and effectively used in plant breeding. The application of next-generation sequencing (NGS technologies has led to remarkable advances in whole genome sequencing, which provides ultra-throughput sequences to revolutionize plant genotyping and breeding. To further broaden NGS usages to large crop genomes such as maize and wheat, genotyping by sequencing (GBS has been developed and applied in sequencing multiplexed samples that combine molecular marker discovery and genotyping. GBS is a novel application of NGS protocols for discovering and genotyping SNPs in crop genomes and populations. The GBS approach includes the digestion of genomic DNA with restriction enzymes followed by the ligation of barcode adapter, PCR amplification and sequencing of the amplified DNA pool on a single lane of flow cells. Bioinformatic pipelines are needed to analyze and interpret GBS datasets. As an ultimate MAS tool and a cost-effective technique, GBS has been successfully used in implementing genome-wide association study (GWAS, genomic diversity study, genetic linkage analysis, molecular marker discovery and genomic selection (GS under a large scale of plant breeding programs.

  11. Genotyping-by-sequencing (GBS), an ultimate marker-assisted selection (MAS) tool to accelerate plant breeding.

    Science.gov (United States)

    He, Jiangfeng; Zhao, Xiaoqing; Laroche, André; Lu, Zhen-Xiang; Liu, HongKui; Li, Ziqin

    2014-01-01

    Marker-assisted selection (MAS) refers to the use of molecular markers to assist phenotypic selections in crop improvement. Several types of molecular markers, such as single nucleotide polymorphism (SNP), have been identified and effectively used in plant breeding. The application of next-generation sequencing (NGS) technologies has led to remarkable advances in whole genome sequencing, which provides ultra-throughput sequences to revolutionize plant genotyping and breeding. To further broaden NGS usages to large crop genomes such as maize and wheat, genotyping-by-sequencing (GBS) has been developed and applied in sequencing multiplexed samples that combine molecular marker discovery and genotyping. GBS is a novel application of NGS protocols for discovering and genotyping SNPs in crop genomes and populations. The GBS approach includes the digestion of genomic DNA with restriction enzymes followed by the ligation of barcode adapter, PCR amplification and sequencing of the amplified DNA pool on a single lane of flow cells. Bioinformatic pipelines are needed to analyze and interpret GBS datasets. As an ultimate MAS tool and a cost-effective technique, GBS has been successfully used in implementing genome-wide association study (GWAS), genomic diversity study, genetic linkage analysis, molecular marker discovery and genomic selection under a large scale of plant breeding programs.

  12. Variability among Capsicum baccatum accessions from Goiás, Brazil, assessed by morphological traits and molecular markers.

    Science.gov (United States)

    Martinez, A L A; Araújo, J S P; Ragassi, C F; Buso, G S C; Reifschneider, F J B

    2017-07-06

    Capsicum peppers are native to the Americas, with Brazil being a significant diversity center. Capsicum baccatum accessions at Instituto Federal (IF) Goiano represent a portion of the species genetic resources from central Brazil. We aimed to characterize a C. baccatum working collection comprising 27 accessions and 3 commercial cultivars using morphological traits and molecular markers to describe its genetic and morphological variability and verify the occurrence of duplicates. This set included 1 C. baccatum var. praetermissum and 29 C. baccatum var. pendulum with potential for use in breeding programs. Twenty-two morphological descriptors, 57 inter-simple sequence repeat, and 34 random amplified polymorphic DNA markers were used. Genetic distance was calculated through the Jaccard similarity index and genetic variability through cluster analysis using the unweighted pair group method with arithmetic mean, resulting in dendrograms for both morphological analysis and molecular analysis. Genetic variability was found among C. baccatum var. pendulum accessions, and the distinction between the two C. baccatum varieties was evident in both the morphological and molecular analyses. The 29 C. baccatum var. pendulum genotypes clustered in four groups according to fruit type in the morphological analysis. They formed seven groups in the molecular analysis, without a clear correspondence with morphology. No duplicates were found. The results describe the genetic and morphological variability, provide a detailed characterization of genotypes, and discard the possibility of duplicates within the IF Goiano C. baccatum L. collection. This study will foment the use of this germplasm collection in C. baccatum breeding programs.

  13. Molecular markers for predicting end-products quality of wheat ...

    African Journals Online (AJOL)

    Molecular markers for predicting end-products quality of wheat (Triticum aestivum L.) ... African Journal of Biotechnology. Journal Home · ABOUT ... Four new Saudi wheat lines (KSU 102, KSU 103, KSU 105 and KSU 106) and two. American ...

  14. In vitro molecular machine learning algorithm via symmetric internal loops of DNA.

    Science.gov (United States)

    Lee, Ji-Hoon; Lee, Seung Hwan; Baek, Christina; Chun, Hyosun; Ryu, Je-Hwan; Kim, Jin-Woo; Deaton, Russell; Zhang, Byoung-Tak

    2017-08-01

    Programmable biomolecules, such as DNA strands, deoxyribozymes, and restriction enzymes, have been used to solve computational problems, construct large-scale logic circuits, and program simple molecular games. Although studies have shown the potential of molecular computing, the capability of computational learning with DNA molecules, i.e., molecular machine learning, has yet to be experimentally verified. Here, we present a novel molecular learning in vitro model in which symmetric internal loops of double-stranded DNA are exploited to measure the differences between training instances, thus enabling the molecules to learn from small errors. The model was evaluated on a data set of twenty dialogue sentences obtained from the television shows Friends and Prison Break. The wet DNA-computing experiments confirmed that the molecular learning machine was able to generalize the dialogue patterns of each show and successfully identify the show from which the sentences originated. The molecular machine learning model described here opens the way for solving machine learning problems in computer science and biology using in vitro molecular computing with the data encoded in DNA molecules. Copyright © 2017. Published by Elsevier B.V.

  15. Hydrodynamic caracterization and molecular weight stimation of ultrasonically sheared DNA

    International Nuclear Information System (INIS)

    Garces, F.; Casal, J.I.; Garcia, A.

    1981-01-01

    The sedimentation coefficients and intrinsec viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight stimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of lambds-DNA. (author) [es

  16. Development and small-scale validation of a novel pigeon-associated mitochondrial DNA source tracking marker for the detection of fecal contamination in harvested rainwater.

    Science.gov (United States)

    Waso, M; Khan, S; Khan, W

    2018-02-15

    The current study was aimed at designing and validating (on a small-scale) a novel pigeon mitochondrial DNA (mtDNA) microbial source tracking (MST) marker for the detection of pigeon fecal matter in harvested rainwater. The pigeon mtDNA MST marker was designed to target the mtDNA Cytochrome b gene by employing mismatch amplification mutation assay kinetics. The pigeon marker was validated by screening 69 non-pigeon and 9 pigeon fecal samples. The host-sensitivity of the assay was determined as 1.00 while the host-specificity of the assay was 0.96. Harvested rainwater samples (n=60) were screened for the prevalence of the marker with the mtDNA Cytochrome b marker detected in 78% of the samples. Bayes' theorem was applied to calculate the conditional probability of the marker detecting true pigeon contamination and the marker subsequently displayed a 99% probability of detecting true pigeon contamination in the harvested rainwater samples. In addition, the mtDNA Cytochrome b marker displayed high concurrence frequencies versus heterotrophic bacteria (78.3%), E. coli (73.3%), total coliforms (71.1%) and fecal coliforms (66.7%). This study thus validates that targeting mtDNA for the design of source tracking markers may be a valuable tool to detect avian fecal contamination in environmental waters. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    Science.gov (United States)

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  18. Use of molecular markers in plant breeding = [Het gebruik van moleculaire merkers in de plantenveredeling

    NARCIS (Netherlands)

    Berloo, van R.

    2000-01-01

    Molecular markers provide plant breeding with an important and valuable new source of information. Linkage between molecular markers can be translated to genetic linkage maps, which have become an important tool in plant and animal genetics. Linkage between (quantitative) trait-data and

  19. Molecular marker systems for Oenothera genetics.

    Science.gov (United States)

    Rauwolf, Uwe; Golczyk, Hieronim; Meurer, Jörg; Herrmann, Reinhold G; Greiner, Stephan

    2008-11-01

    The genus Oenothera has an outstanding scientific tradition. It has been a model for studying aspects of chromosome evolution and speciation, including the impact of plastid nuclear co-evolution. A large collection of strains analyzed during a century of experimental work and unique genetic possibilities allow the exchange of genetically definable plastids, individual or multiple chromosomes, and/or entire haploid genomes (Renner complexes) between species. However, molecular genetic approaches for the genus are largely lacking. In this study, we describe the development of efficient PCR-based marker systems for both the nuclear genome and the plastome. They allow distinguishing individual chromosomes, Renner complexes, plastomes, and subplastomes. We demonstrate their application by monitoring interspecific exchanges of genomes, chromosome pairs, and/or plastids during crossing programs, e.g., to produce plastome-genome incompatible hybrids. Using an appropriate partial permanent translocation heterozygous hybrid, linkage group 7 of the molecular map could be assigned to chromosome 9.8 of the classical Oenothera map. Finally, we provide the first direct molecular evidence that homologous recombination and free segregation of chromosomes in permanent translocation heterozygous strains is suppressed.

  20. Isotopic and molecular fractionation in combustion; three routes to molecular marker validation, including direct molecular 'dating' (GC/AMS)

    Science.gov (United States)

    Currie, L. A.; Klouda, G. A.; Benner, B. A.; Garrity, K.; Eglinton, T. I.

    The identification of unique isotopic, elemental, and molecular markers for sources of combustion aerosol has growing practical importance because of the potential effects of fine particle aerosol on health, visibility and global climate. It is urgent, therefore, that substantial efforts be directed toward the validation of assumptions involving the use of such tracers for source apportionment. We describe here three independent routes toward carbonaceous aerosol molecular marker identification and validation: (1) tracer regression and multivariate statistical techniques applied to field measurements of mixed source, carbonaceous aerosols; (2) a new development in aerosol 14C metrology: direct, pure compound accelerator mass spectrometry (AMS) by off-line GC/AMS ('molecular dating'); and (3) direct observation of isotopic and molecular source emissions during controlled laboratory combustion of specific fuels. Findings from the combined studies include: independent support for benzo( ghi)perylene as a motor vehicle tracer from the first (statistical) and second (direct 'dating') studies; a new indication, from the third (controlled combustion) study, of a relation between 13C isotopic fractionation and PAH molecular fractionation, also linked with fuel and stage of combustion; and quantitative data showing the influence of both fuel type and combustion conditions on the yields of such species as elemental carbon and PAH, reinforcing the importance of exercising caution when applying presumed conservative elemental or organic tracers to fossil or biomass burning field data as in the first study.

  1. Molecular analysis and genomic organization of major DNA satellites in banana (Musa spp.).

    Science.gov (United States)

    Čížková, Jana; Hřibová, Eva; Humplíková, Lenka; Christelová, Pavla; Suchánková, Pavla; Doležel, Jaroslav

    2013-01-01

    Satellite DNA sequences consist of tandemly arranged repetitive units up to thousands nucleotides long in head-to-tail orientation. The evolutionary processes by which satellites arise and evolve include unequal crossing over, gene conversion, transposition and extra chromosomal circular DNA formation. Large blocks of satellite DNA are often observed in heterochromatic regions of chromosomes and are a typical component of centromeric and telomeric regions. Satellite-rich loci may show specific banding patterns and facilitate chromosome identification and analysis of structural chromosome changes. Unlike many other genomes, nuclear genomes of banana (Musa spp.) are poor in satellite DNA and the information on this class of DNA remains limited. The banana cultivars are seed sterile clones originating mostly from natural intra-specific crosses within M. acuminata (A genome) and inter-specific crosses between M. acuminata and M. balbisiana (B genome). Previous studies revealed the closely related nature of the A and B genomes, including similarities in repetitive DNA. In this study we focused on two main banana DNA satellites, which were previously identified in silico. Their genomic organization and molecular diversity was analyzed in a set of nineteen Musa accessions, including representatives of A, B and S (M. schizocarpa) genomes and their inter-specific hybrids. The two DNA satellites showed a high level of sequence conservation within, and a high homology between Musa species. FISH with probes for the satellite DNA sequences, rRNA genes and a single-copy BAC clone 2G17 resulted in characteristic chromosome banding patterns in M. acuminata and M. balbisiana which may aid in determining genomic constitution in interspecific hybrids. In addition to improving the knowledge on Musa satellite DNA, our study increases the number of cytogenetic markers and the number of individual chromosomes, which can be identified in Musa.

  2. Suitability and use of two molecular markers to track race-specific ...

    African Journals Online (AJOL)

    Molecular markers linked to resistance to different races of S. gesneriodes have been identified. It was desirable to demonstrate the applicability and efficiency for use in ... The two marker data set were significantly correlated with the phenotypic data (r=0.95). Based on the tight linkage with the resistant locus, 61RM2 was ...

  3. Cytoplasmic and nuclear DNA markers as powerful tools in ...

    African Journals Online (AJOL)

    Plants are distinguished among eukaryotes in possessing two DNA-containing organelles, the mitochondrion and the plastid, whereas, most eucaryotes contain only the mitochondrial genome. Recently, both organelles are used efficiently in population studies as plant geneticists developed molecular techniques that ...

  4. Segmental distribution of some common molecular markers for colorectal cancer (CRC): influencing factors and potential implications.

    Science.gov (United States)

    Papagiorgis, Petros Christakis

    2016-05-01

    Proximal and distal colorectal cancers (CRCs) are regarded as distinct disease entities, evolving through different genetic pathways and showing multiple clinicopathological and molecular differences. Segmental distribution of some common markers (e.g., KRAS, EGFR, Ki-67, Bcl-2, COX-2) is clinically important, potentially affecting their prognostic or predictive value. However, this distribution is influenced by a variety of factors such as the anatomical overlap of tumorigenic molecular events, associations of some markers with other clinicopathological features (stage and/or grade), and wide methodological variability in markers' assessment. All these factors represent principal influences followed by intratumoral heterogeneity and geographic variation in the frequency of detection of particular markers, whereas the role of other potential influences (e.g., pre-adjuvant treatment, interaction between markers) remains rather unclear. Better understanding and elucidation of the various influences may provide a more accurate picture of the segmental distribution of molecular markers in CRC, potentially allowing the application of a novel patient stratification for treatment, based on particular molecular profiles in combination with tumor location.

  5. Molecular Mechanisms of DNA Replication Checkpoint Activation

    Directory of Open Access Journals (Sweden)

    Bénédicte Recolin

    2014-03-01

    Full Text Available The major challenge of the cell cycle is to deliver an intact, and fully duplicated, genetic material to the daughter cells. To this end, progression of DNA synthesis is monitored by a feedback mechanism known as replication checkpoint that is untimely linked to DNA replication. This signaling pathway ensures coordination of DNA synthesis with cell cycle progression. Failure to activate this checkpoint in response to perturbation of DNA synthesis (replication stress results in forced cell division leading to chromosome fragmentation, aneuploidy, and genomic instability. In this review, we will describe current knowledge of the molecular determinants of the DNA replication checkpoint in eukaryotic cells and discuss a model of activation of this signaling pathway crucial for maintenance of genomic stability.

  6. Molecular Dynamics Simulation of High Density DNA Arrays

    Directory of Open Access Journals (Sweden)

    Rudolf Podgornik

    2018-01-01

    Full Text Available Densely packed DNA arrays exhibit hexagonal and orthorhombic local packings, as well as a weakly first order transition between them. While we have some understanding of the interactions between DNA molecules in aqueous ionic solutions, the structural details of its ordered phases and the mechanism governing the respective phase transitions between them remains less well understood. Since at high DNA densities, i.e., small interaxial spacings, one can neither neglect the atomic details of the interacting macromolecular surfaces nor the atomic details of the intervening ionic solution, the atomistic resolution is a sine qua non to properly describe and analyze the interactions between DNA molecules. In fact, in order to properly understand the details of the observed osmotic equation of state, one needs to implement multiple levels of organization, spanning the range from the molecular order of DNA itself, the possible ordering of counterions, and then all the way to the induced molecular ordering of the aqueous solvent, all coupled together by electrostatic, steric, thermal and direct hydrogen-bonding interactions. Multiscale simulations therefore appear as singularly suited to connect the microscopic details of this system with its macroscopic thermodynamic behavior. We review the details of the simulation of dense atomistically resolved DNA arrays with different packing symmetries and the ensuing osmotic equation of state obtained by enclosing a DNA array in a monovalent salt and multivalent (spermidine counterions within a solvent permeable membrane, mimicking the behavior of DNA arrays subjected to external osmotic stress. By varying the DNA density, the local packing symmetry, and the counterion type, we are able to analyze the osmotic equation of state together with the full structural characterization of the DNA subphase, the counterion distribution and the solvent structural order in terms of its different order parameters and

  7. Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers

    Directory of Open Access Journals (Sweden)

    Liwu Zhang

    2015-10-01

    Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  8. Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers

    Institute of Scientific and Technical Information of China (English)

    Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi

    2015-01-01

    Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  9. Molecular dosimetry of chemical mutagens: measurement of molecular dose and DNA repair germ cells

    International Nuclear Information System (INIS)

    Sega, G.A.

    1975-01-01

    Molecular dosimetry in the germ cells of male mice is reviewed with regard to in vivo alkylation of sperm heads, in vivo alkylation of sperm DNA, and possible alkylation of sperm protamine. DNA repair in male germ cells is reviewed with regard to basic design of experiments, DNA repair in various stages of spermatogenesis, effect of protamine on DNA repair following treatment with EMS or x radiation, and induction of DNA repair by methyl methanesulfonate, propyl methanesulfonate, and isopropyl methanesulfonate

  10. comparison between dna-based, pomological and chemical ...

    African Journals Online (AJOL)

    2015-09-01

    Sep 1, 2015 ... of extra virgin olive oil and consequently for better marketing. Habitually, the ... Several molecular marker techniques such as random amplified .... negatively correlated to the rate of unsaponifiable matter. .... DNA Extraction.

  11. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    NARCIS (Netherlands)

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de G.S.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.; Houbraken, J.; Quaedvlieg, W.; Stielow, B.; Vu, T.D.; Walther, G.

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it

  12. Criteria for selection and application of molecular markers for clinical studies of osteoarthritis.

    Science.gov (United States)

    Otterness, I G; Swindell, A C

    2003-03-01

    To develop criteria for the selection and application of molecular markers for the study of osteoarthritis (OA). Statistical criteria for marker selection for OA are developed. After studying more than 20 different molecular markers for monitoring OA, procedures for choosing markers for clinical studies have been developed. For a particular study, the process starts with the markers showing 'face-validity' for monitoring OA. They are next required to successfully distinguish OA patients from controls. This necessitates definition of the distribution of marker values in OA patients and controls. So far, they have been consistently log-normal. The difference (Delta) in marker values between OA and controls defines the opportunity for marker improvement. The between-visit standard deviation (S) in patients puts limits on the detection of marker changes. The two variables can be combined to estimate the practicality of a marker using a modified power analysis. The number of patients (N*) required to observe a 50% improvement with an alpha level of P=0.05 and with 80% certainty is estimated as 50(S/Delta)(2). N*, S and Delta should be used to characterize and compare markers. Marker efficiency can be refined by regressing on secondary variables, such as age, sex, BMI, severity, etc. Finally, the use of two or more markers may be required to improve marker prediction of clinical outcome. Correlated markers can be used to reinforce conclusions by essentially adding replicative data. Independent, complementary markers can be used to develop associations with clinical parameters, and perhaps diagnose and monitor disease status, activities that so far have not been possible with single markers.

  13. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability.

    Science.gov (United States)

    Raieta, Katia; Muccillo, Livio; Colantuoni, Vittorio

    2015-04-01

    Extra virgin olive oil production has a worldwide economic impact. The use of this brand, however, is of great concern to Institutions and private industries because of the increasing number of fraud and adulteration attempts to the market products. Here, we present a novel, reliable and not expensive method for extracting the DNA from commercial virgin and extra virgin olive oils. The DNA is stable overtime and amenable for molecular analyses; in fact, by carrying out simple sequence repeats (SSRs) markers analysis, we characterise the genetic profile of monovarietal olive oils. By comparing the oil-derived pattern with that of the corresponding tree, we can unambiguously identify four cultivars from Samnium, a region of Southern Italy, and distinguish them from reference and more widely used varieties. Through a parentage statistical analysis, we also identify the putative pollinators, establishing an unprecedented and powerful tool for olive oil traceability. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Molecular marker screening of tomato, ( solanum lycopersicum L ...

    African Journals Online (AJOL)

    Tomato is one of the crops in which genetic resistance has specially been effective against root-knot nematodes. In this study, molecular screening was done on some tomato germplasm to detect markers for the gene that confers resistance (Mi) with specific primer (Mi23/F//Mi23/R). The cultivars; VFNT, FLA 505-BL 1172, ...

  15. Effect of lifelong football training on the expression of muscle molecular markers involved in healthy longevity.

    Science.gov (United States)

    Mancini, A; Vitucci, D; Labruna, G; Imperlini, E; Randers, M B; Schmidt, J F; Hagman, M; Andersen, T R; Russo, R; Orrù, S; Krustrup, P; Salvatore, F; Buono, P

    2017-04-01

    We investigated whether lifelong football training affects the expression of healthy longevity-related muscle molecular markers. Biopsies were collected from the vastus lateralis muscle of 10 lifelong football-trained men (68.2 ± 3.0 years) and of 10 active untrained healthy men (66.7 ± 1.3 years). Gene and protein expression was measured by RTqPCR on RNA and by western blotting on protein extracts from muscle biopsies, respectively. The expression of AMPKα1/α2, NAMPT, TFAM and PGC1α, which are markers of oxidative metabolism, and MyHC β isoform expression was higher in the muscle of football-trained men vs untrained men. Also citrate synthase activity was higher in trained than in untrained men (109.3 ± 9.2 vs 75.1 ± 9.2 mU/mg). These findings were associated with a healthier body composition in trained than in untrained men [body weight: 78.2 ± 6.5 vs 91.2 ± 11.2 kg; body mass index BMI: 24.4 ± 1.6 vs 28.8 ± 4.0 kg m -2 ; fat%: 22.6 ± 8.0 vs 31.4 ± 5.0%)] and with a higher maximal oxygen uptake (VO 2 max: 34.7 ± 3.8 vs 27.3 ± 4.0 ml/min/kg). Also the expression of proteins involved in DNA repair and in senescence suppression (Erk1/2, Akt and FoxM1) was higher in trained than in untrained men. At BMI- and age-adjusted multiple linear regression analysis, fat percentage was independently associated with Akt protein expression, and VO 2 max was independently associated with TFAM mRNA and with Erk1/2 protein expression. Lifelong football training increases the expression of key markers involved in muscle oxidative metabolism, and in the DNA repair and senescence suppression pathways, thus providing the molecular basis for healthy longevity.

  16. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Science.gov (United States)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  17. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  18. A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

    Science.gov (United States)

    Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

    2001-12-01

    Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

  19. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  20. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  1. Transferability of molecular markers from major legumes to Lathyrus spp. for their application in mapping and diversity studies.

    Science.gov (United States)

    Almeida, Nuno Felipe; Trindade Leitão, Susana; Caminero, Constantino; Torres, Ana Maria; Rubiales, Diego; Vaz Patto, Maria Carlota

    2014-01-01

    Lathyrus cicera L. (chickling pea) and L. sativus L. (grass pea) have great potential among grain legumes due to their adaptability to inauspicious environments, high protein content and resistance to serious diseases. Nevertheless, due to its past underused, further activities are required to exploit this potential and to capitalise on the advances in molecular biology that enable improved Lathyrus spp. breeding programmes. In this study we evaluated the transferability of molecular markers developed for closely related legume species to Lathyrus spp. (Medicago truncatula, pea, lentil, faba bean and lupin) and tested the application of those new molecular tools on Lathyrus mapping and diversity studies. Genomic and expressed sequence tag microsatellite, intron-targeted amplified polymorphic, resistance gene analogue and defence-related gene markers were tested. In total 128 (27.7 %) and 132 (28.6 %) molecular markers were successfully cross-amplified, respectively in L. cicera and L. sativus. In total, the efficiency of transferability from genomic microsatellites was 5 %, and from gene-based markers, 55 %. For L. cicera, three cleaved amplified polymorphic sequence markers and one derived cleaved amplified polymorphic sequence marker based on the cross-amplified markers were also developed. Nine of those molecular markers were suitable for mapping in a L. cicera recombinant inbred line population. From the 17 molecular markers tested for diversity analysis, six (35 %) in L. cicera and seven (41 %) in L. sativus were polymorphic and discriminate well all the L. sativus accessions. Additionally, L. cicera accessions were clearly distinguished from L. sativus accessions. This work revealed a high number of transferable molecular markers to be used in current genomic studies in Lathyrus spp. Although their usefulness was higher on diversity studies, they represent the first steps for future comparative mapping involving these species.

  2. dna profiling of capsicum annuum with the help of molecular markers

    African Journals Online (AJOL)

    isha

    2013-07-24

    Jul 24, 2013 ... Since the commercial value of chilli pepper is based on pungency level, ... Randomly Amplified Polymorphic DNA, Dendrogram, Polymerase Chain ..... the Amazon department in Columbia, characterization by AFLPs of.

  3. Molecular identification and genetic variation of varieties of Styphnolobium japonicum (Fabaceae) using SRAP markers.

    Science.gov (United States)

    Sun, R X; Zhang, C H; Zheng, Y Q; Zong, Y C; Yu, X D; Huang, P

    2016-05-06

    Thirty-four Styphnolobium japonicum varieties were analyzed using sequence-related amplified polymorphism (SRAP) markers, to investigate genetic variation and test the effectiveness of SRAP markers in DNA fingerprint establishment. Twelve primer pairs were selected from 120 primer combinations for their reproducibility and high polymorphism. We found a total of 430 amplified fragments, of which 415 fragments were considered polymorphic with an average of 34.58 polymorphic fragments for each primer combination. The percentage of polymorphic fragments was 96.60%, and four primer pairs showed 100% polymorphism. Moreover, simple matched coefficients ranged between 0.68 and 0.89, with an average of 0.785, indicating that the genetic variation among varieties was relatively low. This could be because of the narrow genetic basis of the selected breeding material. Based on the similarity coefficient value of 0.76, the varieties were divided into four major groups. In addition, abundant and clear SRAP fingerprints were obtained and could be used to establish DNA fingerprints. In the DNA fingerprints, each variety had its unique pattern that could be easily distinguished from others. The results demonstrated that 34 varieties of S. japonicum had a relatively narrow genetic variation. Hence, a broadening of the genetic basis of breeding material is necessary. We conclude that establishment of DNA fingerprint is feasible by means of SRAP markers.

  4. Recent advances in yeast molecular biology: recombinant DNA. [Lead abstract

    Energy Technology Data Exchange (ETDEWEB)

    1982-09-01

    Separate abstracts were prepared for the 25 papers presented at a workshop focusing on chromosomal structure, gene regulation, recombination, DNA repair, and cell type control, that have been obtained by experimental approaches incorporating the new technologies of yeast DNA transformation, molecular cloning, and DNA sequence analysis. (KRM)

  5. Influence of molecular weight of DNA on the determination of anti-DNA antibodies in systemic lupus erythematosus (SLE) sera by radioimmunoassay

    Energy Technology Data Exchange (ETDEWEB)

    Geisert, M; Heicke, B; Metzmann, E; Zahn, R K

    1975-04-01

    Using a radioimmunoassay (RIA) based on the Farr technique with radioactively labeled /sup 3/H-DNA for quantitative measurements of anti-DNA antibodies in sera of patients with systemic lupus erythematosus (SLE), the influence of molecular weight of DNA (ranging from 0.1 x 10/sup 6/ to 22.0 x 10/sup 6/ daltons) on binding and precipitation in this system has been investigated. Comparing our results with mathematical models it follows that one antibody molecule is fixed on the average to a statistical DNA segment of 2 x 10/sup 6/ to 4 x 10/sup 6/ daltons. Furthermore binding capacity of the DNA was found to be independent of the molecular weight, as demonstrated in a double label experiment using /sup 14/C and /sup 3/H-labeled DNA of different size. However, the amount of radioactivity precipitated was found to depend on the molecular weight of the labeled DNA following a non-linear function. It was calculated that a minimal ratio of fixed antibody molecules per a certain size of DNA was necessary for precipitation. The mathematical treatment of the observed non-linear precipitation dependence will be discussed using various statistical models. The results indicate that the quantitative measurements of anti-DNA antibodies with the Farr technique e.g., for diagnosis and control of SLE in clinical immunology is highly dependent on the molecular weight of the labeled DNA used in the assay system and reliable results are only obtained with DNA of a sufficiently high molecular weight. (auth)

  6. Serum ALT levels as a surrogate marker for serum HBV DNA levels in HBeAg-negative pregnant women.

    Science.gov (United States)

    Sangfelt, Per; Von Sydow, Madeleine; Uhnoo, Ingrid; Weiland, Ola; Lindh, Gudrun; Fischler, Björn; Lindgren, Susanne; Reichard, Olle

    2004-01-01

    In Stockholm, Sweden, the majority of pregnant women positive for hepatitis B surface antigen (HBsAg) are hepatitis Be antigen (HBeAg) negative. Newborns to HBeAg positive mothers receive vaccination and hepatitis B immunoglobulin (HBIg). Newborns to HBeAg negative mothers receive vaccine and HBIg only if the mothers have elevated ALT levels. The aim of this study was to retrospectively evaluate ALT levels as a surrogate marker for HBV DNA levels in HBeAg negative carrier mothers. Altogether 8947 pregnant women were screened for HBV markers from 1999 to 2001 at the Virology Department, Karolinska Hospital. Among mothers screened 192 tested positive for HBsAg (2.2%). 13 of these samples could not be retrieved. Of the remaining 179 sera, 8 (4%) tested positive for HBeAg and 171 (95.5%) were HBeAg negative. Among the HBeAg negative mothers, 9 had HBV DNA levels > 10(5) copies/ml, and of these 7 had normal ALT levels indicating low sensitivity of an elevated ALT level as a surrogate marker for high HBV DNA level. Furthermore, no correlation was found between ALT and HBV DNA levels. Hence, it is concluded that the use of ALT as a surrogate marker for high viral replication in HBeAg negative mothers could be questioned.

  7. Molecular dynamics simulations of DNA-free and DNA-bound TAL effectors.

    Directory of Open Access Journals (Sweden)

    Hua Wan

    Full Text Available TAL (transcriptional activator-like effectors (TALEs are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA, the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL. The conformational analysis of DNA indicates that the 5' end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism.

  8. Forensic botany II, DNA barcode for land plants: Which markers after the international agreement?

    Science.gov (United States)

    Ferri, G; Corradini, B; Ferrari, F; Santunione, A L; Palazzoli, F; Alu', M

    2015-03-01

    The ambitious idea of using a short piece of DNA for large-scale species identification (DNA barcoding) is already a powerful tool for scientists and the application of this standard technique seems promising in a range of fields including forensic genetics. While DNA barcoding enjoyed a remarkable success for animal identification through cytochrome c oxidase I (COI) analysis, the attempts to identify a single barcode for plants remained a vain hope for a longtime. From the beginning, the Consortium for the Barcode of Life (CBOL) showed a lack of agreement on a core plant barcode, reflecting the diversity of viewpoints. Different research groups advocated various markers with divergent set of criteria until the recent publication by the CBOL-Plant Working Group. After a four-year effort, in 2009 the International Team concluded to agree on standard markers promoting a multilocus solution (rbcL and matK), with 70-75% of discrimination to the species level. In 2009 our group firstly proposed the broad application of DNA barcoding principles as a tool for identification of trace botanical evidence through the analysis of two chloroplast loci (trnH-psbA and trnL-trnF) in plant species belonging to local flora. Difficulties and drawbacks that were encountered included a poor coverage of species in specific databases and the lack of authenticated reference sequences for the selected markers. Successful preliminary results were obtained providing an approach to progressively identify unknown plant specimens to a given taxonomic rank, usable by any non-specialist botanist or in case of a shortage of taxonomic expertise. Now we considered mandatory to update and to compare our previous findings with the new selected plastid markers (matK+rbcL), taking into account forensic requirements. Features of all the four loci (the two previously analyzed trnH-psbA+trnL-trnF and matK+rbcL) were compared singly and in multilocus solutions to assess the most suitable combination for

  9. High molecular weight DNA assembly in vivo for synthetic biology applications.

    Science.gov (United States)

    Juhas, Mario; Ajioka, James W

    2017-05-01

    DNA assembly is the key technology of the emerging interdisciplinary field of synthetic biology. While the assembly of smaller DNA fragments is usually performed in vitro, high molecular weight DNA molecules are assembled in vivo via homologous recombination in the host cell. Escherichia coli, Bacillus subtilis and Saccharomyces cerevisiae are the main hosts used for DNA assembly in vivo. Progress in DNA assembly over the last few years has paved the way for the construction of whole genomes. This review provides an update on recent synthetic biology advances with particular emphasis on high molecular weight DNA assembly in vivo in E. coli, B. subtilis and S. cerevisiae. Special attention is paid to the assembly of whole genomes, such as those of the first synthetic cell, synthetic yeast and minimal genomes.

  10. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    2011-01-01

    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  11. Ultrafast spectroscopy on DNA-cleavage by endonuclease in molecular crowding.

    Science.gov (United States)

    Singh, Priya; Choudhury, Susobhan; Dutta, Shreyasi; Adhikari, Aniruddha; Bhattacharya, Siddhartha; Pal, Debasish; Pal, Samir Kumar

    2017-10-01

    The jam-packed intracellular environments differ the activity of a biological macromolecule from that in laboratory environments (in vitro) through a number of mechanisms called molecular crowding related to structure, function and dynamics of the macromolecule. Here, we have explored the structure, function and dynamics of a model enzyme protein DNase I in molecular crowing of polyethylene glycol (PEG; MW 3350). We have used steady state and picosecond resolved dynamics of a well-known intercalator ethidium bromide (EB) in a 20-mer double-stranded DNA (dsDNA) to monitor the DNA-cleavage by the enzyme in absence and presence PEG. We have also labelled the enzyme by a well-known fluorescent probe 8-anilino-1-naphthalenesulfonic acid ammonium salt (ANS) to study the molecular mechanism of the protein-DNA association through exited state relaxation of the probe in absence (dictated by polarity) and presence of EB in the DNA (dictated by Förster resonance energy transfer (FRET)). The overall and local structures of the protein in presence of PEG have been followed by circular dichroism and time resolved polarization gated spectroscopy respectively. The enhanced dynamical flexibility of protein in presence of PEG as revealed from excited state lifetime and polarization gated anisotropy of ANS has been correlated with the stronger DNA-binding for the higher nuclease activity. We have also used conventional experimental strategy of agarose gel electrophoresis to monitor DNA-cleavage and found consistent results of enhanced nuclease activities both on synthetic 20-mer oligonucleotide and long genomic DNA from calf thymus. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. DNAzyme Feedback Amplification: Relaying Molecular Recognition to Exponential DNA Amplification.

    Science.gov (United States)

    Liu, Meng; Yin, Qingxin; McConnell, Erin M; Chang, Yangyang; Brennan, John D; Li, Yingfu

    2018-03-26

    Technologies capable of linking DNA amplification to molecular recognition are very desirable for ultrasensitive biosensing applications. We have developed a simple but powerful isothermal DNA amplification method, termed DNAzyme feedback amplification (DFA), that is capable of relaying molecular recognition to exponential DNA amplification. The method incorporates both an RNA-cleaving DNAzyme (RCD) and rolling circle amplification (RCA) carried out by a special DNA polymerase using a circular DNA template. DFA begins with a stimulus-dependent RCA reaction, producing tandemly linked RCDs in long-chain DNA products. These RCDs cleave an RNA-containing DNA sequence to form additional primers that hybridize to the circular DNA molecule, giving rise to DNA assemblies that act as the new inputs for RCA. The RCA reaction and the cleavage event keep on feeding each other autonomously, resulting in exponential growth of repetitive DNA sequences that can be easily detected. This method can be used for the detection of both nucleic acid based targets and non-nucleic acid analytes. In this article, we discuss the conceptual framework of the feedback amplification approach, the essential features of this method as well as remaining challenges and possible solutions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Construction of an SSR and RAD-Marker Based Molecular Linkage Map of Vigna vexillata (L.) A. Rich.

    Science.gov (United States)

    Marubodee, Rusama; Ogiso-Tanaka, Eri; Isemura, Takehisa; Chankaew, Sompong; Kaga, Akito; Naito, Ken; Ehara, Hiroshi; Tomooka, Norihiko

    2015-01-01

    Vigna vexillata (L.) A. Rich. (tuber cowpea) is an underutilized crop for consuming its tuber and mature seeds. Wild form of V. vexillata is a pan-tropical perennial herbaceous plant which has been used by local people as a food. Wild V. vexillata has also been considered as useful gene(s) source for V. unguiculata (cowpea), since it was reported to have various resistance gene(s) for insects and diseases of cowpea. To exploit the potential of V. vexillata, an SSR-based linkage map of V. vexillata was developed. A total of 874 SSR markers successfully amplified single DNA fragment in V. vexillata among 1,336 SSR markers developed from Vigna angularis (azuki bean), V. unguiculata and Phaseolus vulgaris (common bean). An F2 population of 300 plants derived from a cross between salt resistant (V1) and susceptible (V5) accessions was used for mapping. A genetic linkage map was constructed using 82 polymorphic SSR markers loci, which could be assigned to 11 linkage groups spanning 511.5 cM in length with a mean distance of 7.2 cM between adjacent markers. To develop higher density molecular linkage map and to confirm SSR markers position in a linkage map, RAD markers were developed and a combined SSR and RAD markers linkage map of V. vexillata was constructed. A total of 559 (84 SSR and 475 RAD) markers loci could be assigned to 11 linkage groups spanning 973.9 cM in length with a mean distance of 1.8 cM between adjacent markers. Linkage and genetic position of all SSR markers in an SSR linkage map were confirmed. When an SSR genetic linkage map of V. vexillata was compared with those of V. radiata and V. unguiculata, it was suggested that the structure of V. vexillata chromosome was considerably differentiated. This map is the first SSR and RAD marker-based V. vexillata linkage map which can be used for the mapping of useful traits.

  14. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  15. Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

    Science.gov (United States)

    Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

    2016-06-04

    Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

  16. Molecular genetic diversity assessment of Citrus species grown in Iran revealed by SSR, ISSR and CAPS molecular markers

    Directory of Open Access Journals (Sweden)

    Ata Allah Sharafi

    2017-12-01

    Full Text Available In this study, genetic diversity in 19 citrus cultivars was analyzed using Simple Sequence Repeat (SSR, Inter-simple Sequence Repeat (ISSR and cleaved amplified polymorphic sequence (CAPS markers. Nine primers for SSR, nine ISSR primers and two primers for CAPS were used for allele scoring. One chloroplast DNA region (rbcL-ORF106 and one mitochondrial DNA region (18S-5S were analyzed using cleaved amplified polymorphic sequence (CAPS marker in 19 citrus accessions grown in Iran. In total, 45 SSR and 131 ISSR polymorphic alleles and tree organelle genome types were detected. Cluster analysis of SSR and ISSR data was performed using UPGMA method and based on Jaccard's coefficient. The result of this investigation showed that the SSR and ISSR primers were highly informative and efficient in detecting genetic variability and relationships of the citrus accessions. And CAPS marker analysis Results showed that Bakraee and one of off type Mexican lime had banding pattern similar to Clementine Mandarin, while Pummelo regarded as maternal parent of other studied genotypes Citron regarded as father parent showed definite banding pattern among 19 studied genotypes which it confirmed Cytoplasmic inheritance from mother cellular organelles.

  17. [Molecular markers: an important tool in the diagnosis, treatment and epidemiology of invasive aspergillosis].

    Science.gov (United States)

    Frías-de León, María Guadalupe; Acosta-Altamirano, Gustavo; Duarte-Escalante, Esperanza; Martínez-Hernández, José Enrique; Martínez-Rivera, María de Los Ángeles; Reyes-Montes, María Del Rocío

    2014-01-01

    Increase in the incidence of invasive aspergillosis has represented a difficult problem for management of patients with this infection due to its high rate of mortality, limited knowledge concerning its diagnosis, and therapeutic practice. The difficulty in management of patients with aspergillosis initiates with detection of the fungus in the specimens of immunosuppressed patients infected with Aspergillus fumigatus; in addition, difficulty exists in terms of the development of resistance to antifungals as a consequence of their indiscriminate use in prophylactic and therapeutic practice and to ignorance concerning the epidemiological data of aspergillosis. With the aim of resolving these problems, molecular markers is employed at present with specific and accurate results. However, in Mexico, the use of molecular markers has not yet been implemented in the routine of intrahospital laboratories; despite the fact that these molecular markers has been widely referred in the literature, it is necessary for it to validated and standardized to ensure that the results obtained in any laboratory would be reliable and comparable. In the present review, we present an update on the usefulness of molecular markers in accurate identification of A. fumigatus, detection of resistance to antifugal triazoles, and epidemiological studies for establishing the necessary measures for prevention and control of aspergillosis.

  18. Molecular mechanisms in radiation damage to DNA: Final report

    International Nuclear Information System (INIS)

    Osman, R.

    1996-01-01

    The objectives of this work were to elucidate the molecular mechanisms that were responsible for radiation-induced DNA damage. The studies were based on theoretical explorations of possible mechanisms that link initial radiation damage in the form of base and sugar damage to conformational changes in DNA

  19. Recent advances in high-throughput molecular marker identification for superficial and invasive bladder cancers

    DEFF Research Database (Denmark)

    Andersen, Lars Dyrskjøt; Zieger, Karsten; Ørntoft, Torben Falck

    2007-01-01

    individually contributed to the management of the disease. However, the development of high-throughput techniques for simultaneous assessment of a large number of markers has allowed classification of tumors into clinically relevant molecular subgroups beyond those possible by pathological classification. Here......Bladder cancer is the fifth most common neoplasm in industrialized countries. Due to frequent recurrences of the superficial form of this disease, bladder cancer ranks as one of the most common cancers. Despite the description of a large number of tumor markers for bladder cancers, none have......, we review the recent advances in high-throughput molecular marker identification for superficial and invasive bladder cancers....

  20. Use of RAPD marker for identification of DNA polymorphism in gamma rays treated Jatropha Curcas L

    International Nuclear Information System (INIS)

    Dhakshanamoorthy, Dharman; Selvaraj, Radhakrishnan

    2010-01-01

    The aim of this study is to examine the discriminatory power of random amplified polymorphic DNA (RAPD) marker in Jatropha curcas, and to determine the effect of various dose exposures (0, 5, 10, f, 20 and 25 Kr) of gamma rays on J. curcas, at molecular level. All the ten random primers used produced reproducible polymorphic bands. PCR products of mutant genome revealed a total of 40 bands, out of which 27 were polymorphic. Polymorphism information content (PIC) values were ranged from 0.00 to 0.40 and the highest PIC value of 0.40 was observed in primer OPU-13 followed by primers OPAL-II and OPT-18 (0.30) while no PIC value were reported in primers OPH-18 and OPM-13. Jaccard's coefficient of similarity varied from 0.476 to 0.723, indicative of high level of genetic variation among the mutants studied. UPGMA cluster analysis indicated three distinct clusters, one comprising control while the second included four mutants viz., 10, 15, 25 and 20 Kr. The mutant 5 Kr remained distinct and formed third cluster indicating its higher genetic diversity from the rest of the mutants and control. The primer OPU-13 produced maximum number of bands (8) showed highest discriminatory power and PIC (0.40) by showing maximum number of polymorphic bands (5) when compared to other primers used. The study reveals that RAPD molecular markers can be used to assess polymorphism among the mutants and can be a useful tool to supplement the distinctness, uniformity and stability analysis for plant varietal identification and protection. (author)

  1. Use of RAPD marker for identification of DNA polymorphism in gamma rays treated Jatropha Curcas L

    Energy Technology Data Exchange (ETDEWEB)

    Dhakshanamoorthy, Dharman; Selvaraj, Radhakrishnan [Department of Botany, Annamalai University, Annamalainagar (India)

    2010-07-15

    The aim of this study is to examine the discriminatory power of random amplified polymorphic DNA (RAPD) marker in Jatropha curcas, and to determine the effect of various dose exposures (0, 5, 10, f, 20 and 25 Kr) of gamma rays on J. curcas, at molecular level. All the ten random primers used produced reproducible polymorphic bands. PCR products of mutant genome revealed a total of 40 bands, out of which 27 were polymorphic. Polymorphism information content (PIC) values were ranged from 0.00 to 0.40 and the highest PIC value of 0.40 was observed in primer OPU-13 followed by primers OPAL-II and OPT-18 (0.30) while no PIC value were reported in primers OPH-18 and OPM-13. Jaccard's coefficient of similarity varied from 0.476 to 0.723, indicative of high level of genetic variation among the mutants studied. UPGMA cluster analysis indicated three distinct clusters, one comprising control while the second included four mutants viz., 10, 15, 25 and 20 Kr. The mutant 5 Kr remained distinct and formed third cluster indicating its higher genetic diversity from the rest of the mutants and control. The primer OPU-13 produced maximum number of bands (8) showed highest discriminatory power and PIC (0.40) by showing maximum number of polymorphic bands (5) when compared to other primers used. The study reveals that RAPD molecular markers can be used to assess polymorphism among the mutants and can be a useful tool to supplement the distinctness, uniformity and stability analysis for plant varietal identification and protection. (author)

  2. Molecular Characterization of Sudanese and Southern Sudanese Chicken Breeds Using mtDNA D-Loop

    Directory of Open Access Journals (Sweden)

    Charles E. Wani

    2014-01-01

    Full Text Available The objective of this study was to assess the genetic relationships and diversity and to estimate the amount of gene flow among the five chicken populations from Sudan and South Sudan and commercial strain of egg line White Leghorn chickens. The chicken populations were genotyped using mtDNA D-loop as a molecular marker. PCR product of the mtDNA D-loop segment was 600 bp and 14 haplotypes were identified. The neighbor-joining phylogenetic tree indicated that the indigenous Sudanese chickens can be grouped into two clades, IV and IIIa only. Median joining networks analysis showed that haplotype LBB49 has the highest frequency. The hierarchal analysis of molecular variance (AMOVA showed that genetic variation within the population was 88.6% and the differentiation among the population was 11.4%. When the populations was redefined into two geographical zones, rich and poor Savanna, the results were fractioned into three genetic variations: between individuals within population 95.5%, between populations within the group 0.75%, and genetic variation between groups 3.75%. The pair wise Fst showed high genetic difference between Betwil populations and the rest with Fst ranging from 0.1492 to 0.2447. We found that there is large number of gene exchanges within the Sudanese indigenous chicken (Nm=4.622.

  3. Survey of Paramecium duboscqui using three markers and assessment of the molecular variability in the genus Paramecium.

    Science.gov (United States)

    Boscaro, Vittorio; Fokin, Sergei I; Verni, Franco; Petroni, Giulio

    2012-12-01

    The genus Paramecium (phylum Ciliophora) is one of the best-known among protozoa. Nevertheless, the knowledge on the diversity and distribution of species within this genus was remarkably scarce until recent times. In the last years a constantly growing amount of data has formed, especially on the distribution of species and the characterization of molecular markers. Much effort has been made on detecting clades inside each morphospecies, which could suggest the presence of sibling species complexes as in the famous case of Paramecium aurelia. In this work we present new data on Paramecium duboscqui, one of the morphospecies that have not yet been surveyed employing DNA sequences as markers. We obtained data from nine strains sampled around the world, using the three most commonly employed markers (18S rRNA gene, ITS1-5.8S-ITS2 and COI gene sequences). Moreover, we compared our results with those already available for other Paramecium species, and performed phylogenetic analyses for the entire genus. We also expanded the knowledge on the ITS2 secondary structure and its usefulness in studies on Paramecium. Our approach, that considers the data of all the species together, highlighted some characteristic patterns as well as some ambiguities that should be further investigated. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Genetic variations and relationships of cultivated and weedy types of perilla species in Korea and Japan using multi DNA markers

    International Nuclear Information System (INIS)

    Sun, Y.; Zheng, S.; Lee, J.; Hong, S.

    2017-01-01

    The genus Perilla, known as an oil crop or a Chinese medicine, vegetable crop, is widely cultivated in East Asia. It occurs in two distinct varieties, var. frutescens and var. crispa, and their genetic relationship is still obscure. To understand the genetic diversity and relationships of the cultivated and weedy types of Perilla crops in Korea, Japan and China, we evaluated the genetic variation of 20 accessions by 3 rDNA markers. Among these three markers, the nuclear ribosomal DNA (nrDNA) internal transcribed spacers (ITS) region of Perilla crops showed less sequence variations than the 5S and 18S genes. There were abundant variable nucleotide sites appearing in the 5S and 18S genes. Especially in the 18S gene, the variable nucleotide sites showed specificity between some Perilla type and other varieties. JPN1 showed 6 special variable nucleotide sites differing from other varieties, resulting in the farthest phylogenetic relationship in the 18S tree. CHI15 shared 8 special variable sites, also showing far phylogenetic relationship with other varieties. According to the sequence analysis result, the cultivated types of Korean var. frutescens showed relatively more genetic diversity than those of Japanese var. frutescens, while Korean var. crispa showed lower genetic diversity than those of Japanese var. crispa. However, the intra- or inter-variety genetic distance did not have significant difference. This work provided more sequence resources of Perilla crops and evidences to evaluate the genetic variation and relationships. Our result would help molecular type identification, functional plant breeding and trait improvement of Perilla crops. (author)

  5. Cytogenetic and molecular markers for detecting Aegilops uniaristata chromosomes in a wheat background.

    Science.gov (United States)

    Gong, Wenping; Li, Guangrong; Zhou, Jianping; Li, Genying; Liu, Cheng; Huang, Chengyan; Zhao, Zhendong; Yang, Zujun

    2014-09-01

    Aegilops uniaristata has many agronomically useful traits that can be used for wheat breeding. So far, a Triticum turgidum - Ae. uniaristata amphiploid and one set of Chinese Spring (CS) - Ae. uniaristata addition lines have been produced. To guide Ae. uniaristata chromatin transformation from these lines into cultivated wheat through chromosome engineering, reliable cytogenetic and molecular markers specific for Ae. uniaristata chromosomes need to be developed. Standard C-banding shows that C-bands mainly exist in the centromeric regions of Ae. uniaristata but rarely at the distal ends. Fluorescence in situ hybridization (FISH) using (GAA)8 as a probe showed that the hybridization signal of chromosomes 1N-7N are different, thus (GAA)8 can be used to identify all Ae. uniaristata chromosomes in wheat background simultaneously. Moreover, a total of 42 molecular markers specific for Ae. uniaristata chromosomes were developed by screening expressed sequence tag - sequence tagged site (EST-STS), expressed sequence tag - simple sequence repeat (EST-SSR), and PCR-based landmark unique gene (PLUG) primers. The markers were subsequently localized using the CS - Ae. uniaristata addition lines and different wheat cultivars as controls. The cytogenetic and molecular markers developed herein will be helpful for screening and identifying wheat - Ae. uniaristata progeny.

  6. Molecular markers linked to apomixis in Panicum maximum Jacq ...

    African Journals Online (AJOL)

    Panicum maximum Jacq. is an important forage grass of African origin largely used in the tropics. The genetic breeding of this species is based on the hybridization of sexual and apomictic genotypes and selection of apomictic F1 hybrids. The objective of this work was to identify molecular markers linked to apomixis in P.

  7. Prevalence of the molecular marker of chloroquine resistance ( pfcrt ...

    African Journals Online (AJOL)

    In line with the World Health Organization (WHO) guideline on chloroquine (CQ) resistance, CQ was withdrawn as the first-line antimalarial drug in Nigeria in 2005 as a result of ... We monitored the resistance pattern 5 years after withdrawal of CQ, using the pfcrt K76T mutation as a molecular marker for CQ resistance.

  8. Validation of systems biology derived molecular markers of renal donor organ status associated with long term allograft function.

    Science.gov (United States)

    Perco, Paul; Heinzel, Andreas; Leierer, Johannes; Schneeberger, Stefan; Bösmüller, Claudia; Oberhuber, Rupert; Wagner, Silvia; Engler, Franziska; Mayer, Gert

    2018-05-03

    Donor organ quality affects long term outcome after renal transplantation. A variety of prognostic molecular markers is available, yet their validity often remains undetermined. A network-based molecular model reflecting donor kidney status based on transcriptomics data and molecular features reported in scientific literature to be associated with chronic allograft nephropathy was created. Significantly enriched biological processes were identified and representative markers were selected. An independent kidney pre-implantation transcriptomics dataset of 76 organs was used to predict estimated glomerular filtration rate (eGFR) values twelve months after transplantation using available clinical data and marker expression values. The best-performing regression model solely based on the clinical parameters donor age, donor gender, and recipient gender explained 17% of variance in post-transplant eGFR values. The five molecular markers EGF, CD2BP2, RALBP1, SF3B1, and DDX19B representing key molecular processes of the constructed renal donor organ status molecular model in addition to the clinical parameters significantly improved model performance (p-value = 0.0007) explaining around 33% of the variability of eGFR values twelve months after transplantation. Collectively, molecular markers reflecting donor organ status significantly add to prediction of post-transplant renal function when added to the clinical parameters donor age and gender.

  9. Programmable molecular recognition based on the geometry of DNA nanostructures.

    Science.gov (United States)

    Woo, Sungwook; Rothemund, Paul W K

    2011-07-10

    From ligand-receptor binding to DNA hybridization, molecular recognition plays a central role in biology. Over the past several decades, chemists have successfully reproduced the exquisite specificity of biomolecular interactions. However, engineering multiple specific interactions in synthetic systems remains difficult. DNA retains its position as the best medium with which to create orthogonal, isoenergetic interactions, based on the complementarity of Watson-Crick binding. Here we show that DNA can be used to create diverse bonds using an entirely different principle: the geometric arrangement of blunt-end stacking interactions. We show that both binary codes and shape complementarity can serve as a basis for such stacking bonds, and explore their specificity, thermodynamics and binding rules. Orthogonal stacking bonds were used to connect five distinct DNA origami. This work, which demonstrates how a single attractive interaction can be developed to create diverse bonds, may guide strategies for molecular recognition in systems beyond DNA nanostructures.

  10. Genetic variability of Pantaneiro horse using RAPD-PCR markers

    OpenAIRE

    Egito,Andréa Alves do; Fuck,Beatriz Helena; McManus,Concepta; Paiva,Samuel Rezende; Albuquerque,Maria do Socorro Maués; Santos,Sandra Aparecida; Abreu,Urbano Gomes Pinto de; Silva,Joaquim Augusto da; Sereno,Fabiana Tavares Pires de Souza; Mariante,Arthur da Silva

    2007-01-01

    Blood samples were collected from Pantaneiro Horses in five regions of Mato Grosso do Sul and Mato Grosso States. Arabian, Mangalarga Marchador and Thoroughbred were also included to estimate genetic distances and the existing variability among and within these breeds by RAPD-PCR (Random Amplified Polymorphic DNA - Polymerase Chain Reaction) molecular markers. From 146 primers, 13 were chosen for amplification and 44 polymorphic bands were generated. The analysis of molecular variance (AMOVA)...

  11. Prediction of industrial tomato hybrids from agronomic traits and ISSR molecular markers.

    Science.gov (United States)

    Figueiredo, A S T; Resende, J T V; Faria, M V; Da-Silva, P R; Fagundes, B S; Morales, R G F

    2016-05-13

    Heterosis is a highly relevant phenomenon in plant breeding. This condition is usually established in hybrids derived from crosses of highly divergent parents. The success of a breeder in obtaining heterosis is directly related to the correct identification of genetically contrasting parents. Currently, the diallel cross is the most commonly used methodology to detect contrasting parents; however, it is a time- and cost-consuming procedure. Therefore, new tools capable of performing this task quickly and accurately are required. Thus, the purpose of this study was to estimate the genetic divergence in industrial tomato lines, based on agronomic traits, and to compare with estimates obtained using inter-simple sequence repeat (ISSR) molecular markers. The genetic divergence among 10 industrial tomato lines, based on nine morphological characters and 12 ISSR primers was analyzed. For data analysis, Pearson and Spearman correlation coefficients were calculated between the genetic dissimilarity measures estimated by Mahalanobis distance and Jaccard's coefficient of genetic dissimilarity from the heterosis estimates, combining ability, and means of important traits of industrial tomato. The ISSR markers efficiently detected contrasting parents for hybrid production in tomato. Parent RVTD-08 was indicated as the most divergent, both by molecular and morphological markers, that positively contributed to increased heterosis and by the specific combining ability in the crosses in which it participated. The genetic dissimilarity estimated by ISSR molecular markers aided the identification of the best hybrids of the experiment in terms of total fruit yield, pulp yield, and soluble solids content.

  12. Predictive gene signatures: molecular markers distinguishing colon adenomatous polyp and carcinoma.

    Directory of Open Access Journals (Sweden)

    Janice E Drew

    Full Text Available Cancers exhibit abnormal molecular signatures associated with disease initiation and progression. Molecular signatures could improve cancer screening, detection, drug development and selection of appropriate drug therapies for individual patients. Typically only very small amounts of tissue are available from patients for analysis and biopsy samples exhibit broad heterogeneity that cannot be captured using a single marker. This report details application of an in-house custom designed GenomeLab System multiplex gene expression assay, the hCellMarkerPlex, to assess predictive gene signatures of normal, adenomatous polyp and carcinoma colon tissue using archived tissue bank material. The hCellMarkerPlex incorporates twenty-one gene markers: epithelial (EZR, KRT18, NOX1, SLC9A2, proliferation (PCNA, CCND1, MS4A12, differentiation (B4GANLT2, CDX1, CDX2, apoptotic (CASP3, NOX1, NTN1, fibroblast (FSP1, COL1A1, structural (ACTG2, CNN1, DES, gene transcription (HDAC1, stem cell (LGR5, endothelial (VWF and mucin production (MUC2. Gene signatures distinguished normal, adenomatous polyp and carcinoma. Individual gene targets significantly contributing to molecular tissue types, classifier genes, were further characterised using real-time PCR, in-situ hybridisation and immunohistochemistry revealing aberrant epithelial expression of MS4A12, LGR5 CDX2, NOX1 and SLC9A2 prior to development of carcinoma. Identified gene signatures identify aberrant epithelial expression of genes prior to cancer development using in-house custom designed gene expression multiplex assays. This approach may be used to assist in objective classification of disease initiation, staging, progression and therapeutic responses using biopsy material.

  13. Preliminary Comparative Analysis of Phenological Varieties of Quercus robur by ISSR-Markers

    Directory of Open Access Journals (Sweden)

    Vasiliy Chokheli

    2016-01-01

    Full Text Available Quercus robur L. is a valuable wood species having long ontogeny and promising to create long-living artificial plantings of recreational and ameliorative purposes in the steppes zone of Russia and other countries. In this work we have performed the genotyping of varieties of Quercus robur L. obtained from collection of Botanical Garden of Southern Federal University using intersimple sequence repeat (ISSR molecular markers. The most polymorphic ISSR-marker (GA 8YC was found in the collection. The polymorphic DNA markers identified in the present study can be used for the future breeding works to obtain valuable genotypes of Quercus genus. In addition we have performed DNA fingerprinting of the prospective sample of the variety Q. robur var. tardiflora Czern.

  14. Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

    International Nuclear Information System (INIS)

    Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

    2015-01-01

    In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

  15. Separation of the genera in the subtribe Cassiinae (Leguminosae: Caesalpinioidae using molecular markers Separação dos gêneros na subtribo Cassiinae (Leguminosae: Caesalpinioidae utilizando marcadores moleculares

    Directory of Open Access Journals (Sweden)

    Laxmikanta Acharya

    2011-03-01

    Full Text Available Random amplified polymorphic DNA (RAPD, Inter simple sequence repeat (ISSR and Amplified fragment length polymorphism (AFLP markers were used to verify the segregation of the genus Cassia L. senso lato into three distinct genera namely Chamaecrista Moench., Senna P. Mill. and Cassia L. sensostricto Eighteen representatives of the three taxa were characterized using the molecular markers. 25 RAPD, six ISSR primers and six AFLP primer combinations resulted in the amplification of 612, 115 and 622 bands (loci respectively. Most of the loci are found to be polymorphic, showing high degrees of genetic diversity among the different taxa studied. The dendrogram constructed on the basis of the RAPD, ISSR and AFLP data using SHAN clustering, divided Cassia L. senso lato. into three different clusters as Chamaecrista Moench. Senna P. Mill. and Cassia L. senso stricto High bootstrap value revealed that all the clusters were stable and robust. It was observed from the present investigation that these genera have their identity at molecular level, which supports the elevation of the genus Cassia L. senso lato to the level of subtribe Cassiinae and segregation into three distinct genera instead of intrageneric categories.Técnicas de Random amplified polymorphic DNA (RAPD, Inter simple sequence repeat (ISSR e Amplified Fragment Length Polymorphism markers (AFLP foram utilizadas para verificar a segregação do gênero Cassia L. senso lato em três diferentes gêneros, Chamaecrista Moench., Senna P. Mill. e Cassia L. senso stricto Dezoito representantes dos três táxons foram caracterizados com o uso de marcadores moleculares: 25 RAPD, seis iniciadores ("primers" ISSR e seis AFLP combinações de iniciadores, resultando na amplificação de 612, 115 e 622 bandas (loci, respectivamente. A maioria dos loci apresentou-se como polimórfico, mostrando um alto grau de diversidade genética entre os táxons estudados. O dendrograma construído com base nos dados de

  16. [Genomic DNA fingerprints of Legionella pneumophila serogroup 2 strains as an epidemiologic marker].

    Science.gov (United States)

    Bender-Beck, L; Mühlenberg, W; Lück, P C; Ott, M; Horbach, I; Fehrenbach, F J; Wewalka, G; Hacker, J

    1995-08-01

    Using pulsed-field gel electrophoresis, DNA fingerprints of eleven Legionella pneumophila isolates of serogroup 2 were generated. It was shown that two strains from a patient suffering from pneumonia as well as three environmental strains isolated from the shower in the hotel where the patient stayed 5 days before his illness were identical. Six strains of the same serogroup isolated from other sources were clearly separated. Thus, DNA fingerprints by pulsed-field gel electrophoresis are excellent epidemiological markers for the rarely occurring serogroup 2 of Legionella pneumophila.

  17. Hydrodynamic characterization and molecular weight estimation of ultrasonically sheared DNA; Caracterizacion hidrodinamica y estimacion de pesos moleculares de DNA degradado por ultrasonidos

    Energy Technology Data Exchange (ETDEWEB)

    Casal, J I; Garces, F; Garcia-Sacristan, A

    1981-07-01

    The sedimentation coefficients and intrinsic viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight estimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of X-ENA. (Author) 35 refs.

  18. Nonlinear microrheology and molecular imaging to map microscale deformations of entangled DNA networks

    Science.gov (United States)

    Wu, Tsai-Chin; Anderson, Rae

    We use active microrheology coupled to single-molecule fluorescence imaging to elucidate the microscale dynamics of entangled DNA. DNA naturally exists in a wide range of lengths and topologies, and is often confined in cell nucleui, forming highly concentrated and entangled biopolymer networks. Thus, DNA is the model polymer for understanding entangled polymer dynamics as well as the crowded environment of cells. These networks display complex viscoelastic properties that are not well understood, especially at the molecular-level and in response to nonlinear perturbations. Specifically, how microscopic stresses and strains propagate through entangled networks, and what molecular deformations lead to the network stress responses are unknown. To answer these important questions, we optically drive a microsphere through entangled DNA, perturbing the system far from equilibrium, while measuring the resistive force the DNA exerts on the bead during and after bead motion. We simultaneously image single fluorescent-labeled DNA molecules throughout the network to directly link the microscale stress response to molecular deformations. We characterize the deformation of the network from the molecular-level to the mesoscale, and map the stress propagation throughout the network. We further study the impact of DNA length (11 - 115 kbp) and topology (linear vs ring DNA) on deformation and propagation dynamics, exploring key nonlinear features such as tube dilation and power-law relaxation.

  19. Mitochondrial DNA Marker EST00083 Is Not Associated with High vs. Average IQ in a German Sample.

    Science.gov (United States)

    Moises, Hans W.; Yang, Liu; Kohnke, Michael; Vetter, Peter; Neppert, Jurgen; Petrill, Stephen A.; Plomin, Robert

    1998-01-01

    Tested the association of a mitochondrial DNA marker (EST00083) with high IQ in a sample of 47 German adults with high IQ scores and 77 adults with IQs estimated at lower than 110. Results do not support the hypothesis that high IQ is associated with this marker. (SLD)

  20. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  1. Effect O6-Guanine Alkylation on DNA Flexibility Studied by Comparative Molecular Dynamics Simulations

    Czech Academy of Sciences Publication Activity Database

    Kara, M.; Dršata, Tomáš; Lankaš, Filip; Zacharias, M.

    2015-01-01

    Roč. 103, č. 1 (2015), s. 23-32 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA14-21893S Institutional support: RVO:61388963 Keywords : DNA damage * DNA alkylation * DNA repair * molecular simulation * molecular dynamics simulation Subject RIV: BO - Biophysics Impact factor: 2.248, year: 2015

  2. A grass molecular identification system for forensic botany: a critical evaluation of the strengths and limitations.

    Science.gov (United States)

    Ward, Jodie; Gilmore, Simon R; Robertson, James; Peakall, Rod

    2009-11-01

    Plant material is frequently encountered in criminal investigations but often overlooked as potential evidence. We designed a DNA-based molecular identification system for 100 Australian grasses that consisted of a series of polymerase chain reaction assays that enabled the progressive identification of grasses to different taxonomic levels. The identification system was based on DNA sequence variation at four chloroplast and two mitochondrial loci. Seventeen informative indels and 68 single-nucleotide polymorphisms were utilized as molecular markers for subfamily to species-level identification. To identify an unknown sample to subfamily level required a minimum of four markers or nine markers for species identification. The accuracy of the system was confirmed by blind tests. We have demonstrated "proof of concept" of a molecular identification system for trace botanical samples. Our evaluation suggests that the adoption of a system that combines this approach with DNA sequencing could assist the morphological identification of grasses found as forensic evidence.

  3. The value of using DNA markers for beef bull selection in the seedstock sector.

    Science.gov (United States)

    Van Eenennaam, A L; van der Werf, J H J; Goddard, M E

    2011-02-01

    The objective of this study was to estimate the value derived from using DNA information to increase the accuracy of beef sire selection in a closed seedstock herd. Breeding objectives for commercial production systems targeting 2 diverse markets were examined using multiple-trait selection indexes developed for the Australian cattle industry. Indexes included those for both maternal (self-replacing) and terminal herds targeting either a domestic market, where steers are finished on pasture, or the export market, where steers are finished on concentrate rations in feedlots and marbling has a large value. Selection index theory was used to predict the response to conventional selection based on phenotypic performance records, and this was compared with including information from 2 hypothetical marker panels. In 1 case the marker panel explained a percentage of additive genetic variance equal to the heritability for all traits in the breeding objective and selection criteria, and in the other case to one-half of this amount. Discounted gene flow methodology was used to calculate the value derived from the use of superior bulls selected using DNA test information and performance recording over that derived from conventional selection using performance recording alone. Results were ultimately calculated as discounted returns per DNA test purchased by the seedstock operator. The DNA testing using these hypothetical marker panels increased the selection response between 29 to 158%. The value of this improvement above that obtained using traditional performance recording ranged from $89 to 565 per commercial bull, and $5,332 to 27,910 per stud bull. Assuming that the entire bull calf crop was tested to achieve these gains, the value of the genetic gain derived from DNA testing ranged from $204 to 1,119 per test. All values assumed that the benefits derived from using superior bulls were efficiently transferred along the production chain to the seedstock producer incurring

  4. DNA strand exchange catalyzed by molecular crowding in PEG solutions

    KAUST Repository

    Feng, Bobo; Frykholm, Karolin; Nordé n, Bengt; Westerlund, Fredrik

    2010-01-01

    DNA strand exchange is catalyzed by molecular crowding and hydrophobic interactions in concentrated aqueous solutions of polyethylene glycol, a discovery of relevance for understanding the function of recombination enzymes and with potential applications to DNA nanotechnology. © 2010 The Royal Society of Chemistry.

  5. Use of electroporation for high-molecular-weight DNA-mediated gene transfer.

    Science.gov (United States)

    Jastreboff, M M; Ito, E; Bertino, J R; Narayanan, R

    1987-08-01

    Electroporation was used to introduce high-molecular-weight DNA into murine hematopoietic cells and NIH3T3 cells. CCRF-CEM cells were stably transfected with SV2NEO plasmid and the genomic DNA from G-418-resistant clones (greater than 65 kb) was introduced into mouse bone marrow and NIH3T3 cells by electroporation. NEO sequences and expression were detected in the hematopoietic tissues of lethally irradiated mice, with 24% of individual spleen colonies expressing NEO. The frequency of genomic DNA transfer into NIH3T3 cells was 0.25 X 10(-3). Electroporation thus offers a powerful mode of gene transfer not only of cloned genes but also of high-molecular-weight DNA into cells.

  6. СD44+/CD24- markers of cancer stem cells in patients with breast cancer of different molecular subtypes.

    Science.gov (United States)

    Chekhun, S V; Zadvorny, T V; Tymovska, Yu O; Anikusko, M F; Novak, O E; Polishchuk, L Z

    2015-03-01

    To determine frequency of tumors with immunohistochemical markers of cancer stem cells (CSC) CD44+/CD24- in patients with breast cancer (BC) of different molecular subtype and to evaluate their prognostic value. Surgical material of 132 patients with BC stage I-II, age from 23 to 75 years, mean age - 50.2 ± 3.1 years was studied. Clinical, immunohistochemical (expression CD44+/CD24-), morphological, statistical. BC is characterized by heterogeneity of molecular subtypes and expression of markers (CD44+/CD24-). Immunohistochemical study of expression of CSC markers in surgical material has detected their expression in 34 (25.4%) patients with BC of different molecular subtypes. The highest frequency of cells with expression of CSC marker was observed in patients with basal molecular subtype (44.8% patients). Most of BC patients with phenotype CD44+/CD24 had stage I of tumor process (34.3%). Statistical processing of data has showen that Yule colligation coefficient equaled 0.28 (р > 0.05) that argues poor correlation between stage of tumor process and number of tumors with positive expression of CSC markers. Statistical processing of data has showen high correlation between presence of cells with expression of CSC markers and metastases of BC in regional lymph nodes (Yule colligation coefficient equals 0.943; р molecular subtype depending on expression of CSC CD44+/CD24- markers was detected. Survival of patients with basal BC was reliably higher at lack in tumors of cells with CSC markers CD44+/CD24- and, correspondingly, lower at presence of such cells (р markers was not determined (р > 0.05). Significance of tumor cells with markers CD44+/CD24- within the limits of molecular subtype of BC may be additional criterion for advanced biological characteristic of BC, and in patients with BC of basal molecular subtype - for predictive evaluation of individual potential of tumor to aggressive clinical course.

  7. Distinctive mitochondrial genome of Calanoid copepod Calanus sinicus with multiple large non-coding regions and reshuffled gene order: Useful molecular markers for phylogenetic and population studies

    Science.gov (United States)

    2011-01-01

    Background Copepods are highly diverse and abundant, resulting in extensive ecological radiation in marine ecosystems. Calanus sinicus dominates continental shelf waters in the northwest Pacific Ocean and plays an important role in the local ecosystem by linking primary production to higher trophic levels. A lack of effective molecular markers has hindered phylogenetic and population genetic studies concerning copepods. As they are genome-level informative, mitochondrial DNA sequences can be used as markers for population genetic studies and phylogenetic studies. Results The mitochondrial genome of C. sinicus is distinct from other arthropods owing to the concurrence of multiple non-coding regions and a reshuffled gene arrangement. Further particularities in the mitogenome of C. sinicus include low A + T-content, symmetrical nucleotide composition between strands, abbreviated stop codons for several PCGs and extended lengths of the genes atp6 and atp8 relative to other copepods. The monophyletic Copepoda should be placed within the Vericrustacea. The close affinity between Cyclopoida and Poecilostomatoida suggests reassigning the latter as subordinate to the former. Monophyly of Maxillopoda is rejected. Within the alignment of 11 C. sinicus mitogenomes, there are 397 variable sites harbouring three 'hotspot' variable sites and three microsatellite loci. Conclusion The occurrence of the circular subgenomic fragment during laboratory assays suggests that special caution should be taken when sequencing mitogenomes using long PCR. Such a phenomenon may provide additional evidence of mitochondrial DNA recombination, which appears to have been a prerequisite for shaping the present mitochondrial profile of C. sinicus during its evolution. The lack of synapomorphic gene arrangements among copepods has cast doubt on the utility of gene order as a useful molecular marker for deep phylogenetic analysis. However, mitochondrial genomic sequences have been valuable markers for

  8. Development of ITS sequence based molecular marker to distinguish, Tribulus terrestris L. (Zygophyllaceae) from its adulterants.

    Science.gov (United States)

    Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma

    2010-09-01

    Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  9. Molecular Markers and Cotton Genetic Improvement: Current Status and Future Prospects

    Directory of Open Access Journals (Sweden)

    Waqas Malik

    2014-01-01

    Full Text Available Narrow genetic base and complex allotetraploid genome of cotton (Gossypium hirsutum L. is stimulating efforts to avail required polymorphism for marker based breeding. The availability of draft genome sequence of G. raimondii and G. arboreum and next generation sequencing (NGS technologies facilitated the development of high-throughput marker technologies in cotton. The concepts of genetic diversity, QTL mapping, and marker assisted selection (MAS are evolving into more efficient concepts of linkage disequilibrium, association mapping, and genomic selection, respectively. The objective of the current review is to analyze the pace of evolution in the molecular marker technologies in cotton during the last ten years into the following four areas: (i comparative analysis of low- and high-throughput marker technologies available in cotton, (ii genetic diversity in the available wild and improved gene pools of cotton, (iii identification of the genomic regions within cotton genome underlying economic traits, and (iv marker based selection methodologies. Moreover, the applications of marker technologies to enhance the breeding efficiency in cotton are also summarized. Aforementioned genomic technologies and the integration of several other omics resources are expected to enhance the cotton productivity and meet the global fiber quantity and quality demands.

  10. Validation of the high-throughput marker technology DArT using the model plant Arabidopsis thaliana.

    Science.gov (United States)

    Wittenberg, Alexander H J; van der Lee, Theo; Cayla, Cyril; Kilian, Andrzej; Visser, Richard G F; Schouten, Henk J

    2005-08-01

    Diversity Arrays Technology (DArT) is a microarray-based DNA marker technique for genome-wide discovery and genotyping of genetic variation. DArT allows simultaneous scoring of hundreds of restriction site based polymorphisms between genotypes and does not require DNA sequence information or site-specific oligonucleotides. This paper demonstrates the potential of DArT for genetic mapping by validating the quality and molecular basis of the markers, using the model plant Arabidopsis thaliana. Restriction fragments from a genomic representation of the ecotype Landsberg erecta (Ler) were amplified by PCR, individualized by cloning and spotted onto glass slides. The arrays were then hybridized with labeled genomic representations of the ecotypes Columbia (Col) and Ler and of individuals from an F(2) population obtained from a Col x Ler cross. The scoring of markers with specialized software was highly reproducible and 107 markers could unambiguously be ordered on a genetic linkage map. The marker order on the genetic linkage map coincided with the order on the DNA sequence map. Sequencing of the Ler markers and alignment with the available Col genome sequence confirmed that the polymorphism in DArT markers is largely a result of restriction site polymorphisms.

  11. Synthetic Ion Channels and DNA Logic Gates as Components of Molecular Robots.

    Science.gov (United States)

    Kawano, Ryuji

    2018-02-19

    A molecular robot is a next-generation biochemical machine that imitates the actions of microorganisms. It is made of biomaterials such as DNA, proteins, and lipids. Three prerequisites have been proposed for the construction of such a robot: sensors, intelligence, and actuators. This Minireview focuses on recent research on synthetic ion channels and DNA computing technologies, which are viewed as potential candidate components of molecular robots. Synthetic ion channels, which are embedded in artificial cell membranes (lipid bilayers), sense ambient ions or chemicals and import them. These artificial sensors are useful components for molecular robots with bodies consisting of a lipid bilayer because they enable the interface between the inside and outside of the molecular robot to function as gates. After the signal molecules arrive inside the molecular robot, they can operate DNA logic gates, which perform computations. These functions will be integrated into the intelligence and sensor sections of molecular robots. Soon, these molecular machines will be able to be assembled to operate as a mass microrobot and play an active role in environmental monitoring and in vivo diagnosis or therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Short Communication: Genetic linkage map of Cucurbita maxima with molecular and morphological markers.

    Science.gov (United States)

    Ge, Y; Li, X; Yang, X X; Cui, C S; Qu, S P

    2015-05-22

    Cucurbita maxima is one of the most widely cultivated vegetables in China and exhibits distinct morphological characteristics. In this study, genetic linkage analysis with 57 simple-sequence repeats, 21 amplified fragment length polymorphisms, 3 random-amplified polymorphic DNA, and one morphological marker revealed 20 genetic linkage groups of C. maxima covering a genetic distance of 991.5 cM with an average of 12.1 cM between adjacent markers. Genetic linkage analysis identified the simple-sequence repeat marker 'PU078072' 5.9 cM away from the locus 'Rc', which controls rind color. The genetic map in the present study will be useful for better mapping, tagging, and cloning of quantitative trait loci/gene(s) affecting economically important traits and for breeding new varieties of C. maxima through marker-assisted selection.

  13. Molecular mechanisms in radiation damage to DNA. Progress report

    International Nuclear Information System (INIS)

    Osman, R.

    1994-01-01

    The objectives of this work are to elucidate the molecular mechanisms that are responsible for radiation-induced DNA damage. The overall goal is to understand the relationship between the chemical and structural changes produced by ionizing radiation in DNA and the resulting impairment of biological function expressed as carcinogenesis or cell death. The studies are based on theoretical explorations of possible mechanisms that link initial radiation damage in the form of base and sugar damage to conformational changes in DNA. These mechanistic explorations should lead to the formulation of testable hypotheses regarding the processes of impairment of regulation of gene expression, alteration in DNA repair, and damage to DNA structure involved in cell death or cancer

  14. Evaluation of multilocus marker efficacy for delineating mangrove species of West Coast India.

    Directory of Open Access Journals (Sweden)

    Ankush Ashok Saddhe

    Full Text Available The plant DNA barcoding is a complex and requires more than one marker(s as compared to animal barcoding. Mangroves are diverse estuarine ecosystem prevalent in the tropical and subtropical zone, but anthropogenic activity turned them into the vulnerable ecosystem. There is a need to build a molecular reference library of mangrove plant species based on molecular barcode marker along with morphological characteristics. In this study, we tested the core plant barcode (rbcL and matK and four promising complementary barcodes (ITS2, psbK-psbI, rpoC1 and atpF-atpH in 14 mangroves species belonging to 5 families from West Coast India. Data analysis was performed based on barcode gap analysis, intra- and inter-specific genetic distance, Automated Barcode Gap Discovery (ABGD, TaxonDNA (BM, BCM, Poisson Tree Processes (PTP and General Mixed Yule-coalescent (GMYC. matK+ITS2 marker based on GMYC method resolved 57.14% of mangroves species and TaxonDNA, ABGD, and PTP discriminated 42.85% of mangrove species. With a single locus analysis, ITS2 exhibited the higher discriminatory power (87.82% and combinations of matK + ITS2 provided the highest discrimination success (89.74% rate except for Avicennia genus. Further, we explored 3 additional markers (psbK-psbI, rpoC1, and atpF-atpH for Avicennia genera (A. alba, A. officinalis and A. marina and atpF-atpH locus was able to discriminate three species of Avicennia genera. Our analysis underscored the efficacy of matK + ITS2 markers along with atpF-atpH as the best combination for mangrove identification in West Coast India regions.

  15. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  16. Genetic Diversity Analysis in 27 Tomato Accessions Using Morphological and Molecular Markers

    Directory of Open Access Journals (Sweden)

    Catur Herison

    2018-02-01

    Full Text Available Genetic diversity is the most important aspect in tomato breeding activities. Better assessment on the diversity of the collected accessions will come up with better result of the cultivar development. This study aimed at analyzing the genetic diversity of 27 tomato accessions by morphological and molecular markers. Twenty seven accessions collected from various regions of Indonesia were planted in the field and evaluated for their morphological traits, and RAPD analyzed for their molecular markers. The UPGMA clustering analyzes, elaborating the combination of morphological and molecular data, indicated that the tomato accessions could be grouped into 5 major groups with 70 % genetic similarity levels. Current study indicated that although many accessions came from different locations, they congregated into the same group. Cherry, Kudamati 1 and Lombok 3 were the farthest genetic distant accessions to the others. Those three genotypes will be the most valuable accessions, when they were crossed with other accessions, for designing a prospective breeding program in the future.

  17. Molecular techniques: An overview of methods for the detection of ...

    African Journals Online (AJOL)

    Several DNA molecular markers are now available for use in surveillance and investigation of food-borne outbreaks that were previously difficult to detect. The results from several sources of literature indicate substantially different degrees of sensitivities between conventional detection methods and molecular-based ...

  18. Diagnostic value of stool DNA testing for multiple markers of colorectal cancer and advanced adenoma: a meta-analysis.

    Science.gov (United States)

    Yang, Hua; Xia, Bing-Qing; Jiang, Bo; Wang, Guozhen; Yang, Yi-Peng; Chen, Hao; Li, Bing-Sheng; Xu, An-Gao; Huang, Yun-Bo; Wang, Xin-Ying

    2013-08-01

    The diagnostic value of stool DNA (sDNA) testing for colorectal neoplasms remains controversial. To compensate for the lack of large-scale unbiased population studies, a meta-analysis was performed to evaluate the diagnostic value of sDNA testing for multiple markers of colorectal cancer (CRC) and advanced adenoma. The PubMed, Science Direct, Biosis Review, Cochrane Library and Embase databases were systematically searched in January 2012 without time restriction. Meta-analysis was performed using a random-effects model using sensitivity, specificity, diagnostic OR (DOR), summary ROC curves, area under the curve (AUC), and 95% CIs as effect measures. Heterogeneity was measured using the χ(2) test and Q statistic; subgroup analysis was also conducted. A total of 20 studies comprising 5876 individuals were eligible. There was no heterogeneity for CRC, but adenoma and advanced adenoma harboured considerable heterogeneity influenced by risk classification and various detection markers. Stratification analysis according to risk classification showed that multiple markers had a high DOR for the high-risk subgroups of both CRC (sensitivity 0.759 [95% CI 0.711 to 0.804]; specificity 0.883 [95% CI 0.846 to 0.913]; AUC 0.906) and advanced adenoma (sensitivity 0.683 [95% CI 0.584 to 0.771]; specificity 0.918 [95% CI 0.866 to 0.954]; AUC 0.946) but not for the average-risk subgroups of either. In the methylation subgroup, sDNA testing had significantly higher DOR for CRC (sensitivity 0.753 [95% CI 0.685 to 0.812]; specificity 0.913 [95% CI 0.860 to 0.950]; AUC 0.918) and advanced adenoma (sensitivity 0.623 [95% CI 0.527 to 0.712]; specificity 0.926 [95% CI 0.882 to 0.958]; AUC 0.910) compared with the mutation subgroup. There was no significant heterogeneity among studies for subgroup analysis. sDNA testing for multiple markers had strong diagnostic significance for CRC and advanced adenoma in high-risk subjects. Methylation makers had more diagnostic value than mutation

  19. Elevated levels of urinary markers of oxidatively generated DNA and RNA damage in bipolar disorder

    DEFF Research Database (Denmark)

    Munkholm, Klaus; Poulsen, Henrik Enghusen; Kessing, Lars Vedel

    2015-01-01

    OBJECTIVES: The pathophysiological mechanisms underlying bipolar disorder and its multi-system nature are unclear. Oxidatively generated damage to nucleosides has been demonstrated in metabolic disorders; however, the extent to which this occurs in bipolar disorder in vivo is unknown. We...... investigated oxidatively generated damage to DNA and RNA in patients with bipolar disorder and its relationship with the affective phase compared with healthy control subjects. METHODS: Urinary excretion of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) and 8-oxo-7,8-dihydroguanosine (8-oxoGuo), markers...... of oxidatively generated DNA and RNA damage, respectively, was measured in 37 rapid cycling patients with bipolar disorder and in 40 age- and gender-matched healthy control subjects. Employing a longitudinal design, repeated measurements of both markers were evaluated in various affective phases in patients...

  20. Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage

    Science.gov (United States)

    Álvarez-Iglesias, Vanesa; Fondevila, Manuel; Blanco-Verea, Alejandro; Carracedo, Ángel; Pascali, Vincenzo L.; Capelli, Cristian

    2012-01-01

    Background According to archaeological records and historical documentation, Italy has been a melting point for populations of different geographical and ethnic matrices. Although Italy has been a favorite subject for numerous population genetic studies, genetic patterns have never been analyzed comprehensively, including uniparental and autosomal markers throughout the country. Methods/Principal Findings A total of 583 individuals were sampled from across the Italian Peninsula, from ten distant (if homogeneous by language) ethnic communities — and from two linguistic isolates (Ladins, Grecani Salentini). All samples were first typed for the mitochondrial DNA (mtDNA) control region and selected coding region SNPs (mtSNPs). This data was pooled for analysis with 3,778 mtDNA control-region profiles collected from the literature. Secondly, a set of Y-chromosome SNPs and STRs were also analyzed in 479 individuals together with a panel of autosomal ancestry informative markers (AIMs) from 441 samples. The resulting genetic record reveals clines of genetic frequencies laid according to the latitude slant along continental Italy – probably generated by demographical events dating back to the Neolithic. The Ladins showed distinctive, if more recent structure. The Neolithic contribution was estimated for the Y-chromosome as 14.5% and for mtDNA as 10.5%. Y-chromosome data showed larger differentiation between North, Center and South than mtDNA. AIMs detected a minor sub-Saharan component; this is however higher than for other European non-Mediterranean populations. The same signal of sub-Saharan heritage was also evident in uniparental markers. Conclusions/Significance Italy shows patterns of molecular variation mirroring other European countries, although some heterogeneity exists based on different analysis and molecular markers. From North to South, Italy shows clinal patterns that were most likely modulated during Neolithic times. PMID:23251386

  1. Uniparental markers of contemporary Italian population reveals details on its pre-Roman heritage.

    Science.gov (United States)

    Brisighelli, Francesca; Álvarez-Iglesias, Vanesa; Fondevila, Manuel; Blanco-Verea, Alejandro; Carracedo, Angel; Pascali, Vincenzo L; Capelli, Cristian; Salas, Antonio

    2012-01-01

    According to archaeological records and historical documentation, Italy has been a melting point for populations of different geographical and ethnic matrices. Although Italy has been a favorite subject for numerous population genetic studies, genetic patterns have never been analyzed comprehensively, including uniparental and autosomal markers throughout the country. A total of 583 individuals were sampled from across the Italian Peninsula, from ten distant (if homogeneous by language) ethnic communities--and from two linguistic isolates (Ladins, Grecani Salentini). All samples were first typed for the mitochondrial DNA (mtDNA) control region and selected coding region SNPs (mtSNPs). This data was pooled for analysis with 3,778 mtDNA control-region profiles collected from the literature. Secondly, a set of Y-chromosome SNPs and STRs were also analyzed in 479 individuals together with a panel of autosomal ancestry informative markers (AIMs) from 441 samples. The resulting genetic record reveals clines of genetic frequencies laid according to the latitude slant along continental Italy--probably generated by demographical events dating back to the Neolithic. The Ladins showed distinctive, if more recent structure. The Neolithic contribution was estimated for the Y-chromosome as 14.5% and for mtDNA as 10.5%. Y-chromosome data showed larger differentiation between North, Center and South than mtDNA. AIMs detected a minor sub-Saharan component; this is however higher than for other European non-Mediterranean populations. The same signal of sub-Saharan heritage was also evident in uniparental markers. Italy shows patterns of molecular variation mirroring other European countries, although some heterogeneity exists based on different analysis and molecular markers. From North to South, Italy shows clinal patterns that were most likely modulated during Neolithic times.

  2. DNA-based techniques for authentication of processed food and food supplements.

    Science.gov (United States)

    Lo, Yat-Tung; Shaw, Pang-Chui

    2018-02-01

    Authentication of food or food supplements with medicinal values is important to avoid adverse toxic effects, provide consumer rights, as well as for certification purpose. Compared to morphological and spectrometric techniques, molecular authentication is found to be accurate, sensitive and reliable. However, DNA degradation and inclusion of inhibitors may lead to failure in PCR amplification. This paper reviews on the existing DNA extraction and PCR protocols, and the use of small size DNA markers with sufficient discriminative power for molecular authentication. Various emerging new molecular techniques such as isothermal amplification for on-site diagnosis, next-generation sequencing for high-throughput species identification, high resolution melting analysis for quick species differentiation, DNA array techniques for rapid detection and quantitative determination in food products are also discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Cortical GABA markers identify a molecular subtype of psychotic and bipolar disorders.

    Science.gov (United States)

    Volk, D W; Sampson, A R; Zhang, Y; Edelson, J R; Lewis, D A

    2016-09-01

    Deficits in gamma aminobutyric acid (GABA) neuron-related markers, including the GABA-synthesizing enzyme GAD67, the calcium-binding protein parvalbumin, the neuropeptide somatostatin, and the transcription factor Lhx6, are most pronounced in a subset of schizophrenia subjects identified as having a 'low GABA marker' (LGM) molecular phenotype. Furthermore, schizophrenia shares degrees of genetic liability, clinical features and cortical circuitry abnormalities with schizoaffective disorder and bipolar disorder. Therefore, we determined the extent to which a similar LGM molecular phenotype may also exist in subjects with these disorders. Transcript levels for GAD67, parvalbumin, somatostatin, and Lhx6 were quantified using quantitative PCR in prefrontal cortex area 9 of 184 subjects with a diagnosis of schizophrenia (n = 39), schizoaffective disorder (n = 23) or bipolar disorder (n = 35), or with a confirmed absence of any psychiatric diagnoses (n = 87). A blinded clustering approach was employed to determine the presence of a LGM molecular phenotype across all subjects. Approximately 49% of the subjects with schizophrenia, 48% of the subjects with schizoaffective disorder, and 29% of the subjects with bipolar disorder, but only 5% of unaffected subjects, clustered in the cortical LGM molecular phenotype. These findings support the characterization of psychotic and bipolar disorders by cortical molecular phenotype which may help elucidate more pathophysiologically informed and personalized medications.

  4. DNA Re-EvolutioN: a game for learning molecular genetics and evolution.

    Science.gov (United States)

    Miralles, Laura; Moran, Paloma; Dopico, Eduardo; Garcia-Vazquez, Eva

    2013-01-01

    Evolution is a main concept in biology, but not many students understand how it works. In this article we introduce the game DNA Re-EvolutioN as an active learning tool that uses genetic concepts (DNA structure, transcription and translation, mutations, natural selection, etc.) as playing rules. Students will learn about molecular evolution while playing a game that mixes up theory and entertainment. The game can be easily adapted to different educational levels. The main goal of this play is to arrive at the end of the game with the longest protein. Students play with pawns and dices, a board containing hypothetical events (mutations, selection) that happen to molecules, "Evolution cards" with indications for DNA mutations, prototypes of a DNA and a mRNA chain with colored "nucleotides" (plasticine balls), and small pieces simulating t-RNA with aminoacids that will serve to construct a "protein" based on the DNA chain. Students will understand how changes in DNA affect the final protein product and may be subjected to positive or negative selection, using a didactic tool funnier than classical theory lectures and easier than molecular laboratory experiments: a flexible and feasible game to learn and enjoy molecular evolution at no-cost. The game was tested by majors and non-majors in genetics from 13 different countries and evaluated with pre- and post-tests obtaining very positive results. © 2013 by The International Union of Biochemistry and Molecular Biology.

  5. Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

    Science.gov (United States)

    Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

    2006-04-01

    p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

  6. DNA barcode-based molecular identification system for fish species.

    Science.gov (United States)

    Kim, Sungmin; Eo, Hae-Seok; Koo, Hyeyoung; Choi, Jun-Kil; Kim, Won

    2010-12-01

    In this study, we applied DNA barcoding to identify species using short DNA sequence analysis. We examined the utility of DNA barcoding by identifying 53 Korean freshwater fish species, 233 other freshwater fish species, and 1339 saltwater fish species. We successfully developed a web-based molecular identification system for fish (MISF) using a profile hidden Markov model. MISF facilitates efficient and reliable species identification, overcoming the limitations of conventional taxonomic approaches. MISF is freely accessible at http://bioinfosys.snu.ac.kr:8080/MISF/misf.jsp .

  7. Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

    Science.gov (United States)

    In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

  8. Identification and characterization of gene-based SSR markers in date palm (Phoenix dactylifera L.

    Directory of Open Access Journals (Sweden)

    Zhao Yongli

    2012-12-01

    Full Text Available Abstract Background Date palm (Phoenix dactylifera L. is an important tree in the Middle East and North Africa due to the nutritional value of its fruit. Molecular Breeding would accelerate genetic improvement of fruit tree through marker assisted selection. However, the lack of molecular markers in date palm restricts the application of molecular breeding. Results In this study, we analyzed 28,889 EST sequences from the date palm genome database to identify simple-sequence repeats (SSRs and to develop gene-based markers, i.e. expressed sequence tag-SSRs (EST-SSRs. We identified 4,609 ESTs as containing SSRs, among which, trinucleotide motifs (69.7% were the most common, followed by tetranucleotide (10.4% and dinucleotide motifs (9.6%. The motif AG (85.7% was most abundant in dinucleotides, while motifs AGG (26.8%, AAG (19.3%, and AGC (16.1% were most common among trinucleotides. A total of 4,967 primer pairs were designed for EST-SSR markers from the computational data. In a follow up laboratory study, we tested a sample of 20 random selected primer pairs for amplification and polymorphism detection using genomic DNA from date palm cultivars. Nearly one-third of these primer pairs detected DNA polymorphism to differentiate the twelve date palm cultivars used. Functional categorization of EST sequences containing SSRs revealed that 3,108 (67.4% of such ESTs had homology with known proteins. Conclusion Date palm EST sequences exhibits a good resource for developing gene-based markers. These genic markers identified in our study may provide a valuable genetic and genomic tool for further genetic research and varietal development in date palm, such as diversity study, QTL mapping, and molecular breeding.

  9. Molecular characterization of cultivated species of the genus Pachyrhizus Rich. ex DC. by AFLP markers

    DEFF Research Database (Denmark)

    Santayana, Monica; Rossel, Genoveva; Núñez, Jorge

    2014-01-01

    ) molecular markers in order to estimate genetic diversity and interspecific relationships. To complement molecular marker information, individuals from each accession were analyzed in order to confirmploidy levels. Eight AFLP primer combinations detected 136 (68.7 %) polymorphic bands. Shannon’s diversity...... indices (Hs) for each species were 1.04 (P. ahipa), 1.07 (P. tuberosus), and 2.42 (P. erosus), while the total diversity index was 2.45. Phylogenetic analysis, principal coordinate analysis and analysis of molecular variance (FST=0.796) all showed significant species differentiation. All accessions were...... diploid (2n=2x=22), which is characteristic of the tribe Phaseoleae. Finally, a misclassified accession of P. tuberosus was identified. Molecular characterization of accessions is necessary for efficient management of germplasm collections....

  10. [Use of ITS and ISSR markers in the molecular characterisation of Pleurotus djamor hybrid strains].

    Science.gov (United States)

    Aguilar Doroteo, Leticia; Zárate Segura, Paola Berenice; Villanueva Arce, Ramón; Yáñez Fernández, Jorge; Garín Aguilar, María Eugenia; Guadarrama Mendoza, Paula Cecilia; Valencia Del Toro, Gustavo

    Molecular characterisation of wild type Pleurotus species is important for germplasm conservation and its further use for genetic improvement. No molecular studies have been performed with monokaryons used for producing hybrid strains, either with the reconstituted strains obtained by pairing those monokaryons. The molecular characterisation of parental dikaryons, hybrid, and reconstituted strains as well as monokaryotic strains, is therefore of utmost importance. To carry out the molecular identification of Pleurotus djamor strains, i.e. dikaryotic wild type strains, hybrid strains, and the monokaryotic strains used for the hybrid formation. Five wild type strains of P. djamor from different states in Mexico were collected and molecularly identified by sequencing the ITS1-5.8-ITS2 region using ITS1 and ITS4 universal oligonucleotides. Four hybrid strains were obtained by pairing neohaplonts of two wild type strains selected. Six ISSR markers were used for the molecular characterisation of monokaryotic and dikaryotic strains. Using the ITS markers, an amplified product of 700bp was obtained in five wild type strains, with a 99-100% similarity with P. djamor. A total of 95 fragments were obtained using the ISSR markers, with 99% of polymorphism. Wild type strains were identified as P. djamor, and were clearly grouped with Mexican strains from other states of Mexico. ISSR markers allowed the generation of polymorphic bands in monokaryotic and dikaryotic strains, splitting both types of strains. The high degree of polymorphism indicates the genetic diversity of P. djamor, an advantage in mushroom production and in the improving of the species. Copyright © 2017 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  12. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  13. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  14. Ultraviolet light induction of diphtheria toxin-resistant mutations in normal and DNA repair-deficient human and Chinese hamster fibroblasts

    International Nuclear Information System (INIS)

    Trosko, J.E.; Schultz, R.S.; Chang, C.C.; Glover, T.

    1980-01-01

    The role on unrepaired DNA lesions in the production of mutations is suspected of contributing to the initiation phase of carcinogenesis. Since the molecular basis of mutagenesis is not understood in eukaryotic cells, development of new genetic markers for quantitative in vitro measurement of mutations for mammalian cells is needed. Furthermore, mammalian cells, genetically deficient for various DNA repair enzymes, will be needed to study the role of unrepaired DNA lesions in mutagenesis. The results in this report relate to preliminary attempts to characterize the diphtheria toxin resistance marker as a useful quantitative genetic marker in human cells and to isolate and characterize various DNA repair-deficient Chinese hamster cells

  15. Microsatellite DNA markers for delineating population structure and kinship among the endangered Kirtland’s warbler (Dendroica kirtlandii)

    Science.gov (United States)

    TIM L. KING; MICHAEL S. EACKLES; ANNE P. HENDERSON; CAROL I. BOCETTI; DAVE CURRIE; JR WUNDERLE

    2005-01-01

    We document the isolation and characterization of 23 microsatellite DNA markers for the endangered Kirtland’s warbler (Dendroica kirtlandii), a Nearctic/Neotropical migrant passerine. This suite of markers revealed moderate to high levels of allelic diversity (averaging 7.7 alleles per locus) and heterozygosity (averaging 72%). Genotypic frequencies at 22 of 23 (95%)...

  16. Molecular Strain Typing of Clinical Isolates, Trichophyton rubrum using Non Transcribed Spacer (NTS) Region as a Molecular Marker.

    Science.gov (United States)

    Ramaraj, Vijayakumar; Vijayaraman, Rajyoganandh S; Elavarashi, Elangovan; Rangarajan, Sudha; Kindo, Anupma Jyoti

    2017-05-01

    Dermatophytes are a group of fungi which infect keratinized tissues and causes superficial mycoses in humans and animals. The group comprises of three major genera, Trichophyton , Microsporum and Epidermophyton . Among them Trichophyton rubrum is a predominant anthropophilic fungi which causes chronic infections. Although, the infection is superficial and treatable, reinfection/coinfection causes inflation in the treatment cost. Identifying the source and mode of transmission is essential to prevent its transmission. Accurate discrimination is required to understand the clinical (relapse or reinfection) and epidemiological implications of the genetic heterogeneity of this species. Polymorphism in the Non Transcribed Spacer (NTS) region of ribosomal DNA (rDNA) clusters renders an effective way to discriminate strains among T. rubrum . To carry out the strain typing of the clinical isolates, Trichophyton rubrum using NTS as a molecular marker. Seventy T.rubrum clinical isolates obtained from April-2011-March 2013, from Sri Ramachandra Medical Centre, Chennai, Tamil Nadu, India, were identified by conventional phenotypic methods and included in this prospective study. The isolates were then subjected to Polymerase Chain Reaction (PCR) targeting two subrepeat elements (SREs), TRS-1 and TRS-2 of the NTS region. Strain-specific polymorphism was observed in both subrepeat loci. Total, nine different strains were obtained on combining both TRS-1 and TRS-2, SREs. The outcome has given a strong representation for using NTS region amplification in discriminating the T. rubrum clinical isolates. The method can be adapted as a tool for conducting epidemiology and population based study in T. rubrum infections. This will help in future exploration of the epidemiology of T. rubrum .

  17. Molecular Genetic Diversity of Date (Phoenix dactylifera) Germplasm in Qatar based on Microsatellite Markers

    KAUST Repository

    Ahmed, Talaat

    2016-01-01

    Depending on morphological traits alone, studying the genetic diversity of date palm is a very difficult task since morphological characteristics are highly affected by the environment. DNA markers are excellent option that can help and enhance

  18. Association between Urinary Excretion of Cortisol and Markers of Oxidatively Damaged DNA and RNA in Humans

    DEFF Research Database (Denmark)

    Joergensen, Anders; Broedbaek, Kasper; Weimann, Allan

    2011-01-01

    Chronic psychological stress is associated with accelerated aging, but the underlying biological mechanisms are not known. Prolonged elevations of the stress hormone cortisol is suspected to play a critical role. Through its actions, cortisol may potentially induce oxidatively generated damage...... to cellular constituents such as DNA and RNA, a phenomenon which has been implicated in aging processes. We investigated the relationship between 24 h excretion of urinary cortisol and markers of oxidatively generated DNA and RNA damage, 8-oxo-7,8-dihydro-2'-deoxyguanosine and 8-oxo-7,8-dihydroguanosine......, in a sample of 220 elderly men and women (age 65 - 83 years). We found a robust association between the excretion of cortisol and the oxidation markers (R(2)¿=¿0.15, P...

  19. A and MdMYB1 allele-specific markers controlling apple (Malus x domestica Borkh.) skin color and suitability for marker-assisted selection.

    Science.gov (United States)

    Zhang, X J; Wang, L X; Chen, X X; Liu, Y L; Meng, R; Wang, Y J; Zhao, Z Y

    2014-10-31

    Pre-selection for fruit skin color at the seedling stage would be highly advantageous, with marker-assisted selection offering a potential method for apple pre-selection. A and MdMYB1 alleles are allele-specific DNA markers that are potentially associated with apple skin color, and co-segregate with the Rf and Rni loci, respectively. Here, we assessed the potential application of these 2 alleles for marker-assisted breeding across 30 diverse cultivars and 2 apple seedling progenies. The red skin color phenotype was usually associated with the MdMYB1-1 allele and A(1) allele, respectively, while the 2 molecular markers provided approximately 91% predictability in the 'Fuji' x 'Cripps Pink' and 'Fuji' x 'Gala' progenies. The results obtained from the 30 cultivars and 2 progenies were consistent for the 2 molecular markers. Hence, the results supported that Rf and Rni could be located in a gene cluster, or even correspond to alleles of the same gene. Our results are consistent with the hypothesis that red/yellow dimorphism is controlled by a monogenic system, with the presence of the red anthocyanin pigmentation being dominant. In addition, our results supported that the practical utilization of the 2 function markers to efficiently and accurately select red-skinned apple cultivars in apple scion breeding programs.

  20. DNA Profiles of MTG (Moderat Tahan Gano) Oil Palm Variety Based on SSR Marker

    Science.gov (United States)

    Putri, L. A. P.; Setiado, H.; Hardianti, R.

    2017-03-01

    The oil palm, an economically important tree in Indonesia, has been one of the world’s major sources of edible oil and a significant precursor of biodiesel fuel. The objectives of this study were to know DNA profile of commercial MTG (Moderat Tahan Gano) oil palm variety collections. A total of 10 trees MTG oil palm variety were used for analysis. In this experiment, the DNA profile diversity was assessed using mEgCIR0174 and SSR-1 loci of oil palm’s specific SSR markers. The results of the experiment indicated out of 3 alleles of pcr product of mEgCIR0174 (198, 203 and 208 bp) and SSR-1 (201, 217 and 232 bp). These preliminary results demonstrated SSR marker can be used to evaluate genetic relatedness among trees of MTG (Moderat Tahan Gano) oil palm variety derived from different crossing or difference to desease resistance trait or misslabeled.

  1. Recovery of DNA from agarose gel by trap method | Xia | African ...

    African Journals Online (AJOL)

    Recovery of DNA from agarose gel electrophoresis is a basic operation during molecular cloning. Circular or linear DNA fragments which vary from 1.5 to 6.5 kb and correspond to 1 kb marker can be recovered from 0.8 to 1.0% agarose gel smoothly with a simple and rapid trap method. The recovery efficiency could be ...

  2. Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities* #

    Science.gov (United States)

    Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

    2014-01-01

    Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20–23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community. PMID:25367789

  3. Designing a SCAR molecular marker for monitoring Trichoderma cf. harzianum in experimental communities.

    Science.gov (United States)

    Pérez, Gabriel; Verdejo, Valentina; Gondim-Porto, Clarissa; Orlando, Julieta; Carú, Margarita

    2014-11-01

    Several species of the fungal genus Trichoderma establish biological interactions with various micro- and macro-organisms. Some of these interactions are relevant in ecological terms and in biotechnological applications, such as biocontrol, where Trichoderma could be considered as an invasive species that colonizes a recipient community. The success of this invasion depends on multiple factors, which can be assayed using experimental communities as study models. Therefore, the aim of this work is to develop a species-specific sequence-characterized amplified region (SCAR) marker to monitor the colonization and growth of T. cf. harzianum when it invades experimental communities. For this study, 16 randomly amplified polymorphic DNA (RAPD) primers of 10-mer were used to generate polymorphic patterns, one of which generated a band present only in strains of T. cf. harzianum. This band was cloned, sequenced, and five primers of 20-23 mer were designed. Primer pairs 2F2/2R2 and 2F2/2R3 successfully and specifically amplified fragments of 278 and 448 bp from the T. cf. harzianum BpT10a strain DNA, respectively. Both primer pairs were also tested against the DNA from 14 strains of T. cf. harzianum and several strains of different fungal genera as specificity controls. Only the DNA from the strains of T. cf. harzianum was successfully amplified. Moreover, primer pair 2F2/2R2 was assessed by quantitative real-time polymerase chain reaction (PCR) using fungal DNA mixtures and DNA extracted from fungal experimental communities as templates. T. cf. harzianum was detectable even when as few as 100 copies of the SCAR marker were available or even when its population represented only 0.1% of the whole community.

  4. Study of DNA interactions with bifenthrin by spectroscopic techniques and molecular modeling

    Science.gov (United States)

    Zhu, Pan; Zhang, Guowen; Ma, Yadi; Zhang, Yepeng; Miao, Hong; Wu, Yongning

    2013-08-01

    The interaction between bifenthrin (BF) and calf thymus DNA (ctDNA) in physiological buffer (pH 7.4) was investigated by UV-vis absorption, fluorescence, circular dichroism (CD), and Fourier transform infrared (FT-IR) spectroscopy, coupled with viscosity measurements and molecular docking techniques. It was found that BF molecular could intercalate into the base pairs of ctDNA as evidenced by significant increases in absorption intensity, fluorescence polarization and relative viscosity of ctDNA, decrease in iodide quenching effect, and induced CD spectral changes. The association constant of BF with ctDNA was evaluated to be in the order of 104 L mol-1. Thermodynamic analysis of the binding data obtained at different temperatures suggested that the binding process was primarily driven by hydrogen bonds and van der Waals forces, as the values of the enthalpy change (ΔH) and the entropy change (ΔS) were calculated to be -31.13 ± 1.89 kJ mol-1 and -22.79 ± 1.21 J mol-1 K-1, respectively. The results of FT-IR spectra and molecular docking showed that a specific binding mainly existed between BF and adenine and guanine bases.

  5. Divergent evolutionary histories of DNA markers in a Hawaiian population of the coral Montipora capitata

    OpenAIRE

    Hollie M. Putnam; Diane K. Adams; Ehud Zelzion; Nicole E. Wagner; Huan Qiu; Tali Mass; Paul G. Falkowski; Ruth D. Gates; Debashish Bhattacharya

    2017-01-01

    We investigated intra- and inter-colony sequence variation in a population of the dominant Hawaiian coral Montipora capitata by analyzing marker gene and genomic data. Ribosomal ITS1 regions showed evidence of a reticulate history among the colonies, suggesting incomplete rDNA repeat homogenization. Analysis of the mitochondrial genome identified a major (M. capitata) and a minor (M. flabellata) haplotype in single polyp-derived sperm bundle DNA with some colonies containing 2?3 different mtD...

  6. Identification of a panel of sensitive and specific DNA methylation markers for lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Hagen Jeffrey A

    2007-10-01

    Full Text Available Abstract Background Lung cancer is the number one cancer killer of both men and women in the United States. Three quarters of lung cancer patients are diagnosed with regionally or distantly disseminated disease; their 5-year survival is only 15%. DNA hypermethylation at promoter CpG islands shows great promise as a cancer-specific marker that would complement visual lung cancer screening tools such as spiral CT, improving early detection. In lung cancer patients, such hypermethylation is detectable in a variety of samples ranging from tumor material to blood and sputum. To date the penetrance of DNA methylation at any single locus has been too low to provide great clinical sensitivity. We used the real-time PCR-based method MethyLight to examine DNA methylation quantitatively at twenty-eight loci in 51 primary human lung adenocarcinomas, 38 adjacent non-tumor lung samples, and 11 lung samples from non-lung cancer patients. Results We identified thirteen loci showing significant differential DNA methylation levels between tumor and non-tumor lung; eight of these show highly significant hypermethylation in adenocarcinoma: CDH13, CDKN2A EX2, CDX2, HOXA1, OPCML, RASSF1, SFPR1, and TWIST1 (p-value Conclusion The identification of eight CpG island loci showing highly significant hypermethylation in lung adenocarcinoma provides strong candidates for evaluation in patient remote media such as plasma and sputum. The four most highly ranked loci, CDKN2A EX2, CDX2, HOXA1 and OPCML, which show significant DNA methylation even in stage IA tumor samples, merit further investigation as some of the most promising lung adenocarcinoma markers identified to date.

  7. DNA-mediated gene transfer into ataxia-telangiectasia cells

    International Nuclear Information System (INIS)

    Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.

    1986-01-01

    The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA

  8. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... This makes coffee seed as one of the important material for molecular marker ... homogenised in 10 ml of freshly prepared extraction buffer (200. mM Tris-HCl pH 8.0, .... DNA material for particular molecular analysis. This method will be ... Pharmawati M, Yan G, Sedgley R, Finnegan PM (2004). Chloroplast.

  9. Genetic studies and a search for molecular markers that are linked ...

    African Journals Online (AJOL)

    Molecular markers that are linked to witchweed resistance can expedite the development of resistant cultivars through adoption of appropriate markerassisted selection (MAS) strategies. The objectives of this investigation were to study the inheritance or low germination stimulant (lgs) production in cultivar SAR 29 and to ...

  10. Identification of hybrids of painted and milky storks using FTA card-collected blood, molecular markers, and morphologies.

    Science.gov (United States)

    Yee, Elsie Yoke Sim; Zainuddin, Zainal Zahari; Ismail, Ahmad; Yap, Chee Kong; Tan, Soon Guan

    2013-10-01

    Suspicious hybrids of painted storks and milky storks were found in a Malaysian zoo. Blood of these birds was sampled on FTA cards for DNA fingerprinting. Of 44 optimized primers, 6 produced diagnostic markers that could identify hybrids. The markers were based on simple, direct PCR-generated multilocus banding patterns that provided two sets of genetic data, one for each of the two stork species and another for the hybrids. It also revealed that large DNA fragments (3,000 bp) could be amplified from blood collected on FTA cards. When the results of each individual bird's DNA fingerprint were compared with plumage characters, the hybrids were found to express a range of intermediate phenotypic traits of the pure breeds with no dominant plumage characteristic from either parental species.

  11. Surface-attached molecular beacons light the way for DNA sequencing

    Czech Academy of Sciences Publication Activity Database

    Paleček, Emil

    2004-01-01

    Roč. 22, č. 2 (2004), s. 55-58 ISSN 0167-7799 R&D Projects: GA AV ČR IBS5004355; GA ČR GA204/03/0566 Institutional research plan: CEZ:AV0Z5004920 Keywords : molecular beacon * DNA stem-loop structure * DNA sensors Subject RIV: BO - Biophysics Impact factor: 8.606, year: 2004

  12. Molecular Fingerprinting Approach in Plant Species Evaluation for a Nuclear Power Programme

    International Nuclear Information System (INIS)

    Azhar Mohamed

    2011-01-01

    Deoxyribonucleic acid (DNA) as a tool for marker technology is found to be remarkable, advanced and exciting in recent years. DNA markers are valuable tools and important in various plant breeding analyses for identification, gene mapping, marker systems and mutagenesis response. As gene expression is related to concurrent cellular activities and is mobilised in the adaptation of plants to adverse environmental conditions, changes at the DNA levels can be detected simultaneously. The changes also reflect response onto plant traits in which selection for better quality plant materials can be made and/or used as bio-indicator response in tracking any environmental change. The objective of the present study is to show Inter Simple Sequence Repeat (ISSR) markers as an important technique in differentiating plant DNA genomic in various species for the evaluation of their diversity and radiation effects in population. The technique has been found to be rapid, simple, reliable and robust in generating molecular fingerprinting database in bio surveillance for a nuclear power programme. (author)

  13. Sensitive voltammetric detection of DNA damage at carbon electrodes using DNA repair enzymes and an electroactive osmium marker

    Czech Academy of Sciences Publication Activity Database

    Havran, Luděk; Vacek, Jan; Cahová, Kateřina; Fojta, Miroslav

    2008-01-01

    Roč. 391, č. 5 (2008), s. 1751-1758 ISSN 1618-2642 R&D Projects: GA AV ČR(CZ) IAA4004402; GA AV ČR(CZ) IAA400040611; GA ČR(CZ) GA203/07/1195; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA damage * electroactive marker * carbon electrodes Subject RIV: BO - Biophysics Impact factor: 3.328, year: 2008

  14. Filipino DNA variation at 12 X-chromosome short tandem repeat markers.

    Science.gov (United States)

    Salvador, Jazelyn M; Apaga, Dame Loveliness T; Delfin, Frederick C; Calacal, Gayvelline C; Dennis, Sheila Estacio; De Ungria, Maria Corazon A

    2018-06-08

    Demands for solving complex kinship scenarios where only distant relatives are available for testing have risen in the past years. In these instances, other genetic markers such as X-chromosome short tandem repeat (X-STR) markers are employed to supplement autosomal and Y-chromosomal STR DNA typing. However, prior to use, the degree of STR polymorphism in the population requires evaluation through generation of an allele or haplotype frequency population database. This population database is also used for statistical evaluation of DNA typing results. Here, we report X-STR data from 143 unrelated Filipino male individuals who were genotyped via conventional polymerase chain reaction-capillary electrophoresis (PCR-CE) using the 12 X-STR loci included in the Investigator ® Argus X-12 kit (Qiagen) and via massively parallel sequencing (MPS) of seven X-STR loci included in the ForenSeq ™ DNA Signature Prep kit of the MiSeq ® FGx ™ Forensic Genomics System (Illumina). Allele calls between PCR-CE and MPS systems were consistent (100% concordance) across seven overlapping X-STRs. Allele and haplotype frequencies and other parameters of forensic interest were calculated based on length (PCR-CE, 12 X-STRs) and sequence (MPS, seven X-STRs) variations observed in the population. Results of our study indicate that the 12 X-STRs in the PCR-CE system are highly informative for the Filipino population. MPS of seven X-STR loci identified 73 X-STR alleles compared with 55 X-STR alleles that were identified solely by length via PCR-CE. Of the 73 sequence-based alleles observed, six alleles have not been reported in the literature. The population data presented here may serve as a reference Philippine frequency database of X-STRs for forensic casework applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Concordance of Hypermethylated DNA and the Tumor Markers CA 15-3, CEA, and TPA in Serum during Monitoring of Patients with Advanced Breast Cancer

    Directory of Open Access Journals (Sweden)

    Søren Kristiansen

    2015-01-01

    Full Text Available The serological protein tumor markers CA 15-3, CEA, and TPA are frequently used to monitor tumor burden among metastatic breast cancer patients. Breast cancer is associated with global DNA hypomethylation and hypermethylation of some promoter regions. No monitoring study has yet investigated the interrelationship between protein tumor markers, the global DNA hypomethylation, and hypermethylated genes in serum from patients with advanced disease. Twenty-nine patients with histologically proven advanced breast cancer received first-line chemotherapy with epirubicin. Samples were collected prior to each treatment and prospectively analyzed for CA 15-3, CEA, and TPA. The same samples were retrospectively analyzed for the concentration of hypermethylated RASSF1A and for global DNA hypomethylation using LINE-1. Among patients with elevated concentrations of the protein markers, concordance could be observed between serial changes of the hypermethylated RASSF1A gene and the protein markers. Among patients with lower concentrations, RASSF1A could only be detected periodically. There was discordance between changes of the hypomethylated LINE-1 as compared to the protein markers. Circulating hypermethylated RASSF1A and protein markers may have similar kinetics during monitoring of tumor burden. Further investigations are needed to determine whether any of the hypermethylated DNA genes may provide predictive information during monitoring.

  16. Concordance of Hypermethylated DNA and the Tumor Markers CA 15-3, CEA, and TPA in Serum during Monitoring of Patients with Advanced Breast Cancer.

    Science.gov (United States)

    Kristiansen, Søren; Jørgensen, Lars Mønster; Hansen, Morten Høgh; Nielsen, Dorte; Sölétormos, György

    2015-01-01

    The serological protein tumor markers CA 15-3, CEA, and TPA are frequently used to monitor tumor burden among metastatic breast cancer patients. Breast cancer is associated with global DNA hypomethylation and hypermethylation of some promoter regions. No monitoring study has yet investigated the interrelationship between protein tumor markers, the global DNA hypomethylation, and hypermethylated genes in serum from patients with advanced disease. Twenty-nine patients with histologically proven advanced breast cancer received first-line chemotherapy with epirubicin. Samples were collected prior to each treatment and prospectively analyzed for CA 15-3, CEA, and TPA. The same samples were retrospectively analyzed for the concentration of hypermethylated RASSF1A and for global DNA hypomethylation using LINE-1. Among patients with elevated concentrations of the protein markers, concordance could be observed between serial changes of the hypermethylated RASSF1A gene and the protein markers. Among patients with lower concentrations, RASSF1A could only be detected periodically. There was discordance between changes of the hypomethylated LINE-1 as compared to the protein markers. Circulating hypermethylated RASSF1A and protein markers may have similar kinetics during monitoring of tumor burden. Further investigations are needed to determine whether any of the hypermethylated DNA genes may provide predictive information during monitoring.

  17. The dual challenges of generality and specificity when developing environmental DNA markers for species and subspecies of Oncorhynchus

    Science.gov (United States)

    Taylor M. Wilcox; Kellie J. Carim; Kevin S. McKelvey; Michael Young; Michael K. Schwartz

    2015-01-01

    Environmental DNA (eDNA) sampling is a powerful tool for detecting invasive and native aquatic species. Often, species of conservation interest co-occur with other, closely related taxa. Here, we developed qPCR (quantitative PCR) markers which distinguish westslope cutthroat trout (Oncorhynchus clarkii lewsi), Yellowstone cutthroat trout (O. clarkii bouvieri...

  18. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  19. Promise and pitfalls of molecular markers of thyroid nodules

    OpenAIRE

    Jadhav, S.; Lila, Anurag; Bandgar, Tushar; Shah, Nalini

    2012-01-01

    Thyroid nodules are common in the general population with a prevalence of 5-7% The initial evaluation of thyroid nodules commonly involves thyroid function tests, an ultrasound (USG) and fine needle aspiration biopsy (FNAB). The optimal management of patients with thyroid nodules with indeterminate cytology is plagued by the lack of highly sensitive and specific diagnostic modalities In this article we attempt to review the available literature on the molecular markers which are increasingly ...

  20. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    Science.gov (United States)

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  1. Using RAD-seq to recognize sex-specific markers and sex chromosome systems.

    Science.gov (United States)

    Gamble, Tony

    2016-05-01

    Next-generation sequencing methods have initiated a revolution in molecular ecology and evolution (Tautz et al. ). Among the most impressive of these sequencing innovations is restriction site-associated DNA sequencing or RAD-seq (Baird et al. ; Andrews et al. ). RAD-seq uses the Illumina sequencing platform to sequence fragments of DNA cut by a specific restriction enzyme and can generate tens of thousands of molecular genetic markers for analysis. One of the many uses of RAD-seq data has been to identify sex-specific genetic markers, markers found in one sex but not the other (Baxter et al. ; Gamble & Zarkower ). Sex-specific markers are a powerful tool for biologists. At their most basic, they can be used to identify the sex of an individual via PCR. This is useful in cases where a species lacks obvious sexual dimorphism at some or all life history stages. For example, such tests have been important for studying sex differences in life history (Sheldon ; Mossman & Waser ), the management and breeding of endangered species (Taberlet et al. ; Griffiths & Tiwari ; Robertson et al. ) and sexing embryonic material (Hacker et al. ; Smith et al. ). Furthermore, sex-specific markers allow recognition of the sex chromosome system in cases where standard cytogenetic methods fail (Charlesworth & Mank ; Gamble & Zarkower ). Thus, species with male-specific markers have male heterogamety (XY) while species with female-specific markers have female heterogamety (ZW). In this issue, Fowler & Buonaccorsi () illustrate the ease by which RAD-seq data can generate sex-specific genetic markers in rockfish (Sebastes). Moreover, by examining RAD-seq data from two closely related rockfish species, Sebastes chrysomelas and Sebastes carnatus (Fig. ), Fowler & Buonaccorsi () uncover shared sex-specific markers and a conserved sex chromosome system. © 2016 John Wiley & Sons Ltd.

  2. Karyotype analysis, DNA content and molecular screening in Lippia alba (Verbenaceae

    Directory of Open Access Journals (Sweden)

    Patrícia M.O. Pierre

    2011-09-01

    Full Text Available Cytogenetic analyses, of pollen viability, nuclear DNA content and RAPD markers were employed to study three chemotypes of Lippia alba (Mill. (Verbenaceae in order to understand the genetic variation among them. Different ploidy levels and mixoploid individuals were observed. This work comprises the first report of different chromosome numbers (cytotypes in L. alba. The chromosome numbers of La2-carvone and La3-linalool chemotypes suggested that they are polyploids. Flow cytometric analysis showed an increase of nuclear DNA content that was not directly proportional to ploidy level variation. A cluster analysis based on RAPD markers revealed that La3-linalool shares genetic markers with La1-citral and La2-carvone. The analysis showed that the majority of genetic variation of La3-linalool could be a consequence of ixoploidy. ur data indicates that sexual reproduction aong those three chemotypes is unlikely and suggests the beginning of reproductive isolation. The results demonstrated that chromosome analysis, nuclear DNA content estimation and RAPD markers constitute excellent tools for detecting genetic variation among L. alba chemotypes.Análises citogenéticas, de viabilidade do pólen, do conteúdo de DNA nuclear e marcadores RAPD foram empregadas no estudo de três quimiotipos de Lippia alba (Mill. (Verbenaceae visando contribuir para o entendimento da variação genética entre os mesmos. Diferentes níveis de ploidia e indivíduos mixoploides foram observados. Este trabalho compreende o primeiro relato de diferentes números cromossômicos (citótipos em L. alba. Os números cromossômicos dos quimiotipos La2-carvona e La3-linalol sugere que eles seja poliploides. A análise da citometria de fluxo mostrou um aumento do conteúdo de DNA nuclear que não foi diretamente proporcional à variação no nível de ploidia. A análise de agrupamento baseada nos marcadores RAPD demonstrou que La3-linalol compartilha marcadores genéticos com La1

  3. Understanding DNA Under Oxidative Stress and Sensitization: The Role of Molecular Modeling

    Directory of Open Access Journals (Sweden)

    Antonio eMonari

    2015-07-01

    Full Text Available DNA is constantly exposed to damaging threats coming from oxidative stress, i.e. from the presence of free radicals and reactive oxygen species. Sensitization from exogenous and endogenous compounds that strongly enhance the frequency of light-induced lesions also plays an important role. The experimental determination of DNA lesions, though a difficult subject, is somehow well established and allows to elucidate even extremely rare DNA lesions. In parallel, molecular modeling has become fundamental to clearly understand the fine mechanisms related to DNA defects induction. Indeed, it offers an unprecedented possibility to get access to an atomistic or even electronic resolution. Ab initio molecular dynamics may also describe the time-evolution of the molecular system and its reactivity. Yet the modeling of DNA (photo-reactions does necessitate elaborate multi-scale methodologies to tackle a damage induction reactivity that takes place in a complex environment. The double-stranded DNA environment is first characterized by a very high flexibility, that dynamical effects are to be taken into account, but also a strongly inhomogeneous electrostatic embedding. Additionally, one aims at capturing more subtle effects, such as the sequence selectivity which is of critical important for DNA damage. The structure and dynamics of the DNA/sensitizers complexes, as well as the photo-induced electron- and energy-transfer phenomena taking place upon sensitization, should be carefully modeled. Finally the factors inducing different repair ratios for different lesions should also be rationalized.In this review we will critically analyze the different computational strategies used to model DNA lesions. A clear picture of the complex interplay between reactivity and structural factors will be sketched. The use of proper multi-scale modeling leads to the in-depth comprehension of DNA lesions mechanism and also to the rational design of new chemo-therapeutic agents.

  4. Feasibility of using microbeads with holographic barcodes to track DNA specimens in the clinical molecular laboratory

    Directory of Open Access Journals (Sweden)

    Jason D. Merker

    2013-07-01

    Full Text Available We demonstrate the feasibility of using glass microbeads with a holographic barcode identifier to track DNA specimens in the molecular pathology laboratory. These beads can be added to peripheral blood specimens and are carried through automated DNA extraction protocols that use magnetic glass particles. We found that an adequate number of microbeads are consistently carried over during genomic DNA extraction to allow specimen identification, that the beads do not interfere with the performance of several different molecular assays, and that the beads and genomic DNA remain stable when stored together under regular storage conditions in the molecular pathology laboratory. The beads function as an internal, easily readable specimen barcode. This approach may be useful for identifying DNA specimens and reducing errors associated with molecular laboratory testing.

  5. Analyte-Triggered DNA-Probe Release from a Triplex Molecular Beacon for Nanopore Sensing.

    Science.gov (United States)

    Guo, Bingyuan; Sheng, Yingying; Zhou, Ke; Liu, Quansheng; Liu, Lei; Wu, Hai-Chen

    2018-03-26

    A new nanopore sensing strategy based on triplex molecular beacon was developed for the detection of specific DNA or multivalent proteins. The sensor is composed of a triplex-forming molecular beacon and a stem-forming DNA component that is modified with a host-guest complex. Upon target DNA hybridizing with the molecular beacon loop or multivalent proteins binding to the recognition elements on the stem, the DNA probe is released and produces highly characteristic current signals when translocated through α-hemolysin. The frequency of current signatures can be used to quantify the concentrations of the target molecules. This sensing approach provides a simple, quick, and modular tool for the detection of specific macromolecules with high sensitivity and excellent selectivity. It may find useful applications in point-of-care diagnostics with a portable nanopore kit in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. MOLECULAR MARKERS OF BLADDER CANCER: FROM THE PARTICULAR TO THE GENERAL

    Directory of Open Access Journals (Sweden)

    A. A. Zabolotneva

    2014-08-01

    Full Text Available Bladder cancer (BC is the second most common urinary tract malignancy. Early diagnosis of BC generally increases the probability of successful treatment in a patient. The paper considers noninvasive diagnosis methods for BC and gives a database of the known molecular markers of this disease.

  7. Application of molecular markers in apple breeding

    Directory of Open Access Journals (Sweden)

    Marić Slađana

    2010-01-01

    Full Text Available Apple is economically the most important species of genus Malus Miller. In respect of production, trade and consumption, it ranks first among deciduous fruit and third on a global scale among all fruit species. Apple breeding is carried out on a large scale in several scientific institutes throughout the world. Due to this activity, apple is a fruit species with the highest number of described monogenic traits; 76 genes, encoding morphological traits, pest and disease resistance, as well as 69 genes encoding enzymes. The development of molecular markers (RFLPs, AFLPs, SCARs and SSRs has allowed the mapping of the apple genome and the development of several saturated genetic maps, to which genes controlling important traits are assigned. Markers flanking these genes not only play an important role in selecting parental combinations and seedlings with positive traits, but they are also particularly important in detecting recessive traits, such as seedless fruit. In addition they enable pre-selection for polygenic quantitative traits. In recent years, particular attention has been paid to biochemical and physiological processes involved in the pathway of important traits e.g., ripening and the storage capability of apple fruit.

  8. Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

    Science.gov (United States)

    Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

    2008-09-01

    We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

  9. Assessing diversity among traditional Greek and foreign eggplant cultivars using molecular markers and morphometrical descriptors

    International Nuclear Information System (INIS)

    Augustinos, A.A.; Petropoulos, C.; Karasoulou, V.; Bletsos, F.; Papasotiropoulos, V.

    2016-01-01

    Eggplant is a widely cultivated vegetable crop of great economic importance. Its long lasting history of domestication, selection and breeding has led to the development of numerous cultivars with variable traits. In the present study, we assessed the diversity levels within and among eleven Greek and foreign cultivars, using 22 morphological descriptors and two different classes of molecular markers (retrotransposon microsatellite amplified polymorphism-REMAP markers and nuclear microsatellites). Our results, in accordance with other studies in the field showed: a) the limited levels of genetic polymorphism within the cultivars; b) the high morphological and genetic divergence existing among them as indicated by the genetic distance values calculated, which could be attributed to selection, inbreeding and bottleneck effects; and c) the lack of concordance among morphological descriptors and molecular markers. Despite these, our analysis showed that the utilization of combinations of markers is an effective method for the characterization of plant material providing also useful diagnostic tools for the identification and authentication of the selected Greek cultivars.

  10. Assessing diversity among traditional Greek and foreign eggplant cultivars using molecular markers and morphometrical descriptors

    Energy Technology Data Exchange (ETDEWEB)

    Augustinos, A.A.; Petropoulos, C.; Karasoulou, V.; Bletsos, F.; Papasotiropoulos, V.

    2016-07-01

    Eggplant is a widely cultivated vegetable crop of great economic importance. Its long lasting history of domestication, selection and breeding has led to the development of numerous cultivars with variable traits. In the present study, we assessed the diversity levels within and among eleven Greek and foreign cultivars, using 22 morphological descriptors and two different classes of molecular markers (retrotransposon microsatellite amplified polymorphism-REMAP markers and nuclear microsatellites). Our results, in accordance with other studies in the field showed: a) the limited levels of genetic polymorphism within the cultivars; b) the high morphological and genetic divergence existing among them as indicated by the genetic distance values calculated, which could be attributed to selection, inbreeding and bottleneck effects; and c) the lack of concordance among morphological descriptors and molecular markers. Despite these, our analysis showed that the utilization of combinations of markers is an effective method for the characterization of plant material providing also useful diagnostic tools for the identification and authentication of the selected Greek cultivars.

  11. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  12. The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

    Science.gov (United States)

    Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

    2011-01-25

    DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

  13. HBV DNA Integration: Molecular Mechanisms and Clinical Implications

    Science.gov (United States)

    Tu, Thomas; Budzinska, Magdalena A.; Shackel, Nicholas A.; Urban, Stephan

    2017-01-01

    Chronic infection with the Hepatitis B Virus (HBV) is a major cause of liver-related morbidity and mortality. One peculiar observation in cells infected with HBV (or with closely‑related animal hepadnaviruses) is the presence of viral DNA integration in the host cell genome, despite this form being a replicative dead-end for the virus. The frequent finding of somatic integration of viral DNA suggests an evolutionary benefit for the virus; however, the mechanism of integration, its functions, and the clinical implications remain unknown. Here we review the current body of knowledge of HBV DNA integration, with particular focus on the molecular mechanisms and its clinical implications (including the possible consequences of replication-independent antigen expression and its possible role in hepatocellular carcinoma). HBV DNA integration is likely to influence HBV replication, persistence, and pathogenesis, and so deserves greater attention in future studies. PMID:28394272

  14. Hydrodynamic characterization and molecular weight estimation of ultrasonically sheared DNA

    International Nuclear Information System (INIS)

    Casal, J. I.; Garces, F.; Garcia-Sacristan, A.

    1981-01-01

    The sedimentation coefficients and intrinsic viscosities of ultrasonically sheared calf thymus DNA have been determined. The molecular weight estimation according to this parameters have been compared with the ones obtained from the electrophoretic migration rates based on the calibration proposed using the known molecular weight restriction fragments of X-ENA. (Author) 35 refs

  15. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    Directory of Open Access Journals (Sweden)

    Nasseri Negin

    2009-01-01

    Full Text Available Abstract Background Squamous cell carcinoma of esophagus (SCCE occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. Methods For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Results Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4% tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect

  16. Qualitative analysis of Adenomatous Polyposis Coli promoter: Hypermethylation, engagement and effects on survival of patients with esophageal cancer in a high risk region of the world, a potential molecular marker

    International Nuclear Information System (INIS)

    Zare, Maryam; Jazii, Ferdous Rastgar; Alivand, Mohammad Reza; Nasseri, Negin Karimi; Malekzadeh, Reza; Yazdanbod, Mansour

    2009-01-01

    Squamous cell carcinoma of esophagus (SCCE) occurs at a high incidence rate in certain parts of the world. This feature necessitates that different aspects of the disease and in particular genetic characteristics be investigated in such regions. In addition, such investigations might lead to achievement of molecular markers helpful for early detection, successful treatment and follow up of the disease. Adenomatous Polyposis Coli (APC) promoter hypermethylation has been shown to be a suitable marker for both serum and solid tumors of adenocarcinoma of esophagus. We investigated the status of APC promoter hypermethylation in Iranian patients, compared the results with the former studies, and evaluated its applicability as a candidate molecular marker by examining association between survival of SCCE patients and APC promoter methylation. For evaluating the status of APC promoter hypermethylation and its association with SCCE, a qualitative methylation specific PCR (MSP) was used. DNA was extracted and digested with an appropriate restriction enzyme, treated with sodium bisulfite in agarose beads and amplified in two-step PCR reaction by applying either methylated or unmethylated promoter specific primers. Universally methylated DNA and methylase treated blood DNA of healthy donors were used as positive controls as well. Survival of patients was followed up for two years after treatment and survival rate of patients with methylated APC promoter was compared with that of unmethylated patients. Assessment of APC promoter methylation revealed that normal tissues were unmethylated, while twenty out of forty five (44.4%) tumor tissues were hypermethylated either in one or both alleles of APC. Among the tissues in which methylation was detected, seven were hypermethylated in both alleles while the other thirteen were hypermethylated in one of the two alleles of APC. Analyzing two-year survival rate of patients with respect to promoter hypermethylation showed a lower rate of

  17. Distribution of Mytilus taxa in European coastal areas as inferred from molecular markers

    NARCIS (Netherlands)

    Kijewski, T.; Zmietanka, B.; Zbawicka, M.; Gosling, E.; Hummel, H.; Wenne, R.

    2011-01-01

    The genetic constitution of mussels (Mytilus spp.) was studied by means of three nuclear (Me 15/16, EF-bis, ITS) and one mtDNA (ND2-COIII) marker on a large European scale. In addition to a sharp cline between Atlantic and Mediterranean M. galloprovincialis, we observed a clear genetic distinction

  18. Population genetic structure of rare and endangered plants using molecular markers

    Science.gov (United States)

    Raji, Jennifer; Atkinson, Carter T.

    2013-01-01

    This study was initiated to assess the levels of genetic diversity and differentiation in the remaining populations of Phyllostegia stachyoides and Melicope zahlbruckneri in Hawai`i Volcanoes National Park and determine the extent of gene flow to identify genetically distinct individuals or groups for conservation purposes. Thirty-six Amplified Fragment Length Polymorphic (AFLP) primer combinations generated a total of 3,242 polymorphic deoxyribonucleic acid (DNA) fragments in the P. stachyoides population with a percentage of polymorphic bands (PPB) ranging from 39.3 to 65.7% and 2,780 for the M. zahlbruckneri population with a PPB of 18.8 to 64.6%. Population differentiation (Fst) of AFLP loci between subpopulations of P. stachyoides was low (0.043) across populations. Analysis of molecular variance of P. stachyoides showed that 4% of the observed genetic differentiation occurred between populations in different kīpuka and 96% when individuals were pooled from all kīpuka. Moderate genetic diversity was detected within the M. zahlbruckneri population. Bayesian and multivariate analyses both classified the P. stachyoides and M. zahlbruckneri populations into genetic groups with considerable sub-structuring detected in the P. stachyoides population. The proportion of genetic differentiation among populations explained by geographical distance was estimated by Mantel tests. No spatial correlation was found between genetic and geographic distances in both populations. Finally, a moderate but significant gene flow that could be attributed to insect or bird-mediated dispersal of pollen across the different kīpuka was observed. The results of this study highlight the utility of a multi-allelic DNA-based marker in screening a large number of polymorphic loci in small and closely related endangered populations and revealed the presence of genetically unique groups of individuals in both M. zahlbruckneri and P. stachyoides populations. Based on these findings

  19. [cDNA library construction from panicle meristem of finger millet].

    Science.gov (United States)

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  20. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  1. Molecular genetic markers for thyroid FNAB. Established assays and future perspective.

    Science.gov (United States)

    Musholt, Thomas J; Musholt, P B

    2015-01-01

    Thyroid nodules > 1 cm are observed in about 12% of unselected adult employees aged 18-65 years screened by ultrasound scan (40). While intensive ultrasound screening leads to early detection of thyroid diseases, the determination of benign or malignant behaviour remains uncertain and may trigger anxieties in many patients and their physicians. A considerable number of thyroid resections are consecutively performed due to suspicion of malignancy in the detected nodes. Fine needle aspiration biopsy (FNAB) has been recommended for the assessment of thyroid nodules to facilitate detection of thyroid carcinomas but also to rule out malignancy and thereby avoid unnecessary thyroid resections. However, cytology results are dependent on experience of the respective cytologist and unfortunately inconclusive in many cases. Molecular genetic markers are already used nowadays to enhance sensitivity and specificity of FNAB cytology in some centers in Germany. The most clinically relevant molecular genetic markers as pre-operative diagnostic tools and the clinical implications for the intraoperative and postoperative management were reviewed. Molecular genetic markers predominantly focus on the preoperative detection of thyroid malignancies rather than the exclusion of thyroid carcinomas. While some centers routinely assess FNABs, other centers concentrate on FNABs with cytology results of follicular neoplasia or suspicion of thyroid carcinoma. Predominantly mutations of BRAF, RET/PTC, RAS, and PAX8/PPARγ or expression of miRNAs are analyzed. However, only the detection of BRAF mutations predicts the presence of (papillary) thyroid malignancy with almost 98% probability, indicating necessity of oncologic thyroid resections irrespective of the cytology result. Other genetic alterations are associated with thyroid malignancy with varying frequency and achieve less impact on the clinical management. Molecular genetic analysis of FNABs is increasingly performed in Germany

  2. Molecular analysis of pancreatic cyst fluid changes clinical management.

    Science.gov (United States)

    Arner, David M; Corning, Brooke E; Ahmed, Ali M; Ho, Henry C; Weinbaum, Bradley J; Siddiqui, Uzma; Aslanian, Harry; Adams, Reid B; Bauer, Todd W; Wang, Andrew Y; Shami, Vanessa M; Sauer, Bryan G

    2018-01-01

    DNA molecular analysis has been suggested as a tool to evaluate pancreatic cysts. This study assesses whether the addition of DNA molecular analysis alters clinical management. This is a retrospective review of 46 consecutive patients who underwent EUS-FNA of pancreatic cysts with DNA molecular analysis at two major academic institutions. Cases were presented to two pancreaticobiliary surgeons first without and then with DNA molecular analysis data. The primary outcome was the frequency with which clinical management was altered with the addition of DNA molecular analysis. Forty-six patients with a mean age of 62.0 (±13.4) years and mean cyst size of 3.2 (±2.3) cm were included in the study. Cyst carcinoembryonic antigen (CEA) was available in 30 patients and ranged from 0.4 to 15,927 ng/mL. DNA molecular analysis was described as benign in 23 (50%), statistically indolent in 13 (28%), statistically higher risk in 9 (20%), and indeterminate in 1 (2%). Surgeon #1 changed the management in 13/46 cases (28%) and surgeon #2 changed the management in 12/46 cases (26%) with the addition of DNA molecular analysis. When organized by CEA concentration, those with an intermediate CEA (45-800 ng/mL) or without a CEA concentration had a management changed more frequently (40%) compared to all others (P molecular analysis alters the clinical management of pancreatic cystic lesions most often when CEA levels are intermediate (45-800 ng/mL) or when no CEA concentration is available. Use of DNA molecular analysis can be considered in this cohort. Further study of molecular markers in pancreatic cystic lesions is recommended.

  3. Molecular dynamics simulation of a DNA containing a single strand break

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H.; Siebers, G.; Furukawa, A.; Otagiri, N.; Osman, R

    2002-07-01

    Molecular dynamics simulations were performed for a dodecamer DNA containing a single strand break (SSB), which has been represented by a 3'-OH deoxyribose and 5'-OH phosphate in the middle of the strand. Molecular force field parameters of the 5'-OH phosphate region were determined from an ab initio calculation at the HF/6-31G level using the program package GAMESS. The DNA was placed in a periodic boundary box with water molecules and Na+ counter-ions to produce a neutralised system. After minimisation, the system was heated to 300 K, equilibrated and a production run at constant NTP was executed for 1 ns using AMBER 4.1. Snapshots of the SSB-containing DNA and a detailed analysis of the equilibriated average structure revealed surprisingly small conformational changes compared to normal DNA. However, dynamic properties calculated using the essential dynamics method showed some features that may be important for the recognition of this damage by repair enzymes. (author)

  4. Feasibility study of molecular memory device based on DNA using methylation to store information

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Liming; Al-Dirini, Feras [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); National ICT Australia, The University of Melbourne, Parkville 3010 (Australia); Qiu, Wanzhi; Skafidas, Efstratios, E-mail: sskaf@unimelb.edu.au [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia); Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Hossain, Faruque M. [Center for Neural Engineering (CfNE), The University of Melbourne, Carlton 3053 (Australia); Evans, Robin [Department of Electrical and Electronic Engineering, The University of Melbourne, Parkville 3010 (Australia)

    2016-07-14

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  5. Feasibility study of molecular memory device based on DNA using methylation to store information

    International Nuclear Information System (INIS)

    Jiang, Liming; Al-Dirini, Feras; Qiu, Wanzhi; Skafidas, Efstratios; Hossain, Faruque M.; Evans, Robin

    2016-01-01

    DNA, because of its robustness and dense information storage capability, has been proposed as a potential candidate for next-generation storage media. However, encoding information into the DNA sequence requires molecular synthesis technology, which to date is costly and prone to synthesis errors. Reading the DNA strand information is also complex. Ideally, DNA storage will provide methods for modifying stored information. Here, we conduct a feasibility study investigating the use of the DNA 5-methylcytosine (5mC) methylation state as a molecular memory to store information. We propose a new 1-bit memory device and study, based on the density functional theory and non-equilibrium Green's function method, the feasibility of electrically reading the information. Our results show that changes to methylation states lead to changes in the peak of negative differential resistance which can be used to interrogate memory state. Our work demonstrates a new memory concept based on methylation state which can be beneficial in the design of next generation DNA based molecular electronic memory devices.

  6. Complete mitochondrial genomes of Taenia multiceps, T. hydatigena and T. pisiformis: additional molecular markers for a tapeworm genus of human and animal health significance.

    Science.gov (United States)

    Jia, Wan-Zhong; Yan, Hong-Bin; Guo, Ai-Jiang; Zhu, Xing-Quan; Wang, Yu-Chao; Shi, Wan-Gui; Chen, Hao-Tai; Zhan, Fang; Zhang, Shao-Hua; Fu, Bao-Quan; Littlewood, D Timothy J; Cai, Xue-Peng

    2010-07-22

    Mitochondrial genomes provide a rich source of molecular variation of proven and widespread utility in molecular ecology, population genetics and evolutionary biology. The tapeworm genus Taenia includes a diversity of tapeworm parasites of significant human and veterinary importance. Here we add complete sequences of the mt genomes of T. multiceps, T. hydatigena and T. pisiformis, to a data set of 4 published mtDNAs in the same genus. Seven complete mt genomes of Taenia species are used to compare and contrast variation within and between genomes in the genus, to estimate a phylogeny for the genus, and to develop novel molecular markers as part of an extended mitochondrial toolkit. The complete circular mtDNAs of T. multiceps, T. hydatigena and T. pisiformis were 13,693, 13,492 and 13,387 bp in size respectively, comprising the usual complement of flatworm genes. Start and stop codons of protein coding genes included those found commonly amongst other platyhelminth mt genomes, but the much rarer initiation codon GTT was inferred for the gene atp6 in T. pisiformis. Phylogenetic analysis of mtDNAs offered novel estimates of the interrelationships of Taenia. Sliding window analyses showed nad6, nad5, atp6, nad3 and nad2 are amongst the most variable of genes per unit length, with the highest peaks in nucleotide diversity found in nad5. New primer pairs capable of amplifying fragments of variable DNA in nad1, rrnS and nad5 genes were designed in silico and tested as possible alternatives to existing mitochondrial markers for Taenia. With the availability of complete mtDNAs of 7 Taenia species, we have shown that analysis of amino acids provides a robust estimate of phylogeny for the genus that differs markedly from morphological estimates or those using partial genes; with implications for understanding the evolutionary radiation of important Taenia. Full alignment of the nucleotides of Taenia mtDNAs and sliding window analysis suggests numerous alternative gene

  7. Cerebrospinal fluid tau levels are a marker for molecular subtype in sporadic Creutzfeldt-Jakob disease.

    Science.gov (United States)

    Karch, André; Hermann, Peter; Ponto, Claudia; Schmitz, Matthias; Arora, Amandeep; Zafar, Saima; Llorens, Franc; Müller-Heine, Annika; Zerr, Inga

    2015-05-01

    The molecular subtype of sporadic Creutzfeldt-Jakob disease (sCJD) is an important prognostic marker for patient survival. However, subtype determination is not possible during lifetime. Because the rate of disease progression is associated with the molecular subtype, this study aimed at investigating if total tau, a marker of neuronal death, allows premortem diagnosis of molecular subtype when codon 129 genotype is known. Two hundred ninety-six sCJD patients were tested for their cerebrospinal fluid total tau level at the time of diagnosis and were investigated for their sCJD subtype postmortem. There was a significant association between tau levels and the prion protein type in patients with codon 129 MM (p disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Stories in Genetic Code. The contribution of ancient DNA studies to anthropology and their ethical implications

    Directory of Open Access Journals (Sweden)

    Cristian M. Crespo

    2010-12-01

    Full Text Available For several decades, biological anthropology has employed different molecular markers in population research. Since 1990 different techniques in molecular biology have been developed allowing preserved DNA extraction and its typification in different samples from museums and archaeological sites. Ancient DNA studies related to archaeological issues are now included in the field of Archaeogenetics. In this work we present some of ancient DNA applications in archaeology. We also discuss advantages and limitations for this kind of research and its relationship with ethic and legal norms.

  9. Single molecular biology: coming of age in DNA replication.

    Science.gov (United States)

    Liu, Xiao-Jing; Lou, Hui-Qiang

    2017-09-20

    DNA replication is an essential process of the living organisms. To achieve precise and reliable replication, DNA polymerases play a central role in DNA synthesis. Previous investigations have shown that the average rates of DNA synthesis on the leading and lagging strands in a replisome must be similar to avoid the formation of significant gaps in the nascent strands. The underlying mechanism has been assumed to be coordination between leading- and lagging-strand polymerases. However, Kowalczykowski's lab members recently performed single molecule techniques in E. coli and showed the real-time behavior of a replisome. The leading- and lagging-strand polymerases function stochastically and independently. Furthermore, when a DNA polymerase is paused, the helicase slows down in a self-regulating fail-safe mechanism, akin to a ''dead-man's switch''. Based on the real-time single-molecular observation, the authors propose that leading- and lagging-strand polymerases synthesize DNA stochastically within a Gaussian distribution. Along with the development and application of single-molecule techniques, we will witness a new age of DNA replication and other biological researches.

  10. X linked neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA marker loci.

    OpenAIRE

    Thomas, N S; Williams, H; Cole, G; Roberts, K; Clarke, A; Liechti-Gallati, S; Braga, S; Gerber, A; Meier, C; Moser, H

    1990-01-01

    We have studied the inheritance of several polymorphic Xq27/28 DNA marker loci in two three generation families with the X linked neonatal lethal form of centronuclear/myotubular myopathy (XL MTM). We found complete linkage of XLMTM to all four informative Xq28 markers analysed, with GCP/RCP (Z = 3.876, theta = 0.00), with DXS15 (Z = 3.737, theta = 0.00), with DXS52 (Z = 2.709, theta = 0.00), and with F8C (Z = 1.020, theta = 0.00). In the absence of any observable recombination, we are unable...

  11. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    Science.gov (United States)

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  12. Transcription analysis of apple fruit development using cDNA microarrays

    NARCIS (Netherlands)

    Soglio, V.; Costa, F.; Molthoff, J.W.; Weemen-Hendriks, M.; Schouten, H.J.; Gianfranceschi, L.

    2009-01-01

    The knowledge of the molecular mechanisms underlying fruit quality traits is fundamental to devise efficient marker-assisted selection strategies and to improve apple breeding. In this study, cDNA microarray technology was used to identify genes whose expression changes during fruit development and

  13. Molecular markers for granulovacuolar degeneration are present in rimmed vacuoles.

    Directory of Open Access Journals (Sweden)

    Masahiro Nakamori

    Full Text Available BACKGROUND: Rimmed vacuoles (RVs are round-oval cytoplasmic inclusions, detected in muscle cells of patients with myopathies, such as inclusion body myositis (IBM and distal myopathy with RVs (DMRV. Granulovacuolar degeneration (GVD bodies are spherical vacuoles containing argentophilic and hematoxyphilic granules, and are one of the pathological hallmarks commonly found in hippocampal pyramidal neurons of patients with aging-related neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease. These diseases are common in the elderly and share some pathological features. Therefore, we hypothesized that mechanisms of vacuolar formation in RVs and GVD bodies are common despite their role in two differing pathologies. We explored the components of RVs by immunohistochemistry, using antibodies for GVD markers. METHODS: Subjects included one AD case, eight cases of sporadic IBM, and three cases of DMRV. We compared immunoreactivity and staining patterns for GVD markers. These markers included: (1 tau-modifying proteins (caspase 3, cyclin-dependent kinase 5 [CDK5], casein kinase 1δ [CK1δ], and c-jun N-terminal kinase [JNK], (2 lipid raft-associated materials (annexin 2, leucine-rich repeat kinase 2 [LRRK2], and flotillin-1, and (3 other markers (charged multi-vesicular body protein 2B [CHMP2B] and phosphorylated transactive response DNA binding protein-43 [pTDP43] in both GVD bodies and RVs. Furthermore, we performed double staining of each GVD marker with pTDP43 to verify the co-localization. RESULTS: GVD markers, including lipid raft-associated proteins and tau kinases, were detected in RVs. CHMP2B, pTDP43, caspase 3, LRRK2, annexin 2 and flotillin-1 were detected on the rim and were diffusely distributed in the cytoplasm of RV-positive fibers. CDK5, CK1δ and JNK were detected only on the rim. In double staining experiments, all GVD markers colocalized with pTDP43 in RVs. CONCLUSIONS: These results suggest that RVs of muscle

  14. Identification of SSR and retrotransposon-based molecular markers linked to morphological characters in oily sunfl ower (Helianthus annuus L.) under natural and water-limited states.

    Science.gov (United States)

    Ali, Soleimani Gezeljeh; Darvishzadeh, Reza; Ebrahimi, Asa; Bihamta, Mohammad Reza

    2018-03-01

    Sunflower is an important source of edible oil. Drought is known as an important factor limiting the growth and productivity of field crops in most parts of the world. Agricultural biotechnology mainly aims at developing crops with higher tolerance to the challenging environmental conditions, such as drought. This study examined a number of morphological characters, along with relative water content (RWC) in 100 inbred sunflower lines. A 10 × 10 simple lattice design with two replications was employed to measure the mentioned parameters under natural and water-limited states during two successive years. In molecular trial, 30 simple sequence repeat (SSR) primer pairs, as well as 14 inter-retrotransposon amplified polymorphism (IRAP) and 14 retrotransposon-microsatellite amplified polymorphism (REMAP) primer combinations were used for DNA fingerprinting of the lines. Most of the examined characters had lower average values under water-limited than natural states. Maximum and minimum reductions were observed in the cases of yield and oil percentage, respectively. The broad-sense heritabilities for all the examined characters were 0.20-0.73 and 0.10-0.34 under natural and water-limited states, respectively. In the studied samples, 8.97% of the 435 possible locus pairs of the SSRs represented significant linkage disequilibrium (LD) levels. In the association analysis using SSR markers, 22 and 21 markers were identified (P ≤ 0.05) for the studied characters under natural and water-limited states, respectively. The corresponding values were 50 and 37 using retrotransposon-based molecular markers. Some detected markers were communal between the characters under water-limited and natural states. This was in line with the phenotypic correlations detected between the characters. Communal markers facilitate the simultaneous selection of several characters and can thus improve the efficacy of selection based on markers in the plant-breeding activities.

  15. Integrating microsatellite DNA markers and otolith geochemistry to assess population structure of European hake (Merluccius merluccius)

    Science.gov (United States)

    Tanner, Susanne E.; Pérez, Montse; Presa, Pablo; Thorrold, Simon R.; Cabral, Henrique N.

    2014-04-01

    Population structure and natal origins of European hake were investigated using microsatellite DNA markers and otolith geochemistry data. Five microsatellites were sequenced and otolith core geochemical composition was determined from age-1 hake collected in the northeast Atlantic Ocean and the Mediterranean Sea. Microsatellites provided evidence of a major genetic split in the vicinity of the Strait of Gibraltar, separating the Atlantic and the Mediterranean populations, with the exception of the Gulf of Cádiz. Based on classification models using otolith core geochemical values, individual natal origins were identified, although with an increased error rate. Coupling genotype and otolith data increased the classification accuracy of individuals to their potential natal origins while providing evidence of movement between the northern and southern stock units in the Atlantic Ocean. Information obtained by the two natural markers on population structure of European hake was complementary as the two markers act at different spatio-temporal scales. Otolith geochemistry provides information over an ecological time frame and on a fine spatial scale, while microsatellite DNA markers report on gene flow over evolutionary time scales and therefore act on a broader spatio-temporal resolution. Thus, this study confirmed the value of otolith geochemistry to complement the assessment of early life stage dispersal in populations with high gene flow and low genetic divergence.

  16. Comparative polymorphism of sterlet fertilizers (Acipenser Ruthenus for microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    Ольга Олексіївна Малишева

    2015-11-01

    Full Text Available Based on microsatellite DNA markers in three (LG-19, LS-68 and LS-39 it is examined intraspecific genetic structure of sterlet fertilizers. As a result of this work it was found that this group of fish is in a balanced state in terms of the genetic polymorphism. On the basis of certain individual differences in allelic variants have been selected and combined the parental pairs for alternative genotypes. The results of the research allow optimize further work on the reproduction of sturgeon under artificial cultivation

  17. Integrated Molecular Imaging and Therapy for Breast Cancer

    National Research Council Canada - National Science Library

    Panchapakesan, Balaji

    2008-01-01

    ...) and NIR dosing of cancer cells using SWCNT. While previous studies have shown the transport of DNA into cells using nanotubes, in this study we show multi-component molecular targeting of both IGF1R and Her2 surface markers in cancer cells...

  18. Molecular characterization of Cymbidium kanran cultivars based on ...

    African Journals Online (AJOL)

    Fifty-four Cymbidium kanran cultivars from China, Japan and Korea were examined and analyzed by using the successive screening of 3'-end extended random primer amplified polymorphic DNA (ERAPD) markers to determine their molecular diversity and relationships. In ERAPD analyses, the strandspecific DNA ...

  19. Molecular beacon based biosensor for the sequence-specific detection of DNA using DNA-capped gold nanoparticles-streptavidin conjugates for signal amplification

    International Nuclear Information System (INIS)

    Fang, Xian; Jiang, Wei; Han, Xiaowei; Zhang, Yuzhong

    2013-01-01

    We describe a highly sensitive and selective molecular beacon-based electrochemical impedance biosensor for the sequence-specific detection of DNA. DNA-capped conjugates between gold nanoparticles (Au-NPs) and streptavidin are used for signal amplification. The molecular beacon was labeled with a thiol at its 5′ end and with biotin at its 3′ end, and then immobilized on the surface of a bare gold electrode through the formation of Au-S bonds. Initially, the molecular beacon is present in the “closed” state, and this shields the biotin from being approached by streptavidin due to steric hindrance. In the presence of the target DNA, the target DNA molecules hybridize with the loop and cause a conformational change that moves the biotin away from the surface of the electrode. The biotin thereby becomes accessible for the reporter (the DNA-streptavidin capped Au-NPs), and this results in a distinct increase in electron transfer resistance. Under optimal conditions, the increase in resistance is linearly related to the logarithm of the concentration of complementary target DNA in the range from 1.0 fM to 0.1 μM, with a detection limit of 0.35 fM (at an S/N of 3). This biosensor exhibits good selectivity, and acceptable stability and reproducibility. (author)

  20. Characterization of 35 novel microsatellite DNA markers from the duck (Anas platyrhynchos genome and cross-amplification in other birds

    Directory of Open Access Journals (Sweden)

    Xu Ke

    2005-07-01

    Full Text Available Abstract In order to study duck microsatellites, we constructed a library enriched for (CAn, (CAGn, (GCCn and (TTTCn. A total of 35 pairs of primers from these microsatellites were developed and used to detect polymorphisms in 31 unrelated Peking ducks. Twenty-eight loci were polymorphic and seven loci were monomorphic. A total of 117 alleles were observed from these polymorphic microsatellite markers, which ranged from 2 to 14 with an average of 4.18 per locus. The frequencies of the 117 alleles ranged from 0.02 to 0.98. The highest heterozygosity (0.97 was observed at the CAUD019 microsatellite locus and the lowest heterozygosity (0.04 at the CAUD008 locus, and 11 loci had heterozygosities greater than 0.50 (46.43%. The polymorphism information content (PIC of 28 loci ranged from 0.04 to 0.88 with an average of 0.42. All the above markers were used to screen the polymorphism in other bird species. Two markers produced specific monomorphic products with the chicken DNA. Fourteen markers generated specific fragments with the goose DNA: 5 were polymorphic and 9 were monomorphic. But no specific product was detected with the peacock DNA. Based on sequence comparisons of the flanking sequence and repeat, we conclude that 2 chicken loci and 14 goose loci were true homologous loci of the duck loci. The microsatellite markers identified and characterized in the present study will contribute to the genetic map, quantitative traits mapping, and phylogenetic analysis in the duck and goose.

  1. Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).

    Science.gov (United States)

    Sinniger, Frederic; Reimer, James D; Pawlowski, Jan

    2008-12-01

    The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.

  2. The value of cell-free DNA for molecular pathology.

    Science.gov (United States)

    Stewart, Caitlin M; Kothari, Prachi D; Mouliere, Florent; Mair, Richard; Somnay, Saira; Benayed, Ryma; Zehir, Ahmet; Weigelt, Britta; Dawson, Sarah-Jane; Arcila, Maria E; Berger, Michael F; Tsui, Dana Wy

    2018-04-01

    Over the past decade, advances in molecular biology and genomics techniques have revolutionized the diagnosis and treatment of cancer. The technological advances in tissue profiling have also been applied to the study of cell-free nucleic acids, an area of increasing interest for molecular pathology. Cell-free nucleic acids are released from tumour cells into the surrounding body fluids and can be assayed non-invasively. The repertoire of genomic alterations in circulating tumour DNA (ctDNA) is reflective of both primary tumours and distant metastatic sites, and ctDNA can be sampled multiple times, thereby overcoming the limitations of the analysis of single biopsies. Furthermore, ctDNA can be sampled regularly to monitor response to treatment, to define the evolution of the tumour genome, and to assess the acquisition of resistance and minimal residual disease. Recently, clinical ctDNA assays have been approved for guidance of therapy, which is an exciting first step in translating cell-free nucleic acid research tests into clinical use for oncology. In this review, we discuss the advantages of cell-free nucleic acids as analytes in different body fluids, including blood plasma, urine, and cerebrospinal fluid, and their clinical applications in solid tumours and haematological malignancies. We will also discuss practical considerations for clinical deployment, such as preanalytical factors and regulatory requirements. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  3. Improving a Lecture-Size Molecular Model Set by Repurposing Used Whiteboard Markers

    Science.gov (United States)

    Dragojlovic, Veljko

    2015-01-01

    Preparation of an inexpensive model set from whiteboard markers and either HGS molecular model set or atoms made of wood is described. The model set is relatively easy to prepare and is sufficiently large to be suitable as an instructor set for use in lectures.

  4. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    Science.gov (United States)

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  5. Identification of molecular markers linked to rice bacterial blight resistance genes from Oryza meyeriana

    Directory of Open Access Journals (Sweden)

    Jing WANG,Chen CHENG,Yanru ZHOU,Yong YANG,Qiong MEI,Junmin LI,Ye CHENG,Chengqi YAN,Jianping CHEN

    2015-09-01

    Full Text Available Y73 is a progeny of asymmetric somatic hybridization between Oryza sativa cv. Dalixiang and the wild rice species Oryza meyeriana. Inoculation with a range of strains of Xanthomonas oryzae pv. oryzae showed that Y73 had inherited a high level of resistance to rice bacterial blight (BB from its wild parent. An F2 population of 7125 individuals was constructed from the cross between Y73 and a BB-susceptible cultivar IR24. After testing 615 SSR and STS markers covering the 12 rice chromosomes, 186 markers were selected that showed polymorphism between Y73 and IR24. Molecular markers linked to the BB resistance genes in Y73 were scanned using the F2 population and the polymorphic markers. The SSR marker RM128 on chromosome 1, the STS marker R03D159 on chromosome 3 and the STS marker R05D104 on chromosome 5 were found to be linked to the rice BB resistance genes in Y73.

  6. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  7. Detecting the effects of toxic agents on spermatogenesis using DNA probes

    International Nuclear Information System (INIS)

    Hecht, N.B.

    1987-01-01

    Advances in the molecular biology of spermatogenesis suggest that DNA probes can be used to monitor the effects of toxic agents in male germ cells of mammals. Molecular hybridization analyses with DNA probes can provide a reproducible methodology capable of detecting changes ranging from massive deletions to single base pair substitutions in the genome of exposed individuals. A constantly increasing number of DNA probes that can be used to detect such alterations in human sperm DNA exist for both ubiquitously expressed proteins and for genes solely expressed in the testis. In this chapter, the currently available testicular stage-specific and/or cell type-specific DNA probes and the techniques by which they can be utilized in reproductive toxicology studies are discussed. The advantages, limitations, and future technological advances of this novel biological marker system for the human male reproductive system are also considered

  8. DNA Methylation as a Biomarker for Body Fluid Identification

    Directory of Open Access Journals (Sweden)

    Rania Gomaa

    2017-12-01

    Full Text Available Currently, available identification techniques for forensic samples are either enzyme or protein based, which can be subjected to degradation, thus limiting its storage potentials. Epigenetic changes arising due to DNA methylation and histone acetylation can be used for body fluid identification. Markers DACT1, USP49, ZC3H12D, FGF7, cg23521140, cg17610929, chromosome 4 (25287119–25287254, chromosome 11 (72085678–72085798, 57171095–57171236, 1493401–1493538, and chromosome 19 (47395505–47395651 are currently being used for semen identification. Markers cg26107890, cg20691722, cg01774894 and cg14991487 are used to differentiate saliva and vaginal secretions from other body fluids. However, such markers show overlapping methylation pattern. This review article aimed to highlight the feasibility of using DNA methylation of certain genetic markers in body fluid identification and its implications for forensic investigations. The reviewed articles have employed molecular genetics techniques such as Bisulfite sequencing PCR (BSP, methylation specific PCR (MSP, Pyrosequencing, Combined Bisulfite Restriction Analysis (COBRA, Methylation-sensitive Single Nucleotide Primer Extension (SNuPE, and Multiplex SNaPshot Microarray. Bioinformatics software such as MATLAB and BiQ Analyzer has been used. Biological fluids have different methylation patterns and thus, this difference can be used to identify the nature of the biological fluid found at the crime scene. Using DNA methylation to identify the body fluids gives accurate results without consumption of the trace evidence and requires a minute amount of DNA for analysis. Recent studies have incorporated next-generation sequencing aiming to find out more reliable markers that can differentiate between different body fluids. Nonetheless, new DNA methylation markers are yet to be discovered to accurately differentiate between saliva and vaginal secretions with high confidence. Epigenetic changes are

  9. Identification of differentiation-stage specific molecular markers for the osteoblastic phenotype

    DEFF Research Database (Denmark)

    Twine, Natalie; Chen, Li; Wilkins, Marc

    to age-matched control (n=4). Using RNA-seq and cluster analysis, we identified a set of stage-specific molecular markers that define the progression of OB phenotype during ex vivo culture of hMSC, predict in vivo bone formation capacity of hMSC and can be employed to study the mechanisms of impaired......The phenotype of osteoblastic (OB) cells in culture is currently defined using a limited number of markers of low sensitivity and specificity which belong mostly to extracellular matrix proteins. Also, for clinical use of human skeletal (mesenchymal) stem cells (hMSC) in bone regeneration......, there is a need to identify predictive markers for in vivo bone forming capacity. Thus, we employed Illumina RNA sequencing (RNASeq) to examine changes in gene expression across 8 time points between 0-12 days of ex vivo OB differentiation of hMSC. We identified a subset of expressed genes as potentially...

  10. Polyploidy creates higher diversity among Cynodon accessions as assessed by molecular markers.

    Science.gov (United States)

    Gulsen, Osman; Sever-Mutlu, Songul; Mutlu, Nedim; Tuna, Metin; Karaguzel, Osman; Shearman, Robert C; Riordan, Terrance P; Heng-Moss, Tiffany M

    2009-05-01

    Developing a better understanding of associations among ploidy level, geographic distribution, and genetic diversity of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to: (1) determine ploidy analysis of Cynodon accessions collected from Turkey, (2) investigate associations between ploidy level and diversity, (3) determine whether geographic and ploidy distribution are related to nuclear genome variation, and (4) correlate among four nuclear molecular marker systems for Cynodon accessions' genetic analyses. One hundred and eighty-two Cynodon accessions collected in Turkey from an area south of the Taurus Mountains along the Mediterranean cost and ten known genotypes were genotyped using sequence related amplified polymorphism (SRAP), peroxidase gene polymorphism (POGP), inter-simple sequence repeat (ISSR), and random amplified polymorphic DNA (RAPD). The diploids, triploids, tetraploids, pentaploids, and hexaploids revealed by flow cytometry had a linear present band frequency of 0.36, 0.47, 0.49, 0.52, and 0.54, respectively. Regression analysis explained that quadratic relationship between ploidy level and band frequency was the most explanatory (r = 0.62, P Cynodon accessions' genetic structure can aid to enhance breeding programs and broaden genetic base of commercial cultivars.

  11. Development and validation of cross-transferable and polymorphic DNA markers for detecting alien genome introgression in Oryza sativa from Oryza brachyantha.

    Science.gov (United States)

    Ray, Soham; Bose, Lotan K; Ray, Joshitha; Ngangkham, Umakanta; Katara, Jawahar L; Samantaray, Sanghamitra; Behera, Lambodar; Anumalla, Mahender; Singh, Onkar N; Chen, Meingsheng; Wing, Rod A; Mohapatra, Trilochan

    2016-08-01

    African wild rice Oryza brachyantha (FF), a distant relative of cultivated rice Oryza sativa (AA), carries genes for pests and disease resistance. Molecular marker assisted alien gene introgression from this wild species to its domesticated counterpart is largely impeded due to the scarce availability of cross-transferable and polymorphic molecular markers that can clearly distinguish these two species. Availability of the whole genome sequence (WGS) of both the species provides a unique opportunity to develop markers, which are cross-transferable. We observed poor cross-transferability (~0.75 %) of O. sativa specific sequence tagged microsatellite (STMS) markers to O. brachyantha. By utilizing the genome sequence information, we developed a set of 45 low cost PCR based co-dominant polymorphic markers (STS and CAPS). These markers were found cross-transferrable (84.78 %) between the two species and could distinguish them from each other and thus allowed tracing alien genome introgression. Finally, we validated a Monosomic Alien Addition Line (MAAL) carrying chromosome 1 of O. brachyantha in O. sativa background using these markers, as a proof of concept. Hence, in this study, we have identified a set molecular marker (comprising of STMS, STS and CAPS) that are capable of detecting alien genome introgression from O. brachyantha to O. sativa.

  12. Single-Nucleotide Polymorphisms of the MSH2 and MLH1 Genes, Potential Molecular Markers for Susceptibility to the Development of Basal Cell Carcinoma in the Brazilian Population.

    Science.gov (United States)

    da Silva Calixto, Poliane; Lopes, Otávio Sérgio; Dos Santos Maia, Mayara; Herrero, Sylvia Satomi Takeno; Longui, Carlos Alberto; Melo, Cynthia Germoglio Farias; de Carvalho Filho, Ivan Rodrigues; Soares, Leonardo Ferreira; de Medeiros, Arnaldo Correia; Delatorre, Plínio; Khayat, André Salim; Burbano, Rommel Rodriguez; Lima, Eleonidas Moura

    2018-07-01

    Basal cell carcinoma - BCC is considered a multifactorial neoplasm involving genetic, epigenetic and environmental factors. Where UVB radiation is considered the main physical agent involved in BCC carcinogenesis. The Brazil and state of Paraíba are exposed to high levels of UVB rays. The mismatch repair - MMR is important DNA repair mechanisms to maintain replication fidelity. Therefore, single nucleotide polymorphisms (SNPs) in genes encoding proteins involved in MMR may be potential molecular markers of susceptibility to BCC. The objective of this study was to evaluate and describe for the first time the SNPs rs560246973, rs2303425 and rs565410865 and risk of developing BCC. The present study analyzed 100 samples of paraffin-embedded tissue from patients with histopathological diagnosis of BCC and 100 control samples. The results were obtained by genotyping method, Dideoxy Unique Allele Specific - PCR (DSASP). The SNPs rs2303425 were not associated with Basal Cell Carcinoma. However, the SNPs rs560246973 and rs565410865 was shown to be associated with the development of BCC when compared to control samples (P molecular markers for BCC.

  13. Molecular genetic approach to human meningioma: loss of genes on chromosome 22

    International Nuclear Information System (INIS)

    Seizinger, B.R.; De La Monte, S.; Atkins, L.; Gusella, J.F.; Martuza, R.L.

    1987-01-01

    A molecular genetic approach employing polymorphic DNA markers has been used to investigate the role of chromosomal aberrations in meningioma, one of the most common tumors of the human nervous system. Comparison of the alleles detected by DNA markers in tumor DNA versus DNA from normal tissue revealed chromosomal alterations present in primary surgical specimens. In agreement with cytogenetic studies of cultured meningiomas, the most frequent alteration detected was loss of heterozygosity on chromosome 22. Forty of 51 patients were constitutionally heterozygous for at least one chromosome 22 DNA marker. Seventeen of the 40 constitutionally heterozygotic patients (43%) displayed hemizygosity for the corresponding marker in their meningioma tumor tissues. Loss of heterozygosity was also detected at a significantly lower frequency for markers on several other autosomes. In view of the striking association between acoustic neuroma and meningioma in bilateral acoustic neurofibromatosis and the discovery that acoustic neuromas display specific loss of genes on chromosome 22, the authors propose that a common mechanism involving chromosome 22 is operative in the development of both tumor types. Fine-structure mapping to reveal partial deletions in meningiomas may provide the means to clone and characterize a gene (or genes) of importance for tumorigenesis in this and possibly other clinically associated tumors of the human nervous system

  14. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  15. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  16. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  17. Molecular Characterization of Selected Local and Exotic Cattle Using RAPD Marker

    Directory of Open Access Journals (Sweden)

    M. Mahfuza Khatun

    2012-06-01

    Full Text Available In order to develop specific genetic markers and determine the genetic diversity of Bangladeshi native cattle (Pabna, Red Chittagong and exotic breeds (Sahiwal, randomly amplified polymorphic DNA (RAPD analysis was performed using 12 primers. Genomic DNA was extracted from 20 cattle (local and exotic blood samples and extracted DNA was observed by gel electrophoresis. Among the random primers three were matched and found to be polymorphic. Genetic relations between cattle’s were determined by RAPD polymorphisms from a total of 66.67%. Statistical analysis of the data, estimating the genetic distances between cattle and sketching the cluster trees were estimated by using MEGA 5.05 software. Comparatively highest genetic distance (0.834 was found between RCC-82 and SL-623. The lowest genetic distance (0.031 was observed between M-1222 and M-5730. The genetic diversity of Red Chittagong and Sahiwal cattle was relatively higher for a prescribed breed. Adequate diversity in performance and adaptability can be exploited from the study results for actual improvement accruing to conservation and development of indigenous cattle resources.

  18. Development and characterization of genomic SSR markers in Cynodon transvaalensis Burtt-Davy.

    Science.gov (United States)

    Tan, Chengcheng; Wu, Yanqi; Taliaferro, Charles M; Bell, Greg E; Martin, Dennis L; Smith, Mike W

    2014-08-01

    Simple sequence repeat (SSR) markers are a major molecular tool for genetic and genomic research that have been extensively developed and used in major crops. However, few are available in African bermudagrass (Cynodon transvaalensis Burtt-Davy), an economically important warm-season turfgrass species. African bermudagrass is mainly used for hybridizations with common bermudagrass [C. dactylon var. dactylon (L.) Pers.] in the development of superior interspecific hybrid turfgrass cultivars. Accordingly, the major objective of this study was to develop and characterize a large set of SSR markers. Genomic DNA of C. transvaalensis '4200TN 24-2' from an Oklahoma State University (OSU) turf nursery was extracted for construction of four SSR genomic libraries enriched with [CA](n), [GA](n), [AAG](n), and [AAT](n) as core repeat motifs. A total of 3,064 clones were sequenced at the OSU core facility. The sequences were categorized into singletons and contiguous sequences to exclude redundancy. From the two sequence categories, 1,795 SSR loci were identified. After excluding duplicate SSRs by comparison with previously developed SSR markers using a nucleotide basic local alignment tool, 1,426 unique primer pairs (PPs) were designed. Out of the 1,426 designed PPs, 981 (68.8 %) amplified alleles of the expected size in the donor DNA. Polymorphisms of the SSR PPs tested in eight C. transvaalensis plants were 93 % polymorphic with 544 markers effective in all genotypes. Inheritance of the SSRs was examined in six F(1) progeny of African parents 'T577' × 'Uganda', indicating 917 markers amplified heritable alleles. The SSR markers developed in the study are the first large set of co-dominant markers in African bermudagrass and should be highly valuable for molecular and traditional breeding research.

  19. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  20. RAPD-SCAR marker and genetic relationship analysis of three Demodex species (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-06-01

    For a long time, classification of Demodex mites has been mainly based on their hosts and phenotype characteristics. The study was the first to conduct molecular identification and genetic relationship analysis for six isolates of three Demodex species by random amplified polymorphic DNA (RAPD) and sequence-characterized amplified region (SCAR) marker. Totally, 239 DNA fragments were amplified from six Demodex isolates with 10 random primers in RAPD, of which 165 were polymorphic. Using a single primer, at least five fragments and at most 40 in the six isolates were amplified, whereas within a single isolate, a range of 35-49 fragments were amplified. DNA fingerprints of primers CZ 1-9 revealed intra- and interspecies difference in six Demodex isolates, whereas primer CZ 10 only revealed interspecies difference. The genetic distance and dendrogram showed the intraspecific genetic distances were closer than the interspecific genetic distances. The interspecific genetic distances of Demodex folliculorum and Demodex canis (0.7931-0.8140) were shorter than that of Demodex brevis and D. canis (0.8182-0.8987). The RAPD-SCAR marker displayed primer CZ 10 could be applied to identify the three Demodex species. The 479-bp fragment was specific for D. brevis, and the 261-bp fragment was specific for D. canis. The conclusion was that the RAPD-SCAR multi-marker was effective in molecular identification of three Demodex species. The genetic relationship between D. folliculorum and D. canis was nearer than that between D. folliculorum and D. brevis.

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. Values of molecular markers in the differential diagnosis of thyroid abnormalities.

    Science.gov (United States)

    Tennakoon, T M P B; Rushdhi, M; Ranasinghe, A D C U; Dassanayake, R S

    2017-06-01

    Thyroid cancer (TC), follicular adenoma (FA) and Hashimoto's thyroiditis (HT) are three of the most frequently reported abnormalities that affect the thyroid gland. A frequent co-occurrence along with similar histopathological features is observed between TC and FA as well as between TC and HT. The conventional diagnostic methods such as histochemical analysis present complications in differential diagnosis when these abnormalities occur simultaneously. Hence, the authors recognize novel methods based on screening genetic defects of thyroid abnormalities as viable diagnostic and prognostic methods that could complement the conventional methods. We have extensively reviewed the existing literature on TC, FA and HT and also on three genes, namely braf, nras and ret/ptc, that could be used to differentially diagnose the three abnormalities. Emphasis was also given to the screening methods available to detect the said molecular markers. It can be conferred from the analysis of the available data that the utilization of braf, nras and ret/ptc as markers for the therapeutic evaluation of FA and HT is debatable. However, molecular screening for braf, nras and ret/ptc mutations proves to be a conclusive method that could be employed to differentially diagnose TC from HT and FA in the instance of a suspected co-occurrence. Thyroid cancer patients can be highly benefited from the screening for the said genetic markers, especially the braf gene due to its diagnostic value as well as due to the availability of personalized medicine targeted specifically for braf mutants.

  3. Inferring Genetic Variation and Demographic History of Michelia yunnanensis Franch. (Magnoliaceae from Chloroplast DNA Sequences and Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Shikang Shen

    2017-04-01

    Full Text Available Michelia yunnanensis Franch., is a traditional ornamental, aromatic, and medicinal shrub that endemic to Yunnan Province in southwest China. Although the species has a large distribution pattern and is abundant in Yunnan Province, the populations are dramatically declining because of overexploitation and habitat destruction. Studies on the genetic variation and demography of endemic species are necessary to develop effective conservation and management strategies. To generate such knowledge, we used 3 pairs of universal cpDNA markers and 10 pairs of microsatellite markers to assess the genetic diversity, genetic structure, and demographic history of 7 M. yunnanensis populations. We calculated a total of 88 alleles for 10 polymorphic loci and 10 haplotypes for a combined 2,089 bp of cpDNA. M. yunnanensis populations showed high genetic diversity (Ho = 0.551 for nuclear markers and Hd = 0.471 for cpDNA markers and low genetic differentiation (FST = 0.058. Geographical structure was not found among M. yunnanensis populations. Genetic distance and geographic distance were not correlated (P > 0.05, which indicated that geographic isolation is not the primary cause of the low genetic differentiation of M. yunnanensis. Additionally, M. yunnanensis populations contracted ~20,000–30,000 years ago, and no recent expansion occurred in current populations. Results indicated that the high genetic diversity of the species and within its populations holds promise for effective genetic resource management and sustainable utilization. Thus, we suggest that the conservation and management of M. yunnanensis should address exotic overexploitation and habitat destruction.

  4. [Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].

    Science.gov (United States)

    Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi

    2013-01-01

    Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.

  5. Use of DNA Markers for Investigating Sources of Bacteria in Contaminated Ground Water: Wooster Township, Wayne County, Ohio

    Science.gov (United States)

    Dumouchelle, Denise H.

    2006-01-01

    In 2004, a public-health nuisance was declared by the Wayne County Board of Health in the Scenic Heights Drive-Batdorf Road area of Wooster Township, Wayne County, Ohio, because of concerns about the safety of water from local wells. Repeated sampling had detected the presence of fecal-indicator bacteria and elevated nitrate concentrations. In June 2006, the U.S. Geological Survey (USGS), in cooperation with the Ohio Environmental Protection Agency (Ohio EPA), collected and analyzed samples from some of the affected wells to help investigate the possibility of human-origin bacterial contamination. Water samples from 12 wells and 5 home sewage-treatment systems (HSTS) were collected. Bromide concentrations were determined in samples from the 12 wells. Samples from 5 of the 12 wells were analyzed for wastewater compounds. Total coliform, enterococci and Escherichia coli (E. coli) bacteria concentrations were determined for samples from 8 of the 12 wells. In addition, two microbial source-tracking tools that employ DNA