Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a
Directory of Open Access Journals (Sweden)
Rachel Deplus
2014-08-01
Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.
Melatonin-Mediated Development of Ovine Cumulus Cells, Perhaps by Regulation of DNA Methylation
Directory of Open Access Journals (Sweden)
Yi Fang
2018-02-01
Full Text Available Cumulus cells of pre-pubertal domestic animals are dysfunctional, perhaps due to age-specific epigenetic events. This study was designed to determine effects of melatonin treatment of donors on methylation modification of pre-pubertal cumulus cells. Cumulus cells from germinal vesicle stage cumulus oocyte complexes (COCs were collected from eighteen lambs which were randomly divided into control group (C and melatonin group given an 18 mg melatonin implant subcutaneous (M. Compared to the C group, the M group had higher concentrations of melatonin in plasma and follicular fluid (p < 0.05, greater superovulation, a higher proportion of fully expanded COCs, and a lower proportion of apoptotic cumulus cells (p < 0.05. Real-time PCR results showed that melatonin up-regulated expression of genes MT1, Bcl2, DNMT1, DNMT3a and DNMT3b, but down-regulated expression of genes p53, Caspase 3 and Bax (p < 0.05. Furthermore, melatonin increased FI of FITC (global methylation level on cumulus cells (p < 0.05. To understand the regulation mechanism, the DNMTs promoter methylation sequence were analyzed. Compared to the C group, although there was less methylation at two CpG sites of DNMT1 (p < 0.05 and higher methylation at two CpG sites of DNMT3a (p < 0.05, there were no significant differences in methylation of the detected DNMT1 and DNMT3a promoter regions. However, there were lower methylation levels at five CpG sites of DNMT3b, which decreased methylation of detected DNMT3b promoter region on M group (p < 0.05. In conclusion, alterations of methylation regulated by melatonin may mediate development of cumulus cells in lambs.
International Nuclear Information System (INIS)
Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck
2011-01-01
Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.
Directory of Open Access Journals (Sweden)
Jochen Gohlke
Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes
Regulation and function of DNA methylation in plants and animals
He, Xinjian
2011-02-15
DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.
Epigenetic regulation during fetal femur development: DNA methylation matters.
Directory of Open Access Journals (Sweden)
María C de Andrés
Full Text Available Epigenetic modifications are heritable changes in gene expression without changes in DNA sequence. DNA methylation has been implicated in the control of several cellular processes including differentiation, gene regulation, development, genomic imprinting and X-chromosome inactivation. Methylated cytosine residues at CpG dinucleotides are commonly associated with gene repression; conversely, strategic loss of methylation during development could lead to activation of lineage-specific genes. Evidence is emerging that bone development and growth are programmed; although, interestingly, bone is constantly remodelled throughout life. Using human embryonic stem cells, human fetal bone cells (HFBCs, adult chondrocytes and STRO-1(+ marrow stromal cells from human bone marrow, we have examined a spectrum of developmental stages of femur development and the role of DNA methylation therein. Using pyrosequencing methodology we analysed the status of methylation of genes implicated in bone biology; furthermore, we correlated these methylation levels with gene expression levels using qRT-PCR and protein distribution during fetal development evaluated using immunohistochemistry. We found that during fetal femur development DNA methylation inversely correlates with expression of genes including iNOS (NOS2 and COL9A1, but not catabolic genes including MMP13 and IL1B. Furthermore, significant demethylation was evident in the osteocalcin promoter between the fetal and adult developmental stages. Increased TET1 expression and decreased expression of DNA (cytosine-5--methyltransferase 1 (DNMT1 in adult chondrocytes compared to HFBCs could contribute to the loss of methylation observed during fetal development. HFBC multipotency confirms these cells to be an ideal developmental system for investigation of DNA methylation regulation. In conclusion, these findings demonstrate the role of epigenetic regulation, specifically DNA methylation, in bone development
DNA methylation regulates neurophysiological spatial representation in memory formation
Directory of Open Access Journals (Sweden)
Eric D. Roth
2015-04-01
Full Text Available Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here, we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single-unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together, our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.
DNA methylation regulates neurophysiological spatial representation in memory formation.
Roth, Eric D; Roth, Tania L; Money, Kelli M; SenGupta, Sonda; Eason, Dawn E; Sweatt, J David
2015-04-01
Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment) known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.
Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.
Directory of Open Access Journals (Sweden)
Kenji Osabe
Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.
Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.
Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W
2014-01-01
In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.
Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B
2016-09-06
The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.
Regulation of the DNA Methylation Landscape in Human Somatic Cell Reprogramming by the miR-29 Family
Directory of Open Access Journals (Sweden)
Eriona Hysolli
2016-07-01
Full Text Available Reprogramming to pluripotency after overexpression of OCT4, SOX2, KLF4, and MYC is accompanied by global genomic and epigenomic changes. Histone modification and DNA methylation states in induced pluripotent stem cells (iPSCs have been shown to be highly similar to embryonic stem cells (ESCs. However, epigenetic differences still exist between iPSCs and ESCs. In particular, aberrant DNA methylation states found in iPSCs are a major concern when using iPSCs in a clinical setting. Thus, it is critical to find factors that regulate DNA methylation states in reprogramming. Here, we found that the miR-29 family is an important epigenetic regulator during human somatic cell reprogramming. Our global DNA methylation and hydroxymethylation analysis shows that DNA demethylation is a major event mediated by miR-29a depletion during early reprogramming, and that iPSCs derived from miR-29a depletion are epigenetically closer to ESCs. Our findings uncover an important miRNA-based approach to generate clinically robust iPSCs.
CDKL5 is a brain MeCP2 target gene regulated by DNA methylation.
Carouge, Delphine; Host, Lionel; Aunis, Dominique; Zwiller, Jean; Anglard, Patrick
2010-06-01
Rett syndrome and its "early-onset seizure" variant are severe neurodevelopmental disorders associated with mutations within the MECP2 and the CDKL5 genes. Antidepressants and drugs of abuse induce the expression of the epigenetic factor MeCP2, thereby influencing chromatin remodeling. We show that increased MeCP2 levels resulted in the repression of Cdkl5 in rat brain structures in response to cocaine, as well as in cells exposed to serotonin, or overexpressing MeCP2. In contrast, Cdkl5 was induced by siRNA-mediated knockdown of Mecp2 and by DNA-methyltransferase inhibitors, demonstrating its regulation by MeCP2 and by DNA methylation. Cdkl5 gene methylation and its methylation-dependent binding to MeCP2 were increased in the striatum of cocaine-treated rats. Our data demonstrate that Cdkl5 is a MeCP2-repressed target gene providing a link between genes the mutation of which generates overlapping symptoms. They highlight DNA methylation changes as a potential mechanism participating in the long-term plasticity triggered by pharmacological agents.
Metformin regulates global DNA methylation via mitochondrial one-carbon metabolism.
Cuyàs, E; Fernández-Arroyo, S; Verdura, S; García, R Á-F; Stursa, J; Werner, L; Blanco-González, E; Montes-Bayón, M; Joven, J; Viollet, B; Neuzil, J; Menendez, J A
2018-02-15
The anti-diabetic biguanide metformin may exert health-promoting effects via metabolic regulation of the epigenome. Here we show that metformin promotes global DNA methylation in non-cancerous, cancer-prone and metastatic cancer cells by decreasing S-adenosylhomocysteine (SAH), a strong feedback inhibitor of S-adenosylmethionine (SAM)-dependent DNA methyltransferases, while promoting the accumulation of SAM, the universal methyl donor for cellular methylation. Using metformin and a mitochondria/complex I (mCI)-targeted analog of metformin (norMitoMet) in experimental pairs of wild-type and AMP-activated protein kinase (AMPK)-, serine hydroxymethyltransferase 2 (SHMT2)- and mCI-null cells, we provide evidence that metformin increases the SAM:SAH ratio-related methylation capacity by targeting the coupling between serine mitochondrial one-carbon flux and CI activity. By increasing the contribution of one-carbon units to the SAM from folate stores while decreasing SAH in response to AMPK-sensed energetic crisis, metformin can operate as a metabolo-epigenetic regulator capable of reprogramming one of the key conduits linking cellular metabolism to the DNA methylation machinery.
Directory of Open Access Journals (Sweden)
Kum-Kang So
2018-02-01
Full Text Available Mutation in CpBck1, an ortholog of the cell wall integrity mitogen-activated protein kinase kinase kinase (MAPKKK of Saccharomyces cerevisiae, in the chestnut blight fungus Cryphonectria parasitica resulted in a sporadic sectorization as culture proceeded. The progeny from the sectored area maintained the characteristics of the sector, showing a massive morphogenetic change, including robust mycelial growth without differentiation. Epigenetic changes were investigated as the genetic mechanism underlying this sectorization. Quantification of DNA methylation and whole-genome bisulfite sequencing revealed genome-wide DNA methylation of the wild-type at each nucleotide level and changes in DNA methylation of the sectored progeny. Compared to the wild-type, the sectored progeny exhibited marked genome-wide DNA hypomethylation but increased methylation sites. Expression analysis of two DNA methyltransferases, including two representative types of DNA methyltransferase (DNMTase, demonstrated that both were significantly down-regulated in the sectored progeny. However, functional analysis using mutant phenotypes of corresponding DNMTases demonstrated that a mutant of CpDmt1, an ortholog of RID of Neurospora crassa, resulted in the sectored phenotype but the CpDmt2 mutant did not, suggesting that the genetic basis of fungal sectorization is more complex. The present study revealed that a mutation in a signaling pathway component resulted in sectorization accompanied with changes in genome-wide DNA methylation, which suggests that this signal transduction pathway is important for epigenetic control of sectorization via regulation of genes involved in DNA methylation.
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Helin, Kristian
2012-01-01
DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...
DNA methylation abnormalities in congenital heart disease.
Serra-Juhé, Clara; Cuscó, Ivon; Homs, Aïda; Flores, Raquel; Torán, Núria; Pérez-Jurado, Luis A
2015-01-01
Congenital heart defects represent the most common malformation at birth, occurring also in ∼50% of individuals with Down syndrome. Congenital heart defects are thought to have multifactorial etiology, but the main causes are largely unknown. We have explored the global methylation profile of fetal heart DNA in comparison to blood DNA from control subjects: an absolute correlation with the type of tissue was detected. Pathway analysis revealed a significant enrichment of differential methylation at genes related to muscle contraction and cardiomyopathies in the developing heart DNA. We have also searched for abnormal methylation profiles on developing heart-tissue DNA of syndromic and non-syndromic congenital heart defects. On average, 3 regions with aberrant methylation were detected per sample and 18 regions were found differentially methylated between groups. Several epimutations were detected in candidate genes involved in growth regulation, apoptosis and folate pathway. A likely pathogenic hypermethylation of several intragenic sites at the MSX1 gene, involved in outflow tract morphogenesis, was found in a fetus with isolated heart malformation. In addition, hypermethylation of the GATA4 gene was present in fetuses with Down syndrome with or without congenital heart defects, as well as in fetuses with isolated heart malformations. Expression deregulation of the abnormally methylated genes was detected. Our data indicate that epigenetic alterations of relevant genes are present in developing heart DNA in fetuses with both isolated and syndromic heart malformations. These epimutations likely contribute to the pathogenesis of the malformation by cis-acting effects on gene expression.
Mediation analysis of alcohol consumption, DNA methylation, and epithelial ovarian cancer.
Wu, Dongyan; Yang, Haitao; Winham, Stacey J; Natanzon, Yanina; Koestler, Devin C; Luo, Tiane; Fridley, Brooke L; Goode, Ellen L; Zhang, Yanbo; Cui, Yuehua
2018-03-01
Epigenetic factors and consumption of alcohol, which suppresses DNA methylation, may influence the development and progression of epithelial ovarian cancer (EOC). However, there is a lack of understanding whether these factors interact to affect the EOC risk. In this study, we aimed to gain insight into this relationship by identifying leukocyte-derived DNA methylation markers acting as potential mediators of alcohol-associated EOC. We implemented a causal inference test (CIT) and the VanderWeele and Vansteelandt multiple mediator model to examine CpG sites that mediate the association between alcohol consumption and EOC risk. We modified one step of the CIT by adopting a high-dimensional inference procedure. The data were based on 196 cases and 202 age-matched controls from the Mayo Clinic Ovarian Cancer Case-Control Study. Implementation of the CIT test revealed two CpG sites (cg09358725, cg11016563), which represent potential mediators of the relationship between alcohol consumption and EOC case-control status. Implementation of the VanderWeele and Vansteelandt multiple mediator model further revealed that these two CpGs were the key mediators. Decreased methylation at both CpGs was more common in cases who drank alcohol at the time of enrollment vs. those who did not. cg11016563 resides in TRPC6 which has been previously shown to be overexpressed in EOC. These findings suggest two CpGs may serve as novel biomarkers for EOC susceptibility.
Whole-genome methylation caller designed for methyl- DNA ...
African Journals Online (AJOL)
etchie
2013-02-20
Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.
Parvovirus b19 DNA CpG dinucleotide methylation and epigenetic regulation of viral expression.
Directory of Open Access Journals (Sweden)
Francesca Bonvicini
Full Text Available CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression.The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections.The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19.
Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression
Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio
2012-01-01
CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013
Xu, Yurui; Chao, Lin; Wang, Jianyu; Sun, Yonghong
2017-01-01
Breast cancer remains the most prevalent cancer among women worldwide. The expression of estrogen receptor-α (ER-α) is an important marker for prognosis. ER-α status may be positive or negative in breast cancer cells, although the cause of negative or positive status is not yet fully characterized. In the present study, the expression of ER-α and miRNA-148a was assessed in two breast cancer cell lines, HCC1937 and MCF7. An association between ER-α and miRNA-148a expression was identified. It was then demonstrated that DNA methyltransferase 1 (DNMT1) is a target of miRNA-148a, which may suppress the expression of ER-α via DNA methylation. Finally, an miRNA-148a mimic or inhibitor was transfected into MCF7 cells; the miRNA-148a mimic increased ER-α expression whereas the miRNA-148a inhibitor decreased ER-α expression. In conclusion, it was identified that miRNA-148a regulates ER-α expression through DNMT1-mediated DNA methylation in breast cancer cells. This may represent a potential miRNA-based strategy to modulate the expression of ER-α and provide a novel perspective for investigating the role of miRNAs in treating breast cancer. PMID:29085474
Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication.
Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto
2016-01-22
The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Sun, Xin; Johnson, Jacqueline; St John, Justin C
2018-05-02
Replication of mitochondrial DNA is strictly regulated during differentiation and development allowing each cell type to acquire its required mtDNA copy number to meet its specific needs for energy. Undifferentiated cells establish the mtDNA set point, which provides low numbers of mtDNA copy but sufficient template for replication once cells commit to specific lineages. However, cancer cells, such as those from the human glioblastoma multiforme cell line, HSR-GBM1, cannot complete differentiation as they fail to enforce the mtDNA set point and are trapped in a 'pseudo-differentiated' state. Global DNA methylation is likely to be a major contributing factor, as DNA demethylation treatments promote differentiation of HSR-GBM1 cells. To determine the relationship between DNA methylation and mtDNA copy number in cancer cells, we applied whole genome MeDIP-Seq and RNA-Seq to HSR-GBM1 cells and following their treatment with the DNA demethylation agents 5-azacytidine and vitamin C. We identified key methylated regions modulated by the DNA demethylation agents that also induced synchronous changes to mtDNA copy number and nuclear gene expression. Our findings highlight the control exerted by DNA methylation on the expression of key genes, the regulation of mtDNA copy number and establishment of the mtDNA set point, which collectively contribute to tumorigenesis.
Methylation of miR-145a-5p promoter mediates adipocytes differentiation
Energy Technology Data Exchange (ETDEWEB)
Du, Jingjing; Cheng, Xiao; Shen, Linyuan; Tan, Zhendong; Luo, Jia; Wu, Xiaoqian; Liu, Chendong [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Yang, Qiong [Department of Animal Husbandry and Veterinary Medicine, Chengdu Agricultural College, Chengdu 611100, Sichuan (China); Jiang, Yanzhi [College of Life and Science, Sichuan Agricultural University, Chengdu 611130 (China); Tang, Guoqing; Li, Xuewei [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhang, Shunhua, E-mail: zhangsh1919@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China); Zhu, Li, E-mail: zhuli7508@163.com [College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130 (China)
2016-06-17
MicroRNAs (miRNAs, miR) play important roles in adipocyte development. Recent studies showed that the expression of several miRNAs is closely related with promoter methylation. However, it is not known whether miRNA mediates adipocytes differentiation by means of DNA methylation. Here, we showed that miR-145a-5p was poorly expressed in adipose tissue from mice fed a high fat diet (HFD). Overexpression or inhibition of miR-145a-5p was unfavorable or beneficial, respectively, for adipogenesis, and these effects were achieved by regulating adipocyte-specific genes involved in lipogenic transcription, fatty acid synthesis, and fatty acid transportation. Particularly, we first suggested that miR-145a-5p mimics or inhibitors promoted or repressed adipocytes proliferation by regulating p53 and p21, which act as cell cycle regulating factors. Surprisingly, the miR-145a-5p-repressed adipocyte differentiation was enhanced or rescued when cells treated with 5-Aza-dC were transfected with miR-145a-5p mimics or inhibitors, respectively. These data indicated that, as a new mean to positively regulate adipocyte proliferation, the process of miR-145a-5p-inhibited adipogenesis may be regulated by DNA methylation. -- Highlights: •MiR-145a-5p promotes adipocytes proliferation. •MiR-145a-5p is negatively correlated with obesity. •MiR-145a-5p mediates adipocytes differentiation via regulating pathway related adipocytes differentiation. MiR-145a-5p mediating adipocytes differentiation was regulated by DNA methylation.
Directory of Open Access Journals (Sweden)
Shimrat Mamrut
Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.
Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T
1990-01-01
During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to be silent when assayed by the in vitro systems. The regulatory step, therefore, was ascribed to DNA templates. The analysis of modified base composition revealed the presence of methylated bases in chromoplast DNA, in which 5-methylcytosine was most abundant. The presence of 5-methylcytosine detected by isoschizomeric endonucleases and Southern hybridization was correlated with the undetectable transcription activity of each gene in the run-on assay and in vitro transcription experiments. It is thus concluded that the suppression of transcription mediated by DNA methylation is one of the mechanisms governing gene expression in plastids converting from chloroplasts to chromoplasts. Images Fig. 1 Fig. 2 Fig. 3. Fig. 4. Fig. 5. PMID:2303026
DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy
Directory of Open Access Journals (Sweden)
Deming Li
2014-06-01
Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.
Genome-scale analysis of aberrant DNA methylation in colorectal cancer
Hinoue, Toshinori; Weisenberger, Daniel J.; Lange, Christopher P.E.; Shen, Hui; Byun, Hyang-Min; Van Den Berg, David; Malik, Simeen; Pan, Fei; Noushmehr, Houtan; van Dijk, Cornelis M.; Tollenaar, Rob A.E.M.; Laird, Peter W.
2012-01-01
Colorectal cancer (CRC) is a heterogeneous disease in which unique subtypes are characterized by distinct genetic and epigenetic alterations. Here we performed comprehensive genome-scale DNA methylation profiling of 125 colorectal tumors and 29 adjacent normal tissues. We identified four DNA methylation–based subgroups of CRC using model-based cluster analyses. Each subtype shows characteristic genetic and clinical features, indicating that they represent biologically distinct subgroups. A CIMP-high (CIMP-H) subgroup, which exhibits an exceptionally high frequency of cancer-specific DNA hypermethylation, is strongly associated with MLH1 DNA hypermethylation and the BRAFV600E mutation. A CIMP-low (CIMP-L) subgroup is enriched for KRAS mutations and characterized by DNA hypermethylation of a subset of CIMP-H-associated markers rather than a unique group of CpG islands. Non-CIMP tumors are separated into two distinct clusters. One non-CIMP subgroup is distinguished by a significantly higher frequency of TP53 mutations and frequent occurrence in the distal colon, while the tumors that belong to the fourth group exhibit a low frequency of both cancer-specific DNA hypermethylation and gene mutations and are significantly enriched for rectal tumors. Furthermore, we identified 112 genes that were down-regulated more than twofold in CIMP-H tumors together with promoter DNA hypermethylation. These represent ∼7% of genes that acquired promoter DNA methylation in CIMP-H tumors. Intriguingly, 48/112 genes were also transcriptionally down-regulated in non-CIMP subgroups, but this was not attributable to promoter DNA hypermethylation. Together, we identified four distinct DNA methylation subgroups of CRC and provided novel insight regarding the role of CIMP-specific DNA hypermethylation in gene silencing. PMID:21659424
Transcription factors as readers and effectors of DNA methylation.
Zhu, Heng; Wang, Guohua; Qian, Jiang
2016-08-01
Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.
Directory of Open Access Journals (Sweden)
Pamela eDi Pasquale
2016-02-01
Full Text Available DNA methylation damage can be induced by endogenous and exogenous chemical agents, which has led every living organism to develop suitable response strategies. We investigated protein expression profiles of Escherichia coli upon exposure to the alkylating agent methyl-methane sulfonate (MMS by differential proteomics. Quantitative proteomic data showed a massive downregulation of enzymes belonging to the glycolytic pathway and fatty acids degradation, strongly suggesting a decrease of energy production. A strong reduction in the expression of the N-acetylneuraminate lyases (NanA involved in the sialic acid metabolism was also observed. Using a null NanA mutant and DANA, a substrate analogue acting as competitive inhibitor, we demonstrated that down regulation of NanA affects biofilm formation and adhesion properties of E. coli MV1161. Exposure to alkylating agents also decreased biofilm formation and bacterial adhesion to Caco-2 eukaryotic cell line by the adherent invasive E. coli (AIEC strain LF82. Our data showed that methylation stress impairs E. coli adhesion properties and suggest a possible role of NanA in biofilm formation and bacteria host interactions.
Energy Technology Data Exchange (ETDEWEB)
Peng, Jamy C.; Karpen, Gary H.
2006-06-15
In order to identify regulators of nuclear organization, Drosophila mutants in the Su(var)3-9 histone H3K9 methyltransferase, RNAi pathway components, and other regulators of heterochromatin-mediated gene silencing were examined for altered nucleoli and positioning of repeated DNAs. Animals lacking components of the H3K9 methylation and RNAi pathways contained disorganized nucleoli, ribosomal DNA (rDNA) and satellite DNAs. The levels of H3K9 dimethylation (H3K9me2) in chromatin associated with repeated DNAs decreased dramatically in Su(var)3-9 and dcr-2 (dicer-2) mutant tissues compared to wild type. We also observed a substantial increase in extrachromosomal repeated DNAs in mutant tissues. The disorganized nucleolus phenotype depends on the presence of Ligase 4 (Lig4), and ecc DNA formation is not induced by removal of cohesin. We conclude that H3K9 methylation of rDNA and satellites, maintained by Su(var)3-9, HP1, and the RNAi pathway, is necessary for the structural stability of repeated DNAs, which is mediated through suppression of non-homologous end joining (NHEJ). These results suggest a mechanism for how local chromatin structure can regulate genome stability, and the organization of chromosomal elements and nuclear organelles.
Directory of Open Access Journals (Sweden)
Fu-Hui Xiao
Full Text Available It is recognized that genetic factors contribute to human longevity. Besides the hypothesis of existence of longevity genes, another suggests that a lower frequency of risk alleles decreases the incidence of age-related diseases in the long-lived people. However, the latter finds no support from recent genetic studies. Considering the crucial role of epigenetic modification in gene regulation, we then hypothesize that suppressing disease-related genes in longevity individuals is likely achieved by epigenetic modification, e.g. DNA methylation. To test this hypothesis, we investigated the genome-wide methylation profile in 4 Chinese female centenarians and 4 middle-aged controls using methyl-DNA immunoprecipitation sequencing. 626 differentially methylated regions (DMRs were observed between both groups. Interestingly, genes with these DMRs were enriched in age-related diseases, including type-2 diabetes, cardiovascular disease, stroke and Alzheimer's disease. This pattern remains rather stable after including methylomes of two white individuals. Further analyses suggest that the observed DMRs likely have functional roles in regulating disease-associated gene expressions, with some genes [e.g. caspase 3 (CASP3] being down-regulated whereas the others [i.e. interleukin 1 receptor, type 2 (IL1R2] up-regulated. Therefore, our study suggests that suppressing the disease-related genes via epigenetic modification is an important contributor to human longevity.
Li, Yong
2017-11-03
The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.
Li, Yong; Liew, Yi Jin; Cui, Guoxin; Cziesielski, Maha J; Zahran, Noura Ibrahim Omar; Michell, Craig T; Voolstra, Christian R.; Aranda, Manuel
2017-01-01
The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.
Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.
2017-02-01
Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.
Genome-Wide Expression of MicroRNAs Is Regulated by DNA Methylation in Hepatocarcinogenesis
Directory of Open Access Journals (Sweden)
Jing Shen
2015-01-01
Full Text Available Background. Previous studies, including ours, have examined the regulation of microRNAs (miRNAs by DNA methylation, but whether this regulation occurs at a genome-wide level in hepatocellular carcinoma (HCC is unclear. Subjects/Methods. Using a two-phase study design, we conducted genome-wide screening for DNA methylation and miRNA expression to explore the potential role of methylation alterations in miRNAs regulation. Results. We found that expressions of 25 miRNAs were statistically significantly different between tumor and nontumor tissues and perfectly differentiated HCC tumor from nontumor. Six miRNAs were overexpressed, and 19 were repressed in tumors. Among 133 miRNAs with inverse correlations between methylation and expression, 8 miRNAs (6% showed statistically significant differences in expression between tumor and nontumor tissues. Six miRNAs were validated in 56 additional paired HCC tissues, and significant inverse correlations were observed for miR-125b and miR-199a, which is consistent with the inactive chromatin pattern found in HepG2 cells. Conclusion. These data suggest that the expressions of miR-125b and miR-199a are dramatically regulated by DNA hypermethylation that plays a key role in hepatocarcinogenesis.
Ferry, Laure; Fournier, Alexandra; Tsusaka, Takeshi; Adelmant, Guillaume; Shimazu, Tadahiro; Matano, Shohei; Kirsh, Olivier; Amouroux, Rachel; Dohmae, Naoshi; Suzuki, Takehiro; Filion, Guillaume J; Deng, Wen; de Dieuleveult, Maud; Fritsch, Lauriane; Kudithipudi, Srikanth; Jeltsch, Albert; Leonhardt, Heinrich; Hajkova, Petra; Marto, Jarrod A; Arita, Kyohei; Shinkai, Yoichi; Defossez, Pierre-Antoine
2017-08-17
DNA methylation is an essential epigenetic mark in mammals that has to be re-established after each round of DNA replication. The protein UHRF1 is essential for this process; it has been proposed that the protein targets newly replicated DNA by cooperatively binding hemi-methylated DNA and H3K9me2/3, but this model leaves a number of questions unanswered. Here, we present evidence for a direct recruitment of UHRF1 by the replication machinery via DNA ligase 1 (LIG1). A histone H3K9-like mimic within LIG1 is methylated by G9a and GLP and, compared with H3K9me2/3, more avidly binds UHRF1. Interaction with methylated LIG1 promotes the recruitment of UHRF1 to DNA replication sites and is required for DNA methylation maintenance. These results further elucidate the function of UHRF1, identify a non-histone target of G9a and GLP, and provide an example of a histone mimic that coordinates DNA replication and DNA methylation maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Mehtap Kilic Eren
agent doxorubicin also induced senescence in BJ fibroblasts associated with decreased SIRT1/2 levels. In conclusion our data reveal that resveratrol induced premature senescence is associated with SIRT1 and SIRT2 down regulation in human dermal fibroblasts. Here we suggest that the concomitant decline in SIRT1/2 expression in response to resveratrol treatment may be a cause for induction of senescence, which is most likely mediated by a regulatory mechanism activated by DNA damage response.
Directory of Open Access Journals (Sweden)
Yongmei Zhang
Full Text Available The persistence of hepatitis B virus (HBV infection is maintained by the nuclear viral covalently closed circular DNA (cccDNA, which serves as transcription template for viral mRNAs. Previous studies suggested that cccDNA contains methylation-prone CpG islands, and that the minichromosome structure of cccDNA is epigenetically regulated by DNA methylation. However, the regulatory effect of each CpG island methylation on cccDNA activity remains elusive. In the present study, we analyzed the distribution of CpG methylation within cccDNA in patient samples and investigated the impact of CpG island methylation on cccDNA-driven virus replication. Our study revealed the following observations: 1 Bisulfite sequencing of cccDNA from chronic hepatitis B patients indicated that CpG island I was seldom methylated, 2 CpG island II methylation was correlated to the low level of serum HBV DNA in patients, and in vitro methylation studies confirmed that CpG island II methylation markedly reduced cccDNA transcription and subsequent viral core DNA replication, 3 CpG island III methylation was associated with low serum HBsAg titers, and 4 Furthermore, we found that HBV genotype, HBeAg positivity, and patient age and liver fibrosis stage were also relevant to cccDNA CpG methylation status. Therefore, we clearly demonstrated that the status of cccDNA methylation is connected to the biological behavior of HBV. Taken together, our study provides a complete profile of CpG island methylation within HBV cccDNA and new insights for the function of CpG methylation in regulating HBV cccDNA transcription.
Neuronal DNA Methylation Profiling of Blast-Related Traumatic Brain Injury.
Haghighi, Fatemeh; Ge, Yongchao; Chen, Sean; Xin, Yurong; Umali, Michelle U; De Gasperi, Rita; Gama Sosa, Miguel A; Ahlers, Stephen T; Elder, Gregory A
2015-08-15
Long-term molecular changes in the brain resulting from blast exposure may be mediated by epigenetic changes, such as deoxyribonucleic acid (DNA) methylation, that regulate gene expression. Aberrant regulation of gene expression is associated with behavioral abnormalities, where DNA methylation bridges environmental signals to sustained changes in gene expression. We assessed DNA methylation changes in the brains of rats exposed to three 74.5 kPa blast overpressure events, conditions that have been associated with long-term anxiogenic manifestations weeks or months following the initial exposures. Rat frontal cortex eight months post-exposure was used for cell sorting of whole brain tissue into neurons and glia. We interrogated DNA methylation profiles in these cells using Expanded Reduced Representation Bisulfite Sequencing. We obtained data for millions of cytosines, showing distinct methylation profiles for neurons and glia and an increase in global methylation in neuronal versus glial cells (pDNA methylation perturbations in blast overpressure-exposed animals, compared with sham blast controls, within 458 and 379 genes in neurons and glia, respectively. Differentially methylated neuronal genes showed enrichment in cell death and survival and nervous system development and function, including genes involved in transforming growth factor β and nitric oxide signaling. Functional validation via gene expression analysis of 30 differentially methylated neuronal and glial genes showed a 1.2 fold change in gene expression of the serotonin N-acetyltransferase gene (Aanat) in blast animals (pDNA methylation induced in response to multiple blast overpressure exposures. In particular, increased methylation and decreased gene expression were observed in the Aanat gene, which is involved in converting serotonin to the circadian hormone melatonin and is implicated in sleep disturbance and depression associated with traumatic brain injury.
Wei, Hongying; Liang, Fan; Meng, Ge; Nie, Zhiqing; Zhou, Ren; Cheng, Wei; Wu, Xiaomeng; Feng, Yan; Wang, Yan
2016-09-01
Fine particulate matter (PM2.5) has been implicated as a risk factor for neurodevelopmental disorders including autism in children. However, the underlying biological mechanism remains unclear. DNA methylation is suggested to be a fundamental mechanism for the neuronal responses to environmental cues. We prepared whole particle of PM2.5 (PM2.5), water-soluble extracts (Pw), organic extracts (Po) and carbon core component (Pc) and characterized their chemical constitutes. We found that PM2.5 induced significant redox imbalance, decreased the levels of intercellular methyl donor S-adenosylmethionine and caused global DNA hypomethylation. Furthermore, PM2.5 exposure triggered gene-specific promoter DNA hypo- or hypermethylation and abnormal mRNA expression of autism candidate genes. PM2.5-induced DNA hypermethylation in promoter regions of synapse related genes were associated with the decreases in their mRNA and protein expression. The inhibiting effects of antioxidative reagents, a methylation-supporting agent and a DNA methyltransferase inhibitor demonstrated the involvement of redox/methylation mechanism in PM2.5-induced abnormal DNA methylation patterns and synaptic protein expression. The biological effects above generally followed a sequence of PM2.5 ≥ Pwo > Po > Pw > Pc. Our results implicated a novel epigenetic mechanism for the neurodevelopmental toxicity of particulate air pollution, and that eliminating the chemical components could mitigate the neurotoxicity of PM2.5.
Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication
Energy Technology Data Exchange (ETDEWEB)
Haruta, Mayumi [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Shimada, Midori, E-mail: midorism@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Nishiyama, Atsuya; Johmura, Yoshikazu [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Le Tallec, Benoît; Debatisse, Michelle [Institut Curie, Centre de Recherche, 26 rue d’Ulm, CNRS UMR 3244, 75248 ParisCedex 05 (France); Nakanishi, Makoto, E-mail: mkt-naka@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan)
2016-01-22
The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.
Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication
International Nuclear Information System (INIS)
Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto
2016-01-01
The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.
SAMHD1 is down regulated in lung cancer by methylation and inhibits tumor cell proliferation
International Nuclear Information System (INIS)
Wang, Jia-lei; Lu, Fan-zhen; Shen, Xiao-Yong; Wu, Yun; Zhao, Li-ting
2014-01-01
Highlights: • SAMHD1 expression level is down regulated in lung adenocarcinoma. • The promoter of SAMHD1 is methylated in lung adenocarcinoma. • Over expression of SAMHD1 inhibits the proliferation of lung cancer cells. - Abstract: The function of dNTP hydrolase SAMHD1 as a viral restriction factor to inhibit the replication of several viruses in human immune cells was well established. However, its regulation and function in lung cancer have been elusive. Here, we report that SAMHD1 is down regulated both on protein and mRNA levels in lung adenocarcinoma compared to adjacent normal tissue. We also found that SAMHD1 promoter is highly methylated in lung adenocarcinoma, which may inhibit its gene expression. Furthermore, over expression of the SAMHD1 reduces dNTP level and inhibits the proliferation of lung tumor cells. These results reveal the regulation and function of SAMHD1 in lung cancer, which is important for the proliferation of lung tumor cells
Lal, Ashish; Pan, Yunfeng; Navarro, Francisco; Dykxhoorn, Derek M.; Moreau, Lisa; Meire, Eti; Bentwich, Zvi; Lieberman, Judy; Chowdhury, Dipanjan
2010-01-01
Terminally differentiated cells have reduced capacity to repair double strand breaks (DSB), but the molecular mechanism behind this down-regulation is unclear. Here we find that miR-24 is consistently up-regulated during post-mitotic differentiation of hematopoietic cell lines and regulates the histone variant H2AX, a key DSB repair protein that activates cell cycle checkpoint proteins and retains DSB repair factors at DSB foci. The H2AX 3’UTR contains conserved miR-24 binding sites regulated by miR-24. Both H2AX mRNA and protein are substantially reduced during hematopoietic cell terminal differentiation by miR-24 up-regulation both in in vitro differentiated cells and primary human blood cells. miR-24 suppression of H2AX renders cells hypersensitive to γ-irradiation and genotoxic drugs. Antagonizing miR-24 in differentiating cells protects them from DNA damage-induced cell death, while transfecting miR-24 mimics in dividing cells increases chromosomal breaks and unrepaired DNA damage and reduces viability in response to DNA damage. This DNA repair phenotype can be fully rescued by over-expressing miR-24-insensitive H2AX. Therefore, miR-24 up-regulation in post-replicative cells reduces H2AX and thereby renders them highly vulnerable to DNA damage. PMID:19377482
Kuss-Duerkop, Sharon K; Westrich, Joseph A; Pyeon, Dohun
2018-02-13
Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus-host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.
Directory of Open Access Journals (Sweden)
Sharon K. Kuss-Duerkop
2018-02-01
Full Text Available Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus–host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.
Kumar, Gulshan; Rattan, Usha Kumari; Singh, Anil Kumar
2016-01-01
Winter dormancy is a well known mechanism adopted by temperate plants, to mitigate the chilling temperature of winters. However, acquisition of sufficient chilling during winter dormancy ensures the normal phenological traits in subsequent growing period. Thus, low temperature appears to play crucial roles in growth and development of temperate plants. Apple, being an important temperate fruit crop, also requires sufficient chilling to release winter dormancy and normal phenological traits, which are often associated with yield and quality of fruits. DNA cytosine methylation is one of the important epigenetic modifications which remarkably affect the gene expression during various developmental and adaptive processes. In present study, methylation sensitive amplified polymorphism was employed to assess the changes in cytosine methylation during dormancy, active growth and fruit set in apple, under differential chilling conditions. Under high chill conditions, total methylation was decreased from 27.2% in dormant bud to 21.0% in fruit set stage, while no significant reduction was found under low chill conditions. Moreover, the demethylation was found to be decreased, while methylation increased from dormant bud to fruit set stage under low chill as compared to high chill conditions. In addition, RNA-Seq analysis showed high expression of DNA methyltransferases and histone methyltransferases during dormancy and fruit set, and low expression of DNA glcosylases during active growth under low chill conditions, which was in accordance with changes in methylation patterns. The RNA-Seq data of 47 genes associated with MSAP fragments involved in cellular metabolism, stress response, antioxidant system and transcriptional regulation showed correlation between methylation and their expression. Similarly, bisulfite sequencing and qRT-PCR analysis of selected genes also showed correlation between gene body methylation and gene expression. Moreover, significant association
Directory of Open Access Journals (Sweden)
Gulshan Kumar
Full Text Available Winter dormancy is a well known mechanism adopted by temperate plants, to mitigate the chilling temperature of winters. However, acquisition of sufficient chilling during winter dormancy ensures the normal phenological traits in subsequent growing period. Thus, low temperature appears to play crucial roles in growth and development of temperate plants. Apple, being an important temperate fruit crop, also requires sufficient chilling to release winter dormancy and normal phenological traits, which are often associated with yield and quality of fruits. DNA cytosine methylation is one of the important epigenetic modifications which remarkably affect the gene expression during various developmental and adaptive processes. In present study, methylation sensitive amplified polymorphism was employed to assess the changes in cytosine methylation during dormancy, active growth and fruit set in apple, under differential chilling conditions. Under high chill conditions, total methylation was decreased from 27.2% in dormant bud to 21.0% in fruit set stage, while no significant reduction was found under low chill conditions. Moreover, the demethylation was found to be decreased, while methylation increased from dormant bud to fruit set stage under low chill as compared to high chill conditions. In addition, RNA-Seq analysis showed high expression of DNA methyltransferases and histone methyltransferases during dormancy and fruit set, and low expression of DNA glcosylases during active growth under low chill conditions, which was in accordance with changes in methylation patterns. The RNA-Seq data of 47 genes associated with MSAP fragments involved in cellular metabolism, stress response, antioxidant system and transcriptional regulation showed correlation between methylation and their expression. Similarly, bisulfite sequencing and qRT-PCR analysis of selected genes also showed correlation between gene body methylation and gene expression. Moreover
Oxidative Stress and DNA Methylation in Prostate Cancer
Directory of Open Access Journals (Sweden)
Krishna Vanaja Donkena
2010-01-01
Full Text Available The protective effects of fruits, vegetables, and other foods on prostate cancer may be due to their antioxidant properties. An imbalance in the oxidative stress/antioxidant status is observed in prostate cancer patients. Genome oxidative damage in prostate cancer patients is associated with higher lipid peroxidation and lower antioxidant levels. Oxygen radicals are associated with different steps of carcinogenesis, including structural DNA damage, epigenetic changes, and protein and lipid alterations. Epigenetics affects genetic regulation, cellular differentiation, embryology, aging, cancer, and other diseases. DNA methylation is perhaps the most extensively studied epigenetic modification, which plays an important role in the regulation of gene expression and chromatin architecture, in association with histone modification and other chromatin-associated proteins. This review will provide a broad overview of the interplay of oxidative stress and DNA methylation, DNA methylation changes in regulation of gene expression, lifestyle changes for prostate cancer prevention, DNA methylation as biomarkers for prostate cancer, methods for detection of methylation, and clinical application of DNA methylation inhibitors for epigenetic therapy.
Evolution of DNA Methylation across Insects.
Bewick, Adam J; Vogel, Kevin J; Moore, Allen J; Schmitz, Robert J
2017-03-01
DNA methylation contributes to gene and transcriptional regulation in eukaryotes, and therefore has been hypothesized to facilitate the evolution of plastic traits such as sociality in insects. However, DNA methylation is sparsely studied in insects. Therefore, we documented patterns of DNA methylation across a wide diversity of insects. We predicted that underlying enzymatic machinery is concordant with patterns of DNA methylation. Finally, given the suggestion that DNA methylation facilitated social evolution in Hymenoptera, we tested the hypothesis that the DNA methylation system will be associated with presence/absence of sociality among other insect orders. We found DNA methylation to be widespread, detected in all orders examined except Diptera (flies). Whole genome bisulfite sequencing showed that orders differed in levels of DNA methylation. Hymenopteran (ants, bees, wasps and sawflies) had some of the lowest levels, including several potential losses. Blattodea (cockroaches and termites) show all possible patterns, including a potential loss of DNA methylation in a eusocial species whereas solitary species had the highest levels. Species with DNA methylation do not always possess the typical enzymatic machinery. We identified a gene duplication event in the maintenance DNA methyltransferase 1 (DNMT1) that is shared by some Hymenoptera, and paralogs have experienced divergent, nonneutral evolution. This diversity and nonneutral evolution of underlying machinery suggests alternative DNA methylation pathways may exist. Phylogenetically corrected comparisons revealed no evidence that supports evolutionary association between sociality and DNA methylation. Future functional studies will be required to advance our understanding of DNA methylation in insects. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip
2016-03-22
Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.
DNA methylation mediates genetic variation for adaptive transgenerational plasticity.
Herman, Jacob J; Sultan, Sonia E
2016-09-14
Environmental stresses experienced by individual parents can influence offspring phenotypes in ways that enhance survival under similar conditions. Although such adaptive transgenerational plasticity is well documented, its transmission mechanisms are generally unknown. One possible mechanism is environmentally induced DNA methylation changes. We tested this hypothesis in the annual plant Polygonum persicaria, a species known to express adaptive transgenerational plasticity in response to parental drought stress. Replicate plants of 12 genetic lines (sampled from natural populations) were grown in dry versus moist soil. Their offspring were exposed to the demethylating agent zebularine or to control conditions during germination and then grown in dry soil. Under control germination conditions, the offspring of drought-stressed parents grew longer root systems and attained greater biomass compared with offspring of well-watered parents of the same genetic lines. Demethylation removed these adaptive developmental effects of parental drought, but did not significantly alter phenotypic expression in offspring of well-watered parents. The effect of demethylation on the expression of the parental drought effect varied among genetic lines. Differential seed provisioning did not contribute to the effect of parental drought on offspring phenotypes. These results demonstrate that DNA methylation can mediate adaptive, genotype-specific effects of parental stress on offspring phenotypes. © 2016 The Author(s).
NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer
Directory of Open Access Journals (Sweden)
Shen Shourong
2010-04-01
Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.
Wang, Xiaoqing; Wang, Lai; Sun, Yizheng; Li, Ruiping; Deng, Jinbo; Deng, Jiexin
2017-02-01
In this study, we investigated the causal relationship between chronic cold exposure and insulin resistance and the mechanisms of how DNA methylation and histone deacetylation regulate cold-reduced insulin resistance. 46 adult male mice from postnatal day 90-180 were randomly assigned to control group and cold-exposure group. Mice in cold-exposure group were placed at temperature from -1 to 4 °C for 30 days to mimic chronic cold environment. Then, fasting blood glucose, blood insulin level and insulin resistance index were measured with enzymatic methods. Immunofluorescent labeling was carried out to visualize the insulin receptor substrate 2 (IRS2), Obese receptor (Ob-R, a leptin receptor), voltage-dependent anion channel protein 1 (VDAC1), cytochrome C (cytC), 5-methylcytosine (5-mC) positive cells in hippocampal CA1 area. Furthermore, the expressions of some proteins mentioned above were detected with Western blot. The results showed: ① Chronic cold exposure could reduce the insulin resistance index (P cold-exposure group than in control group with both immunohistochemical staining and Western blot (P cold exposure increased DNA methylation and histone deacetylation in the pyramidal cells of CA1 area and led to an increase in the expression of histone deacetylase 1 (HDAC1) and DNA methylation relative enzymes (P cold exposure can improve insulin sensitivity, with the involvement of DNA methylation, histone deacetylation and the regulation of mitochondrial energy metabolism. These epigenetic modifications probably form the basic mechanism of cold-reduced insulin resistance. Copyright © 2016 Elsevier Inc. All rights reserved.
Epigenetics in Alzheimer's Disease: Perspective of DNA Methylation.
Qazi, Talal Jamil; Quan, Zhenzhen; Mir, Asif; Qing, Hong
2018-02-01
Research over the years has shown that causes of Alzheimer's disease are not well understood, but over the past years, the involvement of epigenetic mechanisms in the developing memory formation either under pathological or physiological conditions has become clear. The term epigenetics represents the heredity of changes in phenotype that are independent of altered DNA sequences. Different studies validated that cytosine methylation of genomic DNA decreases with age in different tissues of mammals, and therefore, the role of epigenetic factors in developing neurological disorders in aging has been under focus. In this review, we summarized and reviewed the involvement of different epigenetic mechanisms especially the DNA methylation in Alzheimer's disease (AD), late-onset Alzheimer's disease (LOAD), familial Alzheimer's disease (FAD), and autosomal dominant Alzheimer's disease (ADAD). Down to the minutest of details, we tried to discuss the methylation patterns like mitochondrial DNA methylation and ribosomal DNA (rDNA) methylation. Additionally, we mentioned some therapeutic approaches related to epigenetics, which could provide a potential cure for AD. Moreover, we reviewed some recent studies that validate DNA methylation as a potential biomarker and its role in AD. We hope that this review will provide new insights into the understanding of AD pathogenesis from the epigenetic perspective especially from the perspective of DNA methylation.
Energy Technology Data Exchange (ETDEWEB)
Da, M.X. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Zhang, Y.B. [Department of Surgery, Ningxia Medical University, Yinchuan (China); Yao, J.B. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Duan, Y.X. [Department of Surgery, Ningxia Medical University, Yinchuan (China)
2014-09-30
DNA hypomethylation may activate oncogene transcription, thus promoting carcinogenesis and tumor development. S-adenosylmethionine (SAM) is a methyl donor in numerous methylation reactions and acts as an inhibitor of intracellular demethylase activity, which results in hypermethylation of DNA. The main objectives of this study were to determine whether DNA hypomethylation correlated with vascular endothelial growth factor-C (VEGF-C) expression, and the effect of SAM on VEGF-C methylation and gastric cancer growth inhibition. VEGF-C expression was assayed by Western blotting and RT-qPCR in gastric cancer cells, and by immunohistochemistry in tumor xenografts. VEGF-C methylation was assayed by bisulfite DNA sequencing. The effect of SAM on cell apoptosis was assayed by flow cytometry analyses and its effect on cancer growth was assessed in nude mice. The VEGF-C promoters of MGC-803, BGC-823, and SGC-7901 gastric cancer cells, which normally express VEGF-C, were nearly unmethylated. After SAM treatment, the VEGF-C promoters in these cells were highly methylated and VEGF-C expression was downregulated. SAM also significantly inhibited tumor growth in vitro and in vivo. DNA methylation regulates expression of VEGF-C. SAM can effectively induce VEGF-C methylation, reduce the expression of VEGF-C, and inhibit tumor growth. SAM has potential as a drug therapy to silence oncogenes and block the progression of gastric cancer.
DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?
Directory of Open Access Journals (Sweden)
Alessandra eMaresca
2015-03-01
Full Text Available Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5-methyltransferase 1. DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is
Directory of Open Access Journals (Sweden)
Lei Cao-Lei
Full Text Available Animal and human studies suggest that prenatal exposure to stress is associated with adverse health outcomes such as type 2 diabetes. Epigenetic modification, such as DNA methylation, is considered one possible underlying mechanism. The 1998 Quebec ice storm provides a unique opportunity to study an independent prenatal stressor on child outcomes. C-peptide is the best measure of endogenous insulin secretion and is widely used in the clinical management of patients with diabetes. The objectives of this study are to determine 1 the extent to which prenatal exposure to disaster-related stress (maternal objective hardship and maternal cognitive appraisal influences children's C-peptide secretion, and 2 whether DNA methylation of diabetes-related genes mediates the effects of prenatal stress on C-peptide secretion. Children's (n = 30 C-peptide secretion in response to an oral glucose tolerance test were assessed in blood at 13½ years. DNA methylation levels of selected type 1 and 2 diabetes-related genes were chosen based upon the genes associated with prenatal maternal objective hardship and/or cognitive appraisal levels. Bootstrapping analyses were performed to determine the mediation effect of DNA methylation. We found that children whose mothers experienced higher objective hardship exhibited higher C-peptide secretion. Cognitive appraisal was not directly associated with C-peptide secretion. DNA methylation of diabetes-related genes had a positive mediation effect of objective hardship on C-peptide secretion: higher objective hardship predicted higher C-peptide secretion through DNA methylation. Negative mediation effects of cognitive appraisal were observed: negative cognitive appraisal predicted higher C-peptide secretion through DNA methylation. However, only one gene, LTA, remained a significant mediator of cognitive appraisal on C-peptide secretion after the conservative Bonferroni multiple corrections. Our findings suggest that DNA
Directory of Open Access Journals (Sweden)
Chang Su
2014-12-01
Full Text Available DNA methylation plays a critical role in the regulation of gene expression. Most studies of DNA methylation have been performed in herbaceous plants, and little is known about the methylation patterns in tree genomes. In the present study, we generated a map of methylated cytosines at single base pair resolution for Betula platyphylla (white birch by bisulfite sequencing combined with transcriptomics to analyze DNA methylation and its effects on gene expression. We obtained a detailed view of the function of DNA methylation sequence composition and distribution in the genome of B. platyphylla. There are 34,460 genes in the whole genome of birch, and 31,297 genes are methylated. Conservatively, we estimated that 14.29% of genomic cytosines are methylcytosines in birch. Among the methylation sites, the CHH context accounts for 48.86%, and is the largest proportion. Combined transcriptome and methylation analysis showed that the genes with moderate methylation levels had higher expression levels than genes with high and low methylation. In addition, methylated genes are highly enriched for the GO subcategories of binding activities, catalytic activities, cellular processes, response to stimulus and cell death, suggesting that methylation mediates these pathways in birch trees.
Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.
Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li
2017-10-01
Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.
MethylMix 2.0: an R package for identifying DNA methylation genes.
Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier
2018-04-14
DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.
DNA methylation in inflammatory genes among children with obstructive sleep apnea.
Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David
2012-02-01
Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.
Francia, Giulio; Green, Shane K; Bocci, Guido; Man, Shan; Emmenegger, Urban; Ebos, John M L; Weinerman, Adina; Shaked, Yuval; Kerbel, Robert S
2005-10-01
Similar to other anticancer agents, intrinsic or acquired resistance to DNA-damaging chemotherapeutics is a major obstacle for cancer therapy. Current strategies aimed at overcoming this problem are mostly based on the premise that tumor cells acquire heritable genetic mutations that contribute to drug resistance. Here, we present evidence for an epigenetic, tumor cell adhesion-mediated, and reversible form of drug resistance that is associated with a reduction of DNA mismatch repair proteins PMS2 and/or MLH1 as well as other members of this DNA repair process. Growth of human breast cancer, human melanoma, and murine EMT-6 breast cancer cell lines as multicellular spheroids in vitro, which is associated with increased resistance to many chemotherapeutic drugs, including alkylating agents, is shown to lead to a reproducible down-regulation of PMS2, MLH1, or, in some cases, both as well as MHS6, MSH3, and MSH2. The observed down-regulation is in part reversible by treatment of tumor spheroids with the DNA-demethylating agent, 5-azacytidine. Thus, treatment of EMT-6 mouse mammary carcinoma spheroids with 5-azacytidine resulted in reduced and/or disrupted cell-cell adhesion, which in turn sensitized tumor spheroids to cisplatin-mediated killing in vitro. Our results suggest that antiadhesive agents might sensitize tumor spheroids to alkylating agents in part by reversing or preventing reduced DNA mismatch repair activity and that the chemosensitization properties of 5-azacytidine may conceivably reflect its role as a potential antiadhesive agent as well as reversal agent for MLH1 gene silencing in human tumors.
Energy Technology Data Exchange (ETDEWEB)
Gao, Feng-Hou [NO.3 People' s Hospital affiliated to Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 201900 (China); The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Wu, Ying-Li [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Zhao, Meng [Institute of Health Science, SJTU-SM/Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai (China); Liu, Chuan-Xu; Wang, Li-Shun [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Chen, Guo-Qiang, E-mail: chengq@shsmu.edu.cn [The Department of Pathophysiology, Key Laboratory of Cell Differentiation and Apoptosis of National Ministry of Education, Shanghai Jiao-Tong University School of Medicine (SJTU-SM), Shanghai 200025 (China); Institute of Health Science, SJTU-SM/Shanghai Institutes for Biological Science, Chinese Academy of Sciences, Shanghai (China)
2009-11-15
We reported previously that NSC606985, a camptothecin analogue, induces apoptosis of acute myeloid leukemia (AML) cells through proteolytic activation of protein kinase C delta ({Delta}PKC-{delta}). By subcellular proteome analysis, heterogeneous nuclear ribonucleoprotein K (hnRNP K) was identified as being significantly down-regulated in NSC606985-treated leukemic NB4 cells. HnRNP K, a docking protein for DNA, RNA, and transcriptional or translational molecules, is implicated in a host of processes involving the regulation of gene expression. However, the molecular mechanisms of hnRNP K reduction and its roles during apoptosis are still not understood. In the present study, we found that, following the appearance of the {Delta}PKC-{delta}, hnRNP K protein was significantly down-regulated in NSC606985, doxorubicin, arsenic trioxide and ultraviolet-induced apoptosis. We further provided evidence that {Delta}PKC-{delta} mediated the down-regulation of hnRNP K protein during apoptosis: PKC-{delta} inhibitor could rescue the reduction of hnRNP K; hnRNP K failed to be decreased in PKC-{delta}-deficient apoptotic KG1a cells; conditional induction of {Delta}PKC-{delta} in U937T cells directly down-regulated hnRNP K protein. Moreover, the proteasome inhibitor also inhibited the down-regulation of hnRNP K protein by apoptosis inducer and the conditional expression of {Delta}PKC-{delta}. More intriguingly, the suppression of hnRNP K with siRNA transfection significantly induced apoptosis. To our knowledge, this is the first demonstration that proteolytically activated PKC-{delta} down-regulates hnRNP K protein in a proteasome-dependent manner, which plays an important role in apoptosis induction.
Whole genome DNA methylation: beyond genes silencing
Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati
2016-01-01
The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...
Directory of Open Access Journals (Sweden)
Kimberly D Siegmund
Full Text Available The role of DNA cytosine methylation, an epigenetic regulator of chromatin structure and function, during normal and pathological brain development and aging remains unclear. Here, we examined by MethyLight PCR the DNA methylation status at 50 loci, encompassing primarily 5' CpG islands of genes related to CNS growth and development, in temporal neocortex of 125 subjects ranging in age from 17 weeks of gestation to 104 years old. Two psychiatric disease cohorts--defined by chronic neurodegeneration (Alzheimer's or lack thereof (schizophrenia--were included. A robust and progressive rise in DNA methylation levels across the lifespan was observed for 8/50 loci (GABRA2, GAD1, HOXA1, NEUROD1, NEUROD2, PGR, STK11, SYK typically in conjunction with declining levels of the corresponding mRNAs. Another 16 loci were defined by a sharp rise in DNA methylation levels within the first few months or years after birth. Disease-associated changes were limited to 2/50 loci in the Alzheimer's cohort, which appeared to reflect an acceleration of the age-related change in normal brain. Additionally, methylation studies on sorted nuclei provided evidence for bidirectional methylation events in cortical neurons during the transition from childhood to advanced age, as reflected by significant increases at 3, and a decrease at 1 of 10 loci. Furthermore, the DNMT3a de novo DNA methyl-transferase was expressed across all ages, including a subset of neurons residing in layers III and V of the mature cortex. Therefore, DNA methylation is dynamically regulated in the human cerebral cortex throughout the lifespan, involves differentiated neurons, and affects a substantial portion of genes predominantly by an age-related increase.
Lim, Seiyoung; Hwang, Sinwoo; Yu, Ji Hoon; Lim, Joo Weon; Kim, Hyeyoung
2017-05-01
Regulator of calcineurin 1 (RCAN1) is located on the Down syndrome critical region (DSCR) locus in human chromosome 21. Oxidative stress and overexpression of RCAN1 are implicated in neuronal impairment in Down's syndrome (DS) and Alzheimer's disease (AD). Serum level of lycopene, an antioxidant pigment, is low in DS and AD patients, which may be related to neuronal damage. The present study is to investigate whether lycopene inhibits apoptosis by reducing ROS levels, NF-κB activation, expression of the apoptosis regulator Nucling, cell viability, and indices of apoptosis (cytochrome c release, caspase-3 activation) in RCAN1-overexpressing neuronal cells. Cells transfected with either pcDNA or RCAN1 were treated with or without lycopene. Lycopene decreased intracellular and mitochondrial ROS levels, NF-κB activity, and Nucling expression while it reversed decrease in mitochondrial membrane potential, mitochondrial respiration, and glycolytic function in RCAN1-overexpressing cells. Lycopene inhibited cell death, DNA fragmentation, caspase-3 activation, and cytochrome c release in RCAN1-overexpressing cells. Lycopene inhibits RCAN1-mediated apoptosis by reducing ROS levels and by inhibiting NF-κB activation, Nucling induction, and the increase in apoptotic indices in neuronal cells. Consumption of lycopene-rich foods may prevent oxidative stress-associated neuronal damage in some pathologic conditions such as DS or AD. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA Methylation Modulates Nociceptive Sensitization after Incision.
Directory of Open Access Journals (Sweden)
Yuan Sun
Full Text Available DNA methylation is a key epigenetic mechanism controlling DNA accessibility and gene expression. Blockade of DNA methylation can significantly affect pain behaviors implicated in neuropathic and inflammatory pain. However, the role of DNA methylation with regard to postoperative pain has not yet been explored. In this study we sought to investigate the role of DNA methylation in modulating incisional pain and identify possible targets under DNA methylation and contributing to incisional pain. DNA methyltranferase (DNMT inhibitor 5-Aza-2'-deoxycytidine significantly reduced incision-induced mechanical allodynia and thermal sensitivity. Aza-2'-deoxycytidine also reduced hindpaw swelling after incision, suggesting an anti-inflammatory effect. Global DNA methylation and DNMT3b expression were increased in skin after incision, but none of DNMT1, DNMT3a or DNMT3b was altered in spinal cord or DRG. The expression of proopiomelanocortin Pomc encoding β-endorphin and Oprm1 encoding the mu-opioid receptor were upregulated peripherally after incision; moreover, Oprm1 expression was further increased under DNMT inhibitor treatment. Finally, local peripheral injection of the opioid receptor antagonist naloxone significantly exacerbated incision-induced mechanical hypersensitivity. These results suggest that DNA methylation is functionally relevant to incisional nociceptive sensitization, and that mu-opioid receptor signaling might be one methylation regulated pathway controlling sensitization after incision.
Energy Technology Data Exchange (ETDEWEB)
Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)
2015-04-28
Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.
DNA methylation dynamics in muscle development and disease
Directory of Open Access Journals (Sweden)
Elvira eCarrio
2015-03-01
Full Text Available DNA methylation is an essential epigenetic modification for mammalian development and is crucial for the establishment and maintenance of cellular identity. Traditionally, DNA methylation has been considered as a permanent repressive epigenetic mark. However, the application of genome-wide approaches has allowed the analysis of DNA methylation in different genomic contexts revealing a more dynamic regulation than originally thought, since active DNA methylation and demethylation occur during cellular differentiation and tissue specification. Satellite cells are the primary stem cells in adult skeletal muscle and are responsible for postnatal muscle growth, hypertrophy, and muscle regeneration. This review outlines the published data regarding DNA methylation changes along the skeletal muscle program, in both physiological and pathological conditions, to better understand the epigenetic mechanisms that control myogenesis
Directory of Open Access Journals (Sweden)
Carlos F. Araujo-Lima
2018-01-01
Full Text Available Statins are 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA reductase inhibitors, and this class of drugs has been studied as protective agents against DNA damages. Alkylating agents (AAs are able to induce alkylation in macromolecules, causing DNA damage, as DNA methylation. Our objective was to evaluate atorvastatin (AVA antimutagenic, cytoprotective, and antigenotoxic potentials against DNA lesions caused by AA. AVA chemopreventive ability was evaluated using antimutagenicity assays (Salmonella/microsome assay, cytotoxicity, cell cycle, and genotoxicity assays in HepG2 cells. The cells were cotreated with AVA and the AA methyl methanesulfonate (MMS or cyclophosphamide (CPA. Our datum showed that AVA reduces the alkylation-mediated DNA damage in different in vitro experimental models. Cytoprotection of AVA at low doses (0.1–1.0 μM was observed after 24 h of cotreatment with MMS or CPA at their LC50, causing an increase in HepG2 survival rates. After all, AVA at 10 μM and 25 μM had decreased effect in micronucleus formation in HepG2 cells and restored cell cycle alterations induced by MMS and CPA. This study supports the hypothesis that statins can be chemopreventive agents, acting as antimutagenic, antigenotoxic, and cytoprotective components, specifically against alkylating agents of DNA.
Directory of Open Access Journals (Sweden)
Huizi Lei
Full Text Available BACKGROUND AIMS: Gastric cancer is the most frequent gastrointestinal tumor in adults and is the most lethal form of human cancer. Despite of the improvements in treatments, the underlying mechanism of gastric carcinogenesis is not well known. To define novel modulators that regulate susceptibility to tumorgenesis, we focused on miR-219-2-3p. METHODS: Quantitative RT-PCR was employed to investigate the level of miR-219-2-3p in gastric cancer (GC tissues (n = 113 and their matched adjacent normal tissues (n = 113. In vitro cell proliferation, apoptosis assays, cell migration, and invasion assays were performed to elucidate biological effects of miR-219-2-3p. Since silencing of miRNA by promoter CpG island methylation may be an important mechanism in tumorgenesis, GC cells were treated with 5-aza-2'-deoxycytidine and trichostatin A, and expression changes of miR-219-2-3p were subsequently examined by quantitative RT-PCR. Finally, the methylation status of CpG island upstream of miR-219-2-3p was analyzed by methylation-specific PCR in GC tissues (n = 22. RESULTS: miR-219-2-3p was down-regulated in GC and cell lines. In addition, the experiments documented the lower expression of miR-219-2-3p in GC specimens with higher grade and later stage tumors. Meanwhile, miR-219-2-3p exerted antiproliferative, proapoptotic, and antimetastatic roles and reduced levels of p-ERK1/2 in GC cells. Furthermore, 5-aza-2'-deoxycytidine and trichostatin A increased the expression (~2 fold of miR-219-2-3p in GC cells. By methylation-specific PCR, DNA methylation in the upstream region of miR-219-2-3p was detected in both adjacent normal tissues and cancer tissues. As expected, the methylation level was considerably higher in the miR-219-2-3p down-regulated group than up-regulated group. CONCLUSIONS: miR-219-2-3p is potentially involved in gastric cancer progression and metastasis by regulating ERK1/2-related signal pathways, which may provide a novel therapeutic strategy
ROLE OF DNA METHYLATION AS A DIAGNOSTIC BIOMARKER OF SPORADIC BREAST CANCER
Directory of Open Access Journals (Sweden)
Wirsma Arif Harahap
2017-02-01
Full Text Available The initiation and progression of breast cancer have been recognized for many years to be secondary to the accumulation of genetic mutations which lead to aberrant cellular function. Genetic mutations, either inherited or sporadic, may result in the activation of oncogenes and the inactivation of tumor suppressor genes. The more recent discovery that reversible alterations in histone proteins and deoxyribonucleic acid (DNA can also lead to tumorigenesis has introduced a novel term to the field of cancer research: epigenetics. Epigenetics refers to the study of heritable changes in gene regulation that do not involve a change in the DNA sequence. The most often studied in epigenetics of breast cancer is DNA methylation. That a promoter methylation result in transcription blockade supports the notion that cellular inhibition takes place. Compared to normal tissues, hypermethylation occurs from double to triple in cancerous ones. DNA methylation plays a crucial role in oncogenesis and is one of the hallmarks of cancer. Detection of aberrantly methylated CpG islands in promoter region of several genes in DNA sample derived from nipple aspirates, serum, or cancer tissue associated with down regulation of expression or loss of function of these genes has been associated with early stages of breast cancer, where hypermethylation of CpG island points to poorer prognosis in breast cancer. DNA methylation has been identified as signature for TNBC. Methylation of BRCA1 gene is frequently demonstrated in young, estrogen receptor-negative breast cancer patients. Methylation of specific genes is known to differ across race and socioeconomic status. BRCA1 methylation in premenopausal women with sporadic breast cancer in West Sumatra region has been higher than in Western women. DNA methylation may be used to enhance current breast cancer classification. There is such a distinction between methylation and gene expression profiles of breast cancer that not
Directory of Open Access Journals (Sweden)
De Marzo Angelo M
2011-06-01
Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.
DNA methylation-based variation between human populations.
Kader, Farzeen; Ghai, Meenu
2017-02-01
Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.
Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam
2017-10-01
In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Huang, Jian; Zhang, Yun-Li; Teng, Xiao-Mei; Lin, Yun; Zheng, Da-Li; Yang, Peng-Yuan; Han, Ze-Guang
2007-01-01
Hepatocellular carcinoma (HCC) is one of the most common cancers in the world. SFRP1 (the secreted frizzled-related protein 1), a putative tumor suppressor gene mapped onto chromosome 8p12-p11.1, the frequent loss of heterozygosity (LOH) region in human HCC, encodes a Wingless-type (Wnt) signaling antagonist and is frequently inactivated by promoter methylation in many human cancers. However, whether the down-regulation of SFRP1 can contribute to hepatocarcinogenesis still remains unclear. We investigated the expression of SFRP1 through real time RT-PCR and immunohistochemistry staining. The cell growth and colony formation were observed as the overexpression and knockdown of SFRP1. The DNA methylation status within SFRP1 promoter was analyzed through methylation-specific PCR or bisulphate-treated DNA sequencing assays. Loss of heterozygosity was here detected with microsatellite markers. SFRP1 was significantly down-regulated in 76.1% (35/46) HCC specimens at mRNA level and in 30% (30/100) HCCs indicated by immunohistochemistry staining, as compared to adjacent non-cancerous livers. The overexpression of SFRP1 can significantly inhibit the cell growth and colony formation of YY-8103, SMMC7721, and Hep3B cells. The RNA interference against the constitutional SFRP1 in the offspring SMMC7721 cells, which were stably transfected by ectopic SFRP1, can markedly promote cell growth of these cells. LOH of both microsatellite markers D8S532 and D8SAC016868 flanking the gene locus was found in 13% (6 of 46 HCCs) and 6.5% (3 of 46 HCCs) of the informative cases, respectively, where 5 of 8 HCC specimens with LOH showed the down-regulation of SFRP1. DNA hypermethylation within SFRP1 promoter was identified in two of three HCC specimens without SFRP1 expression. Moreover, the DNA methylation of SFRP1 promoter was significantly reduced, along with the re-expression of the gene, in those HCC cell lines, Bel7404, QGY7701, and MHCC-H, as treated by DAC. Our data suggested that the
Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter
2016-09-01
The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.
Resource base influences genome-wide DNA methylation levels in wild baboons (Papio cynocephalus)
Lea, Amanda J.; Altmann, Jeanne; Alberts, Susan C.; Tung, Jenny
2015-01-01
Variation in resource availability commonly exerts strong effects on fitness-related traits in wild animals. However, we know little about the molecular mechanisms that mediate these effects, or about their persistence over time. To address these questions, we profiled genome-wide whole blood DNA methylation levels in two sets of wild baboons: (i) ‘wild-feeding’ baboons that foraged naturally in a savanna environment and (ii) ‘Lodge’ baboons that had ready access to spatially concentrated human food scraps, resulting in high feeding efficiency and low daily travel distances. We identified 1,014 sites (0.20% of sites tested) that were differentially methylated between wild-feeding and Lodge baboons, providing the first evidence that resource availability shapes the epigenome in a wild mammal. Differentially methylated sites tended to occur in contiguous stretches (i.e., in differentially methylated regions or DMRs), in promoters and enhancers, and near metabolism-related genes, supporting their functional importance in gene regulation. In agreement, reporter assay experiments confirmed that methylation at the largest identified DMR, located in the promoter of a key glycolysis-related gene, was sufficient to causally drive changes in gene expression. Intriguingly, all dispersing males carried a consistent epigenetic signature of their membership in a wild-feeding group, regardless of whether males dispersed into or out of this group as adults. Together, our findings support a role for DNA methylation in mediating ecological effects on phenotypic traits in the wild, and emphasize the dynamic environmental sensitivity of DNA methylation levels across the life course. PMID:26508127
Dobrowolski, S F; Lyons-Weiler, J; Spridik, K; Vockley, J; Skvorak, K; Biery, A
2016-09-01
synaptic involvement were targets of promoter hypermethylation that resulted in down-regulation of their expression. Gene dysregulation secondary to abnormal DNA methylation may be contributing to PKU neuropathology. These results suggest drugs that prevent or correct aberrant DNA methylation may offer a novel therapeutic option to management of neurological symptoms in PKU patients. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Gavery Mackenzie R
2010-08-01
Full Text Available Abstract Background DNA methylation is an epigenetic mechanism with important regulatory functions in animals. While the mechanism itself is evolutionarily ancient, the distribution and function of DNA methylation is diverse both within and among phylogenetic groups. Although DNA methylation has been well studied in mammals, there are limited data on invertebrates, particularly molluscs. Here we characterize the distribution and investigate potential functions of DNA methylation in the Pacific oyster (Crassostrea gigas. Results Methylation sensitive PCR and bisulfite sequencing PCR approaches were used to identify CpG methylation in C. gigas genes and demonstrated that this species possesses intragenic methylation. In silico analysis of CpGo/e ratios in publicly available sequence data suggests that DNA methylation is a common feature of the C. gigas genome, and that specific functional categories of genes have significantly different levels of methylation. Conclusions The Pacific oyster genome displays intragenic DNA methylation and contains genes necessary for DNA methylation in animals. Results of this investigation suggest that DNA methylation has regulatory functions in Crassostrea gigas, particularly in gene families that have inducible expression, including those involved in stress and environmental responses.
Directory of Open Access Journals (Sweden)
Christel Eckmann-Scholz
Full Text Available Epigenetic mechanisms including DNA methylation are supposed to play a key role in fetal development. Here we have investigated fetal DNA-methylation levels of 27,578 CpG loci in 47 chorionic villi (CVS and 16 amniotic cell (AC samples. Methylation levels differed significantly between karyotypically normal AC and CVS for 2,014 genes. AC showed more extreme DNA-methylation levels of these genes than CVS and the differentially methylated genes are significantly enriched for processes characteristic for the different cell types sampled. Furthermore, we identified 404 genes differentially methylated in CVS with trisomy 21. These genes were significantly enriched for high CG dinucleotid (CpG content and developmental processes associated with Down syndrome. Our study points to major tissue-specific differences of fetal DNA-methylation and gives rise to the hypothesis that part of the Down syndrome phenotype is epigenetically programmed in the first trimester of pregnancy.
Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi
2011-10-01
DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.
Linkage of DNA Methylation Quantitative Trait Loci to Human Cancer Risk
Directory of Open Access Journals (Sweden)
Holger Heyn
2014-04-01
Full Text Available Epigenetic regulation and, in particular, DNA methylation have been linked to the underlying genetic sequence. DNA methylation quantitative trait loci (meQTL have been identified through significant associations between the genetic and epigenetic codes in physiological and pathological contexts. We propose that interrogating the interplay between polymorphic alleles and DNA methylation is a powerful method for improving our interpretation of risk alleles identified in genome-wide association studies that otherwise lack mechanistic explanation. We integrated patient cancer risk genotype data and genome-scale DNA methylation profiles of 3,649 primary human tumors, representing 13 solid cancer types. We provide a comprehensive meQTL catalog containing DNA methylation associations for 21% of interrogated cancer risk polymorphisms. Differentially methylated loci harbor previously reported and as-yet-unidentified cancer genes. We suggest that such regulation at the DNA level can provide a considerable amount of new information about the biology of cancer-risk alleles.
DNA methylation of amino acid transporter genes in the human placenta.
Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K
2017-12-01
Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.
Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio
2011-11-25
We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.
DNMT1-interacting RNAs block gene specific DNA methylation
Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.
2013-01-01
Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992
Directory of Open Access Journals (Sweden)
Mizuho Sakaki
Full Text Available Cellular senescence is classified into two groups: replicative and premature senescence. Gene expression and epigenetic changes are reported to differ between these two groups and cell types. Normal human diploid fibroblast TIG-3 cells have often been used in cellular senescence research; however, their epigenetic profiles are still not fully understood. To elucidate how cellular senescence is epigenetically regulated in TIG-3 cells, we analyzed the gene expression and DNA methylation profiles of three types of senescent cells, namely, replicatively senescent, ras-induced senescent (RIS, and non-permissive temperature-induced senescent SVts8 cells, using gene expression and DNA methylation microarrays. The expression of genes involved in the cell cycle and immune response was commonly either down- or up-regulated in the three types of senescent cells, respectively. The altered DNA methylation patterns were observed in replicatively senescent cells, but not in prematurely senescent cells. Interestingly, hypomethylated CpG sites detected on non-CpG island regions ("open sea" were enriched in immune response-related genes that had non-CpG island promoters. The integrated analysis of gene expression and methylation in replicatively senescent cells demonstrated that differentially expressed 867 genes, including cell cycle- and immune response-related genes, were associated with DNA methylation changes in CpG sites close to the transcription start sites (TSSs. Furthermore, several miRNAs regulated in part through DNA methylation were found to affect the expression of their targeted genes. Taken together, these results indicate that the epigenetic changes of DNA methylation regulate the expression of a certain portion of genes and partly contribute to the introduction and establishment of replicative senescence.
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.
Directory of Open Access Journals (Sweden)
Christine Couldrey
Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.
Takimoto, Koyo; Kawashima, Nobuyuki; Suzuki, Noriyuki; Koizumi, Yu; Yamamoto, Mioko; Nakashima, Misako; Suda, Hideaki
2014-09-01
Matrix metalloproteinase (MMP)-3 is a member of the MMP family that degrades the extracellular matrix. Application of MMP-3 to injured pulp tissue induces angiogenesis and wound healing, but its anti-inflammatory effects are still unclear. Here, we evaluated the anti-inflammatory functions of MMP-3 in vitro and in vivo. Nitric oxide and inflammatory mediator synthesis in macrophages activated by lipopolysaccharide (LPS) was measured in the presence or absence of MMP-3. The mouse Mmp3 (mMmp3) expression vector containing full length cDNA sequence of mMmp3 or cDNA sequence of mMmp3 missing the signal peptide and pro-peptide regions was transfected to RAW264, a mouse macrophage cell line, and NO synthesis and inflammatory mediator expression were evaluated. Pulpal inflammation was histologically and immunohistochemically evaluated in a rat model of incisor pulpitis induced by the application of LPS for 9 hours in the presence or absence of MMP-3. NO and pro-inflammatory mediator synthesis promoted by LPS was significantly down-regulated by MMP-3 in vitro. The full length of mMmp3 down-regulated the LPS-induced NO synthesis and chemical mediator mRNA expression, however the mMmp3 missing the signal peptide failed to block the NO synthesis induced by LPS. The numbers of major histocompatibility complex class II+ and CD68+ cells, which infiltrated into the rat incisor pulp tissues in response to the topical application of LPS, were significantly decreased by the application of MMP-3 in vivo. These results indicate that MMP-3 possesses anti-inflammatory functions, suggesting its potential utility as an anti-inflammatory agent for pulpal inflammation. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Francesca Lessi
2010-11-01
Full Text Available We have previously shown that serum/glucocorticoid regulated kinase 1 (SGK1 is down-regulated in colorectal cancers (CRC with respect to normal tissue. As hyper-methylation of promoter regions is a well-known mechanism of gene silencing in cancer, we tested whether the SGK1 promoter region was methylated in colonic tumour samples.We investigated the methylation profile of the two CpG islands present in the promoter region of SGK1 in a panel of 5 colorectal cancer cell lines by sequencing clones of bisulphite-treated DNA samples. We further confirmed our findings in a panel of 10 normal and 10 tumour colonic tissue samples of human origin. We observed CpG methylation only in the smaller and more distal CpG island in the promoter region of SGK1 in both normal and tumour samples of colonic origin. We further identified a single nucleotide polymorphism (SNP, rs1743963 which affects methylation of the corresponding CpG.Our results show that even though partial methylation of the promoter region of SGK1 is present, this does not account for the different expression levels seen between normal and tumour tissue.
Directory of Open Access Journals (Sweden)
Rangel-Salazar Rubén
2011-11-01
Full Text Available Abstract Background We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20 hypermethylation in THP-1 macrophages. Here, we: 1 ask what gene expression changes accompany these epigenetic responses; 2 test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Results Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1 surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2 independent of the Dicer/micro-RNA pathway. Conclusions Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
Trichloroethylene-induced gene expression and DNA methylation changes in B6C3F1 mouse liver.
Directory of Open Access Journals (Sweden)
Yan Jiang
Full Text Available Trichloroethylene (TCE, widely used as an organic solvent in the industry, is a common contaminant in air, soil, and water. Chronic TCE exposure induced hepatocellular carcinoma in mice, and occupational exposure in humans was suggested to be associated with liver cancer. To understand the role of non-genotoxic mechanism(s for TCE action, we examined the gene expression and DNA methylation changes in the liver of B6C3F1 mice orally administered with TCE (0, 100, 500 and 1000 mg/kg b.w. per day for 5 days. After 5 days TCE treatment at a dose level of 1000 mg/kg b.w., a total of 431 differentially expressed genes were identified in mouse liver by microarray, of which 291 were up-regulated and 140 down-regulated. The expression changed genes were involved in key signal pathways including PPAR, proliferation, apoptosis and homologous recombination. Notably, the expression level of a number of vital genes involved in the regulation of DNA methylation, such as Utrf1, Tet2, DNMT1, DNMT3a and DNMT3b, were dysregulated. Although global DNA methylation change was not detected in the liver of mice exposed to TCE, the promoter regions of Cdkn1a and Ihh were found to be hypo- and hypermethylated respectively, which correlated negatively with their mRNA expression changes. Furthermore, the gene expression and DNA methylation changes induced by TCE were dose dependent. The overall data indicate that TCE exposure leads to aberrant DNA methylation changes, which might alter the expression of genes involved in the TCE-induced liver tumorgenesis.
Implications of DNA Methylation in Parkinson’s Disease
Directory of Open Access Journals (Sweden)
Ernesto Miranda-Morales
2017-07-01
Full Text Available It has been 200 years since Parkinson’s disease (PD was first described, yet many aspects of its etiopathogenesis remain unclear. PD is a progressive and complex neurodegenerative disorder caused by genetic and environmental factors including aging, nutrition, pesticides and exposure to heavy metals. DNA methylation may be altered in response to some of these factors; therefore, it is proposed that epigenetic mechanisms, particularly DNA methylation, can have a fundamental role in gene–environment interactions that are related with PD. Epigenetic changes in PD-associated genes are now widely studied in different populations, to discover the mechanisms that contribute to disease development and identify novel biomarkers for early diagnosis and future pharmacological treatment. While initial studies sought to find associations between promoter DNA methylation and the regulation of associated genes in PD brain tissue, more recent studies have described concordant DNA methylation patterns between blood and brain tissue DNA. These data justify the use of peripheral blood samples instead of brain tissue for epigenetic studies. Here, we summarize the current data about DNA methylation changes in PD and discuss the potential of DNA methylation as a potential biomarker for PD. Additionally, we discuss environmental and nutritional factors that have been implicated in DNA methylation. Although the search for significant DNA methylation changes and gene expression analyses of PD-associated genes have yielded inconsistent and contradictory results, epigenetic modifications remain under investigation for their potential to reveal the link between environmental risk factors and the development of PD.
Crescenti, Anna; Solà, Rosa; Valls, Rosa M; Caimari, Antoni; Del Bas, Josep M; Anguera, Anna; Anglés, Neus; Arola, Lluís
2013-01-01
DNA methylation regulates gene expression and can be modified by different bioactive compounds in foods, such as polyphenols. Cocoa is a rich source of polyphenols, but its role in DNA methylation is still unknown. The objective was to assess the effect of cocoa consumption on DNA methylation and to determine whether the enzymes involved in the DNA methylation process participate in the mechanisms by which cocoa exerts these effects in humans. The global DNA methylation levels in the peripheral blood were evaluated in 214 volunteers who were pre-hypertensive, stage-1 hypertensive or hypercholesterolemic. The volunteers were divided into two groups: 110 subjects who consumed cocoa (6 g/d) for two weeks and 104 control subjects. In addition, the peripheral blood mononuclear cells (PBMCs) from six subjects were treated with a cocoa extract to analyze the mRNA levels of the DNA methyltransferases (DNMTs), methylenetetrahydrofolate reductase (MTHFR), and methionine synthase reductase (MTRR) genes. Cocoa consumption significantly reduced the DNA methylation levels (2.991±0.366 vs. 3.909±0.380, pcocoa effects on DNA methylation and three polymorphisms located in the MTHFR, MTRR, and DNMT3B genes. Furthermore, in PBMCs, the cocoa extract significantly lowered the mRNA levels of the DNMTs, MTHFR, and MTRR. Our study demonstrates for the first time that the consumption of cocoa decreases the global DNA methylation of peripheral leukocytes in humans with cardiovascular risk factors. In vitro experiments with PBMCs suggest that cocoa may exert this effect partially via the down-regulation of DNMTs, MTHFR and MTRR, which are key genes involved in this epigenetic process. Clinicaltrials.govNCT00511420 and NCT00502047.
Effect of different light quality on DNA methylation variation for brown ...
African Journals Online (AJOL)
DNA methylation plays an important role in regulating gene expression during plant development. We studied the effects of different light quality on DNA methylation patterns of brown cotton (Gossypium hirstum) by using the methylation sensitive amplified polymorphism (MSAP). We selected 66 pairs of MSAP selective ...
De novo DNA methylation during monkey pre-implantation embryogenesis.
Gao, Fei; Niu, Yuyu; Sun, Yi Eve; Lu, Hanlin; Chen, Yongchang; Li, Siguang; Kang, Yu; Luo, Yuping; Si, Chenyang; Yu, Juehua; Li, Chang; Sun, Nianqin; Si, Wei; Wang, Hong; Ji, Weizhi; Tan, Tao
2017-04-01
Critical epigenetic regulation of primate embryogenesis entails DNA methylome changes. Here we report genome-wide composition, patterning, and stage-specific dynamics of DNA methylation in pre-implantation rhesus monkey embryos as well as male and female gametes studied using an optimized tagmentation-based whole-genome bisulfite sequencing method. We show that upon fertilization, both paternal and maternal genomes undergo active DNA demethylation, and genome-wide de novo DNA methylation is also initiated in the same period. By the 8-cell stage, remethylation becomes more pronounced than demethylation, resulting in an increase in global DNA methylation. Promoters of genes associated with oxidative phosphorylation are preferentially remethylated at the 8-cell stage, suggesting that this mode of energy metabolism may not be favored. Unlike in rodents, X chromosome inactivation is not observed during monkey pre-implantation development. Our study provides the first comprehensive illustration of the 'wax and wane' phases of DNA methylation dynamics. Most importantly, our DNA methyltransferase loss-of-function analysis indicates that DNA methylation influences early monkey embryogenesis.
ATM Mediates pRB Function To Control DNMT1 Protein Stability and DNA Methylation
Suzuki, Misa; Hayashi, Naoyuki; Kobayashi, Masahiko; Sasaki, Nobunari; Nishiuchi, Takumi; Doki, Yuichiro; Okamoto, Takahiro; Kohno, Susumu; Muranaka, Hayato; Kitajima, Shunsuke; Yamamoto, Ken-ichi
2013-01-01
The retinoblastoma tumor suppressor gene (RB) product has been implicated in epigenetic control of gene expression owing to its ability to physically bind to many chromatin modifiers. However, the biological and clinical significance of this activity was not well elucidated. To address this, we performed genetic and epigenetic analyses in an Rb-deficient mouse thyroid C cell tumor model. Here we report that the genetic interaction of Rb and ATM regulates DNMT1 protein stability and hence controls the DNA methylation status in the promoters of at least the Ink4a, Shc2, FoxO6, and Noggin genes. Furthermore, we demonstrate that inactivation of pRB promotes Tip60 (acetyltransferase)-dependent ATM activation; allows activated ATM to physically bind to DNMT1, forming a complex with Tip60 and UHRF1 (E3 ligase); and consequently accelerates DNMT1 ubiquitination driven by Tip60-dependent acetylation. Our results indicate that inactivation of the pRB pathway in coordination with aberration in the DNA damage response deregulates DNMT1 stability, leading to an abnormal DNA methylation pattern and malignant progression. PMID:23754744
Bisulfite sequencing reveals that Aspergillus flavus holds a hollow in DNA methylation.
Directory of Open Access Journals (Sweden)
Si-Yang Liu
Full Text Available Aspergillus flavus first gained scientific attention for its production of aflatoxin. The underlying regulation of aflatoxin biosynthesis has been serving as a theoretical model for biosynthesis of other microbial secondary metabolites. Nevertheless, for several decades, the DNA methylation status, one of the important epigenomic modifications involved in gene regulation, in A. flavus remains to be controversial. Here, we applied bisulfite sequencing in conjunction with a biological replicate strategy to investigate the DNA methylation profiling of A. flavus genome. Both the bisulfite sequencing data and the methylome comparisons with other fungi confirm that the DNA methylation level of this fungus is negligible. Further investigation into the DNA methyltransferase of Aspergillus uncovers its close relationship with RID-like enzymes as well as its divergence with the methyltransferase of species with validated DNA methylation. The lack of repeat contents of the A. flavus' genome and the high RIP-index of the small amount of remanent repeat potentially support our speculation that DNA methylation may be absent in A. flavus or that it may possess de novo DNA methylation which occurs very transiently during the obscure sexual stage of this fungal species. This work contributes to our understanding on the DNA methylation status of A. flavus, as well as reinforces our views on the DNA methylation in fungal species. In addition, our strategy of applying bisulfite sequencing to DNA methylation detection in species with low DNA methylation may serve as a reference for later scientific investigations in other hypomethylated species.
D'Addario, Claudio; Micale, Vincenzo; Di Bartolomeo, Martina; Stark, Tibor; Pucci, Mariangela; Sulcova, Alexandra; Palazzo, Mariacarlotta; Babinska, Zuzana; Cremaschi, Laura; Drago, Filippo; Carlo Altamura, A; Maccarrone, Mauro; Dell'Osso, Bernardo
2017-10-01
Compelling evidence supports the involvement of the endocannabinoid system (ECS) in psychosis vulnerability. We here evaluated the transcriptional regulation of ECS components in human peripheral blood mononuclear cells (PBMCs) obtained from subjects suffering from bipolar disorder, major depressive disorder and schizophrenia, focusing in particular on the effects of DNA methylation. We observed selective alterations of DNA methylation at the promoter of CNR1, the gene coding for the type-1 cannabinoid receptor, in schizophrenic patients (N=25) with no changes in any other disorder. We confirmed the regulation of CNR1 in a well-validated animal model of schizophrenia, induced by prenatal methylazoxymethanol (MAM) acetate exposure (N=7 per group) where we found, in the prefrontal cortex, a significant increase in CNR1 expression and a consistent reduction in DNA methylation at specific CpG sites of gene promoter. Overall, our findings suggest a selective dysregulation of ECS in psychosis, and highlight the evaluation of CNR1 DNA methylation levels in PBMCs as a potential biomarker for schizophrenia. Copyright © 2017 Elsevier B.V. All rights reserved.
RNA-directed DNA methylation: Mechanisms and functions
Mahfouz, Magdy M.
2010-07-01
Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.
DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.
Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki
2011-01-01
Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.
International Nuclear Information System (INIS)
Vandegehuchte, Michiel B.; De Coninck, Dieter; Vandenbrouck, Tine; De Coen, Wim M.; Janssen, Colin R.
2010-01-01
A reduced level of DNA methylation has recently been described in both Zn-exposed and non-exposed offspring of Daphnia magna exposed to Zn. The hypothesis examined in this study is that DNA hypomethylation has an effect on gene transcription. A second hypothesis is that accumulative epigenetic effects can affect gene transcription in non-exposed offspring from parents with an exposure history of more than one generation. Transcriptional gene regulation was studied with a cDNA microarray. In the exposed and non-exposed hypomethylated daphnids, a large proportion of common genes were similarly up- or down-regulated, indicating a possible effect of the DNA hypomethylation. Two of these genes can be mechanistically involved in DNA methylation reduction. The similar transcriptional regulation of two and three genes in the F 0 and F 1 exposed daphnids on one hand and their non-exposed offspring on the other hand, could be the result of a one-generation temporary transgenerational epigenetic effect, which was not accumulative. - Zn-induced DNA hypomethylation is related to gene transcription in Daphnia magna and Zn exposure potentially induced limited temporary transgenerational effects on gene transcription.
DNA damage, homology-directed repair, and DNA methylation.
Directory of Open Access Journals (Sweden)
Concetta Cuozzo
2007-07-01
Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.
Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru
2018-01-01
Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around
Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru
2018-01-01
Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD
Ogino, S; Kawasaki, T; Kirkner, G J; Ogawa, A; Dorfman, I; Loda, M; Fuchs, C S
2006-10-01
p21 (CDKN1A/CIP1/WAF1), one of the cyclin-dependent kinase inhibitors, plays a key role in regulating the cell cycle and is transcriptionally regulated by p53. Down-regulation of p21 is caused by TP53 mutations in colorectal cancer. CpG island methylator phenotype (CIMP) appears to be a distinct subtype of colorectal cancer with concordant methylation of multiple gene promoters and is associated with a high degree of microsatellite instability (MSI-H) and BRAF mutations. However, no study to date has evaluated the relationship between p21 expression and CIMP in colorectal cancer. The purpose of this study was to examine the inter-relationships between p21, p53, CIMP, MSI and KRAS/BRAF status in colorectal cancer. We utilized 737 relatively unbiased samples of colorectal cancers from two large prospective cohort studies. Using quantitative real-time PCR (MethyLight), we measured DNA methylation in five CIMP-specific gene promoters [CACNA1G, CDKN2A (p16/INK4A), CRABP1, MLH1 and NEUROG1]. CIMP-high (>or=4/5 methylated promoters) was diagnosed in 118 (16%) of the 737 tumours. We also assessed expression of p21 and p53 by immunohistochemistry. Among the 737 tumours, 371 (50%) showed p21 loss. Both p21 loss and p53 positivity were inversely associated with CIMP-high, MSI-H and BRAF mutations. The associations of p21 with these molecular features were still present after tumours were stratified by p53 status. In contrast, the associations of p53 positivity with the molecular features were no longer present after tumours were stratified by p21 status. When CIMP-high and non-CIMP-high tumours were stratified by MSI or KRAS/BRAF status, CIMP-high and MSI-H (but not BRAF mutations) were still inversely associated with p21 loss. In conclusion, down-regulation of p21 is inversely correlated with CIMP-high and MSI-H in colorectal cancer, independent of TP53 and BRAF status.
Directory of Open Access Journals (Sweden)
Anna Crescenti
Full Text Available DNA methylation regulates gene expression and can be modified by different bioactive compounds in foods, such as polyphenols. Cocoa is a rich source of polyphenols, but its role in DNA methylation is still unknown. The objective was to assess the effect of cocoa consumption on DNA methylation and to determine whether the enzymes involved in the DNA methylation process participate in the mechanisms by which cocoa exerts these effects in humans. The global DNA methylation levels in the peripheral blood were evaluated in 214 volunteers who were pre-hypertensive, stage-1 hypertensive or hypercholesterolemic. The volunteers were divided into two groups: 110 subjects who consumed cocoa (6 g/d for two weeks and 104 control subjects. In addition, the peripheral blood mononuclear cells (PBMCs from six subjects were treated with a cocoa extract to analyze the mRNA levels of the DNA methyltransferases (DNMTs, methylenetetrahydrofolate reductase (MTHFR, and methionine synthase reductase (MTRR genes. Cocoa consumption significantly reduced the DNA methylation levels (2.991±0.366 vs. 3.909±0.380, p<0.001. Additionally, we found an association between the cocoa effects on DNA methylation and three polymorphisms located in the MTHFR, MTRR, and DNMT3B genes. Furthermore, in PBMCs, the cocoa extract significantly lowered the mRNA levels of the DNMTs, MTHFR, and MTRR. Our study demonstrates for the first time that the consumption of cocoa decreases the global DNA methylation of peripheral leukocytes in humans with cardiovascular risk factors. In vitro experiments with PBMCs suggest that cocoa may exert this effect partially via the down-regulation of DNMTs, MTHFR and MTRR, which are key genes involved in this epigenetic process.Clinicaltrials.govNCT00511420 and NCT00502047.
DNA Methylation: A Frontier in Tooth Organogenesis and Developmental Dental Defects.
Wan, Mian; Li, Hongyu; Zhou, Yachuan; Du, Wei; Xu, Xin; Ye, Ling; Zhou, Xuedong; Zheng, Liwei
2018-01-01
Tooth development relies on interactions between epithelial and mesenchymal tissues, which are controlled by sophisticated networks of conserved signaling. The signaling networks regulating odontogenesis have been well characterized, but the epigenetic mechanisms underlying remain to be elucidated. In this review, we describe current researches regarding the control of various genes expression by DNA methylation during odontogenesis, summarize genomic mapping of DNA methylation in various stages of tooth formation and diverse dental tissues by high-throughput approaches, and highlight the roles of DNA methylation in odontogenesis. Researches on mammals have revealed that the genomic methylation, which occurs on cytosine residues, regulates certain genes transcription. Consequently, DNA methylation plays a crucial role in spatiotemporal organization of signaling pathways, and is essential for organogenesis. Recently, mounting evidence proves that methylation of genomes contributes to the spatiotemporal gene dynamics during odontogenesis. With emerging new technologies of mapping cytosine modifications in global genome, investigators are seeking an overall view of DNA methylome dynamics that characterize genetic information to manifest across incredibly varied tooth development stages, dental tissues, and developmental dental defects. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
DNA Methylation Dynamics of Germinal Center B Cells Are Mediated by AID
Directory of Open Access Journals (Sweden)
Pilar M. Dominguez
2015-09-01
Full Text Available Changes in DNA methylation are required for the formation of germinal centers (GCs, but the mechanisms of such changes are poorly understood. Activation-induced cytidine deaminase (AID has been recently implicated in DNA demethylation through its deaminase activity coupled with DNA repair. We investigated the epigenetic function of AID in vivo in germinal center B cells (GCBs isolated from wild-type (WT and AID-deficient (Aicda−/− mice. We determined that the transit of B cells through the GC is associated with marked locus-specific loss of methylation and increased methylation diversity, both of which are lost in Aicda−/− animals. Differentially methylated cytosines (DMCs between GCBs and naive B cells (NBs are enriched in genes that are targeted for somatic hypermutation (SHM by AID, and these genes form networks required for B cell development and proliferation. Finally, we observed significant conservation of AID-dependent epigenetic reprogramming between mouse and human B cells.
What do unicellular organisms teach us about DNA methylation?
Harony, Hala; Ankri, Serge
2008-05-01
DNA methylation is an epigenetic hallmark that has been studied intensively in mammals and plants. However, knowledge of this phenomenon in unicellular organisms is scanty. Examining epigenetic regulation, and more specifically DNA methylation, in these organisms represents a unique opportunity to better understand their biology. The determination of their methylation status is often complicated by the presence of several differentiation stages in their life cycle. This article focuses on some recent advances that have revealed the unexpected nature of the epigenetic determinants present in protozoa. The role of the enigmatic DNA methyltransferase Dnmt2 in unicellular organisms is discussed.
Swathy, Babu; Banerjee, Moinak
2017-01-01
Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission
Directory of Open Access Journals (Sweden)
Babu Swathy
Full Text Available Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects.SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study.Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in
Martin, Lee J; Wong, Margaret
2013-10-01
Amyotrophic lateral sclerosis (ALS) is the third most common adult-onset neurodegenerative disease. A diagnosis is fatal owing to degeneration of motor neurons in brain and spinal cord that control swallowing, breathing, and movement. ALS can be inherited, but most cases are not associated with a family history of the disease. The mechanisms causing motor neuron death in ALS are still unknown. Given the suspected complex interplay between multiple genes, the environment, metabolism, and lifestyle in the pathogenesis of ALS, we have hypothesized that the mechanisms of disease in ALS involve epigenetic contributions that can drive motor neuron degeneration. DNA methylation is an epigenetic mechanism for gene regulation engaged by DNA methyltransferase (Dnmt)-catalyzed methyl group transfer to carbon-5 in cytosine residues in gene regulatory promoter and nonpromoter regions. Recent genome-wide analyses have found differential gene methylation in human ALS. Neuropathologic assessments have revealed that motor neurons in human ALS show significant abnormalities in Dnmt1, Dnmt3a, and 5-methylcytosine. Similar changes are seen in mice with motor neuron degeneration, and Dnmt3a was found abundantly at synapses and in mitochondria. During apoptosis of cultured motor neuron-like cells, Dnmt1 and Dnmt3a protein levels increase, and 5-methylcytosine accumulates. Enforced expression of Dnmt3a, but not Dnmt1, induces degeneration of cultured neurons. Truncation mutation of the Dnmt3a catalytic domain and Dnmt3a RNAi blocks apoptosis of cultured neurons. Inhibition of Dnmt catalytic activity with small molecules RG108 and procainamide protects motor neurons from excessive DNA methylation and apoptosis in cell culture and in a mouse model of ALS. Thus, motor neurons can engage epigenetic mechanisms to cause their degeneration, involving Dnmts and increased DNA methylation. Aberrant DNA methylation in vulnerable cells is a new direction for discovering mechanisms of ALS
DNA methylation regulated microRNAs in HPV-16-induced head and neck squamous cell carcinoma (HNSCC).
Sannigrahi, M K; Sharma, Rajni; Singh, Varinder; Panda, Naresh K; Rattan, Vidya; Khullar, Madhu
2018-02-17
Epigenetic modifications have been reported to play an important role in regulating gene expression and these modifications become critical when they have a role in controlling another important layer of epigenetic regulation namely microRNAs. In the present study, we have identified the microRNAs that may be regulated by promoter DNA methylation and histone acetylation in Human papilloma virus-positive head and neck squamous cell carcinoma. HPV-negative cell line (UPCI:SCC-116) and HPV-16 +ve cell line (UPCI:SCC-090) were treated with methylation inhibitor (5-aza-2'-deoxycytidine, AZA) and acetylation inhibitor (Trichostatin-A, TSA), followed by micro-array analysis. The differentially expressed miRNAs were validated in control (n = 10), HPV-16 +ve (n = 30), and HPV -ve (n = 30) HNC, TCGA (n = 529) tissue samples, and two HPV -ve (SCC116 and Hacat) and two HPV +ve (SCC090 and SiHa) cell lines. Methylation-specific PCR (MSP) and chromatin immunoprecipitation assay (CHIP) were performed to validate their regulation. In silico and in vitro analyses of identified miRNAs were done to study putative pathways they target and their possible role in carcinogenesis. Among 10 miRNAs specifically up-regulated in microarray analysis of AZA-treated SCC090 cells, we observed significantly decreased expression of hsa-miR-181c-5p, hsa-miR-132-5p, hsa-miR-658 in HPV +ve HNC cohort, TCGA tissue samples, and cell lines as compared to their HPV -ve counterpart, and their promoter region also possesses CpG islands. MSP and analysis of TCGA data (MethHC) revealed increased frequency of methylation at the promoter of hsa-miR-132-5p that is negatively correlated with its expression. In TSA-treated SCC090 cells, out of 7 miRNAs, two namely Hsa-miR-129-2-3p and Hsa-miR-449a were found to be up-regulated as compared to HPV -ve cells. However, the levels of enrichment by anti-acetyl-H3 and anti-acetyl-H4 were significantly low in cell lines compared to respective controls
Zhang, Meng; Yan, Feng-Bin; Li, Fang; Jiang, Ke-Ren; Li, Dong-Hua; Han, Rui-Li; Li, Zhuan-Jan; Jiang, Rui-Rui; Liu, Xiao-Jun; Kang, Xiang-Tao; Sun, Gui-Rong
2017-04-05
Poultry meat quality is associated with breed, age, tissue and other factors. Many previous studies have focused on distinct breeds; however, little is known regarding the epigenetic regulatory mechanisms in different age stages, such as DNA methylation. Here, we compared the global DNA methylation profiles between juvenile (20 weeks old) and later laying-period (55 weeks old) hens and identified candidate genes related to the development and meat quality of breast muscle using whole-genome bisulfite sequencing. The results showed that the later laying-period hens, which had a higher intramuscular fat (IMF) deposition capacity and water holding capacity (WHC) and less tenderness, exhibited higher global DNA methylation levels than the juvenile hens. A total of 2,714 differentially methylated regions were identified in the present study, which corresponded to 378 differentially methylated genes, mainly affecting muscle development, lipid metabolism, and the ageing process. Hypermethylation of the promoters of the genes ABCA1, COL6A1 and GSTT1L and the resulting transcriptional down-regulation in the later laying-period hens may be the reason for the significant difference in the meat quality between the juvenile and later laying-period hens. These findings contribute to a better understanding of epigenetic regulation in the skeletal muscle development and meat quality of chicken.
van der Wijst, Monique G. P.; van Tilburg, Amanda Y.; Ruiters, Marcel H. J.; Rots, Marianne G.
2017-01-01
Like the nucleus, mitochondria contain their own DNA and recent reports provide accumulating evidence that also the mitochondrial DNA (mtDNA) is subjective to DNA methylation. This evidence includes the demonstration of mitochondria-localised DNA methyltransferases and demethylases, and the
Methyl-Analyzer--whole genome DNA methylation profiling.
Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G
2011-08-15
Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.
Covelo-Soto, Lara; Saura, María; Morán, Paloma
2015-07-01
Lampreys represent one of the most ancient vertebrate lineages enclosing a special interest for genetic and epigenetic studies. The sea lamprey (Petromyzon marinus) is an anadromous species that experiences metamorphosis all the way up to the adult stage. Although representing a gradual process, metamorphosis in this species involves dramatic conversions with regard to physiological together with structural body changes preparing individuals for a marine and parasitic life; in consequence, multiple gene expression modifications are expected. The implications of thyroid hormones and HOX gene expression changes have previously been reported in this species and also in other vertebrate species. Nonetheless, information lacks on how these genes are regulated in lampreys. We here report about the existence of methylation pattern differences between the adult and the larvae sea lamprey life cycle stages making use of the Methylation-Sensitive Amplified Polymorphism (MSAP) technique. Differentially methylated fragment sequencing allowed to establish homologous identities with HOX genes involved in morphogenesis, along with genes related to the water balance and to the osmotic homoeostasis, all associated to a marine environment adaptation. These results provide evidences revealing that DNA methylation plays a role in the epigenetic regulation of the P. marinus post-natal development representing a starting point for future studies. To the best of our knowledge, this is the first study which detects DNA methylation changes associated with metamorphosis in lampreys. Copyright © 2015 Elsevier Inc. All rights reserved.
Variation in DNA Methylation Patterns is More Common among Maize Inbreds than among Tissues
Directory of Open Access Journals (Sweden)
Steven R. Eichten
2013-07-01
Full Text Available Chromatin modifications, such as DNA methylation, can provide heritable, epigenetic regulation of gene expression in the absence of genetic changes. A role for DNA methylation in meiotically stable marking of repetitive elements and other sequences has been demonstrated in plants. Methylation of DNA is also proposed to play a role in development through providing a mitotic memory of gene expression states established during cellular differentiation. We sought to clarify the relative levels of DNA methylation variation among different genotypes and tissues in maize ( L.. We have assessed genomewide DNA methylation patterns in leaf, immature tassel, embryo, and endosperm tissues of two inbred maize lines: B73 and Mo17. There are hundreds of regions of differential methylation present between the two genotypes. In general, the same regions exhibit differential methylation between B73 and Mo17 in each of the tissues that were surveyed. In contrast, there are few examples of tissue-specific DNA methylation variation. Only a subset of regions with tissue-specific variation in DNA methylation show similar patterns in both genotypes of maize and even fewer are associated with altered gene expression levels among the tissues. Our data indicates a limited impact of DNA methylation on developmental gene regulation within maize.
DNA Methylation program in normal and alcohol-induced thinning cortex.
Öztürk, Nail Can; Resendiz, Marisol; Öztürk, Hakan; Zhou, Feng C
2017-05-01
While cerebral underdevelopment is a hallmark of fetal alcohol spectrum disorders (FASD), the mechanism(s) guiding the broad cortical neurodevelopmental deficits are not clear. DNA methylation is known to regulate early development and tissue specification through gene regulation. Here, we examined DNA methylation in the onset of alcohol-induced cortical thinning in a mouse model of FASD. C57BL/6 (B6) mice were administered a 4% alcohol (v/v) liquid diet from embryonic (E) days 7-16, and their embryos were harvested at E17, along with isocaloric liquid diet and lab chow controls. Cortical neuroanatomy, neural phenotypes, and epigenetic markers of methylation were assessed using immunohistochemistry, Western blot, and methyl-DNA assays. We report that cortical thickness, neuroepithelial proliferation, and neuronal migration and maturity were found to be deterred by alcohol at E17. Simultaneously, DNA methylation, including 5-methylcytosine (5mC) and 5-hydroxcylmethylcytosine (5hmC), which progresses as an intrinsic program guiding normal embryonic cortical development, was severely affected by in utero alcohol exposure. The intricate relationship between cortical thinning and this DNA methylation program disruption is detailed and illustrated. DNA methylation, dynamic across the multiple cortical layers during the late embryonic stage, is highly disrupted by fetal alcohol exposure; this disruption occurs in tandem with characteristic developmental abnormalities, ranging from structural to molecular. Finally, our findings point to a significant question for future exploration: whether epigenetics guides neurodevelopment or whether developmental conditions dictate epigenetic dynamics in the context of alcohol-induced cortical teratogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1
Energy Technology Data Exchange (ETDEWEB)
Bendall, Matthew L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Luong, Khai [Pacific Biosciences, Menlo Park, CA (United States); Wetmore, Kelly M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Blow, Matthew [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Korlach, Jonas [Pacific Biosciences, Menlo Park, CA (United States); Deutschbauer, Adam [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Malmstrom, Rex [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)
2013-08-30
We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns. However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.
Directory of Open Access Journals (Sweden)
Daisuke Yamamoto
2010-09-01
Full Text Available Methylation of CpG islands of genome DNA and lysine residues of histone H3 and H4 tails regulates gene transcription. Inhibition of polyamine synthesis by ornithine decarboxylase antizyme-1 (OAZ in human oral cancer cell line resulted in accumulation of decarboxylated S-adenosylmethionine (dcSAM, which acts as a competitive inhibitor of methylation reactions. We anticipated that accumulation of dcSAM impaired methylation reactions and resulted in hypomethylation of genome DNA and histone tails.Global methylation state of genome DNA and lysine residues of histone H3 and H4 tails were assayed by Methylation by Isoschizomers (MIAMI method and western blotting, respectively, in the presence or absence of OAZ expression. Ectopic expression of OAZ mediated hypomethylation of CpG islands of genome DNA and histone H3 lysine 9 dimethylation (H3K9me2. Protein level of DNA methyltransferase 3B (DNMT3B and histone H3K9me specific methyltransferase G9a were down-regulated in OAZ transfectant.OAZ induced hypomethylation of CpG islands of global genome DNA and H3K9me2 by down-regulating DNMT3B and G9a protein level. Hypomethylation of CpG islands of genome DNA and histone H3K9me2 is a potent mechanism of induction of the genes related to tumor suppression and DNA double strand break repair.
Directory of Open Access Journals (Sweden)
Harvey Mario
2010-01-01
Full Text Available Abstract Background UDP-glucuronosyltransferase 1A1 (UGT1A1 is a pivotal enzyme involved in metabolism of SN-38, the active metabolite of irinotecan commonly used to treat metastatic colorectal cancer. We previously demonstrated aberrant methylation of specific CpG dinucleotides in UGT1A1-negative cells, and revealed that methylation state of the UGT1A1 5'-flanking sequence is negatively correlated with gene transcription. Interestingly, one of these CpG dinucleotides (CpG -4 is found close to a HNF1 response element (HRE, known to be involved in activation of UGT1A1 gene expression, and within an upstream stimulating factor (USF binding site. Results Gel retardation assays revealed that methylation of CpG-4 directly affect the interaction of USF1/2 with its cognate sequence without altering the binding for HNF1-alpha. Luciferase assays sustained a role for USF1/2 and HNF1-alpha in UGT1A1 regulation in colon cancer cells. Based on the differential expression profiles of HNF1A gene in colon cell lines, we also assessed whether methylation affects its expression. In agreement with the presence of CpG islands in the HNF1A promoter, treatments of UGT1A1-negative HCT116 colon cancer cells with a DNA methyltransferase inhibitor restore HNF1A gene expression, as observed for UGT1A1. Conclusions This study reveals that basal UGT1A1 expression in colon cells is positively regulated by HNF1-alpha and USF, and negatively regulated by DNA methylation. Besides, DNA methylation of HNF1A could also play an important role in regulating additional cellular drug metabolism and transporter pathways. This process may contribute to determine local inactivation of drugs such as the anticancer agent SN-38 by glucuronidation and define tumoral response.
Reference Materials for Calibration of Analytical Biases in Quantification of DNA Methylation.
Yu, Hannah; Hahn, Yoonsoo; Yang, Inchul
2015-01-01
Most contemporary methods for the quantification of DNA methylation employ bisulfite conversion and PCR amplification. However, many reports have indicated that bisulfite-mediated PCR methodologies can result in inaccurate measurements of DNA methylation owing to amplification biases. To calibrate analytical biases in quantification of gene methylation, especially those that arise during PCR, we utilized reference materials that represent exact bisulfite-converted sequences with 0% and 100% methylation status of specific genes. After determining relative quantities using qPCR, pairs of plasmids were gravimetrically mixed to generate working standards with predefined DNA methylation levels at 10% intervals in terms of mole fractions. The working standards were used as controls to optimize the experimental conditions and also as calibration standards in melting-based and sequencing-based analyses of DNA methylation. Use of the reference materials enabled precise characterization and proper calibration of various biases during PCR and subsequent methylation measurement processes, resulting in accurate measurements.
Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.
Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode
2017-01-01
during lactation and buccal infant DNA methylation. This study suggests that maternal dietary and supplemental intake of methyl-group donors, especially in the periconception period, can influence infant's buccal DNA methylation in genes related to metabolism, growth, appetite regulation, and maintenance of DNA methylation reactions.
Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).
Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J
2014-01-01
DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic
Quantification of 5-methyl-2'-deoxycytidine in the DNA.
Giel-Pietraszuk, Małgorzata; Insińska-Rak, Małgorzata; Golczak, Anna; Sikorski, Marek; Barciszewska, Mirosława; Barciszewski, Jan
2015-01-01
Methylation at position 5 of cytosine (Cyt) at the CpG sequences leading to formation of 5-methyl-cytosine (m(5)Cyt) is an important element of epigenetic regulation of gene expression. Modification of the normal methylation pattern, unique to each organism, leads to the development of pathological processes and diseases, including cancer. Therefore, quantification of the DNA methylation and analysis of changes in the methylation pattern is very important from a practical point of view and can be used for diagnostic purposes, as well as monitoring of the treatment progress. In this paper we present a new method for quantification of 5-methyl-2'deoxycytidine (m(5)C) in the DNA. The technique is based on conversion of m(5)C into fluorescent 3,N(4)-etheno-5-methyl-2'deoxycytidine (εm(5)C) and its identification by reversed-phase high-performance liquid chromatography (RP-HPLC). The assay was used to evaluate m(5)C concentration in DNA of calf thymus and peripheral blood of cows bred under different conditions. This approach can be applied for measuring of 5-methylcytosine in cellular DNA from different cells and tissues.
Social Crowding during Development Causes Changes in GnRH1 DNA Methylation.
Alvarado, Sebastian G; Lenkov, Kapa; Williams, Blake; Fernald, Russell D
2015-01-01
Gestational and developmental cues have important consequences for long-term health, behavior and adaptation to the environment. In addition, social stressors cause plastic molecular changes in the brain that underlie unique behavioral phenotypes that also modulate fitness. In the adult African cichlid, Astatotilapia burtoni, growth and social status of males are both directly regulated by social interactions in a dynamic social environment, which causes a suite of plastic changes in circuits, cells and gene transcription in the brain. We hypothesized that a possible mechanism underlying some molecular changes might be DNA methylation, a reversible modification made to cytosine nucleotides that is known to regulate gene function. Here we asked whether changes in DNA methylation of the GnRH1 gene, the central regulator of the reproductive axis, were altered during development of A. burtoni. We measured changes in methylation state of the GnRH1 gene during normal development and following the gestational and developmental stress of social crowding. We found differential DNA methylation within developing juveniles between 14-, 28- and 42-day-old. Following gestational crowding of mouth brooding mothers, we saw differential methylation and transcription of GnRH1 in their offspring. Taken together, our data provides evidence for social control of GnRH1 developmental responses to gestational cues through DNA methylation.
DNA methylation patterns in cord blood DNA and body size in childhood.
Directory of Open Access Journals (Sweden)
Caroline L Relton
Full Text Available Epigenetic markings acquired in early life may have phenotypic consequences later in development through their role in transcriptional regulation with relevance to the developmental origins of diseases including obesity. The goal of this study was to investigate whether DNA methylation levels at birth are associated with body size later in childhood.A study design involving two birth cohorts was used to conduct transcription profiling followed by DNA methylation analysis in peripheral blood. Gene expression analysis was undertaken in 24 individuals whose biological samples and clinical data were collected at a mean ± standard deviation (SD age of 12.35 (0.95 years, the upper and lower tertiles of body mass index (BMI were compared with a mean (SD BMI difference of 9.86 (2.37 kg/m(2. This generated a panel of differentially expressed genes for DNA methylation analysis which was then undertaken in cord blood DNA in 178 individuals with body composition data prospectively collected at a mean (SD age of 9.83 (0.23 years. Twenty-nine differentially expressed genes (>1.2-fold and p<10(-4 were analysed to determine DNA methylation levels at 1-3 sites per gene. Five genes were unmethylated and DNA methylation in the remaining 24 genes was analysed using linear regression with bootstrapping. Methylation in 9 of the 24 (37.5% genes studied was associated with at least one index of body composition (BMI, fat mass, lean mass, height at age 9 years, although only one of these associations remained after correction for multiple testing (ALPL with height, p(Corrected = 0.017.DNA methylation patterns in cord blood show some association with altered gene expression, body size and composition in childhood. The observed relationship is correlative and despite suggestion of a mechanistic epigenetic link between in utero life and later phenotype, further investigation is required to establish causality.
DNA methylation and memory formation.
Day, Jeremy J; Sweatt, J David
2010-11-01
Memory formation and storage require long-lasting changes in memory-related neuronal circuits. Recent evidence indicates that DNA methylation may serve as a contributing mechanism in memory formation and storage. These emerging findings suggest a role for an epigenetic mechanism in learning and long-term memory maintenance and raise apparent conundrums and questions. For example, it is unclear how DNA methylation might be reversed during the formation of a memory, how changes in DNA methylation alter neuronal function to promote memory formation, and how DNA methylation patterns differ between neuronal structures to enable both consolidation and storage of memories. Here we evaluate the existing evidence supporting a role for DNA methylation in memory, discuss how DNA methylation may affect genetic and neuronal function to contribute to behavior, propose several future directions for the emerging subfield of neuroepigenetics, and begin to address some of the broader implications of this work.
DNA methylation in metabolic disorders
DEFF Research Database (Denmark)
Barres, Romain; Zierath, Juleen R
2011-01-01
DNA methylation is a major epigenetic modification that controls gene expression in physiologic and pathologic states. Metabolic diseases such as diabetes and obesity are associated with profound alterations in gene expression that are caused by genetic and environmental factors. Recent reports...... have provided evidence that environmental factors at all ages could modify DNA methylation in somatic tissues, which suggests that DNA methylation is a more dynamic process than previously appreciated. Because of the importance of lifestyle factors in metabolic disorders, DNA methylation provides...... a mechanism by which environmental factors, including diet and exercise, can modify genetic predisposition to disease. This article considers the current evidence that defines a role for DNA methylation in metabolic disorders....
Rathore, Mangal S; Jha, Bhavanath
2016-03-01
The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.
Tang, Xiao-Mei; Tao, Xiang; Wang, Yan; Ma, Dong-Wei; Li, Dan; Yang, Hong; Ma, Xin-Rong
2014-12-01
Perennial ryegrass (Lolium perenne), an excellent grass for forage and turf, is widespread in temperate regions. Drought is an important factor that limits its growth, distribution, and yield. DNA methylation affects gene expression and plays an important role in adaptation to adverse environments. In this study, the DNA methylation changes in perennial ryegrass under drought stress were assessed using methylation-sensitive amplified polymorphism (MSAP). After 15 days of drought stress treatment, the plant height was less than half of the control, and the leaves were smaller and darker. Genome-wide, a total of 652 CCGG sites were detected by MSAP. The total methylation level was 57.67 and 47.39 % in the control and drought treatment, respectively, indicating a decrease of 10.28 % due to drought exposure. Fifteen differentially displayed DNA fragments in MSAP profiles were cloned for sequencing analysis. The results showed that most of the genes involved in stress responses. The relative expression levels revealed that three demethylated fragments were up-regulated. The expression of a predicted retrotransposon increased significantly, changing from hypermethylation to non-methylation. Although the extent of methylation in two other genes decreased, the sites of methylation remained, and the expression increased only slightly. All of these results suggested that drought stress decreased the total DNA methylation level in perennial ryegrass and demethylation up-regulated related gene expressions and that the extent of methylation was negatively correlated with expression. Overall, the induced epigenetic changes in genome probably are an important regulatory mechanism for acclimating perennial ryegrass to drought and possibly other environmental stresses.
DNA methylation-dependent regulation of TrkA, TrkB, and TrkC genes in human hepatocellular carcinoma
Energy Technology Data Exchange (ETDEWEB)
Jin, Wook [Laboratory of Molecular Disease and Cell Regulation, Lee Gil Ya Cancer and Diabetes Institute, Gachon University of Medicine and Science, Incheon (Korea, Republic of); Lee, Jong-Joo [Department of Environmental Medical Biology, Institute of Tropical Medicine, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kim, Min Soo [Laboratory of Molecular Disease and Cell Regulation, Lee Gil Ya Cancer and Diabetes Institute, Gachon University of Medicine and Science, Incheon (Korea, Republic of); Son, Byung Ho [Department of Surgery, Kangbuk Samsung Hospital, Sungkyunkwan University, School of Medicine, 108 Pyung-dong, Jongro-gu, Seoul 110-746 (Korea, Republic of); Cho, Yong Kyun, E-mail: choyk2004@hanmail.net [Division of Gastroenterology, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University, School of Medicine, 108 Pyung-dong, Jongro-gu, Seoul 110-746 (Korea, Republic of); Kim, Hyoung-Pyo, E-mail: kimhp@yuhs.ac [Department of Environmental Medical Biology, Institute of Tropical Medicine, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)
2011-03-04
Research highlights: {yields} Expression of TrkA, TrkB, and TrkC is significantly elevated in human hepatocellular carcinoma. {yields} Downregulation of Trks is correlated with their promoter hypermethylation. {yields} Inhibiting DNA methylation restored expression of Trks in normal liver cell lines. {yields} Trks promote the proliferation of hepatocellular carcinoma. {yields} Trks induce expression of the metastatic regulator, Twist. -- Abstract: The tropomyosin-related kinase (Trk) family of neurotrophin receptors, TrkA, TrkB and TrkC, has been implicated in the growth and survival of human cancers. Here we report that Trks are frequently overexpressed in hepatocellular carcinoma (HCC) from patients and human liver cancer cell lines. To unravel the underlying molecular mechanism(s) for this phenomenon, DNA methylation patterns of CpG islands in TrkA, TrkB, and TrkC genes were examined in normal and cancer cell lines derived from liver. A good correlation was observed between promoter hypermethylation and lower expression of TrkA, TrkB, and TrkC genes, which was supported by the data that inhibiting DNA methylation with 5-azacytidine restored expression of those genes in normal liver cell lines. Furthermore, Trks promoted the proliferation of HepG2 and induced expression of the metastatic regulator, Twist. These results suggest that Trks may contribute to growth and metastasis of liver cancer.
DNA methylation-dependent regulation of TrkA, TrkB, and TrkC genes in human hepatocellular carcinoma
International Nuclear Information System (INIS)
Jin, Wook; Lee, Jong-Joo; Kim, Min Soo; Son, Byung Ho; Cho, Yong Kyun; Kim, Hyoung-Pyo
2011-01-01
Research highlights: → Expression of TrkA, TrkB, and TrkC is significantly elevated in human hepatocellular carcinoma. → Downregulation of Trks is correlated with their promoter hypermethylation. → Inhibiting DNA methylation restored expression of Trks in normal liver cell lines. → Trks promote the proliferation of hepatocellular carcinoma. → Trks induce expression of the metastatic regulator, Twist. -- Abstract: The tropomyosin-related kinase (Trk) family of neurotrophin receptors, TrkA, TrkB and TrkC, has been implicated in the growth and survival of human cancers. Here we report that Trks are frequently overexpressed in hepatocellular carcinoma (HCC) from patients and human liver cancer cell lines. To unravel the underlying molecular mechanism(s) for this phenomenon, DNA methylation patterns of CpG islands in TrkA, TrkB, and TrkC genes were examined in normal and cancer cell lines derived from liver. A good correlation was observed between promoter hypermethylation and lower expression of TrkA, TrkB, and TrkC genes, which was supported by the data that inhibiting DNA methylation with 5-azacytidine restored expression of those genes in normal liver cell lines. Furthermore, Trks promoted the proliferation of HepG2 and induced expression of the metastatic regulator, Twist. These results suggest that Trks may contribute to growth and metastasis of liver cancer.
Defining Driver DNA Methylation Changes in Human Cancer
Directory of Open Access Journals (Sweden)
Gerd P. Pfeifer
2018-04-01
Full Text Available Human malignant tumors are characterized by pervasive changes in the patterns of DNA methylation. These changes include a globally hypomethylated tumor cell genome and the focal hypermethylation of numerous 5′-cytosine-phosphate-guanine-3′ (CpG islands, many of them associated with gene promoters. It has been challenging to link specific DNA methylation changes with tumorigenesis in a cause-and-effect relationship. Some evidence suggests that cancer-associated DNA hypomethylation may increase genomic instability. Promoter hypermethylation events can lead to silencing of genes functioning in pathways reflecting hallmarks of cancer, including DNA repair, cell cycle regulation, promotion of apoptosis or control of key tumor-relevant signaling networks. A convincing argument for a tumor-driving role of DNA methylation can be made when the same genes are also frequently mutated in cancer. Many of the most commonly hypermethylated genes encode developmental transcription factors, the methylation of which may lead to permanent gene silencing. Inactivation of such genes will deprive the cells in which the tumor may initiate from the option of undergoing or maintaining lineage differentiation and will lock them into a perpetuated stem cell-like state thus providing an additional window for cell transformation.
Densely ionizing radiation affects DNA methylation of selective LINE-1 elements
Energy Technology Data Exchange (ETDEWEB)
Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others
2016-10-15
Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.
Densely ionizing radiation affects DNA methylation of selective LINE-1 elements
International Nuclear Information System (INIS)
Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.
2016-01-01
Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.
Directory of Open Access Journals (Sweden)
Cátia Lira do Amaral
2014-01-01
Full Text Available Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC. However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded.
Rager, Julia E.; Miller, Sloane; Tulenko, Samantha E.; Smeester, Lisa; Ray, Paul D.; Yosim, Andrew; Currier, Jenna M.; Ishida, María C.; González-Horta, Maria del Carmen; Sánchez-Ramírez, Blanca; Ballinas-Casarrubias, Lourdes; Gutiérrez-Torres, Daniela S.; Drobná, Zuzana; Del Razo, Luz M.; García-Vargas, Gonzalo G.; Kim, William Y.; Zhou, Yi-Hui; Wright, Fred A.; Stýblo, Miroslav; Fry, Rebecca C.
2016-01-01
There is strong epidemiologic evidence linking chronic exposure to inorganic arsenic (iAs) to a myriad of adverse health effects, including cancer of the bladder. The present study set out to identify DNA methylation patterns associated with iAs and its metabolites in exfoliated urothelial cells (EUCs) that originate primarily from the urinary bladder, one of the targets of arsenic (As)-induced carcinogenesis. Genome-wide, gene-specific promoter DNA methylation levels were assessed in EUCs from 46 residents of Chihuahua, Mexico, and the relationship was examined between promoter methylation profiles and the intracellular concentrations of total As (tAs) and As species. A set of 49 differentially methylated genes was identified with increased promoter methylation associated with EUC tAs, iAs, and/or monomethylated As (MMAs) enriched for their roles in metabolic disease and cancer. Notably, no genes had differential methylation associated with EUC dimethylated As (DMAs), suggesting that DMAs may influence DNA methylation-mediated urothelial cell responses to a lesser extent than iAs or MMAs. Further analysis showed that 22 of the 49 As-associated genes (45%) are also differentially methylated in bladder cancer tissue identified using The Cancer Genome Atlas repository. Both the As- and cancer-associated genes are enriched for the binding sites of common transcription factors known to play roles in carcinogenesis, demonstrating a novel potential mechanistic link between iAs exposure and bladder cancer. PMID:26039340
Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng
2015-03-01
DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.
RNA-directed DNA methylation: Mechanisms and functions
Mahfouz, Magdy M.
2010-01-01
Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response
Directory of Open Access Journals (Sweden)
Yuan-Hao Lee
2015-04-01
Full Text Available Accumulating evidence suggests that ubiquitin E3 ligases are involved in cancer development as their mutations correlate with genomic instability and genetic susceptibility to cancer. Despite significant findings of cancer-driving mutations in the BRCA1 gene, estrogen receptor (ER-positive breast cancers progress upon treatment with DNA damaging-cytotoxic therapies. In order to understand the underlying mechanism by which ER-positive breast cancer cells develop resistance to DNA damaging agents, we employed an estrogen receptor agonist, Erb-041, to increase the activity of ERβ and negatively regulate the expression and function of the estrogen receptor α (ERα in MCF-7 breast cancer cells. Upon Erb-041-mediated ERα down-regulation, the transcription of an ERα downstream effector, BCA2 (Breast Cancer Associated gene 2, correspondingly decreased. The ubiquitination of chromatin-bound BCA2 was induced by ultraviolet C (UVC irradiation but suppressed by Erb-041 pretreatment, resulting in a blunted DNA damage response. Upon BCA2 silencing, DNA double-stranded breaks increased with Rad51 up-regulation and ataxia telangiectasia mutated (ATM activation. Mechanistically, UV-induced BCA2 ubiquitination and chromatin binding were found to promote DNA damage response and repair via the interaction of BCA2 with ATM, γH2AX and Rad51. Taken together, this study suggests that Erb-041 potentiates BCA2 dissociation from chromatin and co-localization with Rad51, resulting in inhibition of homologous recombination repair.
Martin, Elizabeth M; Fry, Rebecca C
2018-04-01
DNA methylation is the most well studied of the epigenetic regulators in relation to environmental exposures. To date, numerous studies have detailed the manner by which DNA methylation is influenced by the environment, resulting in altered global and gene-specific DNA methylation. These studies have focused on prenatal, early-life, and adult exposure scenarios. The present review summarizes currently available literature that demonstrates a relationship between DNA methylation and environmental exposures. It includes studies on aflatoxin B 1 , air pollution, arsenic, bisphenol A, cadmium, chromium, lead, mercury, polycyclic aromatic hydrocarbons, persistent organic pollutants, tobacco smoke, and nutritional factors. It also addresses gaps in the literature and future directions for research. These gaps include studies of mixtures, sexual dimorphisms with respect to environmentally associated methylation changes, tissue specificity, and temporal stability of the methylation marks.
The role of DNA methylation on Octopus vulgaris development and their perspectives
Directory of Open Access Journals (Sweden)
Eva eDíaz-Freije
2014-02-01
Full Text Available DNA methylation is a common regulator of gene expression and development in mammalian and other vertebrate genomes. DNA methylation has been studied so far in a few bivalve mollusk species, finding a wide spectrum of levels. We focused our study in the common octopus, Octopus vulgaris, an important organism for neuroscience, physiology and ethology research as well as for human consumption. We aim to confirm the existence of DNA methylation in O. vulgaris and ultimately, if methylation plays a role in gene regulation during octopus development. We used a genome-wide approach, methylation-sensitive amplified polymorphism (MSAP, firstly in four different tissues from the same specimens from adult benthonic individuals to test whether gene expression is regulated by methylation. Secondly, we tested the hypothesis that methylation underlies development by assessing MSAP patters from paralarvae to adult developmental stages. Our data indicate that octopus genome is widely methylated since clear differences can be observed, and the methylation pattern change with the development. The statistical analyses showed significant differences in methylation pattern between paralarvae, where higher internal cytosine methylation is observed, and the three other post-hatching stages. This suggests an important role of cytosine methylation during the first step of development, when major morphological changes take place. However, methylation seems to have little effect on gene expression during the benthonic phase, since any significant effect was revealed in the AMOVA performed. Our observations highlight the importance of epigenetic mechanism in the first developmental steps of the common octopus and open new perspectives to overcome high mortality rate during paralarvae growth. Thus, better understanding the molecular regulation patterns could lead to new approaches that increase the efficiency of husbandry of this emergent species for aquaculture.
Scanlon, Susan E; Scanlon, Christine D; Hegan, Denise C; Sulkowski, Parker L; Glazer, Peter M
2017-06-01
The heavy metal nickel is a known carcinogen, and occupational exposure to nickel compounds has been implicated in human lung and nasal cancers. Unlike many other environmental carcinogens, however, nickel does not directly induce DNA mutagenesis, and the mechanism of nickel-related carcinogenesis remains incompletely understood. Cellular nickel exposure leads to signaling pathway activation, transcriptional changes and epigenetic remodeling, processes also impacted by hypoxia, which itself promotes tumor growth without causing direct DNA damage. One of the mechanisms by which hypoxia contributes to tumor growth is the generation of genomic instability via down-regulation of high-fidelity DNA repair pathways. Here, we find that nickel exposure similarly leads to down-regulation of DNA repair proteins involved in homology-dependent DNA double-strand break repair (HDR) and mismatch repair (MMR) in tumorigenic and non-tumorigenic human lung cells. Functionally, nickel induces a defect in HDR capacity, as determined by plasmid-based host cell reactivation assays, persistence of ionizing radiation-induced DNA double-strand breaks and cellular hypersensitivity to ionizing radiation. Mechanistically, we find that nickel, in contrast to the metalloid arsenic, acutely induces transcriptional repression of HDR and MMR genes as part of a global transcriptional pattern similar to that seen with hypoxia. Finally, we find that exposure to low-dose nickel reduces the activity of the MLH1 promoter, but only arsenic leads to long-term MLH1 promoter silencing. Together, our data elucidate novel mechanisms of heavy metal carcinogenesis and contribute to our understanding of the influence of the microenvironment on the regulation of DNA repair pathways. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
DNA Methylation in Skeletal Muscle Stem Cell Specification, Proliferation, and Differentiation
Directory of Open Access Journals (Sweden)
Rhianna C. Laker
2016-01-01
Full Text Available An unresolved and critically important question in skeletal muscle biology is how muscle stem cells initiate and regulate the genetic program during muscle development. Epigenetic dynamics are essential for cellular development and organogenesis in early life and it is becoming increasingly clear that epigenetic remodeling may also be responsible for the cellular adaptations that occur in later life. DNA methylation of cytosine bases within CpG dinucleotide pairs is an important epigenetic modification that reduces gene expression when located within a promoter or enhancer region. Recent advances in the field suggest that epigenetic regulation is essential for skeletal muscle stem cell identity and subsequent cell development. This review summarizes what is currently known about how skeletal muscle stem cells regulate the myogenic program through DNA methylation, discusses a novel role for metabolism in this process, and addresses DNA methylation dynamics in adult skeletal muscle in response to physical activity.
Annotating the genome by DNA methylation.
Cedar, Howard; Razin, Aharon
2017-01-01
DNA methylation plays a prominent role in setting up and stabilizing the molecular design of gene regulation and by understanding this process one gains profound insight into the underlying biology of mammals. In this article, we trace the discoveries that provided the foundations of this field, starting with the mapping of methyl groups in the genome and the experiments that helped clarify how methylation patterns are maintained through cell division. We then address the basic relationship between methyl groups and gene repression, as well as the molecular rules involved in controlling this process during development in vivo. Finally, we describe ongoing work aimed at defining the role of this modification in disease and deciphering how it may serve as a mechanism for sensing the environment.
Spada, Fabio; Haemmer, Andrea; Kuch, David; Rothbauer, Ulrich; Schermelleh, Lothar; Kremmer, Elisabeth; Carell, Thomas; Längst, Gernot; Leonhardt, Heinrich
2007-01-01
DNA methylation plays a central role in the epigenetic regulation of gene expression in vertebrates. Genetic and biochemical data indicated that DNA methyltransferase 1 (Dnmt1) is indispensable for the maintenance of DNA methylation patterns in mice, but targeting of the DNMT1 locus in human HCT116 tumor cells had only minor effects on genomic methylation and cell viability. In this study, we identified an alternative splicing in these cells that bypasses the disrupting selective marker and results in a catalytically active DNMT1 protein lacking the proliferating cell nuclear antigen–binding domain required for association with the replication machinery. Using a mechanism-based trapping assay, we show that this truncated DNMT1 protein displays only twofold reduced postreplicative DNA methylation maintenance activity in vivo. RNA interference–mediated knockdown of this truncated DNMT1 results in global genomic hypomethylation and cell death. These results indicate that DNMT1 is essential in mouse and human cells, but direct coupling of the replication of genetic and epigenetic information is not strictly required. PMID:17312023
Directory of Open Access Journals (Sweden)
Wenping Zhang
Full Text Available Recently, an increasing number of human and animal studies have reported that exposure to benzo(apyrene (BaP induces neurological abnormalities and is also associated with adverse effects, such as tumor formation, immunosuppression, teratogenicity, and hormonal disorders. However, the exact mechanisms underlying BaP-induced impairment of neurological function remain unclear. The aim of this study was to examine the regulating mechanisms underlying the impact of chronic BaP exposure on neurobehavioral performance.C57BL mice received either BaP in different doses (1.0, 2.5, 6.25 mg/kg or olive oil twice a week for 90 days. Memory and emotional behaviors were evaluated using Y-maze and open-field tests, respectively. Furthermore, levels of mRNA expression were measured by using qPCR, and DNA methylation of NMDA receptor 2B subunit (NR2B was examined using bisulfate pyrosequencing in the prefrontal cortex and hippocampus.Compared to controls, mice that received BaP (2.5, 6.25 mg/kg showed deficits in short-term memory and an anxiety-like behavior. These behavioral alterations were associated with a down-regulation of the NR2B gene and a concomitant increase in the level of DNA methylation in the NR2B promoter in the two brain regions.Chronic BaP exposure induces an increase in DNA methylation in the NR2B gene promoter and down-regulates NR2B expression, which may contribute to its neurotoxic effects on behavioral performance. The results suggest that NR2B vulnerability represents a target for environmental toxicants in the brain.
Directory of Open Access Journals (Sweden)
Yokoyama Seiya
2012-02-01
Full Text Available Abstract Background Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Methods Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE. The MSE method is comprised of the following steps: (a bisulfite treatment of genomic DNA, (b amplification of the target DNA by a nested PCR approach and (c applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. Result The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is Conclusions The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical samples, and this may facilitate identification of new risk markers.
Analysis of DNA methylation in various swine tissues.
Directory of Open Access Journals (Sweden)
Chun Yang
Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.
An integrative analysis of DNA methylation and RNA-Seq data for human heart, kidney and liver
Directory of Open Access Journals (Sweden)
Xie Linglin
2011-12-01
Full Text Available Abstract Background Many groups, including our own, have proposed the use of DNA methylation profiles as biomarkers for various disease states. While much research has been done identifying DNA methylation signatures in cancer vs. normal etc., we still lack sufficient knowledge of the role that differential methylation plays during normal cellular differentiation and tissue specification. We also need thorough, genome level studies to determine the meaning of methylation of individual CpG dinucleotides in terms of gene expression. Results In this study, we have used (insert statistical method here to compile unique DNA methylation signatures from normal human heart, lung, and kidney using the Illumina Infinium 27 K methylation arraysand compared those to gene expression by RNA sequencing. We have identified unique signatures of global DNA methylation for human heart, kidney and liver, and showed that DNA methylation data can be used to correctly classify various tissues. It indicates that DNA methylation reflects tissue specificity and may play an important role in tissue differentiation. The integrative analysis of methylation and RNA-Seq data showed that gene methylation and its transcriptional levels were comprehensively correlated. The location of methylation markers in terms of distance to transcription start site and CpG island showed no effects on the regulation of gene expression by DNA methylation in normal tissues. Conclusions This study showed that an integrative analysis of methylation array and RNA-Seq data can be utilized to discover the global regulation of gene expression by DNA methylation and suggests that DNA methylation plays an important role in normal tissue differentiation via modulation of gene expression.
Differential DNA methylation patterns define status epilepticus and epileptic tolerance.
Miller-Delaney, Suzanne F C; Das, Sudipto; Sano, Takanori; Jimenez-Mateos, Eva M; Bryan, Kenneth; Buckley, Patrick G; Stallings, Raymond L; Henshall, David C
2012-02-01
Prolonged seizures (status epilepticus) produce pathophysiological changes in the hippocampus that are associated with large-scale, wide-ranging changes in gene expression. Epileptic tolerance is an endogenous program of cell protection that can be activated in the brain by previous exposure to a non-harmful seizure episode before status epilepticus. A major transcriptional feature of tolerance is gene downregulation. Here, through methylation analysis of 34,143 discrete loci representing all annotated CpG islands and promoter regions in the mouse genome, we report the genome-wide DNA methylation changes in the hippocampus after status epilepticus and epileptic tolerance in adult mice. A total of 321 genes showed altered DNA methylation after status epilepticus alone or status epilepticus that followed seizure preconditioning, with >90% of the promoters of these genes undergoing hypomethylation. These profiles included genes not previously associated with epilepsy, such as the polycomb gene Phc2. Differential methylation events generally occurred throughout the genome without bias for a particular chromosomal region, with the exception of a small region of chromosome 4, which was significantly overrepresented with genes hypomethylated after status epilepticus. Surprisingly, only few genes displayed differential hypermethylation in epileptic tolerance. Nevertheless, gene ontology analysis emphasized the majority of differential methylation events between the groups occurred in genes associated with nuclear functions, such as DNA binding and transcriptional regulation. The present study reports select, genome-wide DNA methylation changes after status epilepticus and in epileptic tolerance, which may contribute to regulating the gene expression environment of the seizure-damaged hippocampus.
Li, Wanzhen; Wang, Yulong; Zhu, Jianyu; Wang, Zhangxun; Tang, Guiliang; Huang, Bo
2017-03-01
Conidia and mycelia are two important developmental stages in the asexual life cycle of entomopathogenic fungus Metarhizium. Despite the crucial role that DNA methylation plays in many biological processes, its role in regulation of gene expression and development in fungi is not yet fully understood. We performed genome-wide analysis of DNA methylation patterns of an M. robertsii strain with single base pair resolution. Specifically, we examined for changes in methylation patterns between the conidia and mycelia stages. The results showed that approximately 0.38 % of cytosines are methylated in conidia, which is lower than the DNA methylation level (0.42 %) in mycelia. We found that DNA methylation undergoes genome-wide reprogramming during fungal development in M. robertsii. 132 differentially methylated regions (DMRs), which were mostly distributed in gene regions, were identified. KEGG analysis revealed that the DMR-associated genes belong to metabolic pathways. Intriguingly, in contrast to most other eukaryotes, promoter activities in M. robertsii seemed differentially modulated by DNA methylation levels. We found that transcription tended to be enhanced in genes with moderate promoter methylation, while gene expression was decreased in genes with high or low promoter methylation. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Recognition of methylated DNA through methyl-CpG binding domain proteins
DEFF Research Database (Denmark)
Zou, Xueqing; Ma, Wen; Solov'yov, Ilia
2012-01-01
DNA methylation is a key regulatory control route in epigenetics, involving gene silencing and chromosome inactivation. It has been recognized that methyl-CpG binding domain (MBD) proteins play an important role in interpreting the genetic information encoded by methylated DNA (mDNA). Although...... the function of MBD proteins has attracted considerable attention and is well characterized, the mechanism underlying mDNA recognition by MBD proteins is still poorly understood. In this article, we demonstrate that the methyl-CpG dinucleotides are recognized at the MBD-mDNA interface by two MBD arginines...
Directory of Open Access Journals (Sweden)
Guillem Portella
Full Text Available Cytosine methylation is one of the most important epigenetic marks that regulate the process of gene expression. Here, we have examined the effect of epigenetic DNA methylation on nucleosomal stability using molecular dynamics simulations and elastic deformation models. We found that methylation of CpG steps destabilizes nucleosomes, especially when these are placed in sites where the DNA minor groove faces the histone core. The larger stiffness of methylated CpG steps is a crucial factor behind the decrease in nucleosome stability. Methylation changes the positioning and phasing of the nucleosomal DNA, altering the accessibility of DNA to regulatory proteins, and accordingly gene functionality. Our theoretical calculations highlight a simple physical-based explanation on the foundations of epigenetic signaling.
Histone H4 Lysine 20 methylation
DEFF Research Database (Denmark)
Jørgensen, Stine; Schotta, Gunnar; Sørensen, Claus Storgaard
2013-01-01
of histones have emerged as key regulators of genomic integrity. Intense research during the past few years has revealed histone H4 lysine 20 methylation (H4K20me) as critically important for the biological processes that ensure genome integrity, such as DNA damage repair, DNA replication and chromatin...... compaction. The distinct H4K20 methylation states are mediated by SET8/PR-Set7 that catalyses monomethylation of H4K20, whereas SUV4-20H1 and SUV4-20H2 enzymes mediate further H4K20 methylation to H4K20me2 and H4K20me3. Disruption of these H4K20-specific histone methyltransferases leads to genomic...
Flavonoids from Theobroma cacao down-regulate inflammatory mediators.
Ramiro, Emma; Franch, Angels; Castellote, Cristina; Pérez-Cano, Francisco; Permanyer, Joan; Izquierdo-Pulido, Maria; Castell, Margarida
2005-11-02
In the present study, we report the effects of a cocoa extract on the secretion and RNA expression of various proinflammatory mediators by macrophages. Monocyte chemoattractant protein 1 and tumor necrosis factor alpha (TNFalpha) were significantly and dose-dependently diminished by cocoa extract, and this effect was higher than that produced by equivalent concentrations of epicatechin but was lower than that produced by isoquercitrin. Interestingly, cocoa extract added prior to cell activation resulted in a significantly greater inhibition of TNFalpha secretion. Both cocoa extract and epicatechin decreased TNFalpha, interleukin (IL) 1alpha, and IL-6 mRNA expression, suggesting that their inhibitory effect on cytokine secretion is produced, in part, at the transcriptional level. Cocoa extract also significantly decreased NO secretion in a dose-dependent manner and with a greater effect than that produced by epicatechin. In conclusion, our study shows that cocoa flavonoids not only inhibit NO release from macrophages but also down-regulate inflammatory cytokines and chemokines.
The ATPases of cohesin interface with regulators to modulate cohesin-mediated DNA tethering
Çamdere, Gamze; Guacci, Vincent; Stricklin, Jeremiah; Koshland, Douglas
2015-01-01
Cohesin tethers together regions of DNA, thereby mediating higher order chromatin organization that is critical for sister chromatid cohesion, DNA repair and transcriptional regulation. Cohesin contains a heterodimeric ATP-binding Cassette (ABC) ATPase comprised of Smc1 and Smc3 ATPase active sites. These ATPases are required for cohesin to bind DNA. Cohesin’s DNA binding activity is also promoted by the Eco1 acetyltransferase and inhibited by Wpl1. Recently we showed that after cohesin stably binds DNA, a second step is required for DNA tethering. This second step is also controlled by Eco1 acetylation. Here, we use genetic and biochemical analyses to show that this second DNA tethering step is regulated by cohesin ATPase. Furthermore, our results also suggest that Eco1 promotes cohesion by modulating the ATPase cycle of DNA-bound cohesin in a state that is permissive for DNA tethering and refractory to Wpl1 inhibition. DOI: http://dx.doi.org/10.7554/eLife.11315.001 PMID:26583750
Whole-genome methylation caller designed for methyl- DNA ...
African Journals Online (AJOL)
etchie
2013-02-20
Feb 20, 2013 ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, Hidden ... its response to environmental cues. .... have a great potential to become the most cost-effective ... hg18 reference genome (set to 0 if not present in retrieved reads). ..... DNA methylation patterns and epigenetic memory.
Naghitorabi, Mojgan; Mir Mohammad Sadeghi, Hamid; Mohammadi Asl, Javad; Rabbani, Mohammad; Jafarian-Dehkordi, Abbas
2017-01-01
Promoter methylation is one of the main epigenetic mechanisms that leads to the inactivation of tumor suppressor genes during carcinogenesis. Due to the reversible nature of DNA methylation, many studies have been performed to correct theses epigenetic defects by inhibiting DNA methyltransferases (DNMTs). In this case novel therapeutics especially siRNA oligonucleotides have been used to specifically knock down the DNMTs at mRNA level. Also many studies have focused on transcriptional gene silencing in mammalian cells via siRNA mediated promoter methylation. The present study was designed to assess the role of siRNA mediated promoter methylation in DNMT3B knockdown and alteration of promoter methylation of Cadherin-1 (CDH1), Glutathione S-Transferase Pi 1(GSTP1), and DNMT3B genes in MDA-MB-453 cell line. MDA-MB-453 cells were transfected with siDNMT targeting DNMT3B promoter and harvested at 24 and 48 h post transfection to monitor gene silencing and promoter methylation respectively. DNMT3B expression was monitored by quantitative RT-PCR method. Promoter methylation was quantitatively evaluated using differential high resolution melting analysis. A non-significant 20% reduction in DNMT3B mRNA level was shown only after first transfection with siDNMT, which was not reproducible. Promoter methylation levels of DNMT3B, CDH1, and GSTP1 were detected at about 15%, 70% and 10% respectively, in the MDA-MB-453 cell line, with no significant change after transfection. Our results indicated that siDNMT sequence were not able to affect promoter methylation and silencing of DNMT3B in MDA-MB-453 cells. However, quantitation of methylation confirmed a hypermethylated phenotype at CDH1 and GSTP1 promoters as well as a differential methylation pattern at DNMT3B promoter in breast cancer.
Li, Siping; He, Feng; Wen, Haishen; Li, Jifang; Si, Yufeng; Liu, Mingyuan; He, Huiwen; Huang, Zhengju
2017-04-01
Increasingly arisen environmental constraints may contribute to heritable phenotypic variation including methylation changes, which can help the animals with development, growth and survival. In this study, we assessed the DNA methylation levels in three tissues (gonad, kidney and gill) of half smooth tongue sole under the salinity stress. The methylation-sensitive amplification polymorphism (MSAP) technique was applied to illustrate the regulation of epigenetic mechanism in environmental stimuli. Fish were subjected to 15 salinity treatment for 7 and 60 days, respectively. A total of 11259 fragments were amplified with 8 pairs of selective primers. The levels of methylated DNA in different tissues of females and males without salinity stress were analyzed, which were 32.76% and 47.32% in gonad; 38.13% and 37.69% in kidney; 37.58% and 34.96% in gill, respectively. In addition, the significant difference was observed in gonad between females and males, indicating that discrepant regulation in gonadal development and differentiation may involve sex-related genes. Further analysis showed that total and hemi-methylation were significantly decreased under 15 salinity for 7 days, probably resulting in up-regulating salt-tolerance genes expression to adjust salt changing. With the adjustment for 60 days, total and hemi-methylation prominently went back to its normal levels to obtain equilibrium. Particularly, full methylation levels were steady along with salinity stress to maintain the stability of gene expression. Additionally, the data showed that gonads in females and gills in males were superior in adaptability. As a result, DNA methylation regulates tissue- specific epiloci, and may respond to salinity stress by regulating gene expression to maintain animal survival and activity.
Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.
Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai
2017-02-16
DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.
Energy Technology Data Exchange (ETDEWEB)
Ou Xiufang [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China); Long Likun [Inspection and Quarantine Technology Centre of Zhongshan Entry-Exit Inspection and Quarantine Bureau, Zhongshan 528400, Guangdong Province (China); Zhang Yunhong; Xue Yiqun; Liu Jingchun; Lin Xiuyun [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China); Liu Bao [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China)], E-mail: baoliu6677@yahoo.com.cn
2009-03-09
Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety
International Nuclear Information System (INIS)
Ou Xiufang; Long Likun; Zhang Yunhong; Xue Yiqun; Liu Jingchun; Lin Xiuyun; Liu Bao
2009-01-01
Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety
Genome-Wide Analysis of DNA Methylation During Ovule Development of Female-Sterile Rice fsv1
Directory of Open Access Journals (Sweden)
Helian Liu
2017-11-01
Full Text Available The regulation of female fertility is an important field of rice sexual reproduction research. DNA methylation is an essential epigenetic modification that dynamically regulates gene expression during development processes. However, few reports have described the methylation profiles of female-sterile rice during ovule development. In this study, ovules were continuously acquired from the beginning of megaspore mother cell meiosis until the mature female gametophyte formation period, and global DNA methylation patterns were compared in the ovules of a high-frequency female-sterile line (fsv1 and a wild-type rice line (Gui99 using whole-genome bisulfite sequencing (WGBS. Profiling of the global DNA methylation revealed hypo-methylation, and 3471 significantly differentially methylated regions (DMRs were observed in fsv1 ovules compared with Gui99. Based on functional annotation and Kyoto encyclopedia of genes and genomes (KEGG pathway analysis of differentially methylated genes (DMGs, we observed more DMGs enriched in cellular component, reproduction regulation, metabolic pathway, and other pathways. In particular, many ovule development genes and plant hormone-related genes showed significantly different methylation patterns in the two rice lines, and these differences may provide important clues for revealing the mechanism of female gametophyte abortion.
Directory of Open Access Journals (Sweden)
Uppala Radhakrishna
Full Text Available Congenital heart defect (CHD is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS, with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated. Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.
Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O
2016-01-01
Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.
Neuronal DNA Methyltransferases: Epigenetic Mediators between Synaptic Activity and Gene Expression?
Bayraktar, Gonca; Kreutz, Michael R
2018-04-01
DNMT3A and 3B are the main de novo DNA methyltransferases (DNMTs) in the brain that introduce new methylation marks to non-methylated DNA in postmitotic neurons. DNA methylation is a key epigenetic mark that is known to regulate important cellular processes in neuronal development and brain plasticity. Accumulating evidence disclosed rapid and dynamic changes in DNA methylation of plasticity-relevant genes that are important for learning and memory formation. To understand how DNMTs contribute to brain function and how they are regulated by neuronal activity is a prerequisite for a deeper appreciation of activity-dependent gene expression in health and disease. This review discusses the functional role of de novo methyltransferases and in particular DNMT3A1 in the adult brain with special emphasis on synaptic plasticity, memory formation, and brain disorders.
miRNAting control of DNA methylation
Indian Academy of Sciences (India)
DNA methylation is a type of epigenetic modification where a methyl group is added to the cytosine or adenine residue of a given DNA sequence. It has been observed that DNA methylation is achieved by some collaborative agglomeration of certain proteins and non-coding RNAs. The assembly of IDN2 and its ...
[Novel Approaches in DNA Methylation Studies - MS-HRM Analysis and Electrochemistry].
Bartošík, M; Ondroušková, E
Cytosine methylation in DNA is an epigenetic mechanism regulating gene expression and plays a vital role in cell differentiation or proliferation. Tumor cells often exhibit aberrant DNA methylation, e.g. hypermethylation of tumor suppressor gene promoters. New methods, capable of determining methylation status of specific DNA sequences, are thus being developed. Among them, MS-HRM (methylation-specific high resolution melting) and electrochemistry offer relatively inexpensive instrumentation, fast assay times and possibility of screening multiple samples/DNA regions simultaneously. MS-HRM is due to its sensitivity and simplicity an interesting alternative to already established techniques, including methylation-specific PCR or bisulfite sequencing. Electrochemistry, when combined with suitable electroactive labels and electrode surfaces, has been applied in several unique strategies for discrimination of cytosines and methylcytosines. Both techniques were successfully tested in analysis of DNA methylation within promoters of important tumor suppressor genes and could thus help in achieving more precise diagnostics and prognostics of cancer. Aberrant methylation of promoters has already been described in hundreds of genes associated with tumorigenesis and could serve as important biomarker if new methods applicable into clinical practice are sufficiently advanced.Key words: DNA methylation - 5-methylcytosine - HRM analysis - melting temperature - DNA duplex - electrochemistry - nucleic acid hybridizationThis work was supported by MEYS - NPS I - LO1413.The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study.The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 6. 5. 2016Accepted: 16. 5. 2016.
International Nuclear Information System (INIS)
Yokoyama, Seiya; Yonezawa, Suguru; Kitamoto, Sho; Yamada, Norishige; Houjou, Izumi; Sugai, Tamotsu; Nakamura, Shin-ichi; Arisaka, Yoshifumi; Takaori, Kyoichi; Higashi, Michiyo
2012-01-01
Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis) using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE). The MSE method is comprised of the following steps: (a) bisulfite treatment of genomic DNA, (b) amplification of the target DNA by a nested PCR approach and (c) applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is < 0.1% and the detectable minimum amount of DNA is 20 pg, which can be obtained from only a few cells. We also show that MSE can be used for analysis of challenging samples such as human isolated colonic crypts or human pancreatic juices, from which only a small amount of DNA can be extracted. The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical
Drury, Jeanie L; Chung, Whasun Oh
2015-03-01
Epigenetic modifications are changes in gene expression without altering DNA sequence. We previously reported that bacteria-specific innate immune responses are regulated by epigenetic modifications. Our hypothesis is that DNA methylation affects gingival cytokine secretion in response to bacterial stimulation. Gingival epithelial cells (GECs) were treated with DNMT-1 inhibitors prior to Porphyromonas gingivalis (Pg) or Fusobacterium nucleatum (Fn) exposure. Protein secretion was assessed using ELISA. Gene expression was quantified using qRT-PCR. The ability of bacteria to invade inhibitor pretreated GECs was assessed utilizing flow cytometry. Changes were compared to unstimulated GECs. GEC upregulation of IL-6 and CXCL1 by Pg or Fn stimulation was significantly diminished by inhibitor pretreatment. Pg stimulated IL-1α secretion and inhibitor pretreatment significantly enhanced this upregulation, while Fn alone or with inhibitor pretreatment had no effect on IL-1α expression. GEC upregulation of human beta-definsin-2 in response to Pg and Fn exposure was enhanced following the inhibitor pretreatment. GEC susceptibility to bacterial invasion was unaltered. These results suggest that DNA methylation differentially affects gingival cytokine secretion in response to Pg or Fn. Our data provide basis for better understanding of how epigenetic modifications, brought on by exposure to oral bacteria, will subsequently affect host susceptibility to oral diseases. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Thivat, Emilie; Durando, Xavier; Demidem, Aïcha; Farges, Marie-Chantal; Rapp, Maryse; Cellarier, Eric; Guenin, Samuel; D'Incan, Michel; Vasson, Marie-Paule; Chollet, Philippe
2007-01-01
Methionine (MET) depletion used in association with chemotherapy improves the therapeutic index in animal models. This potentiating effect may be due to tumor cell sensitization to chloroethylnitrosoureas through their MET dependency and the down-regulation of O6- methylguanine-DNA methyltransferase (MGMT). Our purpose was to evaluate the impact of the association of a dietary MET restriction with nitrosourea treatment on MGMT activity in peripheral blood mononuclear cells (PBMCs). Six patients with metastatic cancer (melanoma and glioma) received 4 cycles of a MET-free diet with cystemustine (60 mg/m2). MGMT activity in PBMCs decreased by an average of 13% from 553+/-90 fnol/mg before the diet to 413+/-59 fmol/mg after the diet + chemotherapy period (p=0.029). The decrease of MGMT activity was not affected by the duration of the MET-free diet period but seems to be correlated to the plasma MET depletion induced by the MET-free diet.
Nwaobi, Sinifunanya E; Olsen, Michelle L
2015-09-26
DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.
Aberrant DNA methylation associated with Alzheimer's disease in the superior temporal gyrus.
Gao, Zhan; Fu, Hong-Juan; Zhao, Li-Bo; Sun, Zhuo-Yan; Yang, Yu-Fei; Zhu, Hong-Yan
2018-01-01
Abnormal DNA methylation patterns have been demonstrated to be associated with the pathogenesis of Alzheimer's disease (AD). The present study aimed to identify differential methylation in the superior temporal gyrus (STG) of patients with late-onset AD based on epigenome-wide DNA methylation data by bioinformatics analysis. The genome-wide DNA methylation data in the STG region of 34 patients with late-onset AD and 34 controls without dementia were recruited from the Gene Expression Omnibus database. Through systemic quality control, differentially methylated CpG sites were determined by the Student's t-test and mean methylation value differences between the two conditions. Hierarchical clustering analysis was applied to assess the classification performance of differentially methylated CpGs. Functional analysis was performed to investigate the biological functions of the genes associated with differentially methylated CpGs. A total of 17,895 differentially methylated CpG sites were initially identified, including 11,822 hypermethylated CpGs and 6,073 hypomethylated CpGs. Further analysis examined 2,211 differentially methylated CpGs (covering 1,991 genes). AD subjects demonstrated distinctive DNA methylation patterns when compared with the controls, with a classification accuracy value of 1. Hypermethylation was mainly detected for genes regulating the cell cycle progression, whereas hypomethylation was observed in genes involved in transcription factor binding. The present study demonstrated widespread and distinctive DNA methylation alterations in late-onset AD. Identification of AD-associated epigenetic biomarkers may allow for the development of novel diagnostic and therapeutic targets.
Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T
2017-06-01
As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
Energy Technology Data Exchange (ETDEWEB)
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)
2016-05-27
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
International Nuclear Information System (INIS)
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen
2016-01-01
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
DNA Methylation Biomarkers: Cancer and Beyond
Directory of Open Access Journals (Sweden)
Thomas Mikeska
2014-09-01
Full Text Available Biomarkers are naturally-occurring characteristics by which a particular pathological process or disease can be identified or monitored. They can reflect past environmental exposures, predict disease onset or course, or determine a patient’s response to therapy. Epigenetic changes are such characteristics, with most epigenetic biomarkers discovered to date based on the epigenetic mark of DNA methylation. Many tissue types are suitable for the discovery of DNA methylation biomarkers including cell-based samples such as blood and tumor material and cell-free DNA samples such as plasma. DNA methylation biomarkers with diagnostic, prognostic and predictive power are already in clinical trials or in a clinical setting for cancer. Outside cancer, strong evidence that complex disease originates in early life is opening up exciting new avenues for the detection of DNA methylation biomarkers for adverse early life environment and for estimation of future disease risk. However, there are a number of limitations to overcome before such biomarkers reach the clinic. Nevertheless, DNA methylation biomarkers have great potential to contribute to personalized medicine throughout life. We review the current state of play for DNA methylation biomarkers, discuss the barriers that must be crossed on the way to implementation in a clinical setting, and predict their future use for human disease.
Directory of Open Access Journals (Sweden)
Xiaodong Pan
Full Text Available Transforming growth factor-beta (TGF-β, a key mediator of cardiac fibroblast activation, has a major influence on collagen type I production. However, the epigenetic mechanisms by which TGF-β induces collagen type I alpha 1 (COL1A1 expression are not fully understood. This study was designed to examine whether or not DNA methylation is involved in TGF-β-induced COL1A1 expression in cardiac fibroblasts. Cells isolated from neonatal Sprague-Dawley rats were cultured and stimulated with TGF-β1. The mRNA levels of COL1A1 and DNA methyltransferases (DNMTs were determined via quantitative polymerase chain reaction and the protein levels of collagen type I were determined via Western blot as well as enzyme-linked immunosorbent assay. The quantitative methylation of the COL1A1 promoter region was analyzed using the MassARRAY platform of Sequenom. Results showed that TGF-β1 upregulated the mRNA expression of COL1A1 and induced the synthesis of cell-associated and secreted collagen type I in cardiac fibroblasts. DNMT1 and DNMT3a expressions were significantly downregulated and the global DNMT activity was inhibited when treated with 10 ng/mL of TGF-β1 for 48 h. TGF-β1 treatment resulted in a significant reduction of the DNA methylation percentage across multiple CpG sites in the rat COL1A1 promoter. Thus, TGF-β1 can induce collagen type I expression through the inhibition of DNMT1 and DNMT3a expressions as well as global DNMT activity, thereby resulting in DNA demethylation of the COL1A1 promoter. These findings suggested that the DNMT-mediated DNA methylation is an important mechanism in regulating the TGF-β1-induced COL1A1 gene expression.
Reduced DNA methylation of FKBP5 in Cushing's syndrome.
Resmini, Eugenia; Santos, Alicia; Aulinas, Anna; Webb, Susan M; Vives-Gilabert, Yolanda; Cox, Olivia; Wand, Gary; Lee, Richard S
2016-12-01
FKBP5 encodes a co-chaperone of HSP90 protein that regulates intracellular glucocorticoid receptor sensitivity. When it is bound to the glucocorticoid receptor complex, cortisol binds with lower affinity to glucocorticoid receptor. Cushing's syndrome is associated with memory deficits, smaller hippocampal volumes, and wide range of cognitive impairments. We aimed at evaluating blood DNA methylation of FKBP5 and its relationship with memory and hippocampal volumes in Cushing's syndrome patients. Polymorphism rs1360780 in FKBP5 has also been assessed to determine whether genetic variations can also govern CpG methylation. Thirty-two Cushing's syndrome patients and 32 matched controls underwent memory tests, 3-Tesla MRI of the brain, and DNA extraction from total leukocytes. DNA samples were bisulfite treated, PCR amplified, and pyrosequenced to assess a total of 41CpG-dinucleotides in the introns 1, 2, 5, and 7 of FKBP5. Significantly lower intronic FKBP5 DNA methylation in CS patients compared to controls was observed in ten CpG-dinucleotides. DNA methylation at these CpGs correlated with left and right HV (Intron-2-Region-2-CpG-3: LHV, r = 0.73, p = 0.02; RHV, r = 0.58, p = 0.03). Cured and active CS patients showed both lower methylation of intron 2 (92.37, 91.8, and 93.34 %, respectively, p = 0.03 for both) and of intron 7 (77.08, 73.74, and 79.71 %, respectively, p = 0.02 and p < 0.01) than controls. Twenty-two subjects had the CC genotype, 34 had the TC genotype, and eight had the TT genotype. Lower average DNA methylation in intron 7 was observed in the TT subjects compared to CC (72.5vs. 79.5 %, p = 0.02) and to TC (72.5 vs. 79.0 %, p = 0.03). Our data demonstrate, for the first time, a reduction of intronic DNA methylation of FKBP5 in CS patients.
Energy Technology Data Exchange (ETDEWEB)
Ohashi, Koji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Munetsuna, Eiji [Department of Biochemistry, Fujita Health University School of Medicine, Toyoake (Japan); Yamada, Hiroya, E-mail: hyamada@fujita-hu.ac.jp [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan); Ando, Yoshitaka [Department of Joint Research Laboratory of Clinical Medicine, Fujita Health University Hospital, Toyoake (Japan); Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Suzuki, Koji [Department of Public Health, Fujita Health University School of Health Sciences, Toyoake (Japan); Teradaira, Ryoji [Department of Clinical Biochemistry, Fujita Health University School of Health Sciences, Toyoake (Japan); Hashimoto, Shuji [Department of Hygiene, Fujita Health University School of Medicine, Toyoake (Japan)
2015-12-04
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
International Nuclear Information System (INIS)
Ohashi, Koji; Munetsuna, Eiji; Yamada, Hiroya; Ando, Yoshitaka; Yamazaki, Mirai; Taromaru, Nao; Nagura, Ayuri; Ishikawa, Hiroaki; Suzuki, Koji; Teradaira, Ryoji; Hashimoto, Shuji
2015-01-01
DNA methylation status is affected by environmental factors, including nutrition. Fructose consumption is considered a risk factor for the conditions that make up metabolic syndrome such as dyslipidemia. However, the pathogenetic mechanism by which fructose consumption leads to metabolic syndrome is unclear. Based on observations that epigenetic modifications are closely related to induction of metabolic syndrome, we hypothesized that fructose-induced metabolic syndrome is caused by epigenetic alterations. Male SD rats were designated to receive water or 20% fructose solution for 14 weeks. mRNA levels for peroxisome proliferator-activated receptor alpha (PPARα) and carnitine palmitoyltransferase 1A (CPT1A) was analyzed using Real-time PCR. Restriction digestion and real-time PCR (qAMP) was used for the analysis of DNA methylation status. Hepatic lipid accumulation was also observed by fructose intake. Fructose feeding also significantly decreased mRNA levels for PPARα and CPT1A. qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status, and pathogenesis of metabolic syndrome induced by fructose relates to DNA methylation status. - Highlights: • No general consensus has been reached regarding the molecular mechanisms of the pathogenesis of fructose-induced diseases. • Significant increase in hepatic total methylation level was observed after fructose-supplemented feeding. • Fructose feeding significantly decreased mRNA levels for PPARα and CPT1A. • qAMP analysis demonstrated the hypermethylation of promoter regions of PPARα and CTP1A genes. • Fructose-mediated attenuated gene expression may be mediated by alterations of DNA methylation status in rat liver.
Canovas, Sebastian; Ross, Pablo J; Kelsey, Gavin; Coy, Pilar
2017-11-01
DNA methylation can be considered a component of epigenetic memory with a critical role during embryo development, and which undergoes dramatic reprogramming after fertilization. Though it has been a focus of research for many years, the reprogramming mechanism is still not fully understood. Recent results suggest that absence of maintenance at DNA replication is a major factor, and that there is an unexpected role for TET3-mediated oxidation of 5mC to 5hmC in guarding against de novo methylation. Base-resolution and genome-wide profiling methods are enabling more comprehensive assessments of the extent to which ART might impair DNA methylation reprogramming, and which sequence elements are most vulnerable. Indeed, as we also review here, studies showing the effect of culture media, ovarian stimulation or embryo transfer on the methylation pattern of embryos emphasize the need to face ART-associated defects and search for strategies to mitigate adverse effects on the health of ART-derived children. © 2017 WILEY Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Maral Tajerian
Full Text Available Changes in brain structure and cortical function are associated with many chronic pain conditions including low back pain and fibromyalgia. The magnitude of these changes correlates with the duration and/or the intensity of chronic pain. Most studies report changes in common areas involved in pain modulation, including the prefrontal cortex (PFC, and pain-related pathological changes in the PFC can be reversed with effective treatment. While the mechanisms underlying these changes are unknown, they must be dynamically regulated. Epigenetic modulation of gene expression in response to experience and environment is reversible and dynamic. Epigenetic modulation by DNA methylation is associated with abnormal behavior and pathological gene expression in the central nervous system. DNA methylation might also be involved in mediating the pathologies associated with chronic pain in the brain. We therefore tested a whether alterations in DNA methylation are found in the brain long after chronic neuropathic pain is induced in the periphery using the spared nerve injury modal and b whether these injury-associated changes are reversible by interventions that reverse the pathologies associated with chronic pain. Six months following peripheral nerve injury, abnormal sensory thresholds and increased anxiety were accompanied by decreased global methylation in the PFC and the amygdala but not in the visual cortex or the thalamus. Environmental enrichment attenuated nerve injury-induced hypersensitivity and reversed the changes in global PFC methylation. Furthermore, global PFC methylation correlated with mechanical and thermal sensitivity in neuropathic mice. In summary, induction of chronic pain by peripheral nerve injury is associated with epigenetic changes in the brain. These changes are detected long after the original injury, at a long distance from the site of injury and are reversible with environmental manipulation. Changes in brain structure and
International Nuclear Information System (INIS)
Malpeli, Giorgio; Amato, Eliana; Dandrea, Mario; Fumagalli, Caterina; Debattisti, Valentina; Boninsegna, Letizia; Pelosi, Giuseppe; Falconi, Massimo; Scarpa, Aldo
2011-01-01
RASSF1A gene silencing by DNA methylation has been suggested as a major event in pancreatic endocrine tumor (PET) but RASSF1A expression has never been studied. The RASSF1 locus contains two CpG islands (A and C) and generates seven transcripts (RASSF1A-RASSF1G) by differential promoter usage and alternative splicing. We studied 20 primary PETs, their matched normal pancreas and three PET cell lines for the (i) methylation status of the RASSF1 CpG islands using methylation-specific PCR and pyrosequencing and (ii) expression of RASSF1 isoforms by quantitative RT-PCR in 13 cases. CpG island A methylation was evaluated by methylation-specific PCR (MSP) and by quantitative methylation-specific PCR (qMSP); pyrosequencing was applied to quantify the methylation of 51 CpGs also encompassing those explored by MSP and qMSP approaches. MSP detected methylation in 16/20 (80%) PETs and 13/20 (65%) normal pancreas. At qMSP, 11/20 PETs (55%) and 9/20 (45%) normals were methylated in at least 20% of RASSF1A alleles. Pyrosequencing showed variable distribution and levels of methylation within and among samples, with PETs having average methylation higher than normals in 15/20 (75%) cases (P = 0.01). The evaluation of mRNA expression of RASSF1 variants showed that: i) RASSF1A was always expressed in PET and normal tissues, but it was, on average, expressed 6.8 times less in PET (P = 0.003); ii) RASSF1A methylation inversely correlated with its expression; iii) RASSF1 isoforms were rarely found, except for RASSF1B that was always expressed and RASSF1C whose expression was 11.4 times higher in PET than in normal tissue (P = 0.001). A correlation between RASSF1A expression and gene methylation was found in two of the three PET cell lines, which also showed a significant increase in RASSF1A expression upon demethylating treatment. RASSF1A gene methylation in PET is higher than normal pancreas in no more than 75% of cases and as such it cannot be considered a marker for this neoplasm
Keil, Kimberly P; Vezina, Chad M
2015-01-01
Prostate development, benign hyperplasia and cancer involve androgen and growth factor signaling as well as stromal-epithelial interactions. We review how DNA methylation influences these and related processes in other organ systems such as how proliferation is restricted to specific cell populations during defined temporal windows, how androgens elicit their actions and how cells establish, maintain and remodel DNA methylation in a time and cell specific fashion. We also discuss mechanisms by which hormones and endocrine disrupting chemicals reprogram DNA methylation in the prostate and elsewhere and examine evidence for a reawakening of developmental epigenetic pathways as drivers of prostate cancer and benign prostate hyperplasia.
Genome-Wide DNA Methylation Profiles of Phlegm-Dampness Constitution
Directory of Open Access Journals (Sweden)
Haiqiang Yao
2018-03-01
Full Text Available Background/Aims: Metabolic diseases are leading health concerns in today’s global society. In traditional Chinese medicine (TCM, one body type studied is the phlegm-dampness constitution (PC, which predisposes individuals to complex metabolic disorders. Genomic studies have revealed the potential metabolic disorders and the molecular features of PC. The role of epigenetics in the regulation of PC, however, is unknown. Methods: We analyzed a genome-wide DNA methylation in 12 volunteers using Illumina Infinium Human Methylation450 BeadChip on peripheral blood mononuclear cells (PBMCs. Eight volunteers had PC and 4 had balanced constitutions. Results: Methylation data indicated a genome-scale hyper-methylation pattern in PC. We located 288 differentially methylated probes (DMPs. A total of 256 genes were mapped, and some of these were metabolic-related. SQSTM1, DLGAP2 and DAB1 indicated diabetes mellitus; HOXC4 and SMPD3, obesity; and GRWD1 and ATP10A, insulin resistance. According to Ingenuity Pathway Analysis (IPA, differentially methylated genes were abundant in multiple metabolic pathways. Conclusion: Our results suggest the potential risk for metabolic disorders in individuals with PC. We also explain the clinical characteristics of PC with DNA methylation features.
Giri, Anil K; Bharadwaj, Soham; Banerjee, Priyanka; Chakraborty, Shraddha; Parekatt, Vaisak; Rajashekar, Donaka; Tomar, Abhishek; Ravindran, Aarthi; Basu, Analabha; Tandon, Nikhil; Bharadwaj, Dwaipayan
2017-06-01
Phenotypic characteristics are known to vary substantially among different ethnicities around the globe. These variations are mediated by number of stochastic events and cannot be attributed to genetic architecture alone. DNA methylation is a well-established mechanism that sculpts our epigenome influencing phenotypic variation including disease manifestation. Since DNA methylation is an important determinant for health issues of a population, it demands a thorough investigation of the natural differences in genome wide DNA methylation patterns across different ethnic groups. This study is based on comparative analyses of methylome from five different ethnicities with major focus on Indian subjects. The current study uses hierarchical clustering approaches, principal component analysis and locus specific differential methylation analysis on Illumina 450K methylation data to compare methylome of different ethnic subjects. Our data indicates that the variations in DNA methylation patterns of Indians are less among themselves compared to other global population. It empirically correlated with dietary, cultural and demographical divergences across different ethnic groups. Our work further suggests that Indians included in this study, despite their genetic similarity with the Caucasian population, are in close proximity with Japanese in terms of their methylation signatures.
Extensive genetic and DNA methylation variation contribute to heterosis in triploid loquat hybrids.
Liu, Chao; Wang, Mingbo; Wang, Lingli; Guo, Qigao; Liang, Guolu
2018-04-24
We aim to overcome the unclear origin of the loquat and elucidate the heterosis mechanism of the triploid loquat. Here we investigated the genetic and epigenetic variations between the triploid plant and its parental lines using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified fragment length polymorphism (MSAP) analyses. We show that in addition to genetic variations, extensive DNA methylation variation occurred during the formation process of triploid loquat, with the triploid hybrid having increased DNA methylation compared to the parents. Furthermore, a correlation existed between genetic variation and DNA methylation remodeling, suggesting that genome instability may lead to DNA methylation variation or vice versa. Sequence analysis of the MSAP bands revealed that over 53% of them overlap with protein-coding genes, which may indicate a functional role of the differential DNA methylation in gene regulation and hence heterosis phenotypes. Consistent with this, the genetic and epigenetic alterations were associated closely to the heterosis phenotypes of triploid loquat, and this association varied for different traits. Our results suggested that the formation of triploid is accompanied by extensive genetic and DNA methylation variation, and these changes contribute to the heterosis phenotypes of the triploid loquats from the two cross lines.
Directory of Open Access Journals (Sweden)
Patel Osman V
2009-03-01
Full Text Available Abstract Background Bovine trophoblast binucleate cells (BNC express a plethora of molecules including bovine placental lactogen (bPL, gene name is bCSH1 and bovine prolactin-related protein-1 (bPRP1. BCSH1 and bPRP1 are members of the growth hormone (GH/prolactin (PRL gene family, which are expressed simultaneously in BNC and are central to placentation and the progression of pregnancy in cattle. However, there is a paucity of information on the transcriptional regulatory mechanisms of both the bCSH1 and bPRP1 genes. Recent studies, however, have demonstrated that the expression of a number of genes is controlled by the methylation status of their promoter region. In the present study, we examined the cell-type-specific epigenetic alterations of the 5'-flanking region of the bCSH1 and bPRP1 genes to gain an insight into their regulatory mechanisms. Results Analysis of 5-aza-2'-deoxycytidine treatment demonstrated that bCSH1 expression is moderately induced in fibroblast cultures but enhanced in BT-1 cells. Sodium bisulfite based sequencing revealed that bCSH1 is hypomethylated in the cotyledonary tissue but not in the fetal skin, and this pattern was not altered with the progression of pregnancy. On the other hand, the methylation status of bPRP1 was similar between the cotyledon and fetal skin. The bPRP1 gene was exclusively hypermethylated in a bovine trophoblast cell-derived BT-1 cell-line. While the activity of bCSH1 was similar in both BT-1 and bovine fibroblast cells, that of bPRP1 was specific to BT-1. Treatment with a demethylating agent and luciferase assays provided in vitro evidence of the positive regulation of bCSH1 but not bPRP1. Conclusion This is the first report to identify the differential regulatory mechanisms of the bCSH1 and bPRP1 genes and indicates that bCSH1 might potentially be the only transcript that is subject to DNA methyltransferase regulation. The data indicates the possibility of novel kinetics of induction of
Directory of Open Access Journals (Sweden)
Małgorzata Pokrywka
2014-11-01
Full Text Available The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes, have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described.
Peng, Chong; Sui, Zhenghong; Zhou, Wei; Hu, Yiyi; Mi, Ping; Jiang, Minjie; Li, Xiaodong; Ruan, Xudong
2018-06-01
Gracilariopsis lemaneiformis is an economically important agarophyte, which contains high quality gel and shows a high growth rate. Wild population of G. lemaneiformis displayed resident divergence, though with a low genetic diversity as was revealed by amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR) analyses. In addition, different strains of G. lemaneiformis are diverse in morphology. The highly inconsistence between genetic background and physiological characteristics recommends strongly to the regulation at epigenetic level. In this study, the DNA methylation change in G. lemaneiformis among different generation branches and under different temperature stresses was assessed using methylation sensitive amplified polymorphism (MSAP) technique. It was shown that DNA methylation level among different generation branches was diverse. The full and total methylated DNA level was the lowest in the second generation branch and the highest in the third generation. The total methylation level was 61.11%, 60.88% and 64.12% at 15°C, 22°C and 26°C, respectively. Compared with the control group (22°C), the fully methylated and totally methylated ratios were increased in both experiment groups (15°C and 26°C). All of the cytosine methylation/demethylation transform (CMDT) was further analyzed. High temperature treatment could induce more CMDT than low temperature treatment did.
DNA methylation in states of cell physiology and pathology.
Directory of Open Access Journals (Sweden)
Lech Chyczewski
2007-10-01
Full Text Available DNA methylation is one of epigenetic mechanisms regulating gene expression. The methylation pattern is determined during embryogenesis and passed over to differentiating cells and tissues. In a normal cell, a significant degree of methylation is characteristic for extragenic DNA (cytosine within the CG dinucleotide while CpG islands located in gene promoters are unmethylated, except for inactive genes of the X chromosome and the genes subjected to genomic imprinting. The changes in the methylation pattern, which may appear as the organism age and in early stages of cancerogenesis, may lead to the silencing of over ninety endogenic genes. It has been found, that these disorders consist not only of the methylation of CpG islands, which are normally unmethylated, but also of the methylation of other dinucleotides, e.g. CpA. Such methylation has been observed in non-small cell lung cancer, in three regions of the exon 5 of the p53 gene (so-called "non-CpG" methylation. The knowledge of a normal methylation process and its aberrations appeared to be useful while searching for new markers enabling an early detection of cancer. With the application of the Real-Time PCR technique (using primers for methylated and unmethylated sequences five new genes which are potential biomarkers of lung cancer have been presented.
Directory of Open Access Journals (Sweden)
Chris R Smith
Full Text Available BACKGROUND: DNA methylation is a common regulator of gene expression, including acting as a regulator of developmental events and behavioral changes in adults. Using the unique system of genetic caste determination in Pogonomyrmex barbatus, we were able to document changes in DNA methylation during development, and also across both ancient and contemporary hybridization events. METHODOLOGY/PRINCIPAL FINDINGS: Sodium bisulfite sequencing demonstrated in vivo methylation of symmetric CG dinucleotides in P. barbatus. We also found methylation of non-CpG sequences. This validated two bioinformatics methods for predicting gene methylation, the bias in observed to expected ratio of CpG dinucleotides and the density of CpG/TpG single nucleotide polymorphisms (SNP. Frequencies of genomic DNA methylation were determined for different developmental stages and castes using ms-AFLP assays. The genetic caste determination system (GCD is probably the product of an ancestral hybridization event between P. barbatus and P. rugosus. Two lineages obligately co-occur within a GCD population, and queens are derived from intra-lineage matings whereas workers are produced from inter-lineage matings. Relative DNA methylation levels of queens and workers from GCD lineages (contemporary hybrids were not significantly different until adulthood. Virgin queens had significantly higher relative levels of DNA methylation compared to workers. Worker DNA methylation did not vary among developmental stages within each lineage, but was significantly different between the currently hybridizing lineages. Finally, workers of the two genetic caste determination lineages had half as many methylated cytosines as workers from the putative parental species, which have environmental caste determination. CONCLUSIONS/SIGNIFICANCE: These results suggest that DNA methylation may be a conserved regulatory mechanism moderating division of labor in both bees and ants. Current and historic
Directory of Open Access Journals (Sweden)
Stephen L. McDaniel
2017-06-01
Full Text Available Set2-mediated histone methylation at H3K36 regulates diverse activities, including DNA repair, mRNA splicing, and suppression of inappropriate (cryptic transcription. Although failure of Set2 to suppress cryptic transcription has been linked to decreased lifespan, the extent to which cryptic transcription influences other cellular functions is poorly understood. Here, we uncover a role for H3K36 methylation in the regulation of the nutrient stress response pathway. We found that the transcriptional response to nutrient stress was dysregulated in SET2-deleted (set2Δ cells and was correlated with genome-wide bi-directional cryptic transcription that originated from within gene bodies. Antisense transcripts arising from these cryptic events extended into the promoters of the genes from which they arose and were associated with decreased sense transcription under nutrient stress conditions. These results suggest that Set2-enforced transcriptional fidelity is critical to the proper regulation of inducible and highly regulated transcription programs.
Directory of Open Access Journals (Sweden)
Shoichiro Asayama
2015-08-01
Full Text Available Methylated poly(l-histidine (PLH-Me, our original polypeptide, has controlled the contents of dimethylimidazolium, τ/π-methylimidazole and imidazole groups for efficient gene delivery. The screening for the PLH-Me as DNA carrier has been carried out by use of the PLH with 25 mol% (τ-methyl, 16 mol%; π-methyl, 17 mol%; deprotonated imidazole, 41 mol%, 68 mol% (τ-methyl, 16 mol%; π-methyl, 8 mol%; deprotonated imidazole, 8 mol% and 87 mol% (τ-methyl, 7 mol%; π-methyl, 4 mol%; deprotonated imidazole, 2 mol% dimethylimidazolium groups, that is, PLH-Me(25, PLH-Me(68 and PLH-Me(87, respectively. The screening of the chemical structure of PLH-Me has been carried out for DNA carrier properties, which are the stability of its DNA polyion complexes and gene expression. The DNA complexes with the 25 mol% and 68 mol% dimethylated PLH-Me possessed almost same ability to retain DNA, as compared with the 87 mol% dimethylated PLH-Me, which was examined by competitive exchange with dextran sulfate. From the gene transfection experiment against HepG2 cells, human hepatoma cell line, the PLH-Me(25/DNA complex was revealed to mediate highest gene expression. These results suggest that the dimethyl-imidazolium/methylimidazole/imidazole balance of the PLH-Me is important for DNA carrier design.
Androgen receptor function links human sexual dimorphism to DNA methylation.
Directory of Open Access Journals (Sweden)
Ole Ammerpohl
Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.
Zhou, Zhen; Zhang, Hong-Sheng; Liu, Yang; Zhang, Zhong-Guo; Du, Guang-Yuan; Li, Hu; Yu, Xiao-Ying; Huang, Ying-Hui
2018-02-01
Epigenetic modifications such as histone modifications and cytosine hydroxymethylation are linked to tumorigenesis. Loss of 5-hydroxymethylcytosine (5 hmC) by ten-eleven translocation 1 (TET1) down-regulation facilitates tumor initiation and development. However, the mechanisms by which loss of TET1 knockdown promotes malignancy development remains unclear. Here, we report that TET1 knockdown induced epithelial-mesenchymal transition (EMT) and increased cancer cell growth, migration, and invasion in DLD1 cells. Loss of TET1 increased EZH2 expression and reduced UTX-1 expression, thus increasing histone H3K27 tri-methylation causing repression of the target gene E-cadherin. Ectopic expression of the H3K27 demethylase UTX-1 or EZH2 depletion both impeded EZH2 binding caused a loss of H3K27 methylation at epithelial gene E-cadherin promoter, thereby suppressing EMT and tumor invasion in shTET1 cells. Conversely, UTX-1 depletion and ectopic expression of EZH2 enhanced EMT and tumor metastasis in DLD1 cells. These findings provide insight into the regulation of TET1 and E-cadherin and identify EZH2 as a critical mediator of E-cadherin repression and tumor progression. © 2017 Wiley Periodicals, Inc.
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
DNA methylation modifications associated with chronic fatigue syndrome.
Directory of Open Access Journals (Sweden)
Wilfred C de Vega
Full Text Available Chronic Fatigue Syndrome (CFS, also known as myalgic encephalomyelitis, is a complex multifactorial disease that is characterized by the persistent presence of fatigue and other particular symptoms for a minimum of 6 months. Symptoms fail to dissipate after sufficient rest and have major effects on the daily functioning of CFS sufferers. CFS is a multi-system disease with a heterogeneous patient population showing a wide variety of functional disabilities and its biological basis remains poorly understood. Stable alterations in gene function in the immune system have been reported in several studies of CFS. Epigenetic modifications have been implicated in long-term effects on gene function, however, to our knowledge, genome-wide epigenetic modifications associated with CFS have not been explored. We examined the DNA methylome in peripheral blood mononuclear cells isolated from CFS patients and healthy controls using the Illumina HumanMethylation450 BeadChip array, controlling for invariant probes and probes overlapping polymorphic sequences. Gene ontology (GO and network analysis of differentially methylated genes was performed to determine potential biological pathways showing changes in DNA methylation in CFS. We found an increased abundance of differentially methylated genes related to the immune response, cellular metabolism, and kinase activity. Genes associated with immune cell regulation, the largest coordinated enrichment of differentially methylated pathways, showed hypomethylation within promoters and other gene regulatory elements in CFS. These data are consistent with evidence of multisystem dysregulation in CFS and implicate the involvement of DNA modifications in CFS pathology.
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-08-15
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.
Smith, Chris R.; Mutti, Navdeep S.; Jasper, W. Cameron; Naidu, Agni; Smith, Christopher D.; Gadau, Jürgen
2012-01-01
BACKGROUND: DNA methylation is a common regulator of gene expression, including acting as a regulator of developmental events and behavioral changes in adults. Using the unique system of genetic caste determination in Pogonomyrmex barbatus, we were able to document changes in DNA methylation during development, and also across both ancient and contemporary hybridization events. METHODOLOGY/PRINCIPAL FINDINGS: Sodium bisulfite sequencing demonstrated in vivo methylation of symmetric CG dinucle...
Namba-Fukuyo, Hiroe; Funata, Sayaka; Matsusaka, Keisuke; Fukuyo, Masaki; Rahmutulla, Bahityar; Mano, Yasunobu; Fukayama, Masashi; Aburatani, Hiroyuki; Kaneda, Atsushi
2016-12-06
Extensive DNA methylation is observed in gastric cancer with Epstein-Barr virus (EBV) infection, and EBV infection is the cause to induce this extensive hypermethylaton phenotype in gastric epithelial cells. However, some 5' regions of genes do not undergo de novo methylation, despite the induction of methylation in surrounding regions, suggesting the existence of a resistance factor against DNA methylation acquisition. We conducted an RNA-seq analysis of gastric epithelial cells with and without EBV infection and found that TET family genes, especially TET2, were repressed by EBV infection at both mRNA and protein levels. TET2 was found to be downregulated by EBV transcripts, e.g. BARF0 and LMP2A, and also by seven human miRNAs targeting TET2, e.g., miR-93 and miR-29a, which were upregulated by EBV infection, and transfection of which into gastric cells repressed TET2. Hydroxymethylation target genes by TET2 were detected by hydroxymethylated DNA immunoprecipitation sequencing (hMeDIP-seq) with and without TET2 overexpression, and overlapped significantly with methylation target genes in EBV-infected cells. When TET2 was knocked down by shRNA, EBV infection induced de novo methylation more severely, including even higher methylation in methylation-acquired promoters or de novo methylation acquisition in methylation-protected promoters, leading to gene repression. TET2 knockdown alone without EBV infection did not induce de novo DNA methylation. These data suggested that TET2 functions as a resistance factor against DNA methylation in gastric epithelial cells and repression of TET2 contributes to DNA methylation acquisition during EBV infection.
Electronic transport in methylated fragments of DNA
Energy Technology Data Exchange (ETDEWEB)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
International Nuclear Information System (INIS)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.
2015-01-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics
Bruhat, A; Jost, J P
1995-01-01
We have previously shown that estradiol treatment of roosters resulted in a rapid loss of binding activity of the repressor MDBP-2-H1 (a member of the histone H1 family) to methylated DNA that was not due to a decrease in MDBP-2-H1 concentration. Here we demonstrate that MDBP-2-H1 from rooster liver nuclear extracts is a phosphoprotein. Phosphoamino acid analysis reveals that the phosphorylation occurs exclusively on serine residues. Two-dimensional gel electrophoresis and tryptic phosphopeptide analysis show that MDBP-2-H1 is phosphorylated at several sites. Treatment of roosters with estradiol triggers a dephosphorylation of at least two sites in the protein. Phosphatase treatment of purified rooster MDBP-2-H1 combined with gel mobility shift assay indicates that phosphorylation of MDBP-2-H1 is essential for the binding to methylated DNA and that the dephosphorylation can occur on the protein bound to methylated DNA causing its release from DNA. Thus, these results suggest that in vivo modification of the phosphorylation status of MDBP-2-H1 caused by estradiol treatment may be a key step for the down regulation of its binding to methylated DNA. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7731964
Xie, Fang-Fei; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Hong; Wu, Jian; Guo, Yu-Fan; Zeng, Ke-Qin; Wang, Ming-Jun; Zhu, Xiao-Wei; Xia, Wei; Wang, Lan; He, Pei; Bing, Peng-Fei; Lu, Xin; Zhang, Yong-Hong; Lei, Shu-Feng
2018-01-01
DNA methylation is an important regulator on the mRNA expression. However, a genome-wide correlation pattern between DNA methylation and mRNA expression in human peripheral blood mononuclear cells (PBMCs) is largely unknown. The comprehensive relationship between mRNA and DNA methylation was explored by using four types of correlation analyses and a genome-wide methylation-mRNA expression quantitative trait locus (eQTL) analysis in PBMCs in 46 unrelated female subjects. An enrichment analysis was performed to detect biological function for the detected genes. Single pair correlation coefficient (r T1 ) between methylation level and mRNA is moderate (-0.63-0.62) in intensity, and the negative and positive correlations are nearly equal in quantity. Correlation analysis on each gene (T4) found 60.1% genes showed correlations between mRNA and gene-based methylation at P correlation (R T4 > 0.8). Methylation sites have regulation effects on mRNA expression in eQTL analysis, with more often observations in region of transcription start site (TSS). The genes under significant methylation regulation both in correlation analysis and eQTL analysis tend to cluster to the categories (e.g., transcription, translation, regulation of transcription) that are essential for maintaining the basic life activities of cells. Our findings indicated that DNA methylation has predictive regulation effect on mRNA with a very complex pattern in PBMCs. The results increased our understanding on correlation of methylation and mRNA and also provided useful clues for future epigenetic studies in exploring biological and disease-related regulatory mechanisms in PBMC.
Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu
2016-05-10
Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.
DEFF Research Database (Denmark)
von Essen, Marina; Menné, Charlotte; Nielsen, Bodil L
2002-01-01
. The other pathway is dependent on protein kinase C (PKC)-mediated activation of the CD3 gamma di-leucine-based receptor-sorting motif. Previous studies have failed to demonstrate a connection between ligand- and PKC-induced TCR down-regulation. Thus, although an apparent paradox, the dogma has been...... that ligand- and PKC-induced TCR down-regulations are not interrelated. By analyses of a newly developed CD3 gamma-negative T cell variant, freshly isolated and PHA-activated PBMC, and a mouse T cell line, we challenged this dogma and demonstrate in this work that PKC activation and the CD3 gamma di...
Biergans, Stephanie D; Claudianos, Charles; Reinhard, Judith; Galizia, C G
2016-01-01
The activity of the epigenetic writers DNA methyltransferases (Dnmts) after olfactory reward conditioning is important for both stimulus-specific long-term memory (LTM) formation and extinction. It, however, remains unknown which components of memory formation Dnmts regulate (e.g., associative vs. non-associative) and in what context (e.g., varying training conditions). Here, we address these aspects in order to clarify the role of Dnmt-mediated DNA methylation in memory formation. We used a pharmacological Dnmt inhibitor and classical appetitive conditioning in the honeybee Apis mellifera, a well characterized model for classical conditioning. We quantified the effect of DNA methylation on naïve odor and sugar responses, and on responses following olfactory reward conditioning. We show that (1) Dnmts do not influence naïve odor or sugar responses, (2) Dnmts do not affect the learning of new stimuli, but (3) Dnmts influence odor-coding, i.e., 'correct' (stimulus-specific) LTM formation. Particularly, Dnmts reduce memory specificity when experience is low (one-trial training), and increase memory specificity when experience is high (multiple-trial training), generating an ecologically more useful response to learning. (4) In reversal learning conditions, Dnmts are involved in regulating both excitatory (re-acquisition) and inhibitory (forgetting) processes.
Radiation effects on DNA methylation in mice
International Nuclear Information System (INIS)
Komura, J.; Kurishita, A.; Miyamura, Y.; Ono, T.; Tawa, R.; Sakurai, H.
1992-01-01
Effects of ionizing radiation on DNA methylation in liver, brain and spleen were examined by high performance liquid chromatography (HPLC). The total methylated cytosine level in the genome was reduced within 8 hours after 3.8 Gy of irradiation in liver of adult mice. But no appreciable effect was observed in brain and spleen. When mice were irradiated at newborn, liver DNA revealed no change in methylated cytosine level. Even though slight effects of radiation were detected in he methylation of the c-myc and c-fos genes, they were only temporary and no long-term effects were observed. These data suggest that the effect of radiation on DNA methylation in vivo is not prevailing a DNA damage, but rather influenced much through biological parameters. (author)
Directory of Open Access Journals (Sweden)
Woonsu Kim
2018-01-01
Full Text Available Objective DNA methylation plays a major role in regulating the expression of genes related to traits of economic interest (e.g., weight gain in livestock animals. This study characterized and investigated the functional inferences of genome-wide DNA methylome in the loin (longissimus dorsi muscle (LDM of swine. Methods A total of 8.99 Gb methylated DNA immunoprecipitation sequence data were obtained from LDM samples of eight Duroc pigs (four pairs of littermates. The reference pig genome was annotated with 78.5% of the raw reads. A total of 33,506 putative methylated regions (PMR were identified from methylated regions that overlapped at least two samples. Results Of these, only 3.1% were commonly observed in all eight samples. DNA methylation patterns between two littermates were as diverse as between unrelated individuals (p = 0.47, indicating that maternal genetic effects have little influence on the variation in DNA methylation of porcine LDM. The highest density of PMR was observed on chromosome 10. A major proportion (47.7% of PMR was present in the repeat regions, followed by introns (21.5%. The highest conservation of PMR was found in CpG islands (12.1%. These results show an important role for DNA methylation in species- and tissue-specific regulation of gene expression. PMR were also significantly related to muscular cell development, cell-cell communication, cellular integrity and transport, and nutrient metabolism. Conclusion This study indicated the biased distribution and functional role of DNA methylation in gene expression of porcine LDM. DNA methylation was related to cell development, cell-cell communication, cellular integrity and transport, and nutrient metabolism (e.g., insulin signaling pathways. Nutritional and environmental management may have a significant impact on the variation in DNA methylation of porcine LDM.
Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao
2016-03-01
Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.
Ancestry dependent DNA methylation and influence of maternal nutrition.
Directory of Open Access Journals (Sweden)
Khyobeni Mozhui
Full Text Available There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112 and European American (EA; N = 91 participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood. Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition--specifically, plasma levels of vitamin D and folate during pregnancy--on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC. Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome.
Directory of Open Access Journals (Sweden)
Pengrong Yan
2009-10-01
Full Text Available Human T-cell leukemia virus type I (HTLV-I is the etiological agent of adult T-cell leukemia (ATL. Our recent studies have shown that one important mechanism of HTLV-I-Mediated tumorigenesis is through PDZ-LIM domain-containing protein 2 (PDLIM2 repression, although the involved mechanism remains unknown. Here, we further report that HTLV-I-Mediated PDLIM2 repression was a pathophysiological event and the PDLIM2 repression involved DNA methylation. Whereas DNA methyltransferases 1 and 3b but not 3a were upregulated in HTLV-I-transformed T cells, the hypomethylating agent 5-aza-2′-deoxycytidine (5-aza-dC restored PDLIM2 expression and induced death of these malignant cells. Notably, the PDLIM2 repression was independent of the viral regulatory protein Tax because neither short-term induction nor long-term stable expression of Tax could downregulate PDLIM2 expression. These studies provide important insights into PDLIM2 regulation, HTLV-I leukemogenicity, long latency, and cancer health disparities. Given the efficient antitumor activity with no obvious toxicity of 5-aza-dC, these studies also suggest potential therapeutic strategies for ATL.
Lu, Z Z; Yan, L; Zhang, H; Li, M J; Zhang, X H; Zhao, X X
2016-06-23
To investigate the effect and mechanism of mifepristone on the migration of human endometrial carcinoma cells. A human endometrial carcinoma cell line, Ishikawa cells, was cultured in vitro and treated with mifepristone at different concentrations. Wound healing assay was applied to detect the migration of Ishikawa cells. RT-PCR and methylation-specific PCR (MSP) were used to detect the levels of H19 mRNA and its DNA methylation. Western-blot was used to detect the expressions of HMGA2 and epithelial to mesenchymal transition (EMT) related proteins. When treated with different concentrations of mifepristone for 48 hours, the width of scratch of the the control group, the 5 mg/L and the 10 mg/L mifepristone treatment groups were (4.18±0.07)mm, (4.68±0.07)mm, and(4.99±0.07)mm, respectively (Pendometrial carcinoma cells partially through methylation-induced of transcriptional inhibition of H19, which results in the down-regulation of HMGA2 and vimentin and upregulation of E-cadherin.
Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V
2017-07-21
DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.
FXR silencing in human colon cancer by DNA methylation and KRAS signaling.
Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L
2014-01-01
Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.
Lung function discordance in monozygotic twins and associated differences in blood DNA methylation
DEFF Research Database (Denmark)
Bolund, Anneli C S; Starnawska, Anna; Miller, Martin R
2017-01-01
Background: Lung function is an important predictor of morbidity and mortality, with accelerated lung function decline reported to have immense consequences for the world's healthcare systems. The lung function decline across individual's lifetime is a consequence of age-related changes in lung...... as TGF-β-receptor-related genes, may be involved in the cross-sectional level and longitudinal change in lung function in middle-aged monozygotic twins....... and genetic factors. DNA methylation plays a crucial role in regulation of gene expression, with increasing evidence linking aberrant DNA methylation levels with a number of common human diseases. In this study, we investigated possible associations between genome-wide DNA methylation levels and lung function...
Directory of Open Access Journals (Sweden)
Wensheng Wang
2016-11-01
Full Text Available Differences in drought stress tolerance within diverse rice genotypes have been attributed to genetic diversity and epigenetic alterations. DNA methylation is an important epigenetic modification that influences diverse biological processes, but its effects on rice drought stress tolerance are poorly understood. In this study, methylated DNA immunoprecipitation sequencing and an Affymetrix GeneChip rice genome array were used to profile the DNA methylation patterns and transcriptomes of the drought-tolerant introgression line DK151 and its drought-sensitive recurrent parent IR64 under drought and control conditions. The introgression of donor genomic DNA induced genome-wide DNA methylation changes in DK151 plants. A total of 1190 differentially methylated regions (DMRs were detected between the two genotypes under normal growth conditions, and the DMR-associated genes in DK151 plants were mainly related to stress response, programmed cell death, and nutrient reservoir activity, which are implicated to constitutive drought stress tolerance. A comparison of the DNA methylation changes in the two genotypes under drought conditions indicated that DK151 plants have a more stable methylome, with only 92 drought-induced DMRs, than IR64 plants with 506 DMRs. Gene ontology analyses of the DMR-associated genes in drought-stressed plants revealed that changes to the DNA methylation status of genotype-specific genes are associated with the epigenetic regulation of drought stress responses. Transcriptome analysis further helped to identify a set of 12 and 23 DMR-associated genes that were differentially expressed in DK151 and IR64, respectively, under drought stress compared with respective controls. Correlation analysis indicated that DNA methylation has various effects on gene expression, implying that it affects gene expression directly or indirectly through diverse regulatory pathways. Our results indicate that drought-induced alterations to DNA
Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome
Directory of Open Access Journals (Sweden)
Chih-Jie Shen
2014-01-01
Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.
Directory of Open Access Journals (Sweden)
Swarnali Acharyya
2010-08-01
Full Text Available Classical NF-kappaB signaling functions as a negative regulator of skeletal myogenesis through potentially multiple mechanisms. The inhibitory actions of TNFalpha on skeletal muscle differentiation are mediated in part through sustained NF-kappaB activity. In dystrophic muscles, NF-kappaB activity is compartmentalized to myofibers to inhibit regeneration by limiting the number of myogenic progenitor cells. This regulation coincides with elevated levels of muscle derived TNFalpha that is also under IKKbeta and NF-kappaB control.Based on these findings we speculated that in DMD, TNFalpha secreted from myotubes inhibits regeneration by directly acting on satellite cells. Analysis of several satellite cell regulators revealed that TNFalpha is capable of inhibiting Notch-1 in satellite cells and C2C12 myoblasts, which was also found to be dependent on NF-kappaB. Notch-1 inhibition occurred at the mRNA level suggesting a transcriptional repression mechanism. Unlike its classical mode of action, TNFalpha stimulated the recruitment of Ezh2 and Dnmt-3b to coordinate histone and DNA methylation, respectively. Dnmt-3b recruitment was dependent on Ezh2.We propose that in dystrophic muscles, elevated levels of TNFalpha and NF-kappaB inhibit the regenerative potential of satellite cells via epigenetic silencing of the Notch-1 gene.
DNA Methylation in Inflammatory Genes among Children with Obstructive Sleep Apnea
Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David
2012-01-01
Background: Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions.
Wang, Ningning; Zhang, Di; Wang, Zhenhui; Xun, Hongwei; Ma, Jian; Wang, Hui; Huang, Wei; Liu, Ying; Lin, Xiuyun; Li, Ning; Ou, Xiufang; Zhang, Chunyu; Wang, Ming-Bo; Liu, Bao
2014-06-30
Endogenous small (sm) RNAs (primarily si- and miRNAs) are important trans/cis-acting regulators involved in diverse cellular functions. In plants, the RNA-dependent RNA polymerases (RDRs) are essential for smRNA biogenesis. It has been established that RDR2 is involved in the 24 nt siRNA-dependent RNA-directed DNA methylation (RdDM) pathway. Recent studies have suggested that RDR1 is involved in a second RdDM pathway that relies mostly on 21 nt smRNAs and functions to silence a subset of genomic loci that are usually refractory to the normal RdDM pathway in Arabidopsis. Whether and to what extent the homologs of RDR1 may have similar functions in other plants remained unknown. We characterized a loss-of-function mutant (Osrdr1) of the OsRDR1 gene in rice (Oryza sativa L.) derived from a retrotransposon Tos17 insertion. Microarray analysis identified 1,175 differentially expressed genes (5.2% of all expressed genes in the shoot-tip tissue of rice) between Osrdr1 and WT, of which 896 and 279 genes were up- and down-regulated, respectively, in Osrdr1. smRNA sequencing revealed regional alterations in smRNA clusters across the rice genome. Some of the regions with altered smRNA clusters were associated with changes in DNA methylation. In addition, altered expression of several miRNAs was detected in Osrdr1, and at least some of which were associated with altered expression of predicted miRNA target genes. Despite these changes, no phenotypic difference was identified in Osrdr1 relative to WT under normal condition; however, ephemeral phenotypic fluctuations occurred under some abiotic stress conditions. Our results showed that OsRDR1 plays a role in regulating a substantial number of endogenous genes with diverse functions in rice through smRNA-mediated pathways involving DNA methylation, and which participates in abiotic stress response.
Directory of Open Access Journals (Sweden)
Thanh Theresa Dinh
2014-07-01
Full Text Available RNA-directed DNA methylation (RdDM and histone H3 lysine 9 dimethylation (H3K9me2 are related transcriptional silencing mechanisms that target transposable elements (TEs and repeats to maintain genome stability in plants. RdDM is mediated by small and long noncoding RNAs produced by the plant-specific RNA polymerases Pol IV and Pol V, respectively. Through a chemical genetics screen with a luciferase-based DNA methylation reporter, LUCL, we found that camptothecin, a compound with anti-cancer properties that targets DNA topoisomerase 1α (TOP1α was able to de-repress LUCL by reducing its DNA methylation and H3K9me2 levels. Further studies with Arabidopsis top1α mutants showed that TOP1α silences endogenous RdDM loci by facilitating the production of Pol V-dependent long non-coding RNAs, AGONAUTE4 recruitment and H3K9me2 deposition at TEs and repeats. This study assigned a new role in epigenetic silencing to an enzyme that affects DNA topology.
Directory of Open Access Journals (Sweden)
Athma A Pai
2011-02-01
Full Text Available The modification of DNA by methylation is an important epigenetic mechanism that affects the spatial and temporal regulation of gene expression. Methylation patterns have been described in many contexts within and across a range of species. However, the extent to which changes in methylation might underlie inter-species differences in gene regulation, in particular between humans and other primates, has not yet been studied. To this end, we studied DNA methylation patterns in livers, hearts, and kidneys from multiple humans and chimpanzees, using tissue samples for which genome-wide gene expression data were also available. Using the multi-species gene expression and methylation data for 7,723 genes, we were able to study the role of promoter DNA methylation in the evolution of gene regulation across tissues and species. We found that inter-tissue methylation patterns are often conserved between humans and chimpanzees. However, we also found a large number of gene expression differences between species that might be explained, at least in part, by corresponding differences in methylation levels. In particular, we estimate that, in the tissues we studied, inter-species differences in promoter methylation might underlie as much as 12%-18% of differences in gene expression levels between humans and chimpanzees.
Comprehensive analysis of preeclampsia-associated DNA methylation in the placenta.
Directory of Open Access Journals (Sweden)
Tianjiao Chu
Full Text Available A small number of recent reports have suggested that altered placental DNA methylation may be associated with early onset preeclampsia. It is important that further studies be undertaken to confirm and develop these findings. We therefore undertook a systematic analysis of DNA methylation patterns in placental tissue from 24 women with preeclampsia and 24 with uncomplicated pregnancy outcome.We analyzed the DNA methylation status of approximately 27,000 CpG sites in placental tissues in a massively parallel fashion using an oligonucleotide microarray. Follow up analysis of DNA methylation at specific CpG loci was performed using the Epityper MassArray approach and high-throughput bisulfite sequencing.Preeclampsia-specific DNA methylation changes were identified in placental tissue samples irrespective of gestational age of delivery. In addition, we identified a group of CpG sites within specific gene sequences that were only altered in early onset-preeclampsia (EOPET although these DNA methylation changes did not correlate with altered mRNA transcription. We found evidence that fetal gender influences DNA methylation at autosomal loci but could find no clear association between DNA methylation and gestational age.Preeclampsia is associated with altered placental DNA methylation. Fetal gender should be carefully considered during the design of future studies in which placental DNA is analyzed at the level of DNA methylation. Further large-scale analyses of preeclampsia-associated DNA methylation are necessary.
DNA methylation and gene expression of TXNIP in adult offspring of women with diabetes in pregnancy.
Directory of Open Access Journals (Sweden)
Azadeh Houshmand-Oeregaard
Full Text Available Fetal exposure to maternal diabetes increases the risk of type 2 diabetes (T2DM, possibly mediated by epigenetic mechanisms. Low blood TXNIP DNA methylation has been associated with elevated glucose levels and risk of T2DM, and increased skeletal muscle TXNIP gene expression was reported in subjects with impaired glucose metabolism or T2DM. Subcutaneous adipose tissue (SAT and skeletal muscle play a key role in the control of whole body glucose metabolism and insulin action. The extent to which TXNIP DNA methylation levels are decreased and/or gene expression levels increased in SAT or skeletal muscle of a developmentally programmed at-risk population is unknown.The objective of this study was to investigate TXNIP DNA methylation and gene expression in SAT and skeletal muscle, and DNA methylation in blood, from adult offspring of women with gestational diabetes (O-GDM, n = 82 or type 1 diabetes (O-T1DM, n = 67 in pregnancy compared with offspring of women from the background population (O-BP, n = 57.SAT TXNIP DNA methylation was increased (p = 0.032 and gene expression decreased (p = 0.001 in O-GDM, but these differences were attenuated after adjustment for confounders. Neither blood/muscle TXNIP DNA methylation nor muscle gene expression differed between groups.We found no evidence of decreased TXNIP DNA methylation or increased gene expression in metabolic target tissues of offspring exposed to maternal diabetes. Further studies are needed to confirm and understand the paradoxical SAT TXNIP DNA methylation and gene expression changes in O-GDM subjects.
Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David
2015-10-01
A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.
Energy Technology Data Exchange (ETDEWEB)
Ameer, Syeda Shegufta [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Engström, Karin [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden); Hossain, Mohammad Bakhtiar [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Concha, Gabriela [Science Department, Risk Benefit Assessment Unit, National Food Agency, Uppsala (Sweden); Vahter, Marie [Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden); Broberg, Karin, E-mail: Karin.broberg@ki.se [Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden)
2017-04-15
Background: Exposure to inorganic arsenic increases the risk of cancer and non-malignant diseases. Inefficient arsenic metabolism is a marker for susceptibility to arsenic toxicity. Arsenic may alter gene expression, possibly by altering DNA methylation. Objectives: To elucidate the associations between arsenic exposure, gene expression, and DNA methylation in peripheral blood, and the modifying effects of arsenic metabolism. Methods: The study participants, women from the Andes, Argentina, were exposed to arsenic via drinking water. Arsenic exposure was assessed as the sum of arsenic metabolites in urine (U-As), using high performance liquid-chromatography hydride-generation inductively-coupled-plasma-mass-spectrometry, and arsenic metabolism efficiency was assessed by the urinary fractions (%) of the individual metabolites. Genome-wide gene expression (N = 80 women) and DNA methylation (N = 93; 80 overlapping with gene expression) in peripheral blood were measured using Illumina DirectHyb HumanHT-12 v4.0 and Infinium Human-Methylation 450K BeadChip, respectively. Results: U-As concentrations, ranging 10–1251 μg/L, was associated with decreased gene expression: 64% of the top 1000 differentially expressed genes were down-regulated with increasing U-As. U-As was also associated with hypermethylation: 87% of the top 1000 CpGs were hypermethylated with increasing U-As. The expression of six genes and six individual CpG sites were significantly associated with increased U-As concentration. Pathway analyses revealed enrichment of genes related to cell death and cancer. The pathways differed somewhat depending on arsenic metabolism efficiency. We found no overlap between arsenic-related gene expression and DNA methylation for individual genes. Conclusions: Increased arsenic exposure was associated with lower gene expression and hypermethylation in peripheral blood, but with no evident overlap. - Highlights: • Women exposed to inorganic arsenic were studied for
DNA methylation analysis reveals distinct methylation signatures in pediatric germ cell tumors
International Nuclear Information System (INIS)
Amatruda, James F; Frazier, A Lindsay; Poynter, Jenny N; Ross, Julie A; Christensen, Brock; Fustino, Nicholas J; Chen, Kenneth S; Hooten, Anthony J; Nelson, Heather; Kuriger, Jacquelyn K; Rakheja, Dinesh
2013-01-01
Aberrant DNA methylation is a prominent feature of many cancers, and may be especially relevant in germ cell tumors (GCTs) due to the extensive epigenetic reprogramming that occurs in the germ line during normal development. We used the Illumina GoldenGate Cancer Methylation Panel to compare DNA methylation in the three main histologic subtypes of pediatric GCTs (germinoma, teratoma and yolk sac tumor (YST); N = 51) and used recursively partitioned mixture models (RPMM) to test associations between methylation pattern and tumor and demographic characteristics. We identified genes and pathways that were differentially methylated using generalized linear models and Ingenuity Pathway Analysis. We also measured global DNA methylation at LINE1 elements and evaluated methylation at selected imprinted loci using pyrosequencing. Methylation patterns differed by tumor histology, with 18/19 YSTs forming a distinct methylation class. Four pathways showed significant enrichment for YSTs, including a human embryonic stem cell pluripotency pathway. We identified 190 CpG loci with significant methylation differences in mature and immature teratomas (q < 0.05), including a number of CpGs in stem cell and pluripotency-related pathways. Both YST and germinoma showed significantly lower methylation at LINE1 elements compared with normal adjacent tissue while there was no difference between teratoma (mature and immature) and normal tissue. DNA methylation at imprinted loci differed significantly by tumor histology and location. Understanding methylation patterns may identify the developmental stage at which the GCT arose and the at-risk period when environmental exposures could be most harmful. Further, identification of relevant genetic pathways could lead to the development of new targets for therapy
Allele-Specific DNA Methylation Detection by Pyrosequencing®
DEFF Research Database (Denmark)
Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten
2015-01-01
DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....
Tolerization with BLP down-regulates HMGB1 a critical mediator of sepsis-related lethality.
LENUS (Irish Health Repository)
Coffey, J Calvin
2012-02-03
Tolerization with bacterial lipoprotein (BLP) affords a significant survival benefit in sepsis. Given that high mobility group box protein-1 (HMGB1) is a recognized mediator of sepsis-related lethality, we determined if tolerization with BLP leads to alterations in HMGB1. In vitro, BLP tolerization led to a reduction in HMGB1 gene transcription. This was mirrored at the protein level, as HMGB1 protein expression and release were reduced significantly in BLP-tolerized human THP-1 monocytic cells. BLP tolerance in vivo led to a highly significant, long-term survival benefit following challenge with lethal dose BLP in C57BL\\/6 mice. This was associated with an attenuation of HMGB1 release into the circulation, as evidenced by negligible serum HMGB1 levels in BLP-tolerized mice. Moreover, HMGB1 levels in peritoneal macrophages from BLP-tolerized mice were reduced significantly. Hence, tolerization with BLP leads to a down-regulation of HMGB1 protein synthesis and release. The improved survival associated with BLP tolerance could thus be explained by a reduction in HMGB1, were the latter associated with lethality in BLP-related sepsis. In testing this hypothesis, it was noted that neutralization of HMGB1, using anti-HMGB1 antibodies, abrogated BLP-associated lethality almost completely. To conclude, tolerization with BLP leads to a down-regulation of HMGB1, thus offering a novel means of targeting the latter. HMGB1 is also a mediator of lethality in BLP-related sepsis.
Chao, Zhe; Zheng, Xin-Li; Sun, Rui-Ping; Liu, Hai-Long; Huang, Li-Li; Cao, Zong-Xi; Deng, Chang-Yan; Wang, Feng
2016-07-01
Epigenetic processes in the development of skeletal muscle have been appreciated for over a decade. DNA methylation is a major epigenetic modification important for regulating gene expression and suppressing spurious transcription. Up to now, the importance of epigenetic marks in the regulation of Pax7 and myogenic regulatory factors (MRFs) expression is far less explored. In the present study, semi-quantitative the real-time polymerase chain reaction (RT-PCR) analyses showed MyoD and Myf5 were expressed in activated and quiescent C2C12 cells. MyoG was expressed in a later stage of myogenesis. Pax7 was weakly expressed in differentiated C2C12 cells. To further understand the regulation of expression of these genes, the DNA methylation status of Pax7, MyoD, and Myf5 was determined by bisulfite sequencing PCR. During the C2C12 myoblasts fusion process, the changes of promoter and exon 1 methylation of Pax7, MyoD, and Myf5 genes were observed. In addition, an inverse relationship of low methylation and high expression was found. These results suggest that DNA methylation may be an important mechanism regulating Pax7 and MRFs transcription in cell myogenic differentiation.
Evidence Suggesting Absence of Mitochondrial DNA Methylation
DEFF Research Database (Denmark)
Mechta, Mie; Ingerslev, Lars R; Fabre, Odile
2017-01-01
, 16S, ND5 and CYTB, suggesting that mtDNA supercoiled structure blocks the access to bisulfite conversion. Here, we identified an artifact of mtDNA bisulfite sequencing that can lead to an overestimation of mtDNA methylation levels. Our study supports that cytosine methylation is virtually absent...
Differential DNA Methylation in Relation to Age and Health Risks of Obesity
Directory of Open Access Journals (Sweden)
María Luisa Mansego
2015-07-01
Full Text Available The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO; defined according to BMI categories as “Low HRO” (overweight and class 1 obesity versus “High HRO” (class 2 and class 3 obesity. Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study. In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.
Microarray-based DNA methylation study of Ewing's sarcoma of the bone.
Park, Hye-Rim; Jung, Woon-Won; Kim, Hyun-Sook; Park, Yong-Koo
2014-10-01
Alterations in DNA methylation patterns are a hallmark of malignancy. However, the majority of epigenetic studies of Ewing's sarcoma have focused on the analysis of only a few candidate genes. Comprehensive studies are thus lacking and are required. The aim of the present study was to identify novel methylation markers in Ewing's sarcoma using microarray analysis. The current study reports the microarray-based DNA methylation study of 1,505 CpG sites of 807 cancer-related genes from 69 Ewing's sarcoma samples. The Illumina GoldenGate Methylation Cancer Panel I microarray was used, and with the appropriate controls (n=14), a total of 92 hypermethylated genes were identified in the Ewing's sarcoma samples. The majority of the hypermethylated genes were associated with cell adhesion, cell regulation, development and signal transduction. The overall methylation mean values were compared between patients who survived and those that did not. The overall methylation mean was significantly higher in the patients who did not survive (0.25±0.03) than in those who did (0.22±0.05) (P=0.0322). However, the overall methylation mean was not found to significantly correlate with age, gender or tumor location. GDF10 , OSM , APC and HOXA11 were the most significant differentially-methylated genes, however, their methylation levels were not found to significantly correlate with the survival rate. The DNA methylation profile of Ewing's sarcoma was characterized and 92 genes that were significantly hypermethylated were detected. A trend towards a more aggressive behavior was identified in the methylated group. The results of this study indicated that methylation may be significant in the development of Ewing's sarcoma.
Rai, Krishna Kumar; Rai, Nagendra; Rai, Shashi Pandey
2018-07-01
Salicylic acid (SA) and sodium nitroprusside (SNP, NO donor) modulates plant growth and development processes and recent findings have also revealed their involvement in the regulation of epigenetic factors under stress condition. In the present study, some of these factors were comparatively studied in hyacinth bean plants subjected to high temperature (HT) environment (40-42 °C) with and without exogenous application of SA and SNP under field condition. Exogenous application of SA and SNP substantially modulated the growth and biophysical process of hyacinth bean plants under HT environment. Exogenous application of SA and SNP also remarkably regulated the activities of antioxidant enzymes, modulated mRNA level of certain enzymes, improves plant water relation, enhance photosynthesis and thereby increasing plant defence under HT. Coupled restriction enzyme digestion-random amplification (CRED-RA) technique revealed that many methylation changes were "dose dependent" and HT significantly increased DNA damages as evidenced by both increase and decrease in bands profiles, methylation and de-methylation pattern. Thus, the result of the present study clearly shows that exogenous SA and SNP regulates DNA methylation pattern, modulates stress-responsive genes and can impart transient HT tolerance by synchronizing growth and physiological acclimatization of plants, thus narrowing the gaps between physio-biochemical and molecular events in addressing HT tolerance. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Liangping Zha
2017-07-01
Full Text Available The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ and L. japonica var. chinensis (rFLJ. Chlorogenic acid (CGAs were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2. We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica.
Tea and coffee consumption in relation to DNA methylation in four European cohorts.
Ek, Weronica E; Tobi, Elmar W; Ahsan, Muhammad; Lampa, Erik; Ponzi, Erica; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Lumey, L H; Heijmans, Bastiaan T; Botsivali, Maria; Bergdahl, Ingvar A; Karlsson, Torgny; Rask-Andersen, Mathias; Palli, Domenico; Ingelsson, Erik; Hedman, Åsa K; Nilsson, Lena M; Vineis, Paolo; Lind, Lars; Flanagan, James M; Johansson, Åsa
2017-08-15
Lifestyle factors, such as food choices and exposure to chemicals, can alter DNA methylation and lead to changes in gene activity. Two such exposures with pharmacologically active components are coffee and tea consumption. Both coffee and tea have been suggested to play an important role in modulating disease-risk in humans by suppressing tumour progression, decreasing inflammation and influencing estrogen metabolism. These mechanisms may be mediated by changes in DNA methylation. To investigate if DNA methylation in blood is associated with coffee and tea consumption, we performed a genome-wide DNA methylation study for coffee and tea consumption in four European cohorts (N = 3,096). DNA methylation was measured from whole blood at 421,695 CpG sites distributed throughout the genome and analysed in men and women both separately and together in each cohort. Meta-analyses of the results and additional regional-level analyses were performed. After adjusting for multiple testing, the meta-analysis revealed that two individual CpG-sites, mapping to DNAJC16 and TTC17, were differentially methylated in relation to tea consumption in women. No individual sites were associated with men or with the sex-combined analysis for tea or coffee. The regional analysis revealed that 28 regions were differentially methylated in relation to tea consumption in women. These regions contained genes known to interact with estradiol metabolism and cancer. No significant regions were found in the sex-combined and male-only analysis for either tea or coffee consumption. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Demarre, Gaëlle; Chattoraj, Dhruba K
2010-05-06
DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated) sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII) of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.
Insufficient DNA methylation affects healthy aging and promotes age-related health problems.
Liu, Liang; van Groen, Thomas; Kadish, Inga; Li, Yuanyuan; Wang, Deli; James, Smitha R; Karpf, Adam R; Tollefsbol, Trygve O
2011-08-01
DNA methylation plays an integral role in development and aging through epigenetic regulation of genome function. DNA methyltransferase 1 (Dnmt1) is the most prevalent DNA methyltransferase that maintains genomic methylation stability. To further elucidate the function of Dnmt1 in aging and age-related diseases, we exploited the Dnmt1+/- mouse model to investigate how Dnmt1 haploinsufficiency impacts the aging process by assessing the changes of several major aging phenotypes. We confirmed that Dnmt1 haploinsufficiency indeed decreases DNA methylation as a result of reduced Dnmt1 expression. To assess the effect of Dnmt1 haploinsufficiency on general body composition, we performed dual-energy X-ray absorptiometry analysis and showed that reduced Dnmt1 activity decreased bone mineral density and body weight, but with no significant impact on mortality or body fat content. Using behavioral tests, we demonstrated that Dnmt1 haploinsufficiency impairs learning and memory functions in an age-dependent manner. Taken together, our findings point to the interesting likelihood that reduced genomic methylation activity adversely affects the healthy aging process without altering survival and mortality. Our studies demonstrated that cognitive functions of the central nervous system are modulated by Dnmt1 activity and genomic methylation, highlighting the significance of the original epigenetic hypothesis underlying memory coding and function.
TET1 and hydroxymethylcytosine in transcription and DNA methylation fidelity
DEFF Research Database (Denmark)
Williams, Kristine; Christensen, Jesper; Pedersen, Marianne Terndrup
2011-01-01
a role in transcriptional repression. TET1 binds a significant proportion of Polycomb group target genes. Furthermore, TET1 associates and colocalizes with the SIN3A co-repressor complex. We propose that TET1 fine-tunes transcription, opposes aberrant DNA methylation at CpG-rich sequences and thereby...... throughout the genome of embryonic stem cells, with the majority of binding sites located at transcription start sites (TSSs) of CpG-rich promoters and within genes. The hmC modification is found in gene bodies and in contrast to mC is also enriched at CpG-rich TSSs. We provide evidence further that TET1 has...... contributes to the regulation of DNA methylation fidelity....
Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.
2001-07-01
The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.
Cord blood buffy coat DNA methylation is comparable to whole cord blood methylation.
Dou, John; Schmidt, Rebecca J; Benke, Kelly S; Newschaffer, Craig; Hertz-Picciotto, Irva; Croen, Lisa A; Iosif, Ana-Maria; LaSalle, Janine M; Fallin, M Daniele; Bakulski, Kelly M
2018-01-01
Cord blood DNA methylation is associated with numerous health outcomes and environmental exposures. Whole cord blood DNA reflects all nucleated blood cell types, while centrifuging whole blood separates red blood cells, generating a white blood cell buffy coat. Both sample types are used in DNA methylation studies. Cell types have unique methylation patterns and processing can impact cell distributions, which may influence comparability. We evaluated differences in cell composition and DNA methylation between cord blood buffy coat and whole cord blood samples. Cord blood DNA methylation was measured with the Infinium EPIC BeadChip (Illumina) in eight individuals, each contributing buffy coat and whole blood samples. We analyzed principal components (PC) of methylation, performed hierarchical clustering, and computed correlations of mean-centered methylation between pairs. We conducted moderated t-tests on single sites and estimated cell composition. DNA methylation PCs were associated with individual (P PC1 = 1.4 × 10 -9 ; P PC2 = 2.9 × 10 -5 ; P PC3 = 3.8 × 10 -5 ; P PC4 = 4.2 × 10 -6 ; P PC5 = 9.9 × 10 -13 , P PC6 = 1.3 × 10 -11 ) and not with sample type (P PC1-6 >0.7). Samples hierarchically clustered by individual. Pearson correlations of mean-centered methylation between paired samples ranged from r = 0.66 to r = 0.87. No individual site significantly differed between buffy coat and whole cord blood when adjusting for multiple comparisons (five sites had unadjusted Pcoat and whole cord blood are much lower than inter-individual variation, demonstrating that both sample preparation types can be analytically combined and compared.
Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei
2018-02-08
DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.
Directory of Open Access Journals (Sweden)
Gaofeng Pan
2018-02-01
Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.
Energy Technology Data Exchange (ETDEWEB)
Pan, Chun-Hsu [Department of Pharmacy, Taipei Medical University, Taipei 11031, Taiwan (China); Lin, Wen-Hsin; Chien, Yi-Chung; Liu, Fon-Chang; Sheu, Ming-Jyh [School of Pharmacy, China Medical University, Taichung 40402, Taiwan (China); Kuo, Yueh-Hsiung, E-mail: kuoyh@mail.cmu.edu.tw [Tsuzuki Institute for Traditional Medicine, China Medical University, Taichung 40402, Taiwan (China); Department of Chinese Pharmaceutical Sciences and Chinese Medicine Resources, China Medical University, Taichung 40402, Taiwan (China); Department of Biotechnology, Asia University, Taichung 41354, Taiwan (China); Wu, Chieh-Hsi, E-mail: chhswu@tmu.edu.tw [Department of Pharmacy, Taipei Medical University, Taipei 11031, Taiwan (China); School of Pharmacy, China Medical University, Taichung 40402, Taiwan (China); Department of Biological Science and Technology, China Medical University, Taichung 40402, Taiwan (China)
2015-01-15
Anti-angiogenesis is one of the most popular clinical interventions for cancer chemotherapy. A series of synthesized derivative of methyl caffeate were used to evaluate the anti-angiogenic activity and to investigate possible pharmacological mechanisms in the present study. The most potent anti-angiogenic compound was evaluated in the experiments of murine allograft tumor model and Matrigel plug assay as well as cell models in the human umbilical vascular endothelial cells (HUVECs) and the LLC1 lung cancer cells. Our results suggested that K20E suppressed the tumor growth in the allograft tumor model and exhibited anti-angiogenic activity in Matrigel plug assay. Besides, HUVEC viability was found to be significantly reduced by arresting cell cycle at G{sub 2}/M phase and apoptosis. Cell migration, invasion, and tube formation of the HUVECs were also markedly suppressed by K20E treatment. K20E largely down-regulated the intracellular and secreted vascular endothelial growth factor (VEGF) in the LLC1 cancer cells. Besides, VEGF receptor-2 (VEGFR-2) and its downstream signaling cascades (AKT-mTOR and MEK1/2-ERK1/2) as well as gelatinases were all evidently reduced in the HUVECs treated with K20E. Inversely, K20E can up-regulate the expression levels of p53 and p21 proteins in the HUVECs. Based on these results, our study suggested that K20E possessed inhibiting angiogenesis through regulation of VEGF/VEGFR-2 and its downstream signaling cascades in the vascular endothelial cells (VECs). - Highlights: • K20E is an oxidative-coupling compound of methyl caffeate. • K20E exhibits anti-tumor and anti-angiogenesis effects. • K20E suppresses the expressions of VEGF and VEGF receptor-2 (VEGFR-2) proteins. • K20E deactivates VEGFR-2-mediated downstream signaling pathways to inhibit angiogenesis. • K20E up-regulates p53-p21 pathway to induce apoptosis and cell arrest at G2/M phase.
PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response
Liao, Hsin-Wei; Hsu, Jung-Mao; Xia, Weiya; Wang, Hung-Ling; Wang, Ying-Nai; Chang, Wei-Chao; Arold, Stefan T.; Chou, Chao-Kai; Tsou, Pei-Hsiang; Yamaguchi, Hirohito; Fang, Yueh-Fu; Lee, Hong-Jen; Lee, Heng-Huan; Tai, Shyh-Kuan; Yang, Mhu-Hwa; Morelli, Maria P.; Sen, Malabika; Ladbury, John E.; Chen, Chung-Hsuan; Grandis, Jennifer R.; Kopetz, Scott; Hung, Mien-Chie
2015-01-01
Posttranslational modifications to the intracellular domain of the EGFR are known to regulate EGFR functions; however, modifications to the extracellular domain and their effects remain relatively unexplored. Here, we determined that methylation at R198 and R200 of the EGFR extracellular domain by protein arginine methyltransferase 1 (PRMT1) enhances binding to EGF and subsequent receptor dimerization and signaling activation. In a mouse orthotopic colorectal cancer xenograft model, expression of a methylation-defective EGFR reduced tumor growth. Moreover, increased EGFR methylation sustained signaling activation and cell proliferation in the presence of the therapeutic EGFR monoclonal antibody cetuximab. In colorectal cancer patients, EGFR methylation level also correlated with a higher recurrence rate after cetuximab treatment and reduced overall survival. Together, these data indicate that R198/R200 methylation of the EGFR plays an important role in regulating EGFR functionality and resistance to cetuximab treatment.
PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response
Liao, Hsin-Wei
2015-11-16
Posttranslational modifications to the intracellular domain of the EGFR are known to regulate EGFR functions; however, modifications to the extracellular domain and their effects remain relatively unexplored. Here, we determined that methylation at R198 and R200 of the EGFR extracellular domain by protein arginine methyltransferase 1 (PRMT1) enhances binding to EGF and subsequent receptor dimerization and signaling activation. In a mouse orthotopic colorectal cancer xenograft model, expression of a methylation-defective EGFR reduced tumor growth. Moreover, increased EGFR methylation sustained signaling activation and cell proliferation in the presence of the therapeutic EGFR monoclonal antibody cetuximab. In colorectal cancer patients, EGFR methylation level also correlated with a higher recurrence rate after cetuximab treatment and reduced overall survival. Together, these data indicate that R198/R200 methylation of the EGFR plays an important role in regulating EGFR functionality and resistance to cetuximab treatment.
PRMT1-mediated methylation of the EGF receptor regulates signaling and cetuximab response
Liao, Hsin-Wei; Hsu, Jung-Mao; Xia, Weiya; Wang, Hung-Ling; Wang, Ying-Nai; Chang, Wei-Chao; Arold, Stefan T.; Chou, Chao-Kai; Tsou, Pei-Hsiang; Yamaguchi, Hirohito; Fang, Yueh-Fu; Lee, Hong-Jen; Lee, Heng-Huan; Tai, Shyh-Kuan; Yang, Mhu-Hwa; Morelli, Maria P.; Sen, Malabika; Ladbury, John E.; Chen, Chung-Hsuan; Grandis, Jennifer R.; Kopetz, Scott; Hung, Mien-Chie
2015-01-01
Posttranslational modifications to the intracellular domain of the EGFR are known to regulate EGFR functions; however, modifications to the extracellular domain and their effects remain relatively unexplored. Here, we determined that methylation at R198 and R200 of the EGFR extracellular domain by protein arginine methyltransferase 1 (PRMT1) enhances binding to EGF and subsequent receptor dimerization and signaling activation. In a mouse orthotopic colorectal cancer xenograft model, expression of a methylation-defective EGFR reduced tumor growth. Moreover, increased EGFR methylation sustained signaling activation and cell proliferation in the presence of the therapeutic EGFR monoclonal antibody cetuximab. In colorectal cancer patients, EGFR methylation level also correlated with a higher recurrence rate after cetuximab treatment and reduced overall survival. Together, these data indicate that R198/R200 methylation of the EGFR plays an important role in regulating EGFR functionality and resistance to cetuximab treatment. PMID:26571401
Energy Technology Data Exchange (ETDEWEB)
Novak, Petr; Jensen, Taylor J.; Garbe, James C.; Stampfer, Martha R.; Futscher, Bernard W.
2009-04-20
The timing and progression of DNA methylation changes during carcinogenesis are not completely understood. To develop a timeline of aberrant DNA methylation events during malignant transformation, we analyzed genome-wide DNA methylation patterns in an isogenic human mammary epithelial cell (HMEC) culture model of transformation. To acquire immortality and malignancy, the cultured finite lifespan HMEC must overcome two distinct proliferation barriers. The first barrier, stasis, is mediated by the retinoblastoma protein and can be overcome by loss of p16(INK4A) expression. HMEC that escape stasis and continue to proliferate become genomically unstable before encountering a second more stringent proliferation barrier, telomere dysfunction due to telomere attrition. Rare cells that acquire telomerase expression may escape this barrier, become immortal, and develop further malignant properties. Our analysis of HMEC transitioning from finite lifespan to malignantly transformed showed that aberrant DNA methylation changes occur in a stepwise fashion early in the transformation process. The first aberrant DNA methylation step coincides with overcoming stasis, and results in few to hundreds of changes, depending on how stasis was overcome. A second step coincides with immortalization and results in hundreds of additional DNA methylation changes regardless of the immortalization pathway. A majority of these DNA methylation changes are also found in malignant breast cancer cells. These results show that large-scale epigenetic remodeling occurs in the earliest steps of mammary carcinogenesis, temporally links DNA methylation changes and overcoming cellular proliferation barriers, and provides a bank of potential epigenetic biomarkers that mayprove useful in breast cancer risk assessment.
Non-coding RNAs and epigenome: de novo DNA methylation, allelic exclusion and X-inactivation
Directory of Open Access Journals (Sweden)
V. A. Halytskiy
2013-12-01
Full Text Available Non-coding RNAs are widespread class of cell RNAs. They participate in many important processes in cells – signaling, posttranscriptional silencing, protein biosynthesis, splicing, maintenance of genome stability, telomere lengthening, X-inactivation. Nevertheless, activity of these RNAs is not restricted to posttranscriptional sphere, but cover also processes that change or maintain the epigenetic information. Non-coding RNAs can directly bind to the DNA targets and cause their repression through recruitment of DNA methyltransferases as well as chromatin modifying enzymes. Such events constitute molecular mechanism of the RNA-dependent DNA methylation. It is possible, that the RNA-DNA interaction is universal mechanism triggering DNA methylation de novo. Allelic exclusion can be also based on described mechanism. This phenomenon takes place, when non-coding RNA, which precursor is transcribed from one allele, triggers DNA methylation in all other alleles present in the cell. Note, that miRNA-mediated transcriptional silencing resembles allelic exclusion, because both miRNA gene and genes, which can be targeted by this miRNA, contain elements with the same sequences. It can be assumed that RNA-dependent DNA methylation and allelic exclusion originated with the purpose of counteracting the activity of mobile genetic elements. Probably, thinning and deregulation of the cellular non-coding RNA pattern allows reactivation of silent mobile genetic elements resulting in genome instability that leads to ageing and carcinogenesis. In the course of X-inactivation, DNA methylation and subsequent heterochromatinization of X chromosome can be triggered by direct hybridization of 5′-end of large non-coding RNA Xist with DNA targets in remote regions of the X chromosome.
Directory of Open Access Journals (Sweden)
Xiaoguo Zheng
2017-12-01
Full Text Available DNA methylation is the major focus of studies on paternal epigenetic inheritance in mammals, but most previous studies about inheritable DNA methylation changes are passively induced by environmental factors. However, it is unclear whether the active changes mediated by variations in DNA methyltransferase activity are heritable. Here, we established human-derived DNMT3A (hDNMT3A transgenic rats to study the effect of hDNMT3A overexpression on the DNA methylation pattern of rat sperm and to investigate whether this actively altered DNA methylation status is inheritable. Our results revealed that hDNMT3A was overexpressed in the testis of transgenic rats and induced genome-wide alterations in the DNA methylation pattern of rat sperm. Among 5438 reliable loci identified with 64 primer-pair combinations using a methylation-sensitive amplification polymorphism method, 28.01% showed altered amplified band types. Among these amplicons altered loci, 68.42% showed an altered DNA methylation status in the offspring of transgenic rats compared with wild-type rats. Further analysis based on loci which had identical DNA methylation status in all three biological replicates revealed that overexpression of hDNMT3A in paternal testis induced hypermethylation in sperm of both genotype-negative and genotype-positive offspring. Among the differentially methylated loci, 34.26% occurred in both positive and negative offspring of transgenic rats, indicating intergenerational inheritance of active DNA methylation changes in the absence of hDNM3A transmission. Furthermore, 75.07% of the inheritable loci were hyper-methylated while the remaining were hypomethylated. Distribution analysis revealed that the DNA methylation variations mainly occurred in introns and intergenic regions. Functional analysis revealed that genes related to differentially methylated loci were involved in a wide range of functions. Finally, this study demonstrated that active DNA methylation
Folate, colorectal cancer and the involvement of DNA methylation.
Williams, Elizabeth A
2012-11-01
Diet is a major factor in the aetiology of colorectal cancer (CRC). Epidemiological evidence suggests that folate confers a modest protection against CRC risk. However, the relationship is complex, and evidence from human intervention trials and animal studies suggests that a high-dose of folic acid supplementation may enhance the risk of colorectal carcinogenesis in certain circumstances. The molecular mechanisms underlying the apparent dual modulatory effect of folate on colorectal carcinogenesis are not fully understood. Folate is central to C1 metabolism and is needed for both DNA synthesis and DNA methylation, providing plausible biological mechanisms through which folate could modulate cancer risk. Aberrant DNA methylation is an early event in colorectal carcinogenesis and is typically associated with the transcriptional silencing of tumour suppressor genes. Folate is required for the production of S-adenosyl methionine, which serves as a methyl donor for DNA methylation events; thereby folate availability is proposed to modulate DNA methylation status. The evidence for an effect of folate on DNA methylation in the human colon is limited, but a modulation of DNA methylation in response to folate has been demonstrated. More research is required to clarify the optimum intake of folate for CRC prevention and to elucidate the effect of folate availability on DNA methylation and the associated impact on CRC biology.
DNA methylation in human fibroblasts following DNA damage and repair
International Nuclear Information System (INIS)
Kastan, M.B.
1984-01-01
Methylation of deoxycytidine (dCyd) incorporated by DNA excision repair synthesis in human diploid fibroblasts following damage with ultraviolet radiation (UV), N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene was studied utilizing [6- 3 H]dCyd to label repaired DNA specifically and high performance liquid chromatographic analysis to quantify the percentage of deoxycytidine converted to 5-methyldeoxycytidine (m 5 dCyd). In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication a level of 3.4% m 5 dCyd is reached in less than 2 hours, following UV-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approx.2.0% m 5 dCyd in the repair patch. This undermethylation of repair patches occurs throughout the genome. In cells from cultures in logarithmic-phase growth, m 5 dCyd formation in UV-induced repair patches occurs faster and to a greater extent, reaching a level of approx.2.7% in 10-20 hours. Pre-existing hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites. The distribution within chromatin of m 5 dCyd in repair patches was also investigated. Over a wide range of extents of digestion by staphylococcal nuclease or deoxyribonuclease I, the level of hypomethylation in repaired DNA in nuclease sensitive and resistant regions of chromatin was constant relative to the genomic level of methylation in these regions. Similar conclusions were reached in experiments with isolated mononucleosomes
Directory of Open Access Journals (Sweden)
Sharma Shikhar
2012-01-01
Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.
DNA methylation and healthy human aging.
Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S
2015-12-01
The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Allevato, G; Billestrup, N; Goujon, L
1995-01-01
The functional significance of growth hormone (GH) receptor (GHR) internalization is unknown; therefore, we have analyzed domains and individual amino acids in the cytoplasmic region of the rat GHR required for ligand-mediated receptor internalization, receptor down-regulation, and transcriptiona...
Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation.
Wei, Zhi-Qiang; Zhang, Yong-Hong; Ke, Chang-Zheng; Chen, Hong-Xia; Ren, Pan; He, Yu-Lin; Hu, Pei; Ma, De-Qiang; Luo, Jie; Meng, Zhong-Ji
2017-09-14
To investigate the potential effect of curcumin on hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and the underlying mechanism. A HepG2.2.15 cell line stably transfected with HBV was treated with curcumin, and HBV surface antigen (HBsAg) and e antigen (HBeAg) expression levels were assessed by ELISA. Intracellular HBV DNA replication intermediates and cccDNA were detected by Southern blot and real-time PCR, respectively. The acetylation levels of histones H3 and H4 were measured by Western blot. H3/H4-bound cccDNA was detected by chromatin immunoprecipitation (ChIP) assays. The deacetylase inhibitors trichostatin A and sodium butyrate were used to study the mechanism of action for curcumin. Additionally, short interfering RNAs (siRNAs) targeting HBV were tested along with curcumin. Curcumin treatment led to time- and dose-dependent reductions in HBsAg and HBeAg expression and significant reductions in intracellular HBV DNA replication intermediates and HBV cccDNA. After treatment with 20 μmol/L curcumin for 2 d, HBsAg and cccDNA levels in HepG2.2.15 cells were reduced by up to 57.7% ( P curcumin, accompanied by reductions in H3- and H4-bound cccDNA. Furthermore, the deacetylase inhibitors trichostatin A and sodium butyrate could block the effects of curcumin. Additionally, transfection of siRNAs targeting HBV enhanced the inhibitory effects of curcumin. Curcumin inhibits HBV gene replication via down-regulation of cccDNA-bound histone acetylation and has the potential to be developed as a cccDNA-targeting antiviral agent for hepatitis B.
Acharyya, Swarnali; Sharma, Sudarshana M.; Cheng, Alfred S.; Ladner, Katherine J.; He, Wei; Kline, William; Wang, Huating; Ostrowski, Michael C.; Huang, Tim H.; Guttridge, Denis C.
2010-01-01
Background Classical NF-κB signaling functions as a negative regulator of skeletal myogenesis through potentially multiple mechanisms. The inhibitory actions of TNFα on skeletal muscle differentiation are mediated in part through sustained NF-κB activity. In dystrophic muscles, NF-κB activity is compartmentalized to myofibers to inhibit regeneration by limiting the number of myogenic progenitor cells. This regulation coincides with elevated levels of muscle derived TNFα that is also under IKKβ and NF-κB control. Methodology/Principal Findings Based on these findings we speculated that in DMD, TNFα secreted from myotubes inhibits regeneration by directly acting on satellite cells. Analysis of several satellite cell regulators revealed that TNFα is capable of inhibiting Notch-1 in satellite cells and C2C12 myoblasts, which was also found to be dependent on NF-κB. Notch-1 inhibition occurred at the mRNA level suggesting a transcriptional repression mechanism. Unlike its classical mode of action, TNFα stimulated the recruitment of Ezh2 and Dnmt-3b to coordinate histone and DNA methylation, respectively. Dnmt-3b recruitment was dependent on Ezh2. Conclusions/Significance We propose that in dystrophic muscles, elevated levels of TNFα and NF-κB inhibit the regenerative potential of satellite cells via epigenetic silencing of the Notch-1 gene. PMID:20814569
To What Extent Does DNA Methylation Affect Phenotypic Variation in Cattle?
Directory of Open Access Journals (Sweden)
Stephanie McKAY
2015-07-01
Full Text Available DNA methylation is an environmentally influenced epigenetic modification that regulates gene transcription and has the potential to influence variation in economically important phenotypes in agricultural species. We have utilized a novel approach to evaluate the relationship between genetic and epigenetic variation and downstream phenotypes. To begin with, we have integrated RNA-Seq and methyl binding domain sequencing (MBD-Seq data in order to determine the extent to which DNA methylation affects phenotypic variation in economically important traits of cattle. MBD-Seq is a technique that involves the sample enrichment of methylated genomic regions followed by their next-generation sequencing. This study utilized Illumina next generation sequencing technology to perform both RNA-Seq and MBD-Seq. NextGENe software (SoftGenetics, State College, PA was employed for quality trimming and aligning the sequence reads to the UMD3.1 bovine reference genome, generating counts of matched reads and methylated peak identification. Subsequently, we identified and quantified genome-wide methylated regions and characterized the extent of differential methylation and differential expression between two groups of animals with extreme phenotypes. The program edgeR from the R software package (version 3.0.1 was employed for identifying differentially methylated regions and regions of differential expression. Finally, Partial Correlation with Information Theory (PCIT was performed to identify transcripts and methylation events that exhibit differential hubbing. A differential hub is defined as a gene network hub that is more highly connected in one treatment group than the other. This analysis produced every possible pair-wise interaction that subsequently enabled us to look at network interactions of how methylation affects expression. (co-expression, co-methylation, methylation x expression. Genomic regions of interest derived from this analysis were then aligned
Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.
Rebollo, Rita; Mager, Dixie L
2016-01-01
Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.
Elvira-Matelot, Emilie; Hachet, Mélanie; Shamandi, Nahid; Comella, Pascale; Sáez-Vásquez, Julio; Zytnicki, Matthias; Vaucheret, Hervé
2016-02-01
RNaseIII enzymes catalyze the cleavage of double-stranded RNA (dsRNA) and have diverse functions in RNA maturation. Arabidopsis thaliana RNASE THREE LIKE2 (RTL2), which carries one RNaseIII and two dsRNA binding (DRB) domains, is a unique Arabidopsis RNaseIII enzyme resembling the budding yeast small interfering RNA (siRNA)-producing Dcr1 enzyme. Here, we show that RTL2 modulates the production of a subset of small RNAs and that this activity depends on both its RNaseIII and DRB domains. However, the mode of action of RTL2 differs from that of Dcr1. Whereas Dcr1 directly cleaves dsRNAs into 23-nucleotide siRNAs, RTL2 likely cleaves dsRNAs into longer molecules, which are subsequently processed into small RNAs by the DICER-LIKE enzymes. Depending on the dsRNA considered, RTL2-mediated maturation either improves (RTL2-dependent loci) or reduces (RTL2-sensitive loci) the production of small RNAs. Because the vast majority of RTL2-regulated loci correspond to transposons and intergenic regions producing 24-nucleotide siRNAs that guide DNA methylation, RTL2 depletion modifies DNA methylation in these regions. Nevertheless, 13% of RTL2-regulated loci correspond to protein-coding genes. We show that changes in 24-nucleotide siRNA levels also affect DNA methylation levels at such loci and inversely correlate with mRNA steady state levels, thus implicating RTL2 in the regulation of protein-coding gene expression. © 2016 American Society of Plant Biologists. All rights reserved.
DEFF Research Database (Denmark)
Povlsen, Gro Klitgaard; Berezin, Vladimir; Bock, Elisabeth
2008-01-01
The neural cell adhesion molecule (NCAM) plays important roles in neuronal development, regeneration, and synaptic plasticity. NCAM homophilic binding mediates cell adhesion and induces intracellular signals, in which the fibroblast growth factor receptor plays a prominent role. Recent studies...... this NCAM-180-induced EGFR down-regulation involves increased EGFR ubiquitination and lysosomal EGFR degradation. Furthermore, NCAM-180-mediated EGFR down-regulation requires NCAM homophilic binding and interactions of the cytoplasmic domain of NCAM-180 with intracellular interaction partners, but does...
Directory of Open Access Journals (Sweden)
Koramannil Radha Saradalekshmi
Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.
[Impact of siRNA-mediated down-regulation of CD147 on human breast cancer cells].
Li, Zhenqian; Li, Daoming; Li, Jiangwei; Huang, Pei; Qin, Hui
2015-10-01
To investigate the influence of siRNA-mediated down-regulation of CD147 on growth, proliferation and movement of human breast cancer cell line MDA-MB-231. The protein expression of CD147, MMP-2 and TIMP-2 of the MDA-MB-231 cells were analyzed by ABC. Lentiviral expression vector of CD147 gene was constructed and transfected into MDA-MB-231 cells. RT-PCR and Western blot were used to detect the mRNA and protein level changes of CD147 genes to identify the optimal time point, followed by detection of changes of mRNA and protein expression of MMP-2 and TIMP-2 genes. CCK-8 reagent method and cell scratch test were used to detect the proliferation and migration change of MDA-MB-231 cells. The nude mouse model of breast cancer by hypodermic injection with MDA-MB-231 cells was established to document the effect of CD147 siRNA on the tumor transplants. After transfection of lentiviral expression vector of CD147 gene, protein of CD147, MMP-2 and TIMP-2 were weakly or negative expressed, significantly weaker than those of control group (P CD147 and MMP-2 were 96.03% ± 0.84% and 96.03% ± 0.84%, respectively. Both CD147 mRNA and MMP-2 mRNA expression were down-regulated (P 0.05). No less than 2 days after transfection, cell growth of MDA-MB-231 cell line was found significantly inhibited (P CD147 led to reduction of volume and mass of nude mouses. The growth of the carcinoma transplant was inhibited upon siRNA-mediated down-regulation of CD147 (P CD147 may alter the MMP-2/TIMP-2 balance in MDA-MB-231 cells. CD147 gene silencing inhibits the proliferation and migration of MDA-MB-231 cells and the growth of carcinoma transplants in nude mice.
SMC1-Mediated Intra-S-Phase Arrest Facilitates Bocavirus DNA Replication
Luo, Yong; Deng, Xuefeng; Cheng, Fang; Li, Yi
2013-01-01
Activation of a host DNA damage response (DDR) is essential for DNA replication of minute virus of canines (MVC), a member of the genus Bocavirus of the Parvoviridae family; however, the mechanism by which DDR contributes to viral DNA replication is unknown. In the current study, we demonstrate that MVC infection triggers the intra-S-phase arrest to slow down host cellular DNA replication and to recruit cellular DNA replication factors for viral DNA replication. The intra-S-phase arrest is regulated by ATM (ataxia telangiectasia-mutated kinase) signaling in a p53-independent manner. Moreover, we demonstrate that SMC1 (structural maintenance of chromosomes 1) is the key regulator of the intra-S-phase arrest induced during infection. Either knockdown of SMC1 or complementation with a dominant negative SMC1 mutant blocks both the intra-S-phase arrest and viral DNA replication. Finally, we show that the intra-S-phase arrest induced during MVC infection was caused neither by damaged host cellular DNA nor by viral proteins but by replicating viral genomes physically associated with the DNA damage sensor, the Mre11-Rad50-Nbs1 (MRN) complex. In conclusion, the feedback loop between MVC DNA replication and the intra-S-phase arrest is mediated by ATM-SMC1 signaling and plays a critical role in MVC DNA replication. Thus, our findings unravel the mechanism underlying DDR signaling-facilitated MVC DNA replication and demonstrate a novel strategy of DNA virus-host interaction. PMID:23365434
Drugging the methylome: DNA methylation and memory.
Kennedy, Andrew J; Sweatt, J David
2016-01-01
Over the past decade, since epigenetic mechanisms were first implicated in memory formation and synaptic plasticity, dynamic DNA methylation reactions have been identified as integral to long-term memory formation, maintenance, and recall. This review incorporates various new findings that DNA methylation mechanisms are important regulators of non-Hebbian plasticity mechanisms, suggesting that these epigenetic mechanisms are a fundamental link between synaptic plasticity and metaplasticity. Because the field of neuroepigenetics is so young and the biochemical tools necessary to probe gene-specific questions are just now being developed and used, this review also speculates about the direction and potential of therapeutics that target epigenetic mechanisms in the central nervous system and the unique pharmacokinetic and pharmacodynamic properties that epigenetic therapies may possess. Mapping the dynamics of the epigenome in response to experiential learning, even a single epigenetic mark in isolation, remains a significant technical and bioinformatic hurdle facing the field, but will be necessary to identify changes to the methylome that govern memory-associated gene expression and effectively drug the epigenome.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
International Nuclear Information System (INIS)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun
2012-01-01
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn
2012-11-15
Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.
Ben Maamar, Millissia; Sadler-Riggleman, Ingrid; Beck, Daniel; McBirney, Margaux; Nilsson, Eric; Klukovich, Rachel; Xie, Yeming; Tang, Chong; Yan, Wei; Skinner, Michael K
2018-04-01
Epigenetic transgenerational inheritance of disease and phenotypic variation can be induced by several toxicants, such as vinclozolin. This phenomenon can involve DNA methylation, non-coding RNA (ncRNA) and histone retention, and/or modification in the germline (e.g. sperm). These different epigenetic marks are called epimutations and can transmit in part the transgenerational phenotypes. This study was designed to investigate the vinclozolin-induced concurrent alterations of a number of different epigenetic factors, including DNA methylation, ncRNA, and histone retention in rat sperm. Gestating females (F0 generation) were exposed transiently to vinclozolin during fetal gonadal development. The directly exposed F1 generation fetus, the directly exposed germline within the fetus that will generate the F2 generation, and the transgenerational F3 generation sperm were studied. DNA methylation and ncRNA were altered in each generation rat sperm with the direct exposure F1 and F2 generations being distinct from the F3 generation epimutations. Interestingly, an increased number of differential histone retention sites were found in the F3 generation vinclozolin sperm, but not in the F1 or F2 generations. All three different epimutation types were affected in the vinclozolin lineage transgenerational sperm (F3 generation). The direct exposure generations (F1 and F2) epigenetic alterations were distinct from the transgenerational sperm epimutations. The genomic features and gene pathways associated with the epimutations were investigated to help elucidate the integration of these different epigenetic processes. Our results show that the three different types of epimutations are involved and integrated in the mediation of the epigenetic transgenerational inheritance phenomenon.
DNA methylation of miRNA coding sequences putatively associated with childhood obesity.
Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A
2017-02-01
Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.
Beach, Steven R H; Lei, Man Kit; Ong, Mei Ling; Brody, Gene H; Dogan, Meeshanthini V; Philibert, Robert A
2017-09-01
Smoking has been shown to have a large, reliable, and rapid effect on demethylation of AHRR, particularly at cg05575921, suggesting that methylation may be used as an index of cigarette consumption. Because the availability of methyl donors may also influence the degree of demethylation in response to smoking, factors that affect the activity of methylene tetrahydrofolate reductase (MTHFR), a key regulator of methyl group availability, may be of interest. In the current investigation, we examined the extent to which individual differences in methylation of MTHFR moderated the association between smoking and demethylation at cg05575921 as well as at other loci on AHRR associated with a main effect of smoking. Using a discovery sample (AIM, N = 293), and a confirmatory sample (SHAPE, N = 368) of young adult African Americans, degree of methylation of loci in the first exon of MTHFR was associated with amplification of the association between smoking and AHRR demethylation at cg05575921. However, genetic variation at a commonly studied MTHFR variant, C677T, did not influence cg05575921 methylation. The significant interaction between MTHFR methylation and the smoking-induced response at cg05575921 suggests a role for individual differences in methyl cycle regulation in understanding the effects of cigarette consumption on genome wide DNA methylation. © 2017 Wiley Periodicals, Inc.
[PHI regulates histone methylation and acetylation in Burkitt lymphoma Daudi cell line].
Hong, Ling-Ling; Ma, Xu-Dong; Huang, Yi-Qun
2011-02-01
This study was purposed to investigate the effects of phenylhexyl isothiocyanate (PHI) on Burkitt lymphoma Daudi cell line and regulation of histone acetylation and methylation in Daudi cells, and to explore the potential mechanism. The apoptotic rate of Daudi cells treated with PHI was measured by flow cytometry, the changes of histone H3 and H4 acetylation, histone H3K9 and H3K4 methylation in Daudi cells treated with PHI were detected by Western blot. The results showed that PHI could induce apoptosis of Daudi cells, increased the acetylation level of H3 and H4, enhanced the methylation of H3K4, but reduced the methylation of H3K9. It is concluded that the PHI can up-regulate the acetylation level of histone H3 associated with transcription stimulation and the methylation of histone H3K4, down-regulate the methylation on histone H3K9 associated with transcription inhibition, promotes the apoptosis of Daudi cells. PHI may be a potential agent for target therapy of lymphoma.
MicroRNA-mediated down-regulation of NKG2D ligands contributes to glioma immune escape.
Codo, Paula; Weller, Michael; Meister, Gunter; Szabo, Emese; Steinle, Alexander; Wolter, Marietta; Reifenberger, Guido; Roth, Patrick
2014-09-15
Malignant gliomas are intrinsic brain tumors with a dismal prognosis. They are well-adapted to hypoxic conditions and poorly immunogenic. NKG2D is one of the major activating receptors of natural killer (NK) cells and binds to several ligands (NKG2DL). Here we evaluated the impact of miRNA on the expression of NKG2DL in glioma cells including stem-like glioma cells. Three of the candidate miRNA predicted to target NKG2DL were expressed in various glioma cell lines as well as in glioblastomas in vivo: miR-20a, miR-93 and miR-106b. LNA inhibitor-mediated miRNA silencing up-regulated cell surface NKG2DL expression, which translated into increased susceptibility to NK cell-mediated lysis. This effect was reversed by neutralizing NKG2D antibodies, confirming that enhanced lysis upon miRNA silencing was mediated through the NKG2D system. Hypoxia, a hallmark of glioblastomas in vivo, down-regulated the expression of NKG2DL on glioma cells, associated with reduced susceptibility to NK cell-mediated lysis. This process, however, was not mediated through any of the examined miRNA. Accordingly, both hypoxia and the expression of miRNA targeting NKG2DL may contribute to the immune evasion of glioma cells at the level of the NKG2D recognition pathway. Targeting miRNA may therefore represent a novel approach to increase the immunogenicity of glioblastoma.
DNA methylation, microRNAs, and their crosstalk as potential biomarkers in hepatocellular carcinoma
Anwar, Sumadi Lukman; Lehmann, Ulrich
2014-01-01
Epigenetic alterations have been identified as a major characteristic in human cancers. Advances in the field of epigenetics have contributed significantly in refining our knowledge of molecular mechanisms underlying malignant transformation. DNA methylation and microRNA expression are epigenetic mechanisms that are widely altered in human cancers including hepatocellular carcinoma (HCC), the third leading cause of cancer related mortality worldwide. Both DNA methylation and microRNA expression patterns are regulated in developmental stage specific-, cell type specific- and tissue-specific manner. The aberrations are inferred in the maintenance of cancer stem cells and in clonal cell evolution during carcinogenesis. The availability of genome-wide technologies for DNA methylation and microRNA profiling has revolutionized the field of epigenetics and led to the discovery of a number of epigenetically silenced microRNAs in cancerous cells and primary tissues. Dysregulation of these microRNAs affects several key signalling pathways in hepatocarcinogenesis suggesting that modulation of DNA methylation and/or microRNA expression can serve as new therapeutic targets for HCC. Accumulative evidence shows that aberrant DNA methylation of certain microRNA genes is an event specifically found in HCC which correlates with unfavorable outcomes. Therefore, it can potentially serve as a biomarker for detection as well as for prognosis, monitoring and predicting therapeutic responses in HCC. PMID:24976726
Altered DNA methylation: a secondary mechanism involved in carcinogenesis.
Goodman, Jay I; Watson, Rebecca E
2002-01-01
This review focuses on the role that DNA methylation plays in the regulation of normal and aberrant gene expression and on how, in a hypothesis-driven fashion, altered DNA methylation may be viewed as a secondary mechanism involved in carcinogenesis. Research aimed at discerning the mechanisms by which chemicals can transform normal cells into frank carcinomas has both theoretical and practical implications. Through an increased understanding of the mechanisms by which chemicals affect the carcinogenic process, we learn more about basic biology while, at the same time, providing the type of information required to make more rational safety assessment decisions concerning their actual potential to cause cancer under particular conditions of exposure. One key question is: does the mechanism of action of the chemical in question involve a secondary mechanism and, if so, what dose may be below its threshold?
Regulation Mechanism of HBV cccDNA
Directory of Open Access Journals (Sweden)
Cheng Jun
2012-06-01
Full Text Available Covalently closed circular (ccc DNA of hepatitis B virus (HBV existed in the nuclei of HBV infected hepatocytes with a half-life time of 14.3 years in a mathematic model. Viral protein feedback regulation in HBV life cycle to maintain vital viral replication is an important mechanism. Interleukin-6, epithelial growth factor, heme oxygenase-1, histones, and hepatocyte nuclear factors are demonstrated as the key regulators for HBV life cycle. CpG island structure and methylation status are involved in the regulation of HBV DNA replication. Nucleos(tide analogues are widely used in the clinical practice for the treatment of chronic hepatitis B patients, although no evidence indicating a direct inhibiton of HBV cccDNA. In the future, along with the study of HBV life cycle, new drugs including RNA interference technique, will pave the way to eliminate the HBV cccDNA from infected hepatocytes resulting final cure of chronic hepatitis B.
Directory of Open Access Journals (Sweden)
Gaëlle Demarre
2010-05-01
Full Text Available DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.
Maternal Methyl-Group Donor Intake and Global DNA (HydroxyMethylation before and during Pregnancy
Directory of Open Access Journals (Sweden)
Sara Pauwels
2016-08-01
Full Text Available It is still unclear to which extent methyl-group intake during pregnancy can affect maternal global DNA (hydroxylmethylation. Pregnancy methylation profiling and its link with methyl-group intake in a healthy population could enhance our understanding of the development of pregnancy related disorders. One hundred forty-eight women were enrolled in the MANOE (MAternal Nutrition and Offspring’s Epigenome study. Thiry-four women were enrolled before pregnancy and 116 during the first trimester of pregnancy. Global DNA (hydroxymethylation in blood using LC-MS/MS and dietary methyl-group intake (methionine, folate, betaine, and choline using a food-frequency questionnaire were estimated pre-pregnancy, during each trimester, and at delivery. Global DNA (hydroxymethylation levels were highest pre-pregnancy and at weeks 18–22 of pregnancy. We observed a positive relation between folic acid and global DNA methylation (p = 0.04 and hydroxymethylation (p = 0.04. A high intake of methionine pre-pregnancy and in the first trimester showed lower (hydroxymethylation percentage in weeks 11–13 and weeks 18–22, respectively. Choline and betaine intake in the first weeks was negatively associated with hydroxymethylation. Women with a high intake of these three methyl groups in the second and third trimester showed higher hyrdoxymethylation/methylation levels in the third trimester. To conclude, a time trend in DNA (hydroxymethylation was found and women with higher methyl-group intake showed higher methylation in the third trimester, and not in earlier phases of pregnancy.
Modeling spatiotemporal dynamics of DNA methylation
DEFF Research Database (Denmark)
Lövkvist, Cecilia Elisabet
into how epigenetic marks are distributed in the human genome. In the first part of the thesis, we investigate DNA methylation and maintenance of methylation patterns throughout cell division. We argue that collaborative models, those where the methylation of CpG sites depends on the methylation status...... into the game more explicitly in another type of model that speaks out the duality of the two aspects. Using statistical analysis of experimental data, this thesis further explores a link between DNA methylation and nucleosome occupancy. By comparing the patterns on promoters to regions with similar Cp...... division. The patterns of epigentic marks depend on enzymes that ensure their maintenance and introduction. Using theoretical models, this thesis proposes new mechanisms for how enzymes operate to maintain patterns of epigenetic marks. Through analysis of experimental data this work gives new insight...
Chen, Xing-Shu; Huang, Nanxin; Michael, Namaka; Xiao, Lan
2015-01-01
Schizophrenia (SZ) is a chronic and severe mental illness for which currently there is no cure. At present, the exact molecular mechanism involved in the underlying pathogenesis of SZ is unknown. The disease is thought to be caused by a combination of genetic, biological, psychological, and environmental factors. Recent studies have shown that epigenetic regulation is involved in SZ pathology. Specifically, DNA methylation, one of the earliest found epigenetic modifications, has been extensively linked to modulation of neuronal function, leading to psychiatric disorders such as SZ. However, increasing evidence indicates that glial cells, especially dysfunctional oligodendrocytes undergo DNA methylation changes that contribute to the pathogenesis of SZ. This review primarily focuses on DNA methylation involved in glial dysfunctions in SZ. Clarifying this mechanism may lead to the development of new therapeutic interventional strategies for the treatment of SZ and other illnesses by correcting abnormal methylation in glial cells.
Directory of Open Access Journals (Sweden)
Xin-Shu eChen
2015-12-01
Full Text Available Schizophrenia (SZ)is a chronic and severe mental illness for which currently there is no cure. At present, the exact molecular mechanism involved in the underlying pathogenesis of SZ is unknown. The disease is thought to be caused by a combination of genetic, biological, psychological, and environmental factors. Recent studies have shown that epigenetic regulation is involved in SZ pathology. Specifically, DNA methylation, one of the earliest found epigenetic modifications, has been extensively linked to modulation of neuronal function, leading to psychiatric disorders such as SZ. However, increasing evidence indicates that glial cells, especially dysfunctional oligodendrocytes undergo DNA methylation changes that contribute to the pathogenesis of SZ. This review primarily focuses on DNA methylation involved in glial dysfunctions in SZ. Clarifying this mechanism may lead to the development of new therapeutic interventional strategies for the treatment of SZ and other illnesses by correcting abnormal methylation in glial cells.
Directory of Open Access Journals (Sweden)
Diane I Schroeder
2015-08-01
Full Text Available Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs and highly methylated domains (HMDs with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo.
Energy Technology Data Exchange (ETDEWEB)
Luzhna, Lidia [Department of Biological Sciences, University of Lethbridge, AB, Canada T1K 3M4 (Canada); Kovalchuk, Olga, E-mail: olga.kovalchuk@uleth.ca [Department of Biological Sciences, University of Lethbridge, AB, Canada T1K 3M4 (Canada)
2010-02-05
Chemoresistant tumors often fail to respond to other cytotoxic treatments such as radiation therapy. The mechanisms of chemo- and radiotherapy cross resistance are not fully understood and are believed to be epigenetic in nature. We hypothesize that MCF-7 cells and their doxorubicin-resistant variant MCF-7/DOX cells may exhibit different responses to ionizing radiation due to their dissimilar epigenetic status. Similar to previous studies, we found that MCF-7/DOX cells harbor much lower levels of global DNA methylation than MCF-7 cells. Furthermore, we found that MCF-7/DOX cells had lower background apoptosis levels and were less responsive to radiation than MCF-7 cells. Decreased radiation responsiveness correlated to significant global DNA hypomethylation in MCF-7/DOX cells. Here, for the first time, we show that the radiation resistance of MCF-7/DOX cells can be reversed by an epigenetic treatment - the application of methyl-donor SAM. SAM-mediated reversal of DNA methylation led to elevated radiation sensitivity in MCF-7/DOX cells. Contrarily, application of SAM on the radiation sensitive and higher methylated MCF-7 cells resulted in a decrease in their radiation responsiveness. This data suggests that a fine balance of DNA methylation is needed to insure proper radiation and drug responsiveness.
Ding, Guanghui; Wang, Luyan; Zhang, Jing; Wei, Yuanyuan; Wei, Lie; Li, Yang; Shao, Mihua; Xiong, Deqi
2015-06-01
Perfluorooctane sulfonate (PFOS) is an ubiquitous persistent organic pollutant, which can be bioaccumulated and cause adverse effects on organisms. However, there is very limited information about the toxic effects of PFOS to marine organisms and its mechanisms. Therefore, in the present study, adult sea urchins Glyptocidaris crenularis were exposed to PFOS for 21 d, followed by a 7-d depuration period, in order to investigate the toxicity of PFOS to sea urchin and its potential epigenetic mechanisms. Sea urchins dropped spines, and lowered down the motor ability and feeding ability after the PFOS exposure. Superoxide dismutase activities in supernatant of coelomic fluid of sea urchin increased firstly and then dropped down, while the change of the catalase activity took an opposite trend during the exposure period. They both approached to the corresponding activity of the control after the depuration period. The DNA methylation polymorphism, methylation rate and demethylation rate in sea urchin gonad all increased following the prolonged exposure time, and then decreased after the depuration period. The demethylation rates were lower than the corresponding methylation rates, therefore methylation events were dominant during the whole experimental period. This might suggest that sea urchin have strong self-protection mechanisms and can survive from the PFOS exposure presented in this study. Further efforts are needed to more precisely investigate the DNA methylation effects of PFOS and the self-protection mechanism of sea urchin. Copyright © 2015 Elsevier Ltd. All rights reserved.
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Directory of Open Access Journals (Sweden)
Tochiki Keri K
2012-02-01
Full Text Available Abstract Background DNA CpG methylation is carried out by DNA methyltransferases and induces chromatin remodeling and gene silencing through a transcription repressor complex comprising the methyl-CpG-binding protein 2 (MeCP2 and a subset of histone deacetylases. Recently, we have found that MeCP2 activity had a crucial role in the pattern of gene expression seen in the superficial dorsal horn rapidly after injection of Complete Freund's Adjuvant (CFA in the rat ankle joint. The aim of the present study was to analyse the changes in expression of MeCP2, DNA methyltransferases and a subset of histone deacetylases in the superficial dorsal horn during the maintenance phase of persistent pain states. In this process, the cell specific expression of MeCP2 was also investigated. Results Using immunohistochemistry, we found that neurones, oligodendrocytes and astrocytes expressed MeCP2. Microglia, oligodendrocyte precursor cells and Schwann cells never showed any positive stain for MeCP2. Quantitative analyses showed that MeCP2 expression was increased in the superficial dorsal horn 7 days following CFA injection in the ankle joint but decreased 7 days following spared nerve injury. Overall, the expression of DNA methyltransferases and a subset of histone deacetylases followed the same pattern of expression. However, there were no significant changes in the expression of the MeCP2 targets that we had previously shown are regulated in the early time points following CFA injection in the ankle joint. Finally, the expression of MeCP2 was also down regulated in damaged dorsal root ganglion neurones following spared nerve injury. Conclusion Our results strongly suggest that changes in chromatin compaction, regulated by the binding of MeCP2 complexes to methylated DNA, are involved in the modulation of gene expression in the superficial dorsal horn and dorsal root ganglia during the maintenance of persistent pain states.
International Nuclear Information System (INIS)
Tong, Joanna H; Lo, Kwok W; To, Ka F; Ng, David C; Chau, Shuk L; So, Ken K; Leung, Patrick P; Lee, Tin L; Lung, Raymond W; Chan, Michael W; Chan, Anthony W
2010-01-01
Human Disabled-2 (DAB2), is a multi-function signalling molecule that it is frequently down-regulated in human cancers. We aimed to investigate the possible tumour suppressor effect of DAB2 in nasopharyngeal carcinoma (NPC). We studied the expression of DAB2 in NPC cell lines, xenografts and primary tumour samples. The status of promoter methylation was assessed by methylation specific PCR and bisulfite sequencing. The functional role of DAB2 in NPC was investigated by re-introducing DAB2 expression into NPC cell line C666-1. Decrease or absent of DAB2 transcript was observed in NPC cell lines and xenografts. Loss of DAB2 protein expression was seen in 72% (33/46) of primary NPC as demonstrated by immunohistochemistry. Aberrant DAB2 promoter methylation was detected in 65.2% (30/46) of primary NPC samples by methylation specific PCR. Treatment of the DAB2 negative NPC cell line C666-1 with 5-aza-2'-deoxycytidine resulted in restoration of DAB2 expression in a dose-dependent manner. Overexpression of DAB2 in NPC cell line C666-1 resulted in reduced growth rate and 35% reduction in anchorage-dependent colony formation, and inhibition of serum-induced c-Fos expression compared to vector-transfected controls. Over expression of DAB2 resulted in alterations of multiple pathways as demonstrated by expression profiling and functional network analysis, which confirmed the role of DAB2 as an adaptor molecule involved in multiple receptor-mediated signalling pathways. We report the frequent down regulation of DAB2 in NPC and the promoter hypermethylation contributes to the loss of expression of DAB2. This is the first study demonstrating frequent DAB2 promoter hypermethylation in human cancer. Our functional studies support the putative tumour suppressor effect of DAB2 in NPC cells
Genomic DNA methylation-demethylation during aging and reinvigoration of Pinus radiata.
Fraga, Mario F; Rodríguez, Roberto; Cañal, Maria Jesús
2002-08-01
In animals, DNA methylation is related to gene silencing during ontogenic development. Little is known about DNA methylation in plants, although occasional changes in the DNA methylation state of specific gene promoters have been reported in angiosperms during some developmental processes. We found large differences in the extent of DNA methylation between meristematic areas of juvenile and mature Pinus radiata D. Don. trees, whereas differences in the extent of DNA methylation between differentiated tissues of juvenile and mature trees were small. In meristematic areas, there was a gradual decrease in extent of DNA methylation as the degree of reinvigoration increased. The observed changes in extent of DNA methylation during aging and reinvigoration indicate that reinvigoration could be a consequence of epigenetic modifications opposite in direction to those that occur during aging.
International Nuclear Information System (INIS)
Klajic, Jovana; Tost, Jörg; Kristensen, Vessela N; Fleischer, Thomas; Dejeux, Emelyne; Edvardsen, Hege; Warnberg, Fredrik; Bukholm, Ida; Lønning, Per Eystein; Solvang, Hiroko; Børresen-Dale, Anne-Lise
2013-01-01
Aberrant DNA methylation of regulatory genes has frequently been found in human breast cancers and correlated to clinical outcome. In the present study we investigate stage specific changes in the DNA methylation patterns in order to identify valuable markers to understand how these changes affect breast cancer progression. Quantitative DNA methylation analyses of 12 candidate genes ABCB1, BRCCA1, CDKN2A, ESR1, GSTP1, IGF2, MGMT, HMLH1, PPP2R2B, PTEN, RASSF1A and FOXC1 was performed by pyrosequencing a series of 238 breast cancer tissue samples from DCIS to invasive tumors stage I to IV. Significant differences in methylation levels between the DCIS and invasive stage II tumors were observed for six genes RASSF1A, CDKN2A, MGMT, ABCB1, GSTP1 and FOXC1. RASSF1A, ABCB1 and GSTP1 showed significantly higher methylation levels in late stage compared to the early stage breast carcinoma. Z-score analysis revealed significantly lower methylation levels in DCIS and stage I tumors compared with stage II, III and IV tumors. Methylation levels of PTEN, PPP2R2B, FOXC1, ABCB1 and BRCA1 were lower in tumors harboring TP53 mutations then in tumors with wild type TP53. Z-score analysis showed that TP53 mutated tumors had significantly lower overall methylation levels compared to tumors with wild type TP53. Methylation levels of RASSF1A, PPP2R2B, GSTP1 and FOXC1 were higher in ER positive vs. ER negative tumors and methylation levels of PTEN and CDKN2A were higher in HER2 positive vs. HER2 negative tumors. Z-score analysis also showed that HER2 positive tumors had significantly higher z-scores of methylation compared to the HER2 negative tumors. Univariate survival analysis identifies methylation status of PPP2R2B as significant predictor of overall survival and breast cancer specific survival. In the present study we report that the level of aberrant DNA methylation is higher in late stage compared with early stage of invasive breast cancers and DCIS for genes mentioned above
McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M
2016-06-01
Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Petropoulos, Sophie; Guillemin, Claire; Ergaz, Zivanit; Dimov, Sergiy; Suderman, Matthew; Weinstein-Fudim, Liza; Ornoy, Asher; Szyf, Moshe
2015-06-01
Gestational diabetes is associated with risk for metabolic disease later in life. Using a cross-species approach in rat and humans, we examined the hypothesis that gestational diabetes during pregnancy triggers changes in the methylome of the offspring that might be mediating these risks. We show in a gestation diabetes rat model, the Cohen diabetic rat, that gestational diabetes triggers wide alterations in DNA methylation in the placenta in both candidate diabetes genes and genome-wide promoters, thus providing evidence for a causal relationship between diabetes during pregnancy and DNA methylation alterations. There is a significant overlap between differentially methylated genes in the placenta and the liver of the rat offspring. Several genes differentially methylated in rat placenta exposed to maternal diabetes are also differentially methylated in the human placenta of offspring exposed to gestational diabetes in utero. DNA methylation changes inversely correlate with changes in expression. The changes in DNA methylation affect known functional gene pathways involved in endocrine function, metabolism, and insulin responses. These data provide support to the hypothesis that early-life exposures and their effects on metabolic disease are mediated by DNA methylation changes. This has important diagnostic and therapeutic implications.
Epigenetic changes in neurology: DNA methylation in multiple sclerosis.
Iridoy Zulet, M; Pulido Fontes, L; Ayuso Blanco, T; Lacruz Bescos, F; Mendioroz Iriarte, M
2017-09-01
Epigenetics is defined as the study of the mechanisms that regulate gene expression without altering the underlying DNA sequence. The best known is DNA methylation. Multiple Sclerosis (MS) is a disease with no entirely known etiology, in which it is stated that the involvement of environmental factors on people with a genetic predisposition, may be key to the development of the disease. It is at this intersection between genetic predisposition and environmental factors where DNA methylation may play a pathogenic role. A literature review of the effects of environmental risk factors for the development of MS can have on the different epigenetic mechanisms as well as the implication that such changes have on the development of the disease. Knowledge of epigenetic modifications involved in the pathogenesis of MS, opens a new avenue of research for identification of potential biomarkers, as well as finding new therapeutic targets. Copyright © 2015 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.
Wang, Wensheng; Zhao, Xiuqin; Pan, Yajiao; Zhu, Linghua; Fu, Binying; Li, Zhikang
2011-09-20
DNA methylation, one of the most important epigenetic phenomena, plays a vital role in tuning gene expression during plant development as well as in response to environmental stimuli. In the present study, a methylation-sensitive amplified polymorphism (MSAP) analysis was performed to profile DNA methylation changes in two contrasting rice genotypes under salt stress. Consistent with visibly different phenotypes in response to salt stress, epigenetic markers classified as stable inter-cultivar DNA methylation differences were determined between salt-tolerant FL478 and salt-sensitive IR29. In addition, most tissue-specific DNA methylation loci were conserved, while many of the growth stage-dependent DNA methylation loci were dynamic between the two genotypes. Strikingly, salt stress induced a decrease in DNA methylation specifically in roots at the seedling stage that was more profound in IR29 than in the FL478. This result may indicate that demethylation of genes is an active epigenetic response to salt stress in roots at the seedling stage, and helps to further elucidate the implications of DNA methylation in crop growth and development. Copyright © 2011. Published by Elsevier Ltd.
Vogel, S. de; Wouters, K.A.D.; Gottschalk, R.W.H.; Schooten, F.J. van; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Weijenberg, M.P.; Engeland, M. van
2009-01-01
Aberrant DNA methylation affects carcinogenesis of colorectal cancer. Folate metabolizing enzymes may influence the bioavailability of methyl groups, whereas DNA and histone methyltransferases are involved in epigenetic regulation of gene expression. We studied associations of genetic variants of
Loudin, Michael G.; Wang, Jinhua; Leung, Hon-Chiu Eastwood; Gurusiddappa, Sivashankarappa; Meyer, Julia; Condos, Gregory; Morrison, Debra; Tsimelzon, Anna; Devidas, Meenakshi; Heerema, Nyla A.; Carroll, Andrew J.; Plon, Sharon E.; Hunger, Stephen P.; Basso, Giuseppe; Pession, Andrea; Bhojwani, Deepa; Carroll, William L.; Rabin, Karen R.
2014-01-01
Patients with Down syndrome (DS) and acute lymphoblastic leukemia (ALL) have distinct clinical and biological features. Whereas most DS-ALL cases lack the sentinel cytogenetic lesions that guide risk assignment in childhood ALL, JAK2 mutations and CRLF2 overexpression are highly enriched. To further characterize the unique biology of DS-ALL, we performed genome-wide profiling of 58 DS-ALL and 68 non-Down syndrome (NDS) ALL cases by DNA copy number, loss of heterozygosity, gene expression, and methylation analyses. We report a novel deletion within the 6p22 histone gene cluster as significantly more frequent in DS-ALL, occurring in 11 DS (22%) and only two NDS cases (3.1%) (Fisher’s exact p = 0.002). Homozygous deletions yielded significantly lower histone expression levels, and were associated with higher methylation levels, distinct spatial localization of methylated promoters, and enrichment of highly methylated genes for specific pathways and transcription factor binding motifs. Gene expression profiling demonstrated heterogeneity of DS-ALL cases overall, with supervised analysis defining a 45-transcript signature associated with CRLF2 overexpression. Further characterization of pathways associated with histone deletions may identify opportunities for novel targeted interventions. PMID:21647151
Yokoyama, Amy S; Dunaway, Keith; Rutkowsky, Jennifer; Rutledge, John C; Milenkovic, Dragan
2018-02-21
In our previous work in mice, we have shown that chronic consumption of a Western diet (WD; 42% kcal fat, 0.2% total cholesterol and 34% sucrose) is correlated with impaired cognitive function. Cognitive decline has also been associated with alterations in DNA methylation. Additionally, although there have been many studies analyzing the effect of maternal consumption of a WD on DNA methylation in the offspring, few studies have analyzed how an individual's consumption of a WD can impact his/her DNA methylation. Since the frontal cortex is involved in the regulation of cognitive function and is often affected in cases of cognitive decline, this study aimed to examine how chronic consumption of a WD affects DNA methylation in the frontal cortex of mice. Eight-week-old male mice were fed either a control diet (CD) or a WD for 12 weeks, after which time alterations in DNA methylation were analyzed. Assessment of global DNA methylation in the frontal cortex using dot blot analysis revealed that there was a decrease in global DNA methylation in the WD-fed mice compared with the CD-fed mice. Bioinformatic analysis identified several networks and pathways containing genes displaying differential methylation, particularly those involved in metabolism, cell adhesion and cytoskeleton integrity, inflammation and neurological function. In conclusion, the results from this study suggest that consumption of a WD alters DNA methylation in the frontal cortex of mice and could provide one of the mechanisms by which consumption of a WD impairs cognitive function.
Charlet, Jessica; Tomari, Ayumi; Dallosso, Anthony R.; Szemes, Marianna; Kaselova, Martina; Curry, Thomas J.; Almutairi, Bader; Etchevers, Heather C.; McConville, Carmel; Malik, Karim T. A.
2016-01-01
Neuroblastoma is a childhood cancer in which many children still have poor outcomes, emphasising the need to better understand its pathogenesis. Despite recent genome‐wide mutation analyses, many primary neuroblastomas do not contain recognizable driver mutations, implicating alternate molecular pathologies such as epigenetic alterations. To discover genes that become epigenetically deregulated during neuroblastoma tumorigenesis, we took the novel approach of comparing neuroblastomas to neural crest precursor cells, using genome‐wide DNA methylation analysis. We identified 93 genes that were significantly differentially methylated of which 26 (28%) were hypermethylated and 67 (72%) were hypomethylated. Concentrating on hypermethylated genes to identify candidate tumor suppressor loci, we found the cell engulfment and adhesion factor gene MEGF10 to be epigenetically repressed by DNA hypermethylation or by H3K27/K9 methylation in neuroblastoma cell lines. MEGF10 showed significantly down‐regulated expression in neuroblastoma tumor samples; furthermore patients with the lowest‐expressing tumors had reduced relapse‐free survival. Our functional studies showed that knock‐down of MEGF10 expression in neuroblastoma cell lines promoted cell growth, consistent with MEGF10 acting as a clinically relevant, epigenetically deregulated neuroblastoma tumor suppressor gene. © 2016 The Authors. Molecular Carcinogenesis Published by Wiley Periodicals, Inc. PMID:27862318
Energy Technology Data Exchange (ETDEWEB)
Wu, Yuting, E-mail: wuyuting1302@sina.com; Bu, Fangtian; Yu, Haixia; Li, Wanxia; Huang, Cheng; Meng, Xiaoming; Zhang, Lei; Ma, Taotao; Li, Jun, E-mail: lj@ahmu.edu.cn
2017-01-15
Liver fibrosis, resulting from chronic and persistent injury to the liver, is a worldwide health problem. Advanced liver fibrosis results in cirrhosis, liver failure and even hepatocellular cancer (HCC), often eventually requiring liver transplantation, poses a huge health burden on the global community. However, the specific pathogenesis of liver fibrosis remains not fully understood. Numerous basic and clinical studies have provided evidence that epigenetic modifications, especially DNA methylation, might contribute to the activation of hepatic stellate cells (HSCs), the pivotal cell type responsible for the fibrous scar in liver. Here, reduced representation bisulfite sequencing (RRBS) and bisulfite pyrosequencing PCR (BSP) analysis identified hypermethylation status of Septin9 (Sept9) gene in liver fibrogenesis. Sept9 protein was dramatically decreased in livers of CCl4-treated mice and immortalized HSC-T6 cells exposed to TGF-β1. Nevertheless, the suppression of Sept9 could be blocked by DNMT3a-siRNA and DNA methyltransferase inhibitor, 5-aza-2′-deoxycytidine (5-azadC). Overexpressed Sept9 attenuated TGF-β1-induced expression of myofibroblast markers α-SMA and Col1a1, accompanied by up-regulation of cell apoptosis-related proteins. Conversely, RNAi-mediated silencing of Sept9 enhanced accumulation of extracellular matrix. These observations suggested that Sept9 contributed to alleviate liver fibrosis might partially through promoting activated HSCs apoptosis and this anti-fibrogenesis effect might be blocked by DNMT-3a mediated methylation of Sept9. Therefore, pharmacological agents that inhibit Sept9 methylation and increase its expression could be considered as valuable treatments for liver fibrosis. - Highlights: • This is the first report of Sept9 methylation and function in liver fibrosis. • Ectopic expression of Sept9 could block the liver fibrogenesis. • DNMT3a might be responsible for the suppression of Sept9 in liver fibrosis.
International Nuclear Information System (INIS)
Wu, Yuting; Bu, Fangtian; Yu, Haixia; Li, Wanxia; Huang, Cheng; Meng, Xiaoming; Zhang, Lei; Ma, Taotao; Li, Jun
2017-01-01
Liver fibrosis, resulting from chronic and persistent injury to the liver, is a worldwide health problem. Advanced liver fibrosis results in cirrhosis, liver failure and even hepatocellular cancer (HCC), often eventually requiring liver transplantation, poses a huge health burden on the global community. However, the specific pathogenesis of liver fibrosis remains not fully understood. Numerous basic and clinical studies have provided evidence that epigenetic modifications, especially DNA methylation, might contribute to the activation of hepatic stellate cells (HSCs), the pivotal cell type responsible for the fibrous scar in liver. Here, reduced representation bisulfite sequencing (RRBS) and bisulfite pyrosequencing PCR (BSP) analysis identified hypermethylation status of Septin9 (Sept9) gene in liver fibrogenesis. Sept9 protein was dramatically decreased in livers of CCl4-treated mice and immortalized HSC-T6 cells exposed to TGF-β1. Nevertheless, the suppression of Sept9 could be blocked by DNMT3a-siRNA and DNA methyltransferase inhibitor, 5-aza-2′-deoxycytidine (5-azadC). Overexpressed Sept9 attenuated TGF-β1-induced expression of myofibroblast markers α-SMA and Col1a1, accompanied by up-regulation of cell apoptosis-related proteins. Conversely, RNAi-mediated silencing of Sept9 enhanced accumulation of extracellular matrix. These observations suggested that Sept9 contributed to alleviate liver fibrosis might partially through promoting activated HSCs apoptosis and this anti-fibrogenesis effect might be blocked by DNMT-3a mediated methylation of Sept9. Therefore, pharmacological agents that inhibit Sept9 methylation and increase its expression could be considered as valuable treatments for liver fibrosis. - Highlights: • This is the first report of Sept9 methylation and function in liver fibrosis. • Ectopic expression of Sept9 could block the liver fibrogenesis. • DNMT3a might be responsible for the suppression of Sept9 in liver fibrosis.
Zhang, Ting; Liu, Yan; Chen, Hong; Gao, Jiancao; Zhang, Yingying; Yuan, Cong; Wang, Zaizhao
2017-08-01
Both cytochrome P450c17 (CYP17A1) and P-450 side chain cleavage (CYP11A1) play important roles in steroid biosynthesis. According to our previous studies, bisphenol A (BPA) could regulate the mRNA expression of cyp17a1 and cyp11a1 in rare minnow Gobiocypris rarus. However, the potential mechanism of the regulation is barely understood. In the present study, aiming to explore how BPA affects the mRNA expression of cyp17a1 and cyp11a1 in testes and ovaries of G. rarus, we firstly cloned 340-bp fragment of 5' flanking region of cyp11a1 and then detected the methylation level of CpG loci involved in 5' flanking of cyp11a1 and cyp17a1 and their mRNA expression levels. Results showed that exposure to BPA significantly increased serum estradiol (E2) and 11-ketotesterone (11-KT) concentrations. Ovarian mRNA expression of cyp17a1 and cyp11a1 were significantly decreased after BPA exposure 7- for and 14-days. However, transcriptions of testicular cyp17a1 and cyp11a1 were significantly increased and decreased respectively after BPA treatment for 14days. The DNA methylation levels of cyp17a1 were decreased in ovaries on day 7 and increased in ovaries and decreased in testes respectively on day 14. The methylation levels of cyp11a1 were increased in ovaries on day 7 and both ovaries and testes on day 14. There were a significant correlation between DNA methylation at specific CpG loci and cyp17a1 and cyp11a1 genes transcription levels. In conclusion, the CpG loci methylation in 5' flanking region appears to involve in the regulation of mRNA expression of cyp17a1 and cyp11a1 mediated by BPA. Copyright © 2017 Elsevier Inc. All rights reserved.
Links between DNA methylation and nucleosome occupancy in the human genome.
Collings, Clayton K; Anderson, John N
2017-01-01
DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.
International Nuclear Information System (INIS)
Changchien, Jung-Jung; Chen, Ying-Jung; Huang, Chia-Hui; Cheng, Tian-Lu; Lin, Shinne-Ren; Chang, Long-Sen
2015-01-01
Although previous studies have revealed the anti-cancer activity of quinacrine, its effect on leukemia is not clearly resolved. We sought to explore the cytotoxic effect and mechanism of quinacrine action in human leukemia K562 cells. Quinacrine induced K562 cell apoptosis accompanied with ROS generation, mitochondrial depolarization, and down-regulation of BCL2L1 and BCL2. Upon exposure to quinacrine, ROS-mediated p38 MAPK activation and ERK inactivation were observed in K562 cells. Quinacrine-induced cell death and mitochondrial depolarization were suppressed by the p38MAPK inhibitor SB202190 and constitutively active MEK1 over-expression. Activation of p38 MAPK was shown to promote BCL2 degradation. Further, ERK inactivation suppressed c-Jun-mediated transcriptional expression of BCL2L1. Over-expression of BCL2L1 and BCL2 attenuated quinacrine-evoked mitochondrial depolarization and rescued the viability of quinacrine-treated cells. Taken together, our data indicate that quinacrine-induced K562 cell apoptosis is mediated through mitochondrial alterations triggered by p38 MAPK-mediated BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression. - Highlights: • Quinacrine induces K562 cell apoptosis via down-regulation of BCL2 and BCL2L1. • Quinacrine induces p38 MAPK activation and ERK inactivation in K562 cells. • Quinacrine elicits p38 MAPK-mediated BCL2 down-regulation. • Quinacrine suppresses ERK/c-Jun-mediated BCL2L1 expression
Stathmin Mediates Hepatocyte Resistance to Death from Oxidative Stress by down Regulating JNK
Zhao, Enpeng; Amir, Muhammad; Lin, Yu; Czaja, Mark J.
2014-01-01
Stathmin 1 performs a critical function in cell proliferation by regulating microtubule polymerization. This proliferative function is thought to explain the frequent overexpression of stathmin in human cancer and its correlation with a bad prognosis. Whether stathmin also functions in cell death pathways is unclear. Stathmin regulates microtubules in part by binding free tubulin, a process inhibited by stathmin phosphorylation from kinases including c-Jun N-terminal kinase (JNK). The involvement of JNK activation both in stathmin phosphorylation, and in hepatocellular resistance to oxidative stress, led to an examination of the role of stathmin/JNK crosstalk in oxidant-induced hepatocyte death. Oxidative stress from menadione-generated superoxide induced JNK-dependent stathmin phosphorylation at Ser-16, Ser-25 and Ser-38 in hepatocytes. A stathmin knockdown sensitized hepatocytes to both apoptotic and necrotic cell death from menadione without altering levels of oxidant generation. The absence of stathmin during oxidative stress led to JNK overactivation that was the mechanism of cell death as a concomitant knockdown of JNK1 or JNK2 blocked death. Hepatocyte death from JNK overactivation was mediated by the effects of JNK on mitochondria. Mitochondrial outer membrane permeabilization occurred in stathmin knockdown cells at low concentrations of menadione that triggered apoptosis, whereas mitochondrial β-oxidation and ATP homeostasis were compromised at higher, necrotic menadione concentrations. Stathmin therefore mediates hepatocyte resistance to death from oxidative stress by down regulating JNK and maintaining mitochondrial integrity. These findings demonstrate a new mechanism by which stathmin promotes cell survival and potentially tumor growth. PMID:25285524
Stathmin mediates hepatocyte resistance to death from oxidative stress by down regulating JNK.
Directory of Open Access Journals (Sweden)
Enpeng Zhao
Full Text Available Stathmin 1 performs a critical function in cell proliferation by regulating microtubule polymerization. This proliferative function is thought to explain the frequent overexpression of stathmin in human cancer and its correlation with a bad prognosis. Whether stathmin also functions in cell death pathways is unclear. Stathmin regulates microtubules in part by binding free tubulin, a process inhibited by stathmin phosphorylation from kinases including c-Jun N-terminal kinase (JNK. The involvement of JNK activation both in stathmin phosphorylation, and in hepatocellular resistance to oxidative stress, led to an examination of the role of stathmin/JNK crosstalk in oxidant-induced hepatocyte death. Oxidative stress from menadione-generated superoxide induced JNK-dependent stathmin phosphorylation at Ser-16, Ser-25 and Ser-38 in hepatocytes. A stathmin knockdown sensitized hepatocytes to both apoptotic and necrotic cell death from menadione without altering levels of oxidant generation. The absence of stathmin during oxidative stress led to JNK overactivation that was the mechanism of cell death as a concomitant knockdown of JNK1 or JNK2 blocked death. Hepatocyte death from JNK overactivation was mediated by the effects of JNK on mitochondria. Mitochondrial outer membrane permeabilization occurred in stathmin knockdown cells at low concentrations of menadione that triggered apoptosis, whereas mitochondrial β-oxidation and ATP homeostasis were compromised at higher, necrotic menadione concentrations. Stathmin therefore mediates hepatocyte resistance to death from oxidative stress by down regulating JNK and maintaining mitochondrial integrity. These findings demonstrate a new mechanism by which stathmin promotes cell survival and potentially tumor growth.
Forensic DNA methylation profiling from evidence material for investigative leads
Lee, Hwan Young; Lee, Soong Deok; Shin, Kyoung-Jin
2016-01-01
DNA methylation is emerging as an attractive marker providing investigative leads to solve crimes in forensic genetics. The identification of body fluids that utilizes tissue-specific DNA methylation can contribute to solving crimes by predicting activity related to the evidence material. The age estimation based on DNA methylation is expected to reduce the number of potential suspects, when the DNA profile from the evidence does not match with any known person, including those stored in the forensic database. Moreover, the variation in DNA implicates environmental exposure, such as cigarette smoking and alcohol consumption, thereby suggesting the possibility to be used as a marker for predicting the lifestyle of potential suspect. In this review, we describe recent advances in our understanding of DNA methylation variations and the utility of DNA methylation as a forensic marker for advanced investigative leads from evidence materials. [BMB Reports 2016; 49(7): 359-369] PMID:27099236
miRNAting control of DNA methylation
Indian Academy of Sciences (India)
miRNAting control of DNA methylation. ASHWANI ... function and biological process ... Enrichment analysis of the genes methylated by DRM2 for molecular function and biological ... 39(3), June 2014, 365–380, © Indian Academy of Sciences.
DNA methylation modulates H19 and IGF2 expression in porcine female eye
Directory of Open Access Journals (Sweden)
Dongxu Wang
2017-03-01
Full Text Available Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR and bisulfite sequencing PCR (BSP. We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively. We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs. Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye.
DNA methylation modulates H19 and IGF2 expression in porcine female eye
Wang, Dongxu; Wang, Guodong; Yang, Hao; Liu, Haibo; Li, Cuie; Li, Xiaolan; Lin, Chao; Song, Yuning; Li, Zhanjun; Liu, Dianfeng
2017-01-01
Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR) and bisulfite sequencing PCR (BSP). We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA) cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively). We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs). Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye. PMID:28266684
Regulation of homocysteine metabolism and methylation in human and mouse tissues
Chen, Natalie C.; Yang, Fan; Capecci, Louis M.; Gu, Ziyu; Schafer, Andrew I.; Durante, William; Yang, Xiao-Feng; Wang, Hong
2010-01-01
Hyperhomocysteinemia is an independent risk factor for cardiovascular disease. Homocysteine (Hcy) metabolism involves multiple enzymes; however, tissue Hcy metabolism and its relevance to methylation remain unknown. Here, we established gene expression profiles of 8 Hcy metabolic and 12 methylation enzymes in 20 human and 19 mouse tissues through bioinformatic analysis using expression sequence tag clone counts in tissue cDNA libraries. We analyzed correlations between gene expression, Hcy, S-adenosylhomocysteine (SAH), and S-adenosylmethionine (SAM) levels, and SAM/SAH ratios in mouse tissues. Hcy metabolic and methylation enzymes were classified into two types. The expression of Type 1 enzymes positively correlated with tissue Hcy and SAH levels. These include cystathionine β-synthase, cystathionine-γ-lyase, paraxonase 1, 5,10-methylenetetrahydrofolate reductase, betaine:homocysteine methyltransferase, methionine adenosyltransferase, phosphatidylethanolamine N-methyltransferases and glycine N-methyltransferase. Type 2 enzyme expressions correlate with neither tissue Hcy nor SAH levels. These include SAH hydrolase, methionyl-tRNA synthase, 5-methyltetrahydrofolate:Hcy methyltransferase, S-adenosylmethionine decarboxylase, DNA methyltransferase 1/3a, isoprenylcysteine carboxyl methyltransferases, and histone-lysine N-methyltransferase. SAH is the only Hcy metabolite significantly correlated with Hcy levels and methylation enzyme expression. We established equations expressing combined effects of methylation enzymes on tissue SAH, SAM, and SAM/SAH ratios. Our study is the first to provide panoramic tissue gene expression profiles and mathematical models of tissue methylation regulation.—Chen, N. C., Yang, F., Capecci, L. M., Gu, Z., Schafer, A. I., Durante, W., Yang, X.-F., Wang, H. Regulation of homocysteine metabolism and methylation in human and mouse tissues. PMID:20305127
DNA methylation analysis from saliva samples for epidemiological studies.
Nishitani, Shota; Parets, Sasha E; Haas, Brian W; Smith, Alicia K
2018-06-18
Saliva is a non-invasive, easily accessible tissue, which is regularly collected in large epidemiological studies to examine genetic questions. Recently, it is becoming more common to use saliva to assess DNA methylation. However, DNA extracted from saliva is a mixture of both bacterial and human DNA derived from epithelial and immune cells in the mouth. Thus, there are unique challenges to using salivary DNA in methylation studies that can influence data quality. This study assesses: (1) quantification of human DNA after extraction; (2) delineation of human and bacterial DNA; (3) bisulfite conversion (BSC); (4) quantification of BSC DNA; (5) PCR amplification of BSC DNA from saliva and; (6) quantitation of DNA methylation with a targeted assay. The framework proposed will allow saliva samples to be more widely used in targeted epigenetic studies.
An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation
Gao, Zhihuan
2010-04-21
DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.
Information Thermodynamics of Cytosine DNA Methylation.
Directory of Open Access Journals (Sweden)
Robersy Sanchez
Full Text Available Cytosine DNA methylation (CDM is a stable epigenetic modification to the genome and a widespread regulatory process in living organisms that involves multicomponent molecular machines. Genome-wide cytosine methylation patterning participates in the epigenetic reprogramming of a cell, suggesting that the biological information contained within methylation positions may be amenable to decoding. Adaptation to a new cellular or organismal environment also implies the potential for genome-wide redistribution of CDM changes that will ensure the stability of DNA molecules. This raises the question of whether or not we would be able to sort out the regulatory methylation signals from the CDM background ("noise" induced by thermal fluctuations. Here, we propose a novel statistical and information thermodynamic description of the CDM changes to address the last question. The physical basis of our statistical mechanical model was evaluated in two respects: 1 the adherence to Landauer's principle, according to which molecular machines must dissipate a minimum energy ε = kBT ln2 at each logic operation, where kB is the Boltzmann constant, and T is the absolute temperature and 2 whether or not the binary stretch of methylation marks on the DNA molecule comprise a language of sorts, properly constrained by thermodynamic principles. The study was performed for genome-wide methylation data from 152 ecotypes and 40 trans-generational variations of Arabidopsis thaliana and 93 human tissues. The DNA persistence length, a basic mechanical property altered by CDM, was estimated with values from 39 to 66.9 nm. Classical methylome analysis can be retrieved by applying information thermodynamic modelling, which is able to discriminate signal from noise. Our finding suggests that the CDM signal comprises a language scheme properly constrained by molecular thermodynamic principles, which is part of an epigenomic communication system that obeys the same thermodynamic
Dnmt3a is an epigenetic mediator of adipose insulin resistance
DEFF Research Database (Denmark)
You, Dongjoo; Nilsson, Emma; Tenen, Danielle E.
2017-01-01
Insulin resistance results from an intricate interaction between genetic make-up and environment, and thus may be orchestrated by epigenetic mechanisms like DNA methylation. Here, we demonstrate that DNA methyltransferase 3a (Dnmt3a) is both necessary and sufficient to mediate insulin resistance...... in cultured mouse and human adipocytes. Furthermore, adipose-specific Dnmt3a knock-out mice are protected from diet-induced insulin resistance and glucose intolerance without accompanying changes in adiposity. Unbiased gene profiling studies revealed Fgf21 as a key negatively regulated Dnmt3a target gene...... in adipocytes with concordant changes in DNA methylation at the Fgf21 promoter region. Consistent with this, Fgf21 can rescue Dnmt3a-mediated insulin resistance, and DNA methylation at the FGF21 locus was elevated in human subjects with diabetes and correlated negatively with expression of FGF21 in human...
Heterogeneity of DNA methylation in multifocal prostate cancer.
Serenaite, Inga; Daniunaite, Kristina; Jankevicius, Feliksas; Laurinavicius, Arvydas; Petroska, Donatas; Lazutka, Juozas R; Jarmalaite, Sonata
2015-01-01
Most prostate cancer (PCa) cases are multifocal, and separate foci display histological and molecular heterogeneity. DNA hypermethylation is a frequent alteration in PCa, but interfocal heterogeneity of these changes has not been extensively investigated. Ten pairs of foci from multifocal PCa and 15 benign prostatic hyperplasia (BPH) samples were obtained from prostatectomy specimens, resulting altogether in 35 samples. Methylation-specific PCR (MSP) was used to evaluate methylation status of nine tumor suppressor genes (TSGs), and a set of selected TSGs was quantitatively analyzed for methylation intensity by pyrosequencing. Promoter sequences of the RASSF1 and ESR1 genes were methylated in all paired PCa foci, and frequent (≥75 %) DNA methylation was detected in RARB, GSTP1, and ABCB1 genes. MSP revealed different methylation status of at least one gene in separate foci in 8 out of 10 multifocal tumors. The mean methylation level of ESR1, GSTP1, RASSF1, and RARB differed between the paired foci of all PCa cases. The intensity of DNA methylation in these TSGs was significantly higher in PCa cases than in BPH (p epigenetic profile of recurrent tumors can be inferred from our data.
Novakovic, Boris; Fournier, Thierry; Harris, Lynda K; James, Joanna; Roberts, Claire T; Yong, Hannah E J; Kalionis, Bill; Evain-Brion, Danièle; Ebeling, Peter R; Wallace, Euan M; Saffery, Richard; Murthi, Padma
2017-07-03
Homeobox genes regulate embryonic and placental development, and are widely expressed in the human placenta, but their regulatory control by DNA methylation is unclear. DNA methylation analysis was performed on human placentae from first, second and third trimesters to determine methylation patterns of homeobox gene promoters across gestation. Most homeobox genes were hypo-methylated throughout gestation, suggesting that DNA methylation is not the primary mechanism involved in regulating HOX genes expression in the placenta. Nevertheless, several genes showed variable methylation patterns across gestation, with a general trend towards an increase in methylation over gestation. Three genes (TLX1, HOXA10 and DLX5) showed inverse gains of methylation with decreasing mRNA expression throughout pregnancy, supporting a role for DNA methylation in their regulation. Proteins encoded by these genes were primarily localised to the syncytiotrophoblast layer, and showed decreased expression later in gestation. siRNA mediated downregulation of DLX5, TLX1 and HOXA10 in primary term villous cytotrophoblast resulted in decreased proliferation and increased expression of differentiation markers, including ERVW-1. Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function.
Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping
Directory of Open Access Journals (Sweden)
Maruoka Shuichiro
2008-12-01
Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models
High-resolution analysis of cytosine methylation in ancient DNA.
Directory of Open Access Journals (Sweden)
Bastien Llamas
Full Text Available Epigenetic changes to gene expression can result in heritable phenotypic characteristics that are not encoded in the DNA itself, but rather by biochemical modifications to the DNA or associated chromatin proteins. Interposed between genes and environment, these epigenetic modifications can be influenced by environmental factors to affect phenotype for multiple generations. This raises the possibility that epigenetic states provide a substrate for natural selection, with the potential to participate in the rapid adaptation of species to changes in environment. Any direct test of this hypothesis would require the ability to measure epigenetic states over evolutionary timescales. Here we describe the first single-base resolution of cytosine methylation patterns in an ancient mammalian genome, by bisulphite allelic sequencing of loci from late Pleistocene Bison priscus remains. Retrotransposons and the differentially methylated regions of imprinted loci displayed methylation patterns identical to those derived from fresh bovine tissue, indicating that methylation patterns are preserved in the ancient DNA. Our findings establish the biochemical stability of methylated cytosines over extensive time frames, and provide the first direct evidence that cytosine methylation patterns are retained in DNA from ancient specimens. The ability to resolve cytosine methylation in ancient DNA provides a powerful means to study the role of epigenetics in evolution.
Current trends in electrochemical sensing and biosensing of DNA methylation.
Krejcova, Ludmila; Richtera, Lukas; Hynek, David; Labuda, Jan; Adam, Vojtech
2017-11-15
DNA methylation plays an important role in physiological and pathological processes. Several genetic diseases and most malignancies tend to be associated with aberrant DNA methylation. Among other analytical methods, electrochemical approaches have been successfully employed for characterisation of DNA methylation patterns that are essential for the diagnosis and treatment of particular diseases. This article discusses current trends in the electrochemical sensing and biosensing of DNA methylation. Particularly, it provides an overview of applied electrode materials, electrode modifications and biorecognition elements applications with an emphasis on strategies that form the core DNA methylation detection approaches. The three main strategies as (i) bisulfite treatment, (ii) cleavage by restriction endonucleases, and (iii) immuno/affinity reaction were described in greater detail. Additionally, the availability of the reviewed platforms for early cancer diagnosis and the approval of methylation inhibitors for anticancer therapy were discussed. Copyright © 2017 Elsevier B.V. All rights reserved.
Almeida, Luciana O; Neto, Marinaldo P C; Sousa, Lucas O; Tannous, Maryna A; Curti, Carlos; Leopoldino, Andreia M
2017-04-18
Epigenetic modifications are essential in the control of normal cellular processes and cancer development. DNA methylation and histone acetylation are major epigenetic modifications involved in gene transcription and abnormal events driving the oncogenic process. SET protein accumulates in many cancer types, including head and neck squamous cell carcinoma (HNSCC); SET is a member of the INHAT complex that inhibits gene transcription associating with histones and preventing their acetylation. We explored how SET protein accumulation impacts on the regulation of gene expression, focusing on DNA methylation and histone acetylation. DNA methylation profile of 24 tumour suppressors evidenced that SET accumulation decreased DNA methylation in association with loss of 5-methylcytidine, formation of 5-hydroxymethylcytosine and increased TET1 levels, indicating an active DNA demethylation mechanism. However, the expression of some suppressor genes was lowered in cells with high SET levels, suggesting that loss of methylation is not the main mechanism modulating gene expression. SET accumulation also downregulated the expression of 32 genes of a panel of 84 transcription factors, and SET directly interacted with chromatin at the promoter of the downregulated genes, decreasing histone acetylation. Gene expression analysis after cell treatment with 5-aza-2'-deoxycytidine (5-AZA) and Trichostatin A (TSA) revealed that histone acetylation reversed transcription repression promoted by SET. These results suggest a new function for SET in the regulation of chromatin dynamics. In addition, TSA diminished both SET protein levels and SET capability to bind to gene promoter, suggesting that administration of epigenetic modifier agents could be efficient to reverse SET phenotype in cancer.
Longitudinal study of DNA methylation during the first 5 years of life.
Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar
2016-06-03
Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.
Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity
Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.
1990-01-01
Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human
Quantitative DNA methylation analysis of candidate genes in cervical cancer.
Directory of Open Access Journals (Sweden)
Erin M Siegel
Full Text Available Aberrant DNA methylation has been observed in cervical cancer; however, most studies have used non-quantitative approaches to measure DNA methylation. The objective of this study was to quantify methylation within a select panel of genes previously identified as targets for epigenetic silencing in cervical cancer and to identify genes with elevated methylation that can distinguish cancer from normal cervical tissues. We identified 49 women with invasive squamous cell cancer of the cervix and 22 women with normal cytology specimens. Bisulfite-modified genomic DNA was amplified and quantitative pyrosequencing completed for 10 genes (APC, CCNA, CDH1, CDH13, WIF1, TIMP3, DAPK1, RARB, FHIT, and SLIT2. A Methylation Index was calculated as the mean percent methylation across all CpG sites analyzed per gene (~4-9 CpG site per sequence. A binary cut-point was defined at >15% methylation. Sensitivity, specificity and area under ROC curve (AUC of methylation in individual genes or a panel was examined. The median methylation index was significantly higher in cases compared to controls in 8 genes, whereas there was no difference in median methylation for 2 genes. Compared to HPV and age, the combination of DNA methylation level of DAPK1, SLIT2, WIF1 and RARB with HPV and age significantly improved the AUC from 0.79 to 0.99 (95% CI: 0.97-1.00, p-value = 0.003. Pyrosequencing analysis confirmed that several genes are common targets for aberrant methylation in cervical cancer and DNA methylation level of four genes appears to increase specificity to identify cancer compared to HPV detection alone. Alterations in DNA methylation of specific genes in cervical cancers, such as DAPK1, RARB, WIF1, and SLIT2, may also occur early in cervical carcinogenesis and should be evaluated.
Energy Technology Data Exchange (ETDEWEB)
Lacks, S.; Greenberg, B.
1977-01-01
Restriction endonucleases Dpn I and Dpn II are produced by two distinct strains of Diplococcus pneumoniae. The two enzymes show complementary specificity with respect to methylation of sites in DNA. From the identity of its cleavage site with that of Mbo I, it appears that Dpn II cleaves at the unmodified sequence 5'-G-A-T-C-3'. Dpn I cleaves at the same sequence when the adenine residue is methylated. Both enzymes produce only double-strand breaks in susceptible DNA. Their susceptibility to Dpn I and not Dpn II shows that essentially all the G-A-T-C sequences are methylated in DNA from the pneumococcal strain that produces Dpn II as well as in DNA from Hemophilus influenzae and Escherichia coli. In the dam-3 mutant of E. coli none of these sequences appear to be methylated. Residual adenine methylation in the dam-3 mutant DNA most likely occurs at different sites. Different but characteristic degrees of methylation at G-A-T-C sites are found in the DNA of bacterial viruses grown in E. coli. DNAs from mammalian cells and viruses are not methylated at this sequence. Mitochondrial DNA from Paramecium aurelia is not methylated, but a small proportion of G-A-T-C sequences in the macronuclear DNA of this eukaryote appear to be methylated. Possible roles of sequence-specific methylation in the accommodation of plasmids, in the replication of DNA, in the regulation of gene function and in the restriction of viral infection are discussed.
Prognostic DNA Methylation Markers for Prostate Cancer
Directory of Open Access Journals (Sweden)
Siri H. Strand
2014-09-01
Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.
Inácio, Vera; Barros, Pedro M; Costa, Augusta; Roussado, Cristóvão; Gonçalves, Elsa; Costa, Rita; Graça, José; Oliveira, M Margarida; Morais-Cecílio, Leonor
2017-01-01
DNA methylation is thought to influence Quercus suber cork quality, which is the main constraint for its economic valorisation. However, a deep knowledge of the cytosine methylation patterns disclosing the epigenetic variability of trees with different cork quality types is totally missing. This study investigates the hypothesis that variations in DNA methylation contribute to differences in cork cellular characteristics directly related to original or traumatic phellogen activity. We used MSAPs (Methylation Sensitive Amplified Polymorphism) to assess DNA methylation patterns of cork and leaf tissues of Q. suber adult trees growing in three cork oak stands. The relationship between the detected polymorphisms and the diversity of cork quality traits was explored by a marker-trait analysis focusing on the most relevant quality characteristics. Populations differed widely in cork quality, but only slightly in degree of epigenetic differentiation. Four MSAP markers (1.3% of the total) were significantly associated with the most noteworthy quality traits: wood inclusions (nails) and porosity. This evidence supports the potential role of cytosine methylation in the modulation of differential phellogen activity either involved in localized cell death or in pore production, resulting in different cork qualities. Although, the underlying basis of the methylation polymorphism of loci affecting cork quality traits remain unclear, the disclosure of markers statistically associated with cork quality strengthens the potential role of DNA methylation in the regulation of these traits, namely at the phellogen level.
Implications for x-chromosome regulation from studies of human x-chromosome DNA
International Nuclear Information System (INIS)
Wolf, S.F.; Migeon, B.R.
1983-01-01
It is clear that there must be multiple events involved in the regulation of the mammalian X chromosome. The initial event, occurring about the time of implantation results in inactivation of all but a single X chromosome in diploid cells. A popular working hypothesis is that DNA modification, such as methylation or sequence rearrangement, might be responsible for maintenance of the inactive state. Methylation is particularly attractive, since the preference for methylating half-methylated sites might result in perpetuation of the differentiated state. In this paper we discuss several facets of our studies of X inactivation; specifically, our general strategy, studies of X DNA methylation, and studies of loci that escape inactivation. 47 references, 8 figures, 2 tables
He, Bin; Yin, Chao; Gong, Yabin; Liu, Jie; Guo, Huiduo; Zhao, Ruqian
2018-01-01
Melatonin, the major pineal secretory product, has a significant impact on the female reproductive system. Recently, the beneficial effects of melatonin on mammalian oocyte maturation and embryonic development have drawn increased attention. However, the exact underlying mechanisms remain to be fully elucidated. This study demonstrates that supplementing melatonin to in vitro maturation (IVM) medium enhances IVM rate, lipid droplets (LDs) accumulation as well as triglyceride content in porcine oocytes. Decrease of mitochondrial membrane potential, mitochondrial respiratory chain complex IV activity as well as mitochondrial reactive oxygen species (mROS) content indicated that melatonin induced a decrease of mitochondrial activity. The copy number of mitochondrial DNA (mtDNA) which encodes essential subunits of oxidative phosphorylation (OXPHOS), was not affected by melatonin. However, the expression of mtDNA-encoded genes was significantly down-regulated after melatonin treatment. The DNA methyltransferase DNMT1, which regulates methylation and expression of mtDNA, was increased and translocated into the mitochondria in melatonin-treated oocytes. The inhibitory effect of melatonin on the expression of mtDNA was significantly prevented by simultaneous addition of DNMT1 inhibitor, which suggests that melatonin regulates the transcription of mtDNA through up-regulation of DNMT1 and mtDNA methylation. Increase of triglyceride contents after inhibition of OXPHOS indicated that mitochondrial quiescence is crucial for LDs accumulation in oocytes. Taken together, our results suggest that melatonin-induced reduction in mROS production and increase in IVM, and LDs accumulation in porcine oocytes is mediated by mitochondrial quiescence. © 2017 Wiley Periodicals, Inc.
Chen, Y; Feng, H; Chen, D; Abuduwaili, K; Li, X; Zhang, H
2018-01-01
The protective effects of folic acid on DNA damage and DNA methylation induced by N-methyl- N'-nitro- N-nitrosoguanidine (MNNG) in Kazakh esophageal epithelial cells were investigated using a 3 × 3 factorial design trial. The cells were cultured in vitro and exposed to media containing different concentrations of folic acid and MNNG, after which growth indices were detected. DNA damage levels were measured using comet assays, and genome-wide DNA methylation levels (MLs) were measured using high-performance liquid chromatography. The DNA methylation of methylenetetrahydrofolate reductase (MTHFR) and folate receptor- α (FR α) genes was detected by bisulfite sequencing polymerase chain reaction (PCR). The results showed significant increases in tail DNA concentration, tail length, and Olive tail moment ( p methylation frequencies of MTHFR and FR α genes. In particular, significant differences were observed in the promoter regions of both genes ( p methylation in Kazakh esophageal epithelial cells upon MNNG exposure. Thus, sufficient folic acid levels could play a protective role against the damage induced by this compound.
Ganguly, Sudipto; Mula, Soumyaditya; Chattopadhyay, Subrata; Chatterjee, Mitali
2007-05-01
The leaves of Piper betle (locally known as Paan) have long been in use in the Indian indigenous system of medicine for the relief of pain; however, the underlying molecular mechanisms of this effect have not been elucidated. The anti-inflammatory and immunomodulatory effects of an ethanolic extract of the leaves of P. betle (100 mg kg(-1); PB) were demonstrated in a complete Freund's adjuvant-induced model of arthritis in rats with dexamethasone (0.1 mg kg(-1)) as the positive control. At non-toxic concentrations of PB (5-25 microg mL(-1)), a dose-dependent decrease in extracellular production of nitric oxide in murine peritoneal macrophages was measured by the Griess assay and corroborated by flow cytometry using the nitric oxide specific probe, 4,5-diaminofluorescein-2 diacetate. This decreased generation of reactive nitrogen species was mediated by PB progressively down-regulating transcription of inducible nitric oxide synthase in macrophages, and concomitantly causing a dose-dependent decrease in the expression of interleukin-12 p40, indicating the ability of PB to down-regulate T-helper 1 pro-inflammatory responses. Taken together, the anti-inflammatory and anti-arthrotic activity of PB is attributable to its ability to down-regulate the generation of reactive nitrogen species, thus meriting further pharmacological investigation.
PPARGC1A DNA methylation in subcutaneous adipose tissue in low birth weight subjects
DEFF Research Database (Denmark)
Gillberg, Linn; Jacobsen, Stine; Rönn, Tina
2014-01-01
OBJECTIVE: Increased DNA methylation of the metabolic regulator peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PPARGC1A) has been reported in skeletal muscle from type 2 diabetes (T2D) subjects and from low birth weight (LBW) subjects with an increased risk of T2D. High...... and insulin-stimulated SAT from LBW and matched normal birth weight (NBW) subjects during control and high-fat overfeeding. MATERIALS/METHODS: Nineteen young healthy men with LBW and 26 NBW controls were studied after both a 5-day high-fat overfeeding and a control diet in a randomized crossover setting. DNA...... methylation was assessed with bisulfite sequencing and mRNA expression with quantitative real-time PCR. RESULTS: Following high-fat overfeeding, increased SAT PPARGC1A DNA methylation was observed in LBW subjects but not in NBW controls. Basal SAT PPARGC1A mRNA expression was unaffected by diet and similar...
Stress, burnout and depression: A systematic review on DNA methylation mechanisms.
Bakusic, Jelena; Schaufeli, Wilmar; Claes, Stephan; Godderis, Lode
2017-01-01
Despite that burnout presents a serious burden for modern society, there are no diagnostic criteria. Additional difficulty is the differential diagnosis with depression. Consequently, there is a need to dispose of a burnout biomarker. Epigenetic studies suggest that DNA methylation is a possible mediator linking individual response to stress and psychopathology and could be considered as a potential biomarker of stress-related mental disorders. Thus, the aim of this review is to provide an overview of DNA methylation mechanisms in stress, burnout and depression. In addition to state-of-the-art overview, the goal of this review is to provide a scientific base for burnout biomarker research. We performed a systematic literature search and identified 25 pertinent articles. Among these, 15 focused on depression, 7 on chronic stress and only 3 on work stress/burnout. Three epigenome-wide studies were identified and the majority of studies used the candidate-gene approach, assessing 12 different genes. The glucocorticoid receptor gene (NR3C1) displayed different methylation patterns in chronic stress and depression. The serotonin transporter gene (SLC6A4) methylation was similarly affected in stress, depression and burnout. Work-related stress and depressive symptoms were associated with different methylation patterns of the brain derived neurotrophic factor gene (BDNF) in the same human sample. The tyrosine hydroxylase (TH) methylation was correlated with work stress in a single study. Additional, thoroughly designed longitudinal studies are necessary for revealing the cause-effect relationship of work stress, epigenetics and burnout, including its overlap with depression. Copyright © 2016 Elsevier Inc. All rights reserved.
Zhao, Ming; Liang, Gongping; Luo, Shuangyan; Lu, Qianjin
2012-05-01
To investigate the effect of total glucosides of peony (TGP) on expression and DNA methylation status of ITGAL gene (CD11a) in CD4(+) T cells from patients with systemic lupus erythematosus (SLE). CD4(+) T cells were isolated by positive selection using CD4 beads. CD4(+) T cells were treated by TGP at 0, 62.5, 312.5 and 1562.5 mg/L for 48 h. The MTT method was used to assess cell viability; mRNA expression level was measured by realtime-PCR; protein level of CD11a was measured by flow cytometric analysis; DNA methylation status was assayed by bisulfite sequencing. No significant change in cell viability was found in CD4(+) T cells among the different concentration groups (P>0.05). Compared with control, the mRNA and protein levels of ITGAL were down-regulated significantly in SLE CD4(+) T cells treated with TGP (1562.5 mg/L) (PTGP (1562.5 mg/L) treated CD4(+) T cells compared with control group (PTGP can repress CD11a gene expression through enhancing DNA methylation of ITGAL promoter in CD4(+) T cells from patients with SLE. This observation represents a preliminary step in understanding the mechanism of TGP in SLE therapy.
Sha, A H; Lin, X H; Huang, J B; Zhang, D P
2005-07-01
DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. The rice cultivar Wase Aikoku 3 becomes resistant to the blight pathogen Xanthomonas oryzae pv. oryzae at the adult stage. Using methylation-sensitive amplified polymorphism (MSAP) analysis, we compared the patterns of cytosine methylation in seedlings and adult plants of the rice cultivar Wase Aikoku 3 that had been inoculated with the pathogen Xanthomonas oryzae pv. oryzae, subjected to mock inoculation or left untreated. In all, 2000 DNA fragments, each representing a recognition site cleaved by either or both of two isoschizomers, were amplified using 60 pairs of selective primers. A total of 380 sites were found to be methylated. Of these, 45 showed differential cytosine methylation among the seedlings and adult plants subjected to different treatments, and overall levels of methylation were higher in adult plants than in seedlings. All polymorphic fragments were sequenced, and six showed homology to genes that code for products of known function. Northern analysis of three fragments indicated that their expression varied with methylation pattern, with hypermethylation being correlated with repression of transcription, as expected. The results suggest that significant differences in cytosine methylation exist between seedlings and adult plants, and that hypermethylation or hypomethylation of specific genes may be involved in the development of adult plant resistance (APR) in rice plants.
Directory of Open Access Journals (Sweden)
Yuguang Song
Full Text Available Epigenetic modification contributes to the regulation of gene expression and plant development under salinity stress. Here we describe the identification of 49 soybean transcription factors by microarray analysis as being inducible by salinity stress. A semi-quantitative RT-PCR-based expression assay confirmed the salinity stress inducibility of 45 of these 49 transcription factors, and showed that ten of them were up-regulated when seedlings were exposed to the demethylation agent 5-aza-2-deoxycytidine. Salinity stress was shown to affect the methylation status of four of these ten transcription factors (one MYB, one b-ZIP and two AP2/DREB family members using a combination of bisulfite sequencing and DNA methylation-sensitive DNA gel blot analysis. ChIP analysis indicated that the activation of three of the four DNA methylated transcription factors was correlated with an increased level of histone H3K4 trimethylation and H3K9 acetylation, and/or a reduced level of H3K9 demethylation in various parts of the promoter or coding regions. Our results suggest a critical role for some transcription factors' activation/repression by DNA methylation and/or histone modifications in soybean tolerance to salinity stress.
Directory of Open Access Journals (Sweden)
Tanapat Pangeson
2017-11-01
Full Text Available In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA.
Directory of Open Access Journals (Sweden)
Zhentao Zhang
Full Text Available The mechanisms leading to dopaminergic neuronal loss in the substantia nigra of patients with Parkinson disease (PD remain poorly understood. We recently reported that aberrant DNA replication mediated by DNA polymerase-β (DNA pol-β plays a causal role in the death of postmitotic neurons in an in vitro model of PD. In the present study, we show that both proliferating cell nuclear antigen (PCNA and DNA pol-β are required for MPP(+-induced neuronal death. PCNA binds to the catalytic domain of DNA pol-β in MPP(+-treated neurons and in post-mortem brain tissues of PD patients. The PCNA-DNA pol-β complex is loaded into DNA replication forks and mediates DNA replication in postmitotic neurons. The aberrant DNA replication mediated by the PCNA-DNA pol-β complex induces p53-dependent neuronal cell death. Our results indicate that the interaction of PCNA and DNA pol-β contributes to neuronal death in PD.
Differential DNA Methylation Analysis without a Reference Genome
Directory of Open Access Journals (Sweden)
Johanna Klughammer
2015-12-01
Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.
DNA Methylation as a Biomarker for Body Fluid Identification
Directory of Open Access Journals (Sweden)
Rania Gomaa
2017-12-01
Full Text Available Currently, available identification techniques for forensic samples are either enzyme or protein based, which can be subjected to degradation, thus limiting its storage potentials. Epigenetic changes arising due to DNA methylation and histone acetylation can be used for body fluid identification. Markers DACT1, USP49, ZC3H12D, FGF7, cg23521140, cg17610929, chromosome 4 (25287119–25287254, chromosome 11 (72085678–72085798, 57171095–57171236, 1493401–1493538, and chromosome 19 (47395505–47395651 are currently being used for semen identification. Markers cg26107890, cg20691722, cg01774894 and cg14991487 are used to differentiate saliva and vaginal secretions from other body fluids. However, such markers show overlapping methylation pattern. This review article aimed to highlight the feasibility of using DNA methylation of certain genetic markers in body fluid identification and its implications for forensic investigations. The reviewed articles have employed molecular genetics techniques such as Bisulfite sequencing PCR (BSP, methylation specific PCR (MSP, Pyrosequencing, Combined Bisulfite Restriction Analysis (COBRA, Methylation-sensitive Single Nucleotide Primer Extension (SNuPE, and Multiplex SNaPshot Microarray. Bioinformatics software such as MATLAB and BiQ Analyzer has been used. Biological fluids have different methylation patterns and thus, this difference can be used to identify the nature of the biological fluid found at the crime scene. Using DNA methylation to identify the body fluids gives accurate results without consumption of the trace evidence and requires a minute amount of DNA for analysis. Recent studies have incorporated next-generation sequencing aiming to find out more reliable markers that can differentiate between different body fluids. Nonetheless, new DNA methylation markers are yet to be discovered to accurately differentiate between saliva and vaginal secretions with high confidence. Epigenetic changes are
Dynamics of DNA methylation in recent human and great ape evolution.
Directory of Open Access Journals (Sweden)
Irene Hernando-Herraez
Full Text Available DNA methylation is an epigenetic modification involved in regulatory processes such as cell differentiation during development, X-chromosome inactivation, genomic imprinting and susceptibility to complex disease. However, the dynamics of DNA methylation changes between humans and their closest relatives are still poorly understood. We performed a comparative analysis of CpG methylation patterns between 9 humans and 23 primate samples including all species of great apes (chimpanzee, bonobo, gorilla and orangutan using Illumina Methylation450 bead arrays. Our analysis identified ∼800 genes with significantly altered methylation patterns among the great apes, including ∼170 genes with a methylation pattern unique to human. Some of these are known to be involved in developmental and neurological features, suggesting that epigenetic changes have been frequent during recent human and primate evolution. We identified a significant positive relationship between the rate of coding variation and alterations of methylation at the promoter level, indicative of co-occurrence between evolution of protein sequence and gene regulation. In contrast, and supporting the idea that many phenotypic differences between humans and great apes are not due to amino acid differences, our analysis also identified 184 genes that are perfectly conserved at protein level between human and chimpanzee, yet show significant epigenetic differences between these two species. We conclude that epigenetic alterations are an important force during primate evolution and have been under-explored in evolutionary comparative genomics.
Directory of Open Access Journals (Sweden)
Tiziana Angrisano
Full Text Available Bacterial lipopolysaccharide (LPS induces release of inflammatory mediators both in immune and epithelial cells. We investigated whether changes of epigenetic marks, including selected histone modification and DNA methylation, may drive or accompany the activation of COX-2 gene in HT-29 human intestinal epithelial cells upon exposure to LPS. Here we describe cyclical histone acetylation (H3, methylation (H3K4, H3K9, H3K27 and DNA methylation changes occurring at COX-2 gene promoter overtime after LPS stimulation. Histone K27 methylation changes are carried out by the H3 demethylase JMJD3 and are essential for COX-2 induction by LPS. The changes of the histone code are associated with cyclical methylation signatures at the promoter and gene body of COX-2 gene.
Directory of Open Access Journals (Sweden)
Samuel L Collins
Full Text Available Multicellular tumour spheroid (MCTS cultures are excellent model systems for simulating the development and microenvironmental conditions of in vivo tumour growth. Many documented cell lines can generate differentiated MCTS when cultured in suspension or in a non-adhesive environment. While physiological and biochemical properties of MCTS have been extensively characterized, insight into the events and conditions responsible for initiation of these structures is lacking. MCTS are formed by only a small subpopulation of cells during surface-associated growth but the processes responsible for this differentiation are poorly understood and have not been previously studied experimentally. Analysis of gene expression within spheroids has provided clues but to date it is not known if the observed differences are a cause or consequence of MCTS growth. One mechanism linked to tumourigenesis in a number of cancers is genetic instability arising from impaired DNA mismatch repair (MMR. This study aimed to determine the role of MMR in MCTS initiation and development. Using surface-associated N2a and CHLA-02-ATRT culture systems we have investigated the impact of impaired MMR on MCTS growth. Analysis of the DNA MMR genes MLH1 and PMS2 revealed both to be significantly down-regulated at the mRNA level compared with non-spheroid-forming cells. By using small interfering RNA (siRNA against these genes we show that silencing of MLH1 and PMS2 enhances both MCTS initiation and subsequent expansion. This effect was prolonged over several passages following siRNA transfection. Down-regulation of DNA MMR can contribute to tumour initiation and progression in N2a and CHLA-02-ATRT MCTS models. Studies of surface-associated MCTS differentiation may have broader applications in studying events in the initiation of cancer foci.
Kurita, Satoshi; Higuchi, Hajime; Saito, Yoshimasa; Nakamoto, Nobuhiro; Takaishi, Hiromasa; Tada, Shinichiro; Saito, Hidetsugu; Gores, Gregory J; Hibi, Toshifumi
2010-06-01
DNA methylation plays a critical role in chromatin remodeling and gene expression. DNA methyltransferases (DNMTs) are hypothesized to mediate cellular DNA methylation status and gene expression during mammalian development and in malignant diseases. In this study, we examined the role of DNA methyltransferase 1 (DNMT1) and DNMT3b in cell proliferation and survival of hepatocellular carcinoma (HCC) cells. Gene silencing of both DNMT1 and DNMT3b by targeted siRNA knockdown reduces cell proliferation and sensitizes the cells to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated cell death. The proapoptotic protein caspase-8 demonstrated promoter hypermethylation in HCC cells and was up-regulated by knockdown of DNMT1 and DNMT3b both at mRNA and protein levels. In addition, death receptor TRAIL-R2/DR5 (TRAIL receptor 2/death receptor 5) did not exhibit promoter hypermethylation in HCC cells but was also up-regulated by knockdown of DNMT1 and DNMT3b both at mRNA and protein levels. Consistent with this observation, the combined transfection of DNMT1-siRNA plus DNMT3b-siRNA enhanced formation of the TRAIL-death-inducing signaling complex formation in HCC cells. In conclusion, our data suggest that DNA methylation of specific genomic regions maintained by DNMT1 and DNMT3b plays a critical role in survival of HCC cells, and a simultaneous knockdown of both DNMT1 and DNMT3b may be a novel anticancer strategy for the treatment of HCC.
Energy Technology Data Exchange (ETDEWEB)
Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.; Heimark, Ronald L.; Cress, Anne E.; Dickinson, Sally; Stampfer, Martha R.; Futscher, Bernard W.
2009-12-23
BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in both normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation
The multi-domain protein Np95 connects DNA methylation and histone modification.
Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich
2010-04-01
DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ss. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways.
Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta
2015-07-13
We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.
Genome-wide association between DNA methylation and alternative splicing in an invertebrate
Directory of Open Access Journals (Sweden)
Flores Kevin
2012-09-01
Full Text Available Abstract Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee and Nasonia vitripennis (jewel wasp analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice
Global DNA methylation responses to low dose radiation exposure
International Nuclear Information System (INIS)
Newman, M.R.; Ormsby, R.J.; Blyth, B.J.; Sykes, P.J.; Bezak, E.
2011-01-01
Full text: High radiation doses cause breaks in the DNA which are considered the critical lesions in initiation of radiation-induced cancer. However, at very low radiation doses relevant for the general public, the induction of such breaks will be rare, and other changes to the DNA such as DNA methylation which affects gene expression may playa role in radiation responses. We are studying global DNA methylation after low dose radiation exposure to determine if low dose radiation has short- and/or long-term effects on chromatin structure. We developed a sensitive high resolution melt assay to measure the levels of DNA methylation across the mouse genome by analysing a stretch of DNA sequence within Long Interspersed Nuclear Elements-I (LINE I) that comprise a very large proportion of the mouse and human genomes. Our initial results suggest no significant short-term or longterm) changes in global NA methylation after low dose whole-body X-radiation of 10 J1Gyor 10 mGy, with a significant transient increase in NA methylation observed I day after a high dose of I Gy. If the low radiation doses tested are inducing changes in bal DNA methylation, these would appear to be smaller than the variation observed between the sexes and following the general stress of the sham-irradiation procedure itself. This research was funded by the Low Dose Radiation Research Program, Biological and Environmental Research, US DOE, Grant DE-FG02-05ER64104 and MN is the recipient of the FMCF/BHP Dose Radiation Research Scholarship.
Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.
2015-01-01
Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578
DNA demethylation upregulated Nrf2 expression in Alzheimer's disease cellular model
Directory of Open Access Journals (Sweden)
Huimin eCao
2016-01-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (Nrf2 is an important transcription factor in the defense against oxidative stress. Cumulative evidence has shown that oxidative stress plays a key role in the pathogenesis of Alzheimer's disease (AD. Previous animal and clinical studies had observed decreased expression of Nrf2 in AD. However, the underlying regulation mechanisms of Nrf2 in AD remain unclear. Here, we used the DNA methyltransferases (Dnmts inhibitor 5-aza-2′-deoxycytidine (5-Aza to test whether Nrf2 expression was regulated by methylation in N2a cells characterizing by expressing human Swedish mutant amyloid precursor protein (N2a/APPswe. We found 5-Aza treatment increased Nrf2 at both mRNA and protein levels via down-regulating the expression of Dnmts and DNA demethylation. In addition, 5-Aza mediated upregulation of Nrf2 expression was concomitant with increased nuclear translocation of Nrf2 and higher expression of Nrf2 downstream target gene NAD(PH:quinone oxidoreductas (NQO1. Our study showed that DNA demethylation promoted the Nrf2 cell signaling pathway, which may enhance the antioxidant system against AD development.
Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt
2014-11-07
We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.
Sagarkar, Sneha; Bhamburkar, Tanmayi; Shelkar, Gajanan; Choudhary, Amit; Kokare, Dadasaheb M; Sakharkar, Amul J
2017-10-01
Minimal traumatic brain injury (MTBI) often transforms into chronic neuropsychiatric conditions including anxiety, the underlying mechanisms of which are largely unknown. In the present study, we employed the closed-head injury paradigm to induce MTBI in rats and examined whether DNA methylation can explain long-term changes in the expression of the brain-derived neurotrophic factor (BDNF) in the amygdala as well as trauma-induced anxiety-like behaviors. The MTBI caused anxiety-like behaviors and altered the expression of DNA methyltransferase (DNMT) isoforms (DNMT1, DNMT3a, and DNMT3b) and factors involved in DNA demethylation such as the growth arrest and DNA damage 45 (GADD45a and GADD45b). After 30days of MTBI, the over-expression of DNMT3a and DNMT3b corresponded to heightened DNMT activity, whereas the mRNA levels of GADD45a and GADD45b were declined. The methylated cytosine levels at the BDNF promoters (Ip, IVp and IXp) were increased in the amygdala of the trauma-induced animals; these coincided negatively with the mRNA levels of exon IV and IXa, but not of exon I. Interestingly, treatment with 5-azacytidine, a pan DNMT inhibitor, normalized the MTBI-induced DNMT activity and DNA hypermethylation at exon IVp and IXp. Furthermore, 5-azacytidine also corrected the deficits in the expression of exons IV and IXa and reduced the anxiety-like behaviors. These results suggest that the DNMT-mediated DNA methylation at the BDNF IVp and IXp might be involved in the regulation of BDNF gene expression in the amygdala. Further, it could also be related to MTBI-induced anxiety-like behaviors via the regulation of synaptic plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.
McKay, Jill A; Xie, Long; Harris, Sarah; Wong, Yi K; Ford, Dianne; Mathers, John C
2011-07-01
DNA methylation patterns are tissue specific and may influence tissue-specific gene regulation. Human studies investigating DNA methylation in relation to environmental factors primarily use blood-derived DNA as a surrogate for DNA from target tissues. It is therefore important to know if DNA methylation changes in blood in response to environmental changes reflect those in target tissues. Folate intake can influence DNA methylation, via altered methyl donor supply. Previously, manipulations of maternal folate intake during pregnancy altered the patterns of DNA methylation in offspring but, to our knowledge, the consequences for maternal DNA methylation are unknown. Given the increased requirement for folate during pregnancy, mothers may be susceptible to aberrant DNA methylation due to folate depletion. Female mice were fed folate-adequate (2 mg folic acid/kg diet) or folate-deplete (0.4 mg folic acid/kg diet) diets prior to mating and during pregnancy and lactation. Following weaning, dams were killed and DNA methylation was assessed by pyrosequencing® in blood, liver, and kidney at the Esr1, Igf2 differentially methylated region (DMR)1, Igf2 DMR2, Slc39a4CGI1, and Slc39a4CGI2 loci. We observed tissue-specific differences in methylation at all loci. Folate depletion reduced Igf2 DMR1 and Slc39a4CGI1 methylation across all tissues and altered Igf2 DMR2 methylation in a tissue-specific manner (pmethylation measurements may not always reflect methylation within other tissues. Further measurements of blood-derived and tissue-specific methylation patterns are warranted to understand the complexity of tissue-specific responses to altered nutritional exposure. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Wurdeman, R.L.; Gold, B.
1988-01-01
DNA alkylation by N-alkyl-N-nitrosoureas is generally accepted to be responsible for their mutagenic, carcinogenic, and antineoplastic activities. The exact nature of the ultimate alkylating intermediate is still controversial, with a variety of species having been nominated. The sequence specificity for DNA alkylation by simple N-alkyl-N-nitrosoureas has not been reported, although such information is basic in understanding the specific point mutations induced by these compounds in oncogene targets. These two points are addressed by using N-methyl-N-nitrosourea methylation of a 576 base-pair 32 P-end-labeled DNA restriction fragment and high-resolution polyacrylamide sequencing gels. This method provides information on the formation of N 7 -methylguanine, by the generation of single-strand breaks upon exposure to piperidine
Involvement of DNA methylation in memory processing in the honey bee.
Lockett, Gabrielle A; Helliwell, Paul; Maleszka, Ryszard
2010-08-23
DNA methylation, an important and evolutionarily conserved epigenetic mechanism, is implicated in learning and memory processes in vertebrates, but its role in behaviour in invertebrates is unknown. We examined the role of DNA methylation in memory in the honey bee using an appetitive Pavlovian olfactory discrimination task, and by assessing the expression of DNA methyltransferase3, a key driver of epigenetic reprogramming. Here we report that DNA methyltransferase inhibition reduces acquisition retention and alters the extinction depending on treatment time, and DNA methyltransferase3 is upregulated after training. Our findings add to the understanding of epigenetic mechanisms in learning and memory, extending known roles of DNA methylation to appetitive and extinction memory, and for the first time implicate DNA methylation in memory in invertebrates.
International Nuclear Information System (INIS)
Li, Yang; Hu, Fang; Xue, Meng; Jia, Yi-Jie; Zheng, Zong-Ji; Wang, Ling; Guan, Mei-Ping; Xue, Yao-Ming
2017-01-01
Diabetic kidney disease (DKD) has become the leading cause of end-stage renal disease worldwide and is associated with glomerular mesangial cell (MC) proliferation and excessive extracellular matrix (ECM) production. Klotho can attenuate renal fibrosis in part by inhibiting TGF-β1/Smad3 signaling in DKD. Early growth response factor 1 (Egr-1) has been shown to play a key role in renal fibrosis in part by facilitating the formation of a positive feedback loop involving TGF-β1. However, whether Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in DKD is unclear. In the present study, we assessed human MCs that were incubated under high-glucose conditions to mimic diabetes. Then, we transfected the cells with Klotho plasmid or siRNA to overexpress or knock down Klotho gene and protein expression. Klotho, Egr-1, fibronectin (FN), collagen type I (Col I), Smad3 and phosphorylated Smad3 (p-Smad3) gene and protein expression levels were determined by RT-qPCR and western blotting respectively. High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. pcDNA3.1-Klotho transfection-mediated Klotho overexpression down-regulated Egr-1, FN and Col I expression and the p-Smad3/Smad3 ratio in human MCs. Conversely, siRNA-mediated Klotho silencing up-regulated Egr-1, FN, and Col I expression and the p-Smad3/Smad3 ratio. Moreover, the effects of si-Klotho on Egr-1 expression were abolished by the TGF-β1 inhibitor SB-431542. Klotho overexpression can prevent mesangial ECM production in high-glucose-treated human MCs, an effect that has been partially attributed to Egr-1 down-regulation facilitated by TGF-β1/Smad3 signaling inhibition. - Highlights: • High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. • Klotho overexpression down-regulated Egr-1 and prevented mesangial ECM production in high-glucose-treated human MCs. • Klotho down-regulated Egr-1 by inhibiting
Frequent down-regulation of ABC transporter genes in prostate cancer
International Nuclear Information System (INIS)
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-01-01
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p < 0.001). The study suggests frequent down-regulation of the ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors. The online version of this article (doi:10.1186/s12885-015-1689-8) contains supplementary material, which is available to authorized users
JMJD1C demethylates MDC1 to regulate the RNF8 and BRCA1-mediated chromatin response to DNA breaks
DEFF Research Database (Denmark)
Watanabe, Sugiko; Watanabe, Kenji; Akimov, Vyacheslav
2013-01-01
Chromatin ubiquitylation flanking DNA double-strand breaks (DSBs), mediated by RNF8 and RNF168 ubiquitin ligases, orchestrates a two-branch pathway, recruiting repair factors 53BP1 or the RAP80-BRCA1 complex. We report that human demethylase JMJD1C regulates the RAP80-BRCA1 branch of this DNA...
Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter
International Nuclear Information System (INIS)
Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix
2011-01-01
Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing
Directory of Open Access Journals (Sweden)
Bekim Sadikovic
Full Text Available Genetic and epigenetic changes contribute to deregulation of gene expression and development of human cancer. Changes in DNA methylation are key epigenetic factors regulating gene expression and genomic stability. Recent progress in microarray technologies resulted in developments of high resolution platforms for profiling of genetic, epigenetic and gene expression changes. OS is a pediatric bone tumor with characteristically high level of numerical and structural chromosomal changes. Furthermore, little is known about DNA methylation changes in OS. Our objective was to develop an integrative approach for analysis of high-resolution epigenomic, genomic, and gene expression profiles in order to identify functional epi/genomic differences between OS cell lines and normal human osteoblasts. A combination of Affymetrix Promoter Tilling Arrays for DNA methylation, Agilent array-CGH platform for genomic imbalance and Affymetrix Gene 1.0 platform for gene expression analysis was used. As a result, an integrative high-resolution approach for interrogation of genome-wide tumour-specific changes in DNA methylation was developed. This approach was used to provide the first genomic DNA methylation maps, and to identify and validate genes with aberrant DNA methylation in OS cell lines. This first integrative analysis of global cancer-related changes in DNA methylation, genomic imbalance, and gene expression has provided comprehensive evidence of the cumulative roles of epigenetic and genetic mechanisms in deregulation of gene expression networks.
International Nuclear Information System (INIS)
Zhang, X.; Li, L.; Zhang, L.; Borowitz, J.L.; Isom, G.E.
2009-01-01
Cyanide is a potent inhibitor of mitochondrial oxidative metabolism and produces mitochondria-mediated death of dopaminergic neurons and sublethal intoxications that are associated with a Parkinson-like syndrome. Cyanide toxicity is enhanced when mitochondrial uncoupling is stimulated following up-regulation of uncoupling protein-2 (UCP-2). In this study, the role of a pro-survival protein, Bcl-2, in cyanide-mediated cell death was determined in a rat dopaminergic immortalized mesencephalic cell line (N27 cells). Following pharmacological up-regulation of UCP-2 by treatment with Wy14,643, cyanide reduced cellular Bcl-2 expression by increasing proteasomal degradation of the protein. The increased turnover of Bcl-2 was mediated by an increase of oxidative stress following UCP-2 up-regulation. The oxidative stress involved depletion of mitochondrial glutathione (mtGSH) and increased H 2 O 2 generation. Repletion of mtGSH by loading cells with glutathione ethyl ester reduced H 2 O 2 generation and in turn blocked the cyanide-induced decrease of Bcl-2. To determine if UCP-2 mediated the response, RNAi knock down was conducted. The RNAi decreased cyanide-induced depletion of mtGSH, reduced H 2 O 2 accumulation, and inhibited down-regulation of Bcl-2, thus blocking cell death. To confirm the role of Bcl-2 down-regulation in the cell death, it was shown that over-expression of Bcl-2 by cDNA transfection attenuated the enhancement of cyanide toxicity after UCP-2 up-regulation. It was concluded that UCP-2 up-regulation sensitizes cells to cyanide by increasing cellular oxidative stress, leading to an increase of Bcl-2 degradation. Then the reduced Bcl-2 levels sensitize the cells to cyanide-mediated cell death.
International Nuclear Information System (INIS)
Zheng, Liduan; Li, Dan; Xiang, Xuan; Tong, Ling; Qi, Meng; Pu, Jiarui; Huang, Kai; Tong, Qiangsong
2013-01-01
Recent evidence indicates that methyl jasmonate (MJ), a plant stress hormone, exhibits anti-cancer activity on human cancer cells. The aim of this study is to determine whether sub-cytotoxic MJ can abolish the migration, invasion and angiogenesis gastric cancer cells. Human gastric cancer cell lines SGC-7901 and MKN-45 were treated with diverse concentrations of MJ. Cell viability, proliferation, migration, invasion and angiogenesis capabilities of cancer cells were measured by MTT colorimetry, EdU incorporation, scratch assay, matrigel invasion assay, and tube formation assay. Gene expression was detected by western blot and real-time quantitative RT-PCR. Binding of transcription factor on gene promoter was detected by chromatin immunoprecipitation. Sub-cytotoxic (0.05 to 0.2 mM) MJ attenuated the migration, invasion and angiogenesis, but not the cell viability or proliferation, of gastric cancer cells in a time- and dose-dependent manner, with down-regulation of matrix metalloproteinase 14 (MMP-14) and its downstream gene vascular endothelial growth factor. Restoration of MMP-14 expression rescued the SGC-7901 and MKN-45 cells from sub-cytotoxic MJ-inhibited migration, invasion and angiogenesis. In addition, sub-cytotoxic MJ decreased the specificity protein 1 (Sp1) expression and binding on MMP-14 promoter, while restoration of Sp1 expression rescued the cancer cells from sub-cytotoxic MJ-mediated defects in MMP-14 expression, migration, invasion and angiogenesis. Sub-cytotoxic MJ attenuates the MMP-14 expression via decreasing the Sp1 expression and binding on MMP-14 promoter, thus inhibiting the migration, invasion and angiogenesis of gastric cancer cells
Directory of Open Access Journals (Sweden)
Marieke I Bouwland-Both
Full Text Available Changes in epigenetic programming of embryonic growth genes during pregnancy seem to affect fetal growth. Therefore, in a population-based prospective birth cohort in the Netherlands, we examined associations between fetal and infant growth and DNA methylation of IGF2DMR, H19 and MTHFR. For this study, we selected 69 case children born small-for-gestational age (SGA, birth weight <-2SDS and 471 control children. Fetal growth was assessed with serial ultrasound measurements. Information on birth outcomes was retrieved from medical records. Infant weight was assessed at three and six months. Methylation was assessed in DNA extracted from umbilical cord white blood cells. Analyses were performed using linear mixed models with DNA methylation as dependent variable. The DNA methylation levels of IGF2DMR and H19 in the control group were, median (90% range, 53.6% (44.5-61.6 and 30.0% (25.6-34.2 and in the SGA group 52.0% (43.9-60.9 and 30.5% (23.9-32.9, respectively. The MTHFR region was found to be hypomethylated with limited variability in the control and SGA group, 2.5% (1.4-4.0 and 2.4% (1.5-3.8, respectively. SGA was associated with lower IGF2DMR DNA methylation (β = -1.07, 95% CI -1.93; -0.21, P-value = 0.015, but not with H19 methylation. A weight gain in the first three months after birth was associated with lower IGF2DMR DNA methylation (β = -0.53, 95% CI -0.91; -0.16, P-value = 0.005. Genetic variants in the IGF2/H19 locus were associated with IGF2DMR DNA methylation (P-value<0.05, but not with H19 methylation. Furthermore, our results suggest a possibility of mediation of DNA methylation in the association between the genetic variants and SGA. To conclude, IGF2DMR and H19 DNA methylation is associated with fetal and infant growth.
Smith, Gilbert; Smith, Carl; Kenny, John G; Chaudhuri, Roy R; Ritchie, Michael G
2015-04-01
Epigenetic marks such as DNA methylation play important biological roles in gene expression regulation and cellular differentiation during development. To examine whether DNA methylation patterns are potentially associated with naturally occurring phenotypic differences, we examined genome-wide DNA methylation within Gasterosteus aculeatus, using reduced representation bisulfite sequencing. First, we identified highly methylated regions of the stickleback genome, finding such regions to be located predominantly within genes, and associated with genes functioning in metabolism and biosynthetic processes, cell adhesion, signaling pathways, and blood vessel development. Next, we identified putative differentially methylated regions (DMRs) of the genome between complete and low lateral plate morphs of G. aculeatus. We detected 77 DMRs that were mainly located in intergenic regions. Annotations of genes associated with these DMRs revealed potential functions in a number of known divergent adaptive phenotypes between G. aculeatus ecotypes, including cardiovascular development, growth, and neuromuscular development. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Global DNA methylation of ischemic stroke subtypes.
Directory of Open Access Journals (Sweden)
Carolina Soriano-Tárraga
Full Text Available Ischemic stroke (IS, a heterogeneous multifactorial disorder, is among the leading causes of mortality and long-term disability in the western world. Epidemiological data provides evidence for a genetic component to the disease, but its epigenetic involvement is still largely unknown. Epigenetic mechanisms, such as DNA methylation, change over time and may be associated with aging processes and with modulation of the risk of various pathologies, such as cardiovascular disease and stroke. We analyzed 2 independent cohorts of IS patients. Global DNA methylation was measured by luminometric methylation assay (LUMA of DNA blood samples. Univariate and multivariate regression analyses were used to assess the methylation differences between the 3 most common IS subtypes, large-artery atherosclerosis (LAA, small-artery disease (SAD, and cardio-aortic embolism (CE. A total of 485 IS patients from 2 independent hospital cohorts (n = 281 and n = 204 were included, distributed across 3 IS subtypes: LAA (78/281, 59/204, SAD (97/281, 53/204, and CE (106/281, 89/204. In univariate analyses, no statistical differences in LUMA levels were observed between the 3 etiologies in either cohort. Multivariate analysis, adjusted by age, sex, hyperlipidemia, and smoking habit, confirmed the lack of differences in methylation levels between the analyzed IS subtypes in both cohorts. Despite differences in pathogenesis, our results showed no global methylation differences between LAA, SAD, and CE subtypes of IS. Further work is required to establish whether the epigenetic mechanism of methylation might play a role in this complex disease.
Morales, Eva; Vilahur, Nadia; Salas, Lucas A; Motta, Valeria; Fernandez, Mariana F; Murcia, Mario; Llop, Sabrina; Tardon, Adonina; Fernandez-Tardon, Guillermo; Santa-Marina, Loreto; Gallastegui, Mara; Bollati, Valentina; Estivill, Xavier; Olea, Nicolas; Sunyer, Jordi; Bustamante, Mariona
2016-10-01
We conducted an epigenome-wide association study (EWAS) of DNA methylation in placenta in relation to maternal tobacco smoking during pregnancy and examined whether smoking-induced changes lead to low birthweight. DNA methylation in placenta was measured using the Illumina HumanMethylation450 BeadChip in 179 participants from the INfancia y Medio Ambiente (INMA) birth cohort. Methylation levels across 431 311 CpGs were tested for differential methylation between smokers and non-smokers in pregnancy. We took forward three top-ranking loci for further validation and replication by bisulfite pyrosequencing using data of 248 additional participants of the INMA cohort. We examined the association of methylation at smoking-associated loci with birthweight by applying a mediation analysis and a two-sample Mendelian randomization approach. Fifty CpGs were differentially methylated in placenta between smokers and non-smokers during pregnancy [false discovery rate (FDR) < 0.05]. We validated and replicated differential methylation at three top-ranking loci: cg27402634 located between LINC00086 and LEKR1, a gene previously related to birthweight in genome-wide association studies; cg20340720 (WBP1L); and cg25585967 and cg12294026 (TRIO). Dose-response relationships with maternal urine cotinine concentration during pregnancy were confirmed. Differential methylation at cg27402634 explained up to 36% of the lower birthweight in the offspring of smokers (Sobel P-value < 0.05). A two-sample Mendelian randomization analysis provided evidence that decreases in methylation levels at cg27402634 lead to decreases in birthweight. We identified novel loci differentially methylated in placenta in relation to maternal smoking during pregnancy. Adverse effects of maternal smoking on birthweight of the offspring may be mediated by alterations in the placental methylome. © The Author 2016; all rights reserved. Published by Oxford University Press on behalf of the International
Altered DNA methylation associated with a translocation linked to major mental illness
McCartney, Daniel L; Walker, Rosie M; Morris, Stewart W; Anderson, Susan M; Duff, Barbara J; Marioni, Riccardo E; Millar, J Kirsty; McCarthy, Shane E; Ryan, Niamh M; Lawrie, Stephen M; Watson, Andrew R; Blackwood, Douglas H R; Thomson, Pippa A; McIntosh, Andrew M; McCombie, W Richard
2018-01-01
Recent work has highlighted a possible role for altered epigenetic modifications, including differential DNA methylation, in susceptibility to psychiatric illness. Here, we investigate blood-based DNA methylation in a large family where a balanced translocation between chromosomes 1 and 11 shows genome-wide significant linkage to psychiatric illness. Genome-wide DNA methylation was profiled in whole-blood-derived DNA from 41 individuals using the Infinium HumanMethylation450 BeadChip (Illumin...
Characterization of Dnmt1 Binding and DNA Methylation on Nucleosomes and Nucleosomal Arrays.
Directory of Open Access Journals (Sweden)
Anna Schrader
Full Text Available The packaging of DNA into nucleosomes and the organisation into higher order structures of chromatin limits the access of sequence specific DNA binding factors to DNA. In cells, DNA methylation is preferentially occuring in the linker region of nucleosomes, suggesting a structural impact of chromatin on DNA methylation. These observations raise the question whether DNA methyltransferases are capable to recognize the nucleosomal substrates and to modify the packaged DNA. Here, we performed a detailed analysis of nucleosome binding and nucleosomal DNA methylation by the maintenance DNA methyltransferase Dnmt1. Our binding studies show that Dnmt1 has a DNA length sensing activity, binding cooperatively to DNA, and requiring a minimal DNA length of 20 bp. Dnmt1 needs linker DNA to bind to nucleosomes and most efficiently recognizes nucleosomes with symmetric DNA linkers. Footprinting experiments reveal that Dnmt1 binds to both DNA linkers exiting the nucleosome core. The binding pattern correlates with the efficient methylation of DNA linkers. However, the enzyme lacks the ability to methylate nucleosomal CpG sites on mononucleosomes and nucleosomal arrays, unless chromatin remodeling enzymes create a dynamic chromatin state. In addition, our results show that Dnmt1 functionally interacts with specific chromatin remodeling enzymes to enable complete methylation of hemi-methylated DNA in chromatin.
DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.
Directory of Open Access Journals (Sweden)
Mads Dyrvig
Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.
Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones
Institute of Scientific and Technical Information of China (English)
2008-01-01
High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.
Alghamian, Yaman; Abou Alchamat, Ghalia; Murad, Hossam; Madania, Ammar
2017-09-01
DNA damage caused by radiation initiates biological responses affecting cell fate. DNA methylation regulates gene expression and modulates DNA damage pathways. Alterations in the methylation profiles of cell cycle regulating genes may control cell response to radiation. In this study we investigated the effect of ionizing radiation on the methylation levels of 22 cell cycle regulating genes in correlation with gene expression in 1321NI astrocytoma cell line. 1321NI cells were irradiated with 2, 5 or 10Gy doses then analyzed after 24, 48 and 72h for cell viability using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazoliu bromide) assay. Flow cytometry were used to study the effect of 10Gy irradiation on cell cycle. EpiTect Methyl II PCR Array was used to identify differentially methylated genes in irradiated cells. Changes in gene expression was determined by qPCR. Azacytidine treatment was used to determine whether DNA methylation affectes gene expression. Our results showed that irradiation decreased cell viability and caused cell cycle arrest at G2/M. Out of 22 genes tested, only CCNF and RAD9A showed some increase in DNA methylation (3.59% and 3.62%, respectively) after 10Gy irradiation, and this increase coincided with downregulation of both genes (by 4 and 2 fold, respectively). with azacytidine confirmed that expression of CCNF and RAD9A genes was regulated by methylation. 1321NI cell line is highly radioresistant and that irradiation of these cells with a 10Gy dose increases DNA methylation of CCNF and RAD9A genes. This dose down-regulates these genes, favoring G2/M arrest. Copyright © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Wong, Yan Fung; Micklem, Chris N; Taguchi, Masataka
2014-01-01
Myelodysplastic syndrome (MDS) is a disorder of hematopoietic stem cells (HSCs) that is often treated with DNA methyltransferase 1 (DNMT1) inhibitors (5-azacytidine [AZA], 5-aza-2'-deoxycytidine), suggesting a role for DNA methylation in disease progression. How DNMT inhibition retards disease...... regulators not expressed within the hematopoietic compartment and was distinct from that observed between healthy hematopoietic cell types. After AZA treatment, we observed only limited DNA demethylation at sites that varied between patients. This suggests that a subset of the stem cell population...... is resistant to AZA and provides a basis for disease relapse. Using gene expression data from patient samples and an in vitro AZA treatment study, we identified differentially methylated genes that can be activated following treatment and that remain silent in the CD34+ stem cell compartment of high-risk MDS...
Pros and cons of methylation-based enrichment methods for ancient DNA
Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic
2015-01-01
The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828
Energy Technology Data Exchange (ETDEWEB)
Maldonado Santoyo, Maria; Rodriguez Flores, Crescencio; Lopez Torres, Adolfo; Wrobel, Kazimierz [Department of Chemistry, University of Guanajuato, L de Retana No 5, 36000 Guanajuato (Mexico); Wrobel, Katarzyna, E-mail: katarzyn@quijote.ugto.mx [Department of Chemistry, University of Guanajuato, L de Retana No 5, 36000 Guanajuato (Mexico)
2011-10-15
In this work, possible relationships between global DNA methylation and metal/metalloid concentrations in earthworms have been explored. Direct correlation was observed between soil and tissue As, Se, Sb, Zn, Cu, Mn, Ag, Co, Hg, Pb (p < 0.05). Speciation results obtained for As and Hg hint at the capability of earthworms for conversion of inorganic element forms present in soil to methylated species. Inverse correlation was observed between the percentage of methylated DNA cytosines and total tissue As, As + Hg, As + Hg + Se + Sb ({beta} = -0.8456, p = 0.071; {beta} = -0.9406, p = 0.017; {beta} = -0.9526, p = 0.012 respectively), as well as inorganic As + Hg ({beta} = -0.8807, p = 0.049). It was concluded that earthworms would be particularly helpful as bioindicators of elements undergoing in vivo methylation and might also be used to assess the related risk of epigenetic changes in DNA methylation. - Graphical abstract: Display Omitted Highlights: > Several metals and metalloids contribute to epigenetic gene regulation. > As, Hg, Se, Sb inversely correlated with global DNA methylation in earthworms. > Biomethylation of the above elements in worms suggested. > Elements biomethylation apparently competes with DNA methylation. > DNA methylation a biomarker of epigenetic risks related to soil metals/metalloids. - Biomethylation of As, Hg in earthworms versus DNA methylation - a candidate biomarker of epigenetic risks related to the presence of metals/metalloids in soil.
Directory of Open Access Journals (Sweden)
Chung Jae
2009-06-01
Full Text Available Abstract Background Cisplatin and carboplatin are the primary first-line therapies for the treatment of ovarian cancer. However, resistance to these platinum-based drugs occurs in the large majority of initially responsive tumors, resulting in fully chemoresistant, fatal disease. Although the precise mechanism(s underlying the development of platinum resistance in late-stage ovarian cancer patients currently remains unknown, CpG-island (CGI methylation, a phenomenon strongly associated with aberrant gene silencing and ovarian tumorigenesis, may contribute to this devastating condition. Methods To model the onset of drug resistance, and investigate DNA methylation and gene expression alterations associated with platinum resistance, we treated clonally derived, drug-sensitive A2780 epithelial ovarian cancer cells with increasing concentrations of cisplatin. After several cycles of drug selection, the isogenic drug-sensitive and -resistant pairs were subjected to global CGI methylation and mRNA expression microarray analyses. To identify chemoresistance-associated, biological pathways likely impacted by DNA methylation, promoter CGI methylation and mRNA expression profiles were integrated and subjected to pathway enrichment analysis. Results Promoter CGI methylation revealed a positive association (Spearman correlation of 0.99 between the total number of hypermethylated CGIs and GI50 values (i.e., increased drug resistance following successive cisplatin treatment cycles. In accord with that result, chemoresistance was reversible by DNA methylation inhibitors. Pathway enrichment analysis revealed hypermethylation-mediated repression of cell adhesion and tight junction pathways and hypomethylation-mediated activation of the cell growth-promoting pathways PI3K/Akt, TGF-beta, and cell cycle progression, which may contribute to the onset of chemoresistance in ovarian cancer cells. Conclusion Selective epigenetic disruption of distinct biological
Directory of Open Access Journals (Sweden)
Elmar W Tobi
Full Text Available Both the early environment and genetic variation may affect DNA methylation, which is one of the major molecular marks of the epigenome. The combined effect of these factors on a well-defined locus has not been studied to date. We evaluated the association of periconceptional exposure to the Dutch Famine of 1944-45, as an example of an early environmental exposure, and single nucleotide polymorphisms covering the genetic variation (tagging SNPs with DNA methylation at the imprinted IGF2/H19 region, a model for an epigenetically regulated genomic region. DNA methylation was measured at five differentially methylated regions (DMRs that regulate the imprinted status of the IGF2/H19 region. Small but consistent differences in DNA methylation were observed comparing 60 individuals with periconceptional famine exposure with unexposed same-sex siblings at all IGF2 DMRs (P(BH<0.05 after adjustment for multiple testing, but not at the H19 DMR. IGF2 DMR0 methylation was associated with IGF2 SNP rs2239681 (P(BH = 0.027 and INS promoter methylation with INS SNPs, including rs689, which tags the INS VNTR, suggesting a mechanism for the reported effect of the VNTR on INS expression (P(BH = 3.4 × 10(-3. Prenatal famine and genetic variation showed similar associations with IGF2/H19 methylation and their contributions were additive. They were small in absolute terms (<3%, but on average 0.5 standard deviations relative to the variation in the population. Our analyses suggest that environmental and genetic factors could have independent and additive similarly sized effects on DNA methylation at the same regulatory site.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
The multi-domain protein Np95 connects DNA methylation and histone modification
Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich
2010-01-01
DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ß. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways. PMID:20026581
Li, Yin; Hamilton, Katherine J; Lai, Anne Y; Burns, Katherine A; Li, Leping; Wade, Paul A; Korach, Kenneth S
2014-03-01
Diethylstilbestrol (DES) is a synthetic estrogen associated with adverse effects on reproductive organs. DES-induced toxicity of the mouse seminal vesicle (SV) is mediated by estrogen receptor α (ERα), which alters expression of seminal vesicle secretory protein IV (Svs4) and lactoferrin (Ltf) genes. We examined a role for nuclear receptor activity in association with DNA methylation and altered gene expression. We used the neonatal DES exposure mouse model to examine DNA methylation patterns via bisulfite conversion sequencing in SVs of wild-type (WT) and ERα-knockout (αERKO) mice. The DNA methylation status at four specific CpGs (-160, -237, -306, and -367) in the Svs4 gene promoter changed during mouse development from methylated to unmethylated, and DES prevented this change at 10 weeks of age in WT SV. At two specific CpGs (-449 and -459) of the Ltf gene promoter, DES altered the methylation status from methylated to unmethylated. Alterations in DNA methylation of Svs4 and Ltf were not observed in αERKO SVs, suggesting that changes of methylation status at these CpGs are ERα dependent. The methylation status was associated with the level of gene expression. In addition, gene expression of three epigenetic modifiers-DNMT3A, MBD2, and HDAC2-increased in the SV of DES-exposed WT mice. DES-induced hormonal toxicity resulted from altered gene expression of Svs4 and Ltf associated with changes in DNA methylation that were mediated by ERα. Alterations in gene expression of DNMT3A, MBD2, and HDAC2 in DES-exposed male mice may be involved in mediating the changes in methylation status in the SV. Li Y, Hamilton KJ, Lai AY, Burns KA, Li L, Wade PA, Korach KS. 2014. Diethylstilbestrol (DES)-stimulated hormonal toxicity is mediated by ERα alteration of target gene methylation patterns and epigenetic modifiers (DNMT3A, MBD2, and HDAC2) in the mouse seminal vesicle. Environ Health Perspect 122:262-268; http://dx.doi.org/10.1289/ehp.1307351.
Brown, William M
2015-12-01
Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where
Rivière, Guillaume; Lienhard, Daniel; Andrieu, Thomas; Vieau, Didier; Frey, Brigitte M; Frey, Felix J
2011-04-01
Somatic angiotensin-converting enzyme (sACE) is crucial in cardiovascular homeostasis and displays a tissue-specific profile. Epigenetic patterns modulate genes expression and their alterations were implied in pathologies including hypertension. However, the influence of DNA methylation and chromatin condensation state on the expression of sACE is unknown. We examined whether such epigenetic mechanisms could participate in the control of sACE expression in vitro and in vivo. We identified two CpG islands in the human ace-1 gene 3 kb proximal promoter region. Their methylation abolished the luciferase activity of ace-1 promoter/reporter constructs transfected into human liver (HepG2), colon (HT29), microvascular endothelial (HMEC-1) and lung (SUT) cell lines (p sACE mRNA expression cell-type specifically (p sACE mRNA expression in the lungs and liver (p = 0.05), but not in the kidney. In conclusion, the expression level of somatic ACE is modulated by CpG-methylation and histone deacetylases inhibition. The basal methylation pattern of the promoter of the ace-1 gene is cell-type specific and correlates to sACE transcription. DNMT inhibition is associated with altered methylation of the ace-1 promoter and a cell-type and tissue-specific increase of sACE mRNA levels. This study indicates a strong influence of epigenetic mechanisms on sACE expression.
DNA Methylation: An Epigenetic Risk Factor in Preterm Birth
Menon, Ramkumar; Conneely, Karen N.; Smith, Alicia K.
2012-01-01
Spontaneous preterm birth (PTB; birth prior to 37 weeks of gestation) is a complex phenotype with multiple risk factors that complicate our understanding of its etiology. A number of recent studies have supported the hypothesis that epigenetic modifications such as DNA methylation induced by pregnancy-related risk factors may influence the risk of PTB or result in changes that predispose a neonate to adult-onset diseases. The critical role of timing of gene expression in the etiology of PTB makes it a highly relevant disorder in which to examine the potential role of epigenetic changes. Because changes in DNA methylation patterns can result in long-term consequences, it is of critical interest to identify the epigenetic patterns associated with adverse pregnancy outcomes. This review examines the potential role of DNA methylation as a risk factor for PTB and discusses several issues and limitations that should be considered when planning DNA methylation studies. PMID:22228737
Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G
2006-02-09
Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.
Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O
2017-08-01
Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.
Modulation of DNA methylation by human papillomavirus E6 and E7 oncoproteins in cervical cancer
Sen, Prakriti; Ganguly, Pooja; Ganguly, Niladri
2018-01-01
Human papillomaviruses (HPVs) are double stranded circular DNA viruses that infect cutaneous and mucosal epithelial cells. Almost 99% of cervical cancer has a HPV infection. The early oncoproteins E6 and E7 are important in this cellular transformation process. Epigenetic mechanisms have long been known to result in decisive alterations in DNA, leading to alterations in DNA-protein interactions, alterations in chromatin structure and compaction and significant alterations in gene expression. The enzymes responsible for these epigenetic modifications are DNA methyl transferases (DNMTs), histone acetylases and deacetylases. Epigenetics has an important role in cancer development by modifying the cellular micro environment. In this review, the authors discuss the role of HPV oncoproteins E6 and E7 in modulating the epigenetic mechanisms inside the host cell. The oncoproteins induce the expression of DNMTs which lead to aberrant DNA methylations and disruption of the normal epigenetic processes. The E7 oncoprotein may additionally directly bind and induce methyl transferase activity of the enzyme. These modulations lead to altered gene expression levels, particularly the genes involved in apoptosis, cell cycle and cell adhesion. In addition, the present review discusses how epigenetic mechanisms may be targeted for possible therapeutic interventions for HPV mediated cervical cancer. PMID:29285184
Hydroxylation of methylated DNA by TET1 in chondrocyte differentiation of C3H10T1/2 cells
Directory of Open Access Journals (Sweden)
Ryo Ito
2016-03-01
Full Text Available DNA methylation is closely involved in the regulation of cellular differentiation, including chondrogenic differentiation of mesenchymal stem cells. Recent studies showed that Ten–eleven translocation (TET family proteins converted 5-methylcytosine (5mC to 5-hydroxymethylcytosine, 5-formylcytosine and 5carboxylcytosine by oxidation. These reactions constitute potential mechanisms for active demethylation of methylated DNA. However, the relationship between the DNA methylation patterns and the effects of TET family proteins in chondrocyte differentiation is still unclear. In this study, we showed that DNA hydroxylation of 5mC was increased during chondrocytic differentiation of C3H10T1/2 cells and that the expression of Tet1 was particularly enhanced. Moreover, knockdown experiments revealed that the downregulation of Tet1 expression caused decreases in chondrogenesis markers such as type 2 and type 10 collagens. Furthermore, we found that TET proteins had a site preference for hydroxylation of 5mC on the Insulin-like growth factor 1 (Igf1 promoter in chondrocytes. Taken together, we showed that the expression of Tet1 was specifically facilitated in chondrocyte differentiation and Tet1 can regulate chondrocyte marker gene expression presumably through its hydroxylation activity for DNA.
Obesity-related DNA methylation at imprinted genes in human sperm: Results from the TIEGER study.
Soubry, Adelheid; Guo, Lisa; Huang, Zhiqing; Hoyo, Cathrine; Romanus, Stephanie; Price, Thomas; Murphy, Susan K
2016-01-01
Epigenetic reprogramming in mammalian gametes resets methylation marks that regulate monoallelic expression of imprinted genes. In males, this involves erasure of the maternal methylation marks and establishment of paternal-specific methylation to appropriately guide normal development. The degree to which exogenous factors influence the fidelity of methylation reprogramming is unknown. We previously found an association between paternal obesity and altered DNA methylation in umbilical cord blood, suggesting that the father's endocrine, nutritional, or lifestyle status could potentiate intergenerational heritable epigenetic abnormalities. In these analyses, we examine the relationship between male overweight/obesity and DNA methylation status of imprinted gene regulatory regions in the gametes. Linear regression models were used to compare sperm DNA methylation percentages, quantified by bisulfite pyrosequencing, at 12 differentially methylated regions (DMRs) from 23 overweight/obese and 44 normal weight men. Our study population included 69 volunteers from The Influence of the Environment on Gametic Epigenetic Reprogramming (TIEGER) study, based in NC, USA. After adjusting for age and fertility patient status, semen from overweight or obese men had significantly lower methylation percentages at the MEG3 (β = -1.99; SE = 0.84; p = 0.02), NDN (β = -1.10; SE = 0.47; p = 0.02), SNRPN (β = -0.65; SE = 0.27; p = 0.02), and SGCE/PEG10 (β = -2.5; SE = 1.01; p = 0.01) DMRs. Our data further suggest a slight increase in DNA methylation at the MEG3-IG DMR (β = +1.22; SE = 0.59; p = 0.04) and H19 DMR (β = +1.37; SE = 0.62; p = 0.03) in sperm of overweight/obese men. Our data support that male overweight/obesity status is traceable in the sperm epigenome. Further research is needed to understand the effect of such changes and the point of origin of DNA methylation differences between lean and
The Role of DNA Methylation in Xylogenesis in Different Tissues of Poplar
Directory of Open Access Journals (Sweden)
Qingshi Wang
2016-07-01
Full Text Available In trees, xylem tissues play a key role in the formation of woody tissues, which have important uses for pulp and timber production; also DNA methylation plays an important part in gene regulation during xylogenesis in trees. In our study, methylation-sensitive amplified polymorphism (MSAP analysis was used to analyze the role cytosine methylation plays in wood formation in the commercially important tree species Populus tomentosa. This analysis compared the methylation patterns between xylem tissues (developing xylem and mature xylem and non-xylem tissues (cambium, shoot apex, young leaf, mature leaf, phloem, root, male catkin, and female catkin and found 10,316 polymorphic methylation sites. MSAP identified 132 candidate genes with the same methylation patterns in xylem tissues, including seven wood-related genes. The expression of these genes differed significantly between xylem and non-xylem tissue types (P<0.01. This indicated that the difference of expression of specific genes with unique methylation patterns, rather than relative methylation levels between the two tissue types plays a critical role in wood biosynthesis. However, 46.2% of candidate genes with the same methylation pattern in vascular tissues (cambium, phloem, and developing xylem did not have distinct expression patterns in xylem and non-xylem tissue. Also, bisulfite sequencing and transcriptome sequencing of MYB, NAC and FASCICLIN-LIKE AGP 13 revealed that the location of cytosine methylation in the gene might affect the expression of different transcripts from the corresponding gene. The expression of different transcripts that produce distinct proteins from a single gene might play an important role in the regulation of xylogenesis.
Cao, Yi
2015-09-01
Environmental pollution is one of the main causes of human cancer. Exposures to environmental carcinogens result in genetic and epigenetic alterations which induce cell transformation. Epigenetic changes caused by environmental pollution play important roles in the development and progression of environmental pollution-related cancers. Studies on DNA methylation are among the earliest and most conducted epigenetic research linked to cancer. In this review, the roles of DNA methylation in carcinogenesis and their significance in clinical medicine were summarized, and the effects of environmental pollutants, particularly air pollutants, on DNA methylation were introduced. Furthermore, prospective applications of DNA methylation to environmental pollution detection and cancer prevention were discussed.
Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.
Directory of Open Access Journals (Sweden)
Toshinori Hinoue
Full Text Available A CpG island methylator phenotype (CIMP is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E is tightly associated with CIMP, raising the question of whether BRAF(V600E plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E. We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E causes DNA hypermethylation by stably expressing BRAF(V600E in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling, EPHA3, KIT, and FLT1 (receptor tyrosine kinases and SMO (Hedgehog signaling. Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E in CIMP+ colorectal cancer. Our data will be useful for future investigations toward
Analysis of the association between CIMP and BRAF in colorectal cancer by DNA methylation profiling.
Hinoue, Toshinori; Weisenberger, Daniel J; Pan, Fei; Campan, Mihaela; Kim, Myungjin; Young, Joanne; Whitehall, Vicki L; Leggett, Barbara A; Laird, Peter W
2009-12-21
A CpG island methylator phenotype (CIMP) is displayed by a distinct subset of colorectal cancers with a high frequency of DNA hypermethylation in a specific group of CpG islands. Recent studies have shown that an activating mutation of BRAF (BRAF(V600E)) is tightly associated with CIMP, raising the question of whether BRAF(V600E) plays a causal role in the development of CIMP or whether CIMP provides a favorable environment for the acquisition of BRAF(V600E). We employed Illumina GoldenGate DNA methylation technology, which interrogates 1,505 CpG sites in 807 different genes, to further study this association. We first examined whether expression of BRAF(V600E) causes DNA hypermethylation by stably expressing BRAF(V600E) in the CIMP-negative, BRAF wild-type COLO 320DM colorectal cancer cell line. We determined 100 CIMP-associated CpG sites and examined changes in DNA methylation in eight stably transfected clones over multiple passages. We found that BRAF(V600E) is not sufficient to induce CIMP in our system. Secondly, considering the alternative possibility, we identified genes whose DNA hypermethylation was closely linked to BRAF(V600E) and CIMP in 235 primary colorectal tumors. Interestingly, genes that showed the most significant link include those that mediate various signaling pathways implicated in colorectal tumorigenesis, such as BMP3 and BMP6 (BMP signaling), EPHA3, KIT, and FLT1 (receptor tyrosine kinases) and SMO (Hedgehog signaling). Furthermore, we identified CIMP-dependent DNA hypermethylation of IGFBP7, which has been shown to mediate BRAF(V600E)-induced cellular senescence and apoptosis. Promoter DNA hypermethylation of IGFBP7 was associated with silencing of the gene. CIMP-specific inactivation of BRAF(V600E)-induced senescence and apoptosis pathways by IGFBP7 DNA hypermethylation might create a favorable context for the acquisition of BRAF(V600E) in CIMP+ colorectal cancer. Our data will be useful for future investigations toward understanding
Aberrantly methylated DNA as a biomarker in breast cancer.
Kristiansen, Søren; Jørgensen, Lars M; Guldberg, Per; Sölétormos, György
2013-01-01
Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into subgroups based on DNA biomarkers may improve prognosis. Serial monitoring of DNA-methylation markers in blood during treatment may be useful, particularly when the cancer burden is below the detection level for standard imaging techniques. Overall, aberrant DNA methylation has a great potential as a versatile biomarker tool for screening, diagnosis, prognosis and monitoring of breast cancer. Standardization of methods and biomarker panels will be required to fully exploit this clinical potential.
Zhu, Honglin; Mi, Wentao; Luo, Hui; Chen, Tao; Liu, Shengxi; Raman, Indu; Zuo, Xiaoxia; Li, Quan-Zhen
2016-07-13
Recent achievement in genetics and epigenetics has led to the exploration of the pathogenesis of systemic lupus erythematosus (SLE). Identification of differentially expressed genes and their regulatory mechanism(s) at whole-genome level will provide a comprehensive understanding of the development of SLE and its devastating complications, lupus nephritis (LN). We performed whole-genome transcription and DNA methylation analysis in PBMC of 30 SLE patients, including 15 with LN (SLE LN(+)) and 15 without LN (SLE LN(-)), and 25 normal controls (NC) using HumanHT-12 Beadchips and Illumina Human Methy450 chips. The serum proinflammatory cytokines were quantified using Bio-plex Human Cytokine 27-plex assay. Differentially expressed genes and differentially methylated CpG were analyzed with GenomeStudio, R, and SAM software. The association between DNA methylation and gene expression were tested. Gene interaction pathways of the differentially expressed genes were analyzed by IPA software. We identified 552 upregulated genes and 550 downregulated genes in PBMC of SLE. Integration of DNA methylation and gene expression profiling showed that 334 upregulated genes were hypomethylated, and 479 downregulated genes were hypermethylated. Pathway analysis on the differential genes in SLE revealed significant enrichment in interferon (IFN) signaling and toll-like receptor (TLR) signaling pathways. Nine IFN- and seven TLR-related genes were identified and displayed step-wise increase in SLE LN(-) and SLE LN(+). Hypomethylated CpG sites were detected on these genes. The gene expressions for MX1, GPR84, and E2F2 were increased in SLE LN(+) as compared to SLE LN(-) patients. The serum levels of inflammatory cytokines, including IL17A, IP-10, bFGF, TNF-α, IL-6, IL-15, GM-CSF, IL-1RA, IL-5, and IL-12p70, were significantly elevated in SLE compared with NC. The levels of IL-15 and IL1RA correlated with their mRNA expression. The upregulation of IL-15 may be regulated by hypomethylated
Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A
2018-05-08
Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.
Traumatic stress and accelerated DNA methylation age: A meta-analysis.
Wolf, Erika J; Maniates, Hannah; Nugent, Nicole; Maihofer, Adam X; Armstrong, Don; Ratanatharathorn, Andrew; Ashley-Koch, Allison E; Garrett, Melanie; Kimbrel, Nathan A; Lori, Adriana; Va Mid-Atlantic Mirecc Workgroup; Aiello, Allison E; Baker, Dewleen G; Beckham, Jean C; Boks, Marco P; Galea, Sandro; Geuze, Elbert; Hauser, Michael A; Kessler, Ronald C; Koenen, Karestan C; Miller, Mark W; Ressler, Kerry J; Risbrough, Victoria; Rutten, Bart P F; Stein, Murray B; Ursano, Robert J; Vermetten, Eric; Vinkers, Christiaan H; Uddin, Monica; Smith, Alicia K; Nievergelt, Caroline M; Logue, Mark W
2018-06-01
Recent studies examining the association between posttraumatic stress disorder (PTSD) and accelerated aging, as defined by DNA methylation-based estimates of cellular age that exceed chronological age, have yielded mixed results. We conducted a meta-analysis of trauma exposure and PTSD diagnosis and symptom severity in association with accelerated DNA methylation age using data from 9 cohorts contributing to the Psychiatric Genomics Consortium PTSD Epigenetics Workgroup (combined N = 2186). Associations between demographic and cellular variables and accelerated DNA methylation age were also examined, as was the moderating influence of demographic variables. Meta-analysis of regression coefficients from contributing cohorts revealed that childhood trauma exposure (when measured with the Childhood Trauma Questionnaire) and lifetime PTSD severity evidenced significant, albeit small, meta-analytic associations with accelerated DNA methylation age (ps = 0.028 and 0.016, respectively). Sex, CD4T cell proportions, and natural killer cell proportions were also significantly associated with accelerated DNA methylation age (all ps age. There was no evidence of moderation of the trauma or PTSD variables by demographic factors. Results suggest that traumatic stress is associated with advanced epigenetic age and raise the possibility that cells integral to immune system maintenance and responsivity play a role in this. This study highlights the need for additional research into the biological mechanisms linking traumatic stress to accelerated DNA methylation age and the importance of furthering our understanding of the neurobiological and health consequences of PTSD. Published by Elsevier Ltd.
An evaluation of two-channel ChIP-on-chip and DNA methylation microarray normalization strategies
2012-01-01
Background The combination of chromatin immunoprecipitation with two-channel microarray technology enables genome-wide mapping of binding sites of DNA-interacting proteins (ChIP-on-chip) or sites with methylated CpG di-nucleotides (DNA methylation microarray). These powerful tools are the gateway to understanding gene transcription regulation. Since the goals of such studies, the sample preparation procedures, the microarray content and study design are all different from transcriptomics microarrays, the data pre-processing strategies traditionally applied to transcriptomics microarrays may not be appropriate. Particularly, the main challenge of the normalization of "regulation microarrays" is (i) to make the data of individual microarrays quantitatively comparable and (ii) to keep the signals of the enriched probes, representing DNA sequences from the precipitate, as distinguishable as possible from the signals of the un-enriched probes, representing DNA sequences largely absent from the precipitate. Results We compare several widely used normalization approaches (VSN, LOWESS, quantile, T-quantile, Tukey's biweight scaling, Peng's method) applied to a selection of regulation microarray datasets, ranging from DNA methylation to transcription factor binding and histone modification studies. Through comparison of the data distributions of control probes and gene promoter probes before and after normalization, and assessment of the power to identify known enriched genomic regions after normalization, we demonstrate that there are clear differences in performance between normalization procedures. Conclusion T-quantile normalization applied separately on the channels and Tukey's biweight scaling outperform other methods in terms of the conservation of enriched and un-enriched signal separation, as well as in identification of genomic regions known to be enriched. T-quantile normalization is preferable as it additionally improves comparability between microarrays. In
Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.
Cooper, D N; Errington, L H; Clayton, R M
1983-01-01
Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.
Valledor, Luis; Meijón, Mónica; Hasbún, Rodrigo; Jesús Cañal, Maria; Rodríguez, Roberto
2010-03-15
Needle differentiation is a very complex process associated with the formation of a mature photosynthetic organ. From meristem differentiation to leaf maturation, gene control must play an important role switching required genes on and off to define tissue functions, with the epigenetic code being one of the main regulation mechanisms. In this work, we examined the connections between the variation in the levels of some epigenetic players (DNA methylation, acetylated histone H4 and histone H3 methylation at Lys 4 and Lys 9) at work during needle maturation. Our results indicate that needle maturation, which is associated with a decrease in organogenic capability, is related to an increase in heterochromatin-related epigenetic markers (high DNA methylation and low acetylated histone H4 levels, and the presence of histone H3 methylated at lys 9). Immunohistochemical analyses also showed that the DNA methylation of palisade parenchyma cell layers during the transition from immature to mature scions is associated with the loss of the capacity to induce adventitious organs. Copyright 2009 Elsevier GmbH. All rights reserved.
In vivo control of CpG and non-CpG DNA methylation by DNA methyltransferases.
Directory of Open Access Journals (Sweden)
Julia Arand
2012-06-01
Full Text Available The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites. The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position-, cell type-, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM to calculate the relative contribution of DNA methyltransferases (Dnmts for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs.
Genome-wide screen of ovary-specific DNA methylation in polycystic ovary syndrome.
Yu, Ying-Ying; Sun, Cui-Xiang; Liu, Yin-Kun; Li, Yan; Wang, Li; Zhang, Wei
2015-07-01
To compare genome-wide DNA methylation profiles in ovary tissue from women with polycystic ovary syndrome (PCOS) and healthy controls. Case-control study matched for age and body mass index. University-affiliated hospital. Ten women with PCOS who underwent ovarian drilling to induce ovulation and 10 healthy women who were undergoing laparoscopic sterilization, hysterectomy for benign conditions, diagnostic laparoscopy for pelvic pain, or oophorectomy for nonovarian indications. None. Genome-wide DNA methylation patterns determined by immunoprecipitation and microarray (MeDIP-chip) analysis. The methylation levels were statistically significantly higher in CpG island shores (CGI shores), which lie outside of core promoter regions, and lower within gene bodies in women with PCOS relative to the controls. In addition, high CpG content promoters were the most frequently hypermethylated promoters in PCOS ovaries but were more often hypomethylated in controls. Second, 872 CGIs, specifically methylated in PCOS, represented 342 genes that could be associated with various molecular functions, including protein binding, hormone activity, and transcription regulator activity. Finally, methylation differences were validated in seven genes by methylation-specific polymerase chain reaction. These genes correlated to several functional families related to the pathogenesis of PCOS and may be potential biomarkers for this disease. Our results demonstrated that epigenetic modification differs between PCOS and normal ovaries, which may help to further understand the pathophysiology of this disease. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Morales, Eva; Groom, Alexandra; Lawlor, Debbie A; Relton, Caroline L
2014-05-02
Epigenetic changes could mediate the association of maternal pre-pregnancy body mass index (BMI) and gestational weight gain (GWG) with adverse offspring outcomes. However, studies in humans are lacking. Here, we examined the association of maternal pre-pregnancy BMI and GWG in different periods of pregnancy with cytosine-guanine (CpG) dinucleotide site methylation differences in newborn cord blood DNA from 88 participants in the Avon Longitudinal Study of Parents and Children (ALSPAC) cohort using the Illumina GoldenGate Panel I. Pyrosequencing was used for validation of the top associated locus and for replication in 170 non-overlapping mother-offspring pairs from the ALSPAC cohort. After correction for multiple testing greater GWG in early pregnancy (between 0 to 18 weeks of gestation) was associated with increased DNA methylation levels in four CpG sites at MMP7, KCNK4, TRPM5 and NFKB1 genes (difference in methylation >5% per 400 g/week greater GWG) (q values 0.023 -0.065). Pre-pregnancy BMI and GWG in mid- or late pregnancy were not associated with differential DNA methylation at any CpG site. Pyrosequencing showed that greater GWG in early pregnancy was associated with increased DNA methylation levels at the top associated CpG site at MMP7, although association did not reach statistical significance (p = 0.302). Greater GWG in mid- (p = 0.167) and late-pregnancy (p = 0.037) were also associated with increased DNA methylation levels at the MMP7 CpG site. In addition, newborns of mothers who exceeded the IoM-recommended GWG had higher DNA methylation levels at the MMP7 CpG site than those of mothers with IoM-recommended GWG (p = 0.080). We failed to replicate findings. Greater GWG in early pregnancy was associated with increased methylation at CpG sites at MMP7, KCNK4, TRPM5 and NFKB1 genes in offspring cord blood DNA. The specific association of GWG in early pregnancy with the top associated CpG site at MMP7 was not validated using
Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA
Directory of Open Access Journals (Sweden)
Zhongai Li
2015-01-01
Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.
Potential of DNA methylation in rectal cancer as diagnostic and prognostic biomarkers
Exner, Ruth; Pulverer, Walter; Diem, Martina; Spaller, Lisa; Woltering, Laura; Schreiber, Martin; Wolf, Brigitte; Sonntagbauer, Markus; Schr?der, Fabian; Stift, Judith; Wrba, Fritz; Bergmann, Michael; Weinh?usel, Andreas; Egger, Gerda
2015-01-01
Background: Aberrant DNA methylation is more prominent in proximal compared with distal colorectal cancers. Although a number of methylation markers were identified for colon cancer, yet few are available for rectal cancer. Methods: DNA methylation differences were assessed by a targeted DNA microarray for 360 marker candidates between 22 fresh frozen rectal tumour samples and 8 controls and validated by microfluidic high-throughput and methylation-sensitive qPCR in fresh frozen and formalin-...
Quantitative analysis of DNA methylation in chronic lymphocytic leukemia patients.
Lyko, Frank; Stach, Dirk; Brenner, Axel; Stilgenbauer, Stephan; Döhner, Hartmut; Wirtz, Michaela; Wiessler, Manfred; Schmitz, Oliver J
2004-06-01
Changes in the genomic DNA methylation level have been found to be closely associated with tumorigenesis. In order to analyze the relation of aberrant DNA methylation to clinical and biological risk factors, we have determined the cytosine methylation level of 81 patients diagnosed with chronic lymphocytic leukemia (CLL). The analysis was based on DNA hydrolysis followed by derivatization of the 2'-desoxyribonucleoside-3'-monophosphates with BODIPY FL EDA. Derivatives were separated by micellar electrokinetic chromatography, and laser-induced fluorescence was used for detection. We analyzed potential correlations between DNA methylation levels and numerous patient parameters, including clinical observations and biological data. As a result, we observed a significant correlation with the immunoglobulin variable heavy chain gene (VH) mutation status. This factor has been repeatedly proposed as a reliable prognostic marker for CLL, which suggests that the methylation level might be a valuable factor in determining the prognostic outcome of CLL. We are now in the process of refining our method to broaden its application potential. In this context, we show here that the oxidation of the fluorescence marker in the samples and the evaporation of methanol in the electrolytes can be prevented by a film of paraffin oil. In summary, our results thus establish capillary electrophoresis as a valuable tool for analyzing the DNA methylation status of clinical samples.
microRNA-143 down-regulates Hexokinase 2 in colon cancer cells
DEFF Research Database (Denmark)
Gregersen, Lea Haarup; Jacobsen, Anders; Frankel, Lisa
2012-01-01
a significant enrichment of miR-143 seed sites in their 3' UTRs. Here we report the identification of Hexokinase 2 (HK2) as a direct target of miR-143. We show that re-introduction of miR-143 in the colon cancer cell line DLD-1 results in a decreased lactate secretion. CONCLUSION: We have identified...... and validated HK2 as a miR-143 target. Furthermore, our results indicate that miR-143 mediated down-regulation of HK2 affects glucose metabolism in colon cancer cells. We hypothesize that loss of miR-143-mediated repression of HK2 can promote glucose metabolism in cancer cells, contributing to the shift towards......ABSTRACT: BACKGROUND: MicroRNAs (miRNAs) are well recognized as gene regulators and have been implicated in the regulation of development as well as human diseases. miR-143 is located at a fragile site on chromosome 5 frequently deleted in cancer, and has been reported to be down...
International Nuclear Information System (INIS)
Unno, Yuka; Sakai, Masakazu; Sakamoto, Yu-ichiro; Kuniyasu, Akihiko; Nakayama, Hitoshi; Nagai, Ryoji; Horiuchi, Seikoh
2004-01-01
Advanced glycation end products (AGE)-modified proteins as well as oxidized-LDL (Ox-LDL) undergo receptor-mediated endocytosis by CHO cells overexpressing CD36, a member of class B scavenger receptor family. The purpose of the present study was to examine the effects of glycolaldehyde-modified BSA (GA-BSA) as an AGE-ligand and Ox-LDL on leptin expression in adipocytes. GA-BSA decreased leptin expression at both protein and mRNA levels in 3T3-L1 adipocytes and mouse epididymal adipocytes. Ox-LDL showed a similar inhibitory effect on leptin expression in 3T3-L1 adipocytes, which effect was protected by N-acetylcysteine, a reactive oxygen species (ROS) inhibitor. Binding of 125 I-GA-BSA or 125 I-Ox-LDL to 3T3-L1 adipocytes and subsequent endocytic degradation were inhibited by a neutralizing anti-CD36 antibody. Furthermore, this antibody also suppressed Ox-LDL-induced leptin down-regulation. These results clarify that the interaction of GA-BSA and Ox-LDL with CD36 leads to down-regulation of leptin expression via ROS system(s) in 3T3-L1 adipocytes, suggesting that a potential link of AGE- and/or Ox-LDL-induced leptin down-regulation might be linked to insulin-sensitivity in metabolic syndrome
Lee, Chang Youn; Shin, Sunhye; Lee, Jiyun; Seo, Hyang-Hee; Lim, Kyu Hee; Kim, Hyemin; Choi, Jung-Won; Kim, Sang Woo; Lee, Seahyung; Lim, Soyeon; Hwang, Ki-Chul
2016-10-20
Stem cell therapy using adult stem cells, such as mesenchymal stem cells (MSCs) has produced some promising results in treating the damaged heart. However, the low survival rate of MSCs after transplantation is still one of the crucial factors that limit the therapeutic effect of stem cells. In the damaged heart, oxidative stress due to reactive oxygen species (ROS) production can cause the death of transplanted MSCs. Apoptosis signal-regulating kinase 1 (ASK1) has been implicated in the development of oxidative stress-related pathologic conditions. Thus, we hypothesized that down-regulation of ASK1 in human MSCs (hMSCs) might attenuate the post-transplantation death of MSCs. To test this hypothesis, we screened microRNAs (miRNAs) based on a miRNA-target prediction database and empirical data and investigated the anti-apoptotic effect of selected miRNAs on human adipose-derived stem cells (hASCs) and on rat myocardial infarction (MI) models. Our data indicated that miRNA-301a most significantly suppressed ASK1 expression in hASCs. Apoptosis-related genes were significantly down-regulated in miRNA-301a-enriched hASCs exposed to hypoxic conditions. Taken together, these data show that miRNA-mediated down-regulation of ASK1 protects MSCs during post-transplantation, leading to an increase in the efficacy of MSC-based cell therapy.
Directory of Open Access Journals (Sweden)
Chang Youn Lee
2016-10-01
Full Text Available Stem cell therapy using adult stem cells, such as mesenchymal stem cells (MSCs has produced some promising results in treating the damaged heart. However, the low survival rate of MSCs after transplantation is still one of the crucial factors that limit the therapeutic effect of stem cells. In the damaged heart, oxidative stress due to reactive oxygen species (ROS production can cause the death of transplanted MSCs. Apoptosis signal-regulating kinase 1 (ASK1 has been implicated in the development of oxidative stress-related pathologic conditions. Thus, we hypothesized that down-regulation of ASK1 in human MSCs (hMSCs might attenuate the post-transplantation death of MSCs. To test this hypothesis, we screened microRNAs (miRNAs based on a miRNA-target prediction database and empirical data and investigated the anti-apoptotic effect of selected miRNAs on human adipose-derived stem cells (hASCs and on rat myocardial infarction (MI models. Our data indicated that miRNA-301a most significantly suppressed ASK1 expression in hASCs. Apoptosis-related genes were significantly down-regulated in miRNA-301a-enriched hASCs exposed to hypoxic conditions. Taken together, these data show that miRNA-mediated down-regulation of ASK1 protects MSCs during post-transplantation, leading to an increase in the efficacy of MSC-based cell therapy.
DNA Methylation Analysis of HTR2A Regulatory Region in Leukocytes of Autistic Subjects.
Hranilovic, Dubravka; Blazevic, Sofia; Stefulj, Jasminka; Zill, Peter
2016-02-01
Disturbed brain and peripheral serotonin homeostasis is often found in subjects with autism spectrum disorder (ASD). The role of the serotonin receptor 2A (HTR2A) in the regulation of central and peripheral serotonin homeostasis, as well as its altered expression in autistic subjects, have implicated the HTR2A gene as a major candidate for the serotonin disturbance seen in autism. Several studies, yielding so far inconclusive results, have attempted to associate autism with a functional SNP -1438 G/A (rs6311) in the HTR2A promoter region, while possible contribution of epigenetic mechanisms, such as DNA methylation, to HTR2A dysregulation in autism has not yet been investigated. In this study, we compared the mean DNA methylation within the regulatory region of the HTR2A gene between autistic and control subjects. DNA methylation was analysed in peripheral blood leukocytes using bisulfite conversion and sequencing of the HTR2A region containing rs6311 polymorphism. Autistic subjects of rs6311 AG genotype displayed higher mean methylation levels within the analysed region than the corresponding controls (P epigenetic mechanisms might contribute to HTR2A dysregulation observed in individuals with ASD. © 2015 International Society for Autism Research, Wiley Periodicals, Inc.
A DNA methylation-based definition of biologically distinct breast cancer subtypes.
Stefansson, Olafur A; Moran, Sebastian; Gomez, Antonio; Sayols, Sergi; Arribas-Jorba, Carlos; Sandoval, Juan; Hilmarsdottir, Holmfridur; Olafsdottir, Elinborg; Tryggvadottir, Laufey; Jonasson, Jon G; Eyfjord, Jorunn; Esteller, Manel
2015-03-01
In cancer, epigenetic states are deregulated and thought to be of significance in cancer development and progression. We explored DNA methylation-based signatures in association with breast cancer subtypes to assess their impact on clinical presentation and patient prognosis. DNA methylation was analyzed using Infinium 450K arrays in 40 tumors and 17 normal breast samples, together with DNA copy number changes and subtype-specific markers by tissue microarrays. The identified methylation signatures were validated against a cohort of 212 tumors annotated for breast cancer subtypes by the PAM50 method (The Cancer Genome Atlas). Selected markers were pyrosequenced in an independent validation cohort of 310 tumors and analyzed with respect to survival, clinical stage and grade. The results demonstrate that DNA methylation patterns linked to the luminal-B subtype are characterized by CpG island promoter methylation events. In contrast, a large fraction of basal-like tumors are characterized by hypomethylation events occurring within the gene body. Based on these hallmark signatures, we defined two DNA methylation-based subtypes, Epi-LumB and Epi-Basal, and show that they are associated with unfavorable clinical parameters and reduced survival. Our data show that distinct mechanisms leading to changes in CpG methylation states are operative in different breast cancer subtypes. Importantly, we show that a few selected proxy markers can be used to detect the distinct DNA methylation-based subtypes thereby providing valuable information on disease prognosis. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C
2017-10-18
Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.
Li, Jiang; Li, Caili; Lu, Shanfa
2018-05-08
DEMETER-like DNA glycosylases (DMLs) initiate the base excision repair-dependent DNA demethylation to regulate a wide range of biological processes in plants. Six putative SmDML genes, termed SmDML1-SmDML6, were identified from the genome of S. miltiorrhiza, an emerging model plant for Traditional Chinese Medicine (TCM) studies. Integrated analysis of gene structures, sequence features, conserved domains and motifs, phylogenetic analysis and differential expression showed the conservation and divergence of SmDMLs. SmDML1, SmDML2 and SmDML4 were significantly down-regulated by the treatment of 5Aza-dC, a general DNA methylation inhibitor, suggesting involvement of SmDMLs in genome DNA methylation change. SmDML1 was predicted and experimentally validated to be target of Smi-miR7972. Computational analysis of forty whole genome sequences and almost all of RNA-seq data from Lamiids revealed that MIR7972s were only distributed in some plants of the three orders, including Lamiales, Solanales and Boraginales, and the number of MIR7972 genes varied among species. It suggests that MIR7972 genes underwent expansion and loss during the evolution of some Lamiids species. Phylogenetic analysis of MIR7972s showed closer evolutionary relationships between MIR7972s in Boraginales and Solanales in comparison with Lamiales. These results provide a valuable resource for elucidating DNA demethylation mechanism in S. miltiorrhiza.
Directory of Open Access Journals (Sweden)
Hala M El-Gendy
2007-06-01
Full Text Available BACKGROUND: Down syndrome (DS is a complex genetic disease. Some clinical features of patients with this syndrome could be related to functional folate deficiency. The purpose of this study was to evaluate the total homocysteine (T-Hcy metabolism in DS children and to determine whether the supplementation with folic acid therapy would shift the genetically induced metabolic imbalance or not. METHODS: Thirty-five infants with DS, with the mean age of 17.66 ± 12.24 months were included in this study. They were selected from those attending the Genetic Outpatients Clinic in Children hospital.
RESULTS: Our results revealed that Down syndrome children had a significant decrease in serum plasma T-Hcy level after the treatment with folic acid [11.79 ± 0.92 vs. 14.41 ± 4.93 μmol/L]. A significant negative correlation was found between T-Hcy and folic acid serum levels [r = -0.112; P<0.05].
CONCLUSIONS: We concluded that the regulation of methylation pathways in Down syndrome patients becomes important in the light of possible normalization of the metabolic imbalance and the detection of increased sensitivity to therapeutic interventions.KEY WORDS: Down syndrome, hyperhomocysteine, folic acid, vitamin B-12.
International Nuclear Information System (INIS)
Liang Xin; Xu Ke; Xu Yufang; Liu Jianwen; Qian Xuhong
2011-01-01
The Bcl-2 family contains a panel of proteins which are conserved regulators of apoptosis in mammalian cells, like the anti-apoptotic protein Bcl-2. According to its significant role in altering susceptibility to apoptosis, the deciphering of the mechanism of Bcl-2 expression modulation may be crucial for identifying therapeutics strategies for cancer. Treatment with naphthalimide-based DNA intercalators, including M2-A and R16, generally leads to a decrease in Bcl-2 intracellular amounts. Whereas the interest for these chemotherapeutics is accompanied by advances in the fundamental understanding of their anticancer properties, the molecular mechanism underlying changes in Bcl-2 expression remains poorly understood. We report here that p53 contributes to Bcl-2 down-regulation induced by B1, a novel naphthalimide-based DNA intercalating agent. Indeed, the decrease in Bcl-2 protein levels observed during B1-induced apoptosis was correlated to the decrease in mRNA levels, as a result of the inhibition of Bcl-2 transcription and promoter activity. In this context, we evaluated p53 contribution in the Bcl-2 transcriptional down-regulation. We found a significant increase of p53 binding to P 2 promoter TATA box in MCF7 cells by chromatin immunoprecipitation. These data suggest that B1-induced caspase-independent apoptosis in MCF-7 cells is associated with the activation of p53 and the down-regulation of Bcl-2. Our study strengthens the links between p53 and Bcl-2 at a transcriptional level, upon naphthalimide-based DNA intercalator treatment. - Research highlights: → B1 induced apoptosis in MCF-7 cells, following a transcriptional decrease in Bcl-2. → B1 treatment triggered p53 activation and leads to a p53-dependent down-regulation of Bcl-2. → B1 induced significant increase of p53 binding to Bcl-2 P 2 promoter TATA box.
A nonparametric Bayesian approach for clustering bisulfate-based DNA methylation profiles.
Zhang, Lin; Meng, Jia; Liu, Hui; Huang, Yufei
2012-01-01
DNA methylation occurs in the context of a CpG dinucleotide. It is an important epigenetic modification, which can be inherited through cell division. The two major types of methylation include hypomethylation and hypermethylation. Unique methylation patterns have been shown to exist in diseases including various types of cancer. DNA methylation analysis promises to become a powerful tool in cancer diagnosis, treatment and prognostication. Large-scale methylation arrays are now available for studying methylation genome-wide. The Illumina methylation platform simultaneously measures cytosine methylation at more than 1500 CpG sites associated with over 800 cancer-related genes. Cluster analysis is often used to identify DNA methylation subgroups for prognosis and diagnosis. However, due to the unique non-Gaussian characteristics, traditional clustering methods may not be appropriate for DNA and methylation data, and the determination of optimal cluster number is still problematic. A Dirichlet process beta mixture model (DPBMM) is proposed that models the DNA methylation expressions as an infinite number of beta mixture distribution. The model allows automatic learning of the relevant parameters such as the cluster mixing proportion, the parameters of beta distribution for each cluster, and especially the number of potential clusters. Since the model is high dimensional and analytically intractable, we proposed a Gibbs sampling "no-gaps" solution for computing the posterior distributions, hence the estimates of the parameters. The proposed algorithm was tested on simulated data as well as methylation data from 55 Glioblastoma multiform (GBM) brain tissue samples. To reduce the computational burden due to the high data dimensionality, a dimension reduction method is adopted. The two GBM clusters yielded by DPBMM are based on data of different number of loci (P-value < 0.1), while hierarchical clustering cannot yield statistically significant clusters.
Vincent, Rebecca N; Gooding, Luke D; Louie, Kenny; Chan Wong, Edgar; Ma, Sai
2016-09-01
To investigate DNA methylation and expression of imprinted genes and an imprinted gene network (IGN) in neonates conceived via assisted reproductive technology (ART). Case control. Research institution. Two hundred sixty-four cases of cord blood and/or placental villi from neonates (101 IVF, 81 ICSI, 82 naturally conceived). Placentas were obtained at birth for biopsy and cord blood extraction. DNA methylation and expression of imprinted genes. DNA methylation at the PLAGL1 differentially methylated region (DMR) was significantly higher in IVF cord blood (48.0%) compared with controls (46.0%). No differences were found in DNA methylation between conception modes for KvDMR1 and LINE-1 in cord blood and placenta as well as PLAGL1 and PEG10 in placenta villi. PLAGL1 expression was lower in both IVF and ICSI cord blood groups than in controls (relative quantification of 0.65, 0.74, 0.89, respectively). Analyzing the expression of 3 genes in a PLAGL1 regulated IGN revealed different expression between conception modes and a significant correlation to PLAGL1 expression in only one (KCNQ1OT1). Our results suggest a stability of DNA methylation at imprinted DMRs; however, we show PLAGL1 methylation/expression to be altered after ART. As PLAGL1 expression correlated with only one of the three IGN genes in cord blood, we propose there is a more complex mechanism of regulating the IGN that may involve other genes and epigenetic modifications in this tissue. Further research investigating IGN-implicated genes in various neonatal tissues is warranted to elucidate the full effects ART-induced alterations to PLAGL1 and the IGN may have on fetal growth/development. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
MIRA: An R package for DNA methylation-based inference of regulatory activity.
Lawson, John T; Tomazou, Eleni M; Bock, Christoph; Sheffield, Nathan C
2018-03-01
DNA methylation contains information about the regulatory state of the cell. MIRA aggregates genome-scale DNA methylation data into a DNA methylation profile for independent region sets with shared biological annotation. Using this profile, MIRA infers and scores the collective regulatory activity for each region set. MIRA facilitates regulatory analysis in situations where classical regulatory assays would be difficult and allows public sources of open chromatin and protein binding regions to be leveraged for novel insight into the regulatory state of DNA methylation datasets. R package available on Bioconductor: http://bioconductor.org/packages/release/bioc/html/MIRA.html. nsheffield@virginia.edu.
Movahedi, Ali; Zhang, Jiaxin; Sun, Weibo; Mohammadi, Kourosh; Almasi Zadeh Yaghuti, Amir; Wei, Hui; Wu, Xiaolong; Yin, Tongming; Zhuge, Qiang
2018-06-01
Epigenetic modification by DNA methylation is necessary for all cellular processes, including genetic expression events, DNA repair, genomic imprinting and regulation of tissue development. It occurs almost exclusively at the C5 position of symmetric CpG and asymmetric CpHpG and CpHpH sites in genomic DNA. The RNA-directed DNA methylation (RDM1) gene is crucial for heterochromatin and DNA methylation. We overexpressed PtRDM1 gene from Populus trichocarpa to amplify transcripts of orthologous RDM1 in 'Nanlin895' (P. deltoides × P. euramericana 'Nanlin895'). This overexpression resulted in increasing RDM1 transcript levels: by ∼150% at 0 mM NaCl treatment and by ∼300% at 60 mM NaCl treatment compared to WT (control) poplars. Genomic cytosine methylation was monitored within 5.8S rDNA and histone H3 loci by bisulfite sequencing. In total, transgenic poplars revealed more DNA methylation than WT plants. In our results, roots revealed more methylated CG contexts than stems and leaves whereas, histone H3 presented more DNA methylation than 5.8S rDNA in both WT and transgenic poplars. The NaCl stresses enhanced more DNA methylation in transgenic poplars than WT plants through histone H3 and 5.8 rDNA loci. Also, the overexpression of PtRDM1 resulted in hyper-methylation, which affected plant phenotype. Transgenic poplars revealed significantly more regeneration of roots than WT poplars via NaCl treatments. Our results proved that RDM1 protein enhanced the DNA methylation by chromatin remodeling (e.g. histone H3) more than repetitive DNA sequences (e.g. 5.8S rDNA). Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai
2015-11-24
Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.
International Nuclear Information System (INIS)
Yan, Jun; Lu, Qian; Dong, Jiahong; Li, Xiaowu; Ma, Kuansheng; Cai, Lei
2012-01-01
To understand the molecular mechanisms of caveolin-1 downregulation by hepatitis B virus X protein (HBx). The DNA methylation status of the caveolin-1 promoter was examined by nested methylation-specific PCR of 33 hepatitis B virus (HBV)-infected hepatocellular carcinoma (HCC) samples. The SMMC-7721 hepatoma cell line was transfected with a recombinant HBx adenoviral vector, and the effects of HBx protein on caveolin-1 expression and promoter methylation were examined and confirmed by sequencing. A reporter gene containing the caveolin-1 promoter region was constructed, and the effects of HBx on the transcriptional activity of the promoter were also studied. Methylation of the caveolin-1 promoter was detected in 84.8% (28/33) of HBV-infected HCC samples. Expression of caveolin-1 was significantly downregulated (P = 0.022), and multiple CpG sites in the promoter region of caveolin-1 were methylated in SMMC-7721 cells after HBx transfection. Transfected HBx significantly suppressed caveolin-1 promoter activity (P = 0.001). HBx protein induces methylation of the caveolin-1 promoter region and suppresses its expression
Yang, Jin-Lan; Liu, Li-Wang; Gong, Yi-Qin; Huang, Dan-Qiong; Wang, Feng; He, Ling-Li
2007-06-01
The level of cytosine methylation induced by cadmium in radish (Raphanus sativus L.) genome was analysed using the technique of methylation-sensitive amplified polymorphism (MSAP). The MSAP ratios in radish seedling exposed to cadmium chloride at the concentration of 50, 250 and 500 mg/L were 37%, 43% and 51%, respectively, and the control was 34%; the full methylation levels (C(m)CGG in double strands) were at 23%, 25% and 27%, respectively, while the control was 22%. The level of increase in MSAP and full methylation indicated that de novo methylation occurred in some 5'-CCGG sites under Cd stress. There was significant positive correlation between increase of total DNA methylation level and CdCl(2) concentration. Four types of MSAP patterns: de novo methylation, de-methylation, atypical pattern and no changes of methylation pattern were identified among CdCl(2) treatments and the control. DNA methylation alteration in plants treated with CdCl(2) was mainly through de novo methylation.
The Effect of Metabolic and Bariatric Surgery on DNA Methylation Patterns.
Morcillo, Sonsoles; Macías-González, Manuel; Tinahones, Francisco J
2017-08-30
Metabolic and bariatric surgery (MBS) is considered to be the most effective treatment for obesity. Not only due to the significant weight reduction but also because of the many health benefits associated with it. In the last 5 years, several studies have suggested that epigenetic modifications could be involved in the mechanisms underlying the response to bariatric surgery. In this review, we will compile the different studies (2012-2017) concerning the effect of this surgical procedure on DNA methylation patterns (the most studied epigenetic marker) and its association with metabolic improvement. This is an emerging area, and currently, there are not many studies in the literature. The aim is to show what has been done so far and what the future direction in this emerging area might be. Recent findings have shown how metabolic and bariatric surgery modifies the DNA methylation profile of the specific genes associated with the pathophysiology of the disease. The studies were performed in morbidly obese subjects, mainly in women, with the aim of reducing weight and improving the obesity-associated comorbidities. DNA methylation has been measured both in specific tissue and in peripheral blood samples. In general, studies about site-specific DNA methylation have shown a change in the methylation profile after surgery, whereas the studies analyzing global DNA methylation are not so conclusive. Summing up, metabolic and bariatric surgery can modify the DNA methylation profile of different genes and contributes to the metabolic health benefits that are often seen after metabolic and bariatric surgery. Although there are still many issues to be resolved, the capacity to revert the DNA methylation profile of specific sites opens a window for searching for target markers to treat obesity-related comorbidities.
Identification of body fluid-specific DNA methylation markers for use in forensic science.
Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung
2014-11-01
DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Shiwa, Yuh; Hachiya, Tsuyoshi; Furukawa, Ryohei; Ohmomo, Hideki; Ono, Kanako; Kudo, Hisaaki; Hata, Jun; Hozawa, Atsushi; Iwasaki, Motoki; Matsuda, Koichi; Minegishi, Naoko; Satoh, Mamoru; Tanno, Kozo; Yamaji, Taiki; Wakai, Kenji; Hitomi, Jiro; Kiyohara, Yutaka; Kubo, Michiaki; Tanaka, Hideo; Tsugane, Shoichiro; Yamamoto, Masayuki; Sobue, Kenji; Shimizu, Atsushi
2016-01-01
Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS) using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03) when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50) when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14) by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45) and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17). These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.
Directory of Open Access Journals (Sweden)
Yuh Shiwa
Full Text Available Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03 when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50 when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14 by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45 and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17. These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.
Preeclampsia is associated with hypermethylation of IGF-1 promoter mediated by DNMT1.
Ma, Min; Zhou, Qiong-Jie; Xiong, Yu; Li, Bin; Li, Xiao-Tian
2018-01-01
Previous studies have demonstrated a dynamic epigenetic regulation of genes expression in placenta trophoblasts and a dynamic imbalance of DNA methylation and hydroxymethylation. Reduced IGF-1 has been observed in preeclampsia. This study was to investigate the interactive roles between IGF-1 and the global DNA methylation/hydroxymethylation, and the status of DNA methylation/hydroxymethylation and associated enzymes such as DNMTs and TETs in peeeclamptic placentas and hypoxic trophoblasts. It was found that IGF-1 was decreased in preeclamptic placentas and hypoxic trophoblasts when compared to the control group using immunohistochemisty, western blot, qRT-PCR and ELISA. Pyrophosphate sequencing showed IGF-1 promoter was significantly hypermethylated in preeclamptic placentas, which was responsible for reduced IGF-1 expression. Preeclamptic placentas and hypoxic trophoblasts were hypermethylated and hypohydroxymethylated accompanied by remarkably higher 5mC, DNMT1 and DNMT3b, and lower DNMT3a, 5hmC, TET1, TET2 and TET3 detected by immunohistochemisty, western blot, qRT-PCR and ELISA. Pearson's correlation confirmed a statistically significant negative correlation between IGF-1 and DNMT1. Furthermore, both treatment with 5-Aza-dc and DNMT1-siRNA significantly increased the expression of IGF-1 in HTR8 cells, indicating the potential mechanism of DNMT1-mediated DNA methylation in IGF-1 regulation. However, IGF-1 didn't change DNA methylation or hydroxymethylation. These findings suggest that preeclampsia is associated with hypermethylation of IGF-1 promoter mediated by DNMT1 and provide new insights into the diagnosis and treatment of preeclampsia.
Directory of Open Access Journals (Sweden)
Mandy Jayne Peffers
Full Text Available Mesenchymal stem cells (MSC are capable of multipotent differentiation into connective tissues and as such are an attractive source for autologous cell-based regenerative medicine and tissue engineering. Epigenetic mechanisms, like DNA methylation, contribute to the changes in gene expression in ageing. However there was a lack of sufficient knowledge of the role that differential methylation plays during chondrogenic, osteogenic and tenogenic differentiation from ageing MSCs. This study undertook genome level determination of the effects of DNA methylation on expression in engineered tissues from chronologically aged MSCs. We compiled unique DNA methylation signatures from chondrogenic, osteogenic, and tenogenic engineered tissues derived from young; n = 4 (21.8 years ± 2.4 SD and old; n = 4 (65.5 years±8.3SD human MSCs donors using the Illumina HumanMethylation 450 Beadchip arrays and compared these to gene expression by RNA sequencing. Unique and common signatures of global DNA methylation were identified. There were 201, 67 and 32 chondrogenic, osteogenic and tenogenic age-related DE protein-coding genes respectively. Findings inferred the nature of the transcript networks was predominantly for 'cell death and survival', 'cell morphology', and 'cell growth and proliferation'. Further studies are required to validate if this gene expression effect translates to cell events. Alternative splicing (AS was dysregulated in ageing with 119, 21 and 9 differential splicing events identified in chondrogenic, osteogenic and tenogenic respectively, and enrichment in genes associated principally with metabolic processes. Gene ontology analysis of differentially methylated loci indicated age-related enrichment for all engineered tissue types in 'skeletal system morphogenesis', 'regulation of cell proliferation' and 'regulation of transcription' suggesting that dynamic epigenetic modifications may occur in genes associated with shared and distinct
Peffers, Mandy Jayne; Goljanek-Whysall, Katarzyna; Collins, John; Fang, Yongxiang; Rushton, Michael; Loughlin, John; Proctor, Carole; Clegg, Peter David
2016-01-01
Mesenchymal stem cells (MSC) are capable of multipotent differentiation into connective tissues and as such are an attractive source for autologous cell-based regenerative medicine and tissue engineering. Epigenetic mechanisms, like DNA methylation, contribute to the changes in gene expression in ageing. However there was a lack of sufficient knowledge of the role that differential methylation plays during chondrogenic, osteogenic and tenogenic differentiation from ageing MSCs. This study undertook genome level determination of the effects of DNA methylation on expression in engineered tissues from chronologically aged MSCs. We compiled unique DNA methylation signatures from chondrogenic, osteogenic, and tenogenic engineered tissues derived from young; n = 4 (21.8 years ± 2.4 SD) and old; n = 4 (65.5 years±8.3SD) human MSCs donors using the Illumina HumanMethylation 450 Beadchip arrays and compared these to gene expression by RNA sequencing. Unique and common signatures of global DNA methylation were identified. There were 201, 67 and 32 chondrogenic, osteogenic and tenogenic age-related DE protein-coding genes respectively. Findings inferred the nature of the transcript networks was predominantly for ‘cell death and survival’, ‘cell morphology’, and ‘cell growth and proliferation’. Further studies are required to validate if this gene expression effect translates to cell events. Alternative splicing (AS) was dysregulated in ageing with 119, 21 and 9 differential splicing events identified in chondrogenic, osteogenic and tenogenic respectively, and enrichment in genes associated principally with metabolic processes. Gene ontology analysis of differentially methylated loci indicated age-related enrichment for all engineered tissue types in ‘skeletal system morphogenesis’, ‘regulation of cell proliferation’ and ‘regulation of transcription’ suggesting that dynamic epigenetic modifications may occur in genes associated with shared and
Bodell, W J; Banerjee, M R
1976-01-01
We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436
Nek1 silencing slows down DNA repair and blocks DNA damage-induced cell cycle arrest.
Pelegrini, Alessandra Luíza; Moura, Dinara Jaqueline; Brenner, Bethânia Luise; Ledur, Pitia Flores; Maques, Gabriela Porto; Henriques, João Antônio Pegas; Saffi, Jenifer; Lenz, Guido
2010-09-01
Never in mitosis A (NIMA)-related kinases (Nek) are evolutionarily conserved proteins structurally related to the Aspergillus nidulans mitotic regulator NIMA. Nek1 is one of the 11 isoforms of the Neks identified in mammals. Different lines of evidence suggest the participation of Nek1 in response to DNA damage, which is also supported by the interaction of this kinase with proteins involved in DNA repair pathways and cell cycle regulation. In this report, we show that cells with Nek1 knockdown (KD) through stable RNA interference present a delay in DNA repair when treated with methyl-methanesulfonate (MMS), hydrogen peroxide (H(2)O(2)) and cisplatin (CPT). In particular, interstrand cross links induced by CPT take much longer to be resolved in Nek1 KD cells when compared to wild-type (WT) cells. In KD cells, phosphorylation of Chk1 in response to CPT was strongly reduced. While WT cells accumulate in G(2)/M after DNA damage with MMS and H(2)O(2), Nek1 KD cells do not arrest, suggesting that G(2)/M arrest induced by the DNA damage requires Nek1. Surprisingly, CPT-treated Nek1 KD cells arrest with a 4N DNA content similar to WT cells. This deregulation in cell cycle control in Nek1 KD cells leads to an increased sensitivity to genotoxic agents when compared to WT cells. These results suggest that Nek1 is involved in the beginning of the cellular response to genotoxic stress and plays an important role in preventing cell death induced by DNA damage.
Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells
Directory of Open Access Journals (Sweden)
Wernet Peter
2010-08-01
Full Text Available Abstract Background The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. Findings We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. Conclusions The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.
Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells.
Neves, Rui; Scheel, Christina; Weinhold, Sandra; Honisch, Ellen; Iwaniuk, Katharina M; Trompeter, Hans-Ingo; Niederacher, Dieter; Wernet, Peter; Santourlidis, Simeon; Uhrberg, Markus
2010-08-03
The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE) was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.
Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.
Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong
2017-10-15
Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
Structural insight into maintenance methylation by mouse DNA methyltransferase 1 (Dnmt1)
Takeshita, Kohei; Suetake, Isao; Yamashita, Eiki; Suga, Michihiro; Narita, Hirotaka; Nakagawa, Atsushi; Tajima, Shoji
2011-01-01
Methylation of cytosine in DNA plays a crucial role in development through inheritable gene silencing. The DNA methyltransferase Dnmt1 is responsible for the propagation of methylation patterns to the next generation via its preferential methylation of hemimethylated CpG sites in the genome; however, how Dnmt1 maintains methylation patterns is not fully understood. Here we report the crystal structure of the large fragment (291–1620) of mouse Dnmt1 and its complexes with cofactor S-adenosyl-L-methionine and its product S-adenosyl-L-homocystein. Notably, in the absence of DNA, the N-terminal domain responsible for targeting Dnmt1 to replication foci is inserted into the DNA-binding pocket, indicating that this domain must be removed for methylation to occur. Upon binding of S-adenosyl-L-methionine, the catalytic cysteine residue undergoes a conformation transition to a catalytically competent position. For the recognition of hemimethylated DNA, Dnmt1 is expected to utilize a target recognition domain that overhangs the putative DNA-binding pocket. Taking into considerations the recent report of a shorter fragment structure of Dnmt1 that the CXXC motif positions itself in the catalytic pocket and prevents aberrant de novo methylation, we propose that maintenance methylation is a multistep process accompanied by structural changes. PMID:21518897
Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B
2017-04-01
Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.
Heterogeneity in white blood cells has potential to confound DNA methylation measurements.
Directory of Open Access Journals (Sweden)
Bjorn T Adalsteinsson
Full Text Available Epigenetic studies are commonly conducted on DNA from tissue samples. However, tissues are ensembles of cells that may each have their own epigenetic profile, and therefore inter-individual cellular heterogeneity may compromise these studies. Here, we explore the potential for such confounding on DNA methylation measurement outcomes when using DNA from whole blood. DNA methylation was measured using pyrosequencing-based methodology in whole blood (n = 50-179 and in two white blood cell fractions (n = 20, isolated using density gradient centrifugation, in four CGIs (CpG Islands located in genes HHEX (10 CpG sites assayed, KCNJ11 (8 CpGs, KCNQ1 (4 CpGs and PM20D1 (7 CpGs. Cellular heterogeneity (variation in proportional white blood cell counts of neutrophils, lymphocytes, monocytes, eosinophils and basophils, counted by an automated cell counter explained up to 40% (p<0.0001 of the inter-individual variation in whole blood DNA methylation levels in the HHEX CGI, but not a significant proportion of the variation in the other three CGIs tested. DNA methylation levels in the two cell fractions, polymorphonuclear and mononuclear cells, differed significantly in the HHEX CGI; specifically the average absolute difference ranged between 3.4-15.7 percentage points per CpG site. In the other three CGIs tested, methylation levels in the two fractions did not differ significantly, and/or the difference was more moderate. In the examined CGIs, methylation levels were highly correlated between cell fractions. In summary, our analysis detects region-specific differential DNA methylation between white blood cell subtypes, which can confound the outcome of whole blood DNA methylation measurements. Finally, by demonstrating the high correlation between methylation levels in cell fractions, our results suggest a possibility to use a proportional number of a single white blood cell type to correct for this confounding effect in analyses.
DNA Methylation Landscapes of Human Fetal Development
Slieker, Roderick C.; Roost, Matthias S.; van Iperen, Liesbeth; Suchiman, H. Eka D; Tobi, Elmar W.; Carlotti, Françoise; de Koning, Eelco J P; Slagboom, P. Eline; Heijmans, Bastiaan T.; Chuva de Sousa Lopes, Susana M.
2015-01-01
Remodelling the methylome is a hallmark of mammalian development and cell differentiation. However, current knowledge of DNA methylation dynamics in human tissue specification and organ development largely stems from the extrapolation of studies in vitro and animal models. Here, we report on the DNA
DNA Methylation as a Biomarker for Preeclampsia
Energy Technology Data Exchange (ETDEWEB)
Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.; Linggi, Bryan E.; Ohm, Joyce E.
2014-10-01
Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-wide DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.
Directory of Open Access Journals (Sweden)
Dimos Gaidatzis
2014-02-01
Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.
Effects of temperature and relative humidity on DNA methylation.
Bind, Marie-Abele; Zanobetti, Antonella; Gasparrini, Antonio; Peters, Annette; Coull, Brent; Baccarelli, Andrea; Tarantini, Letizia; Koutrakis, Petros; Vokonas, Pantel; Schwartz, Joel
2014-07-01
Previous studies have found relationships between DNA methylation and various environmental contaminant exposures. Associations with weather have not been examined. Because temperature and humidity are related to mortality even on non-extreme days, we hypothesized that temperature and relative humidity may affect methylation. We repeatedly measured methylation on long interspersed nuclear elements (LINE-1), Alu, and 9 candidate genes in blood samples from 777 elderly men participating in the Normative Aging Study (1999-2009). We assessed whether ambient temperature and relative humidity are related to methylation on LINE-1 and Alu, as well as on genes controlling coagulation, inflammation, cortisol, DNA repair, and metabolic pathway. We examined intermediate-term associations of temperature, relative humidity, and their interaction with methylation, using distributed lag models. Temperature or relative humidity levels were associated with methylation on tissue factor (F3), intercellular adhesion molecule 1 (ICAM-1), toll-like receptor 2 (TRL-2), carnitine O-acetyltransferase (CRAT), interferon gamma (IFN-γ), inducible nitric oxide synthase (iNOS), and glucocorticoid receptor, LINE-1, and Alu. For instance, a 5°C increase in 3-week average temperature in ICAM-1 methylation was associated with a 9% increase (95% confidence interval: 3% to 15%), whereas a 10% increase in 3-week average relative humidity was associated with a 5% decrease (-8% to -1%). The relative humidity association with ICAM-1 methylation was stronger on hot days than mild days. DNA methylation in blood cells may reflect biological effects of temperature and relative humidity. Temperature and relative humidity may also interact to produce stronger effects.
Epigenetic control of viral life-cycle by a DNA-methylation dependent transcription factor.
Directory of Open Access Journals (Sweden)
Kirsty Flower
Full Text Available Epstein-Barr virus (EBV encoded transcription factor Zta (BZLF1, ZEBRA, EB1 is the prototype of a class of transcription factor (including C/EBPalpha that interact with CpG-containing DNA response elements in a methylation-dependent manner. The EBV genome undergoes a biphasic methylation cycle; it is extensively methylated during viral latency but is reset to an unmethylated state following viral lytic replication. Zta is expressed transiently following infection and again during the switch between latency and lytic replication. The requirement for CpG-methylation at critical Zta response elements (ZREs has been proposed to regulate EBV replication, specifically it could aid the activation of viral lytic gene expression from silenced promoters on the methylated genome during latency in addition to preventing full lytic reactivation from the non-methylated EBV genome immediately following infection. We developed a computational approach to predict the location of ZREs which we experimentally assessed using in vitro and in vivo DNA association assays. A remarkably different binding motif is apparent for the CpG and non-CpG ZREs. Computational prediction of the location of these binding motifs in EBV revealed that the majority of lytic cycle genes have at least one and many have multiple copies of methylation-dependent CpG ZREs within their promoters. This suggests that the abundance of Zta protein coupled with the methylation status of the EBV genome act together to co-ordinate the expression of lytic cycle genes at the majority of EBV promoters.
Shen, M L; He, Z N; Zhang, X; Duan, H W; Niu, Y; Bin, P; Ye, M; Meng, T; Dai, Y F; Yu, S F; Chen, W; Zheng, Y X
2017-06-06
Objective: To investigate the association between etheno-DNA adduct and the promoter of DNA methylation levels of cyclin dependent kinase inhibitor 2A (P16), Ras association domain family 1 (RASSF1A) and O-6-methylguanine-DNA methyltransferase (MGMT) in workers with occupational exposure to diesel engine exhaust (DEE). Methods: We recruited 124 diesel engine testing workers as DEE exposure group and 112 water pump operator in the same area as control group in Henan province in 2012 using cluster sampling. The demographic data were obtained by questionnaire survey; urine after work and venous blood samples were collected from each subject. The urinary etheno-DNA adducts were detected using UPLC-MS/MS, including 1,N6-etheno-2'-deoxyadenosine (εdA) and 3,N4-etheno-2'-deoxycytidine(εdC). The DNA methylation levels of P16, RASSF1A, and MGMT were evaluated using bisulfite-pyrosequencing assay. The percentage of methylation was expressed as the 5-methylcytosine (5mC) over the sum of cytosines (%5mC). Spearman correlation and multiple linear regression were applied to analyze the association between etheno-DNA adducts and DNA methylation of P16, RASSF1A, and MGMT. Results: The median ( P (25)- P (75)) of urinary εdA level was 230.00 (98.04-470.91) pmol/g creatinine in DEE exposure group, and 102.10 (49.95-194.48) creatinine in control group. The level of εdA was higher in DEE exposure group than control group ( P 0.05) . Multiple linear regression confirmed the negative correlation between εdA and DNA methylation levels of P16, RASSF1A, and MGMT in non-smoking group (β (95 %CI ) was -0.068 (-0.132--0.003), -0.082 (-0.159--0.004) and -0.048 (-0.090--0.007), P values were 0.039, 0.039 and 0.024, respectively). Moreover, εdC was negative associated with DNA methylation level of MGMT in non-smoking group (β (95 %CI ) was -0.094 (-0.179--0.008), P= 0.032). Conclusion: DEE exposure could induce the increased of εdA and decreased of DNA methylation levels of P16, RASSF1A
DNA methylation levels associated with race and childhood asthma severity.
Chan, Marcia A; Ciaccio, Christina E; Gigliotti, Nicole M; Rezaiekhaligh, Mo; Siedlik, Jacob A; Kennedy, Kevin; Barnes, Charles S
2017-10-01
Asthma is a common chronic childhood disease worldwide. Socioeconomic status, genetic predisposition and environmental factors contribute to its incidence and severity. A disproportionate number of children with asthma are economically disadvantaged and live in substandard housing with potential indoor environmental exposures such as cockroaches, dust mites, rodents and molds. These exposures may manifest through epigenetic mechanisms that can lead to changes in relevant gene expression. We examined the association of global DNA methylation levels with socioeconomic status, asthma severity and race/ethnicity. We measured global DNA methylation in peripheral blood of children with asthma enrolled in the Kansas City Safe and Healthy Homes Program. Inclusion criteria included residing in the same home for a minimum of 4 days per week and total family income of less than 80% of the Kansas City median family income. DNA methylation levels were quantified by an immunoassay that assessed the percentage of 5-methylcytosine. Our results indicate that overall, African American children had higher levels of global DNA methylation than children of other races/ethnicities (p = 0.029). This difference was more pronounced when socioeconomic status and asthma severity were coupled with race/ethnicity (p = 0.042) where low-income, African American children with persistent asthma had significantly elevated methylation levels relative to other races/ethnicities in the same context (p = 0.006, Hedges g = 1.14). Our study demonstrates a significant interaction effect among global DNA methylation levels, asthma severity, race/ethnicity, and socioeconomic status.
DEFF Research Database (Denmark)
Gillberg, Linn; Jacobsen, Stine; Ribel-Madsen, Rasmus
2013-01-01
and in muscle from individuals at risk of T2D. This study aimed to investigate DNA promoter methylation and gene expression of PPARGC1A in skeletal muscle from first degree relatives (FDR) of T2D patients, and to determine the association with insulin action as well as the influence of family relation. We...... genetic regulation to play a role. No significant effect of familiality on DNA methylation was found. Taken together, increased DNA methylation of the PPARGC1A promoter is unlikely to play a major causal role for the development of insulin resistance in FDR of patients with T2D....... included 124 Danish FDR of T2D patients from 46 different families. Skeletal muscle biopsies were excised from vastus lateralis and insulin action was assessed by oral glucose tolerance tests. DNA methylation and mRNA expression levels were measured using bisulfite sequencing and quantitative real-time PCR...
International Nuclear Information System (INIS)
Cai Yingyun; Liu Yin; Yu Dongdong; Zhang Xuming
2003-01-01
Murine coronavirus mouse hepatitis virus (MHV) causes encephalitis and demyelination in the central nervous system of susceptible rodents. Astrocytes are the major target for MHV persistence. However, the mechanisms by which astrocytes survive MHV infection and permit viral persistence are not known. Here we performed DNA microarray analysis on differential gene expression in astrocyte DBT cells by MHV infection and found that the mRNA of the proapoptotic gene BNip3 was significantly decreased following MHV infection. This finding was further confirmed by quantitative reverse transcription-polymerase chain reaction, Western blot analysis, and BNip3-promoter-luciferase reporter system. Interestingly, infection with live and ultraviolet light-inactivated viruses equally repressed BNip3 expression, indicating that the down-regulation of BNip3 expression does not require virus replication and is mediated during cell entry. Furthermore, treatment of cells with chloroquine, which blocks the acidification of endosomes, significantly inhibited the repression of the BNip3 promoter activity induced by the acidic pH-dependent MHV mutant OBLV60, which enters cells via endocytosis, indicating that the down-regulation of BNip3 expression is mediated by fusion between viral envelope and cell membranes during entry. Deletion analysis showed that the sequence between nucleotides 262 and 550 of the 588-base-pair BNip3 promoter is necessary and sufficient for driving the BNip3 expression and that it contains signals that are responsible for MHV-induced down-regulation of BNip3 expression in DBT cells. These results may provide insights into the mechanisms by which MHV evades host antiviral defense and promotes cell survival, thereby allowing its persistence in the host astrocytes
Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G
2018-02-01
R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Usability of human Infinium MethylationEPIC BeadChip for mouse DNA methylation studies.
Needhamsen, Maria; Ewing, Ewoud; Lund, Harald; Gomez-Cabrero, David; Harris, Robert Adam; Kular, Lara; Jagodic, Maja
2017-11-15
The advent of array-based genome-wide DNA methylation methods has enabled quantitative measurement of single CpG methylation status at relatively low cost and sample input. Whereas the use of Infinium Human Methylation BeadChips has shown great utility in clinical studies, no equivalent tool is available for rodent animal samples. We examined the feasibility of using the new Infinium MethylationEPIC BeadChip for studying DNA methylation in mouse. In silico, we identified 19,420 EPIC probes (referred as mEPIC probes), which align with a unique best alignment score to the bisulfite converted reference mouse genome mm10. Further annotation revealed that 85% of mEPIC probes overlapped with mm10.refSeq genes at different genomic features including promoters (TSS1500 and TSS200), 1st exons, 5'UTRs, 3'UTRs, CpG islands, shores, shelves, open seas and FANTOM5 enhancers. Hybridization of mouse samples to Infinium Human MethylationEPIC BeadChips showed successful measurement of mEPIC probes and reproducibility between inter-array biological replicates. Finally, we demonstrated the utility of mEPIC probes for data exploration such as hierarchical clustering. Given the absence of cost and labor convenient genome-wide technologies in the murine system, our findings show that the Infinium MethylationEPIC BeadChip platform is suitable for investigation of the mouse methylome. Furthermore, we provide the "mEPICmanifest" with genomic features, available to users of Infinium Human MethylationEPIC arrays for mouse samples.
GAD1 mRNA expression and DNA methylation in prefrontal cortex of subjects with schizophrenia.
Directory of Open Access Journals (Sweden)
Hsien-Sung Huang
2007-08-01
Full Text Available Dysfunction of prefrontal cortex in schizophrenia includes changes in GABAergic mRNAs, including decreased expression of GAD1, encoding the 67 kDa glutamate decarboxylase (GAD67 GABA synthesis enzyme. The underlying molecular mechanisms remain unclear. Alterations in DNA methylation as an epigenetic regulator of gene expression are thought to play a role but this hypothesis is difficult to test because no techniques are available to extract DNA from GAD1 expressing neurons efficiently from human postmortem brain. Here, we present an alternative approach that is based on immunoprecipitation of mononucleosomes with anti-methyl-histone antibodies differentiating between sites of potential gene expression as opposed to repressive or silenced chromatin. Methylation patterns of CpG dinucleotides at the GAD1 proximal promoter and intron 2 were determined for each of the two chromatin fractions separately, using a case-control design for 14 schizophrenia subjects affected by a decrease in prefrontal GAD1 mRNA levels. In controls, the methylation frequencies at CpG dinucleotides, while overall higher in repressive as compared to open chromatin, did not exceed 5% at the proximal GAD1 promoter and 30% within intron 2. Subjects with schizophrenia showed a significant, on average 8-fold deficit in repressive chromatin-associated DNA methylation at the promoter. These results suggest that chromatin remodeling mechanisms are involved in dysregulated GABAergic gene expression in schizophrenia.
Genome-wide signatures of differential DNA methylation in pediatric acute lymphoblastic leukemia
DEFF Research Database (Denmark)
Nordlund, Jessica; Bäcklin, Christofer L; Wahlberg, Per
2013-01-01
BACKGROUND: Although aberrant DNA methylation has been observed previously in acute lymphoblastic leukemia (ALL), the patterns of differential methylation have not been comprehensively determined in all subtypes of ALL on a genome-wide scale. The relationship between DNA methylation, cytogenetic...... background, drug resistance and relapse in ALL is poorly understood. RESULTS: We surveyed the DNA methylation levels of 435,941 CpG sites in samples from 764 children at diagnosis of ALL and from 27 children at relapse. This survey uncovered four characteristic methylation signatures. First, compared...... cells at relapse, compared with matched samples at diagnosis. Analysis of relapse-free survival identified CpG sites with subtype-specific differential methylation that divided the patients into different risk groups, depending on their methylation status. CONCLUSIONS: Our results suggest an important...
Diagnostic markers of urothelial cancer based on DNA methylation analysis
International Nuclear Information System (INIS)
Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki
2013-01-01
Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect
Linking loss of sodium-iodide symporter expression to DNA damage
Energy Technology Data Exchange (ETDEWEB)
Lyckesvärd, Madeleine Nordén [Sahlgrenska Cancer Center, University of Gothenburg, Göteborg (Sweden); Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Kapoor, Nirmal [Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Ingeson-Carlsson, Camilla; Carlsson, Therese [Sahlgrenska Cancer Center, University of Gothenburg, Göteborg (Sweden); Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Karlsson, Jan-Olof [Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Postgård, Per; Himmelman, Jakob; Forssell-Aronsson, Eva [Department of Radiation Physics, University of Gothenburg, Göteborg (Sweden); Hammarsten, Ola [Department of Clinical Chemistry, University of Gothenburg, Göteborg (Sweden); Nilsson, Mikael, E-mail: mikael.nilsson@gu.se [Sahlgrenska Cancer Center, University of Gothenburg, Göteborg (Sweden); Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden)
2016-05-15
Radiotherapy of thyroid cancer with I-131 is abrogated by inherent loss of radioiodine uptake due to loss of sodium iodide symporter (NIS) expression in poorly differentiated tumor cells. It is also known that ionizing radiation per se down-regulates NIS (the stunning effect), but the mechanism is unknown. Here we investigated whether loss of NIS-mediated iodide transport may be elicited by DNA damage. Calicheamicin, a fungal toxin that specifically cleaves double-stranded DNA, induced a full scale DNA damage response mediated by the ataxia-telangiectasia mutated (ATM) kinase in quiescent normal thyrocytes. At sublethal concentrations (<1 nM) calicheamicin blocked NIS mRNA expression and transepithelial iodide transport as stimulated by thyrotropin; loss of function occurred at a much faster rate than after I-131 irradiation. KU-55933, a selective ATM kinase inhibitor, partly rescued NIS expression and iodide transport in DNA-damaged cells. Prolonged ATM inhibition in healthy cells also repressed NIS-mediated iodide transport. ATM-dependent loss of iodide transport was counteracted by IGF-1. Together, these findings indicate that NIS, the major iodide transporter of the thyroid gland, is susceptible to DNA damage involving ATM-mediated mechanisms. This uncovers novel means of poor radioiodine uptake in thyroid cells subjected to extrinsic or intrinsic genotoxic stress. - Highlights: • DNA damage inhibits polarized iodide transport in normal thyroid cells. • Down-regulation of NIS expression is mediated by activation of the ATM kinase. • Long-term ATM inhibition also represses NIS-mediated iodide transport. • IGF-1 rescues NIS expression and iodide transport in DNA-damaged cells.
Linking loss of sodium-iodide symporter expression to DNA damage
International Nuclear Information System (INIS)
Lyckesvärd, Madeleine Nordén; Kapoor, Nirmal; Ingeson-Carlsson, Camilla; Carlsson, Therese; Karlsson, Jan-Olof; Postgård, Per; Himmelman, Jakob; Forssell-Aronsson, Eva; Hammarsten, Ola; Nilsson, Mikael
2016-01-01
Radiotherapy of thyroid cancer with I-131 is abrogated by inherent loss of radioiodine uptake due to loss of sodium iodide symporter (NIS) expression in poorly differentiated tumor cells. It is also known that ionizing radiation per se down-regulates NIS (the stunning effect), but the mechanism is unknown. Here we investigated whether loss of NIS-mediated iodide transport may be elicited by DNA damage. Calicheamicin, a fungal toxin that specifically cleaves double-stranded DNA, induced a full scale DNA damage response mediated by the ataxia-telangiectasia mutated (ATM) kinase in quiescent normal thyrocytes. At sublethal concentrations (<1 nM) calicheamicin blocked NIS mRNA expression and transepithelial iodide transport as stimulated by thyrotropin; loss of function occurred at a much faster rate than after I-131 irradiation. KU-55933, a selective ATM kinase inhibitor, partly rescued NIS expression and iodide transport in DNA-damaged cells. Prolonged ATM inhibition in healthy cells also repressed NIS-mediated iodide transport. ATM-dependent loss of iodide transport was counteracted by IGF-1. Together, these findings indicate that NIS, the major iodide transporter of the thyroid gland, is susceptible to DNA damage involving ATM-mediated mechanisms. This uncovers novel means of poor radioiodine uptake in thyroid cells subjected to extrinsic or intrinsic genotoxic stress. - Highlights: • DNA damage inhibits polarized iodide transport in normal thyroid cells. • Down-regulation of NIS expression is mediated by activation of the ATM kinase. • Long-term ATM inhibition also represses NIS-mediated iodide transport. • IGF-1 rescues NIS expression and iodide transport in DNA-damaged cells.
Dorts, Jennifer; Falisse, Elodie; Schoofs, Emilie; Flamion, Enora; Kestemont, Patrick; Silvestre, Frédéric
2016-10-12
DNA methylation, a well-studied epigenetic mark, is important for gene regulation in adulthood and for development. Using genetic and epigenetic approaches, the present study aimed at evaluating the effects of heat stress and copper exposure during zebrafish early embryogenesis when patterns of DNA methylation are being established, a process called reprogramming. Embryos were exposed to 325 μg Cu/L from fertilization (<1 h post fertilization - hpf) to 4 hpf at either 26.5 °C or 34 °C, followed by incubation in clean water at 26.5 °C till 96 hpf. Significant increased mortality rates and delayed hatching were observed following exposure to combined high temperature and Cu. Secondly, both stressors, alone or in combination, significantly upregulated the expression of de novo DNA methyltransferase genes (dnmt3) along with no differences in global cytosine methylation level. Finally, Cu exposure significantly increased the expression of metallothionein (mt2) and heat shock protein (hsp70), the latter being also increased following exposure to high temperature. These results highlighted the sensitivity of early embryogenesis and more precisely of the reprogramming period to environmental challenges, in a realistic situation of combined stressors.
Methylation effect on the ohmic resistance of a poly-GC DNA-like chain
Energy Technology Data Exchange (ETDEWEB)
Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)
2016-10-14
We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Roy, A; Roy Chattopadhyay, N
2013-07-01
Cancer involves various sets of altered gene functions which embrace all the three basic mechanisms of regulation of gene expression. However, no common mechanism is inferred till date for this versatile disease and thus no full proof remedy can be offered. Here we show that the basic mechanisms are interlinked and indicate towards one of those mechanisms as being the superior one; the methylation of cytosines in specific DNA sequences, for the initiation and maintenance of carcinogenesis. The analyses of the previous reports and the nucleotide sequences of the DNA methyltransferases strongly support the assumption that the mutation(s) in the DNA-binding site(s) of DNA-methyltransferases acts as a master regulator; though it continues the cycle from mutation to repair to methylation. We anticipate that our hypothesis will start a line of study for the proposal of a treatment regime for cancers by introducing wild type methyltransferases in the diseased cells and/or germ cells, and/or by targeting ligands to the altered binding domain(s) where a mutation in the concerned enzyme(s) is seen. Copyright © 2013. Published by Elsevier Ltd.
Effects of TET2 mutations on DNA methylation in chronic myelomonocytic leukemia
TET2 enzymatically converts 5-methyl-cytosine to 5-hydroxymethyl-cytosine, possibly leading to loss of DNA methylation. TET2 mutations are common in myeloid leukemia and were proposed to contribute to leukemogenesis through DNA methylation. To expand on this concept, we studied chronic myelomonocyti...
Methylated DNA for monitoring tumor growth and regression
DEFF Research Database (Denmark)
Kristiansen, Søren; Nielsen, Dorte; Söletormos, Georg
2014-01-01
Abstract A wide range of protein cancer biomarkers is currently recommended in international guidelines for monitoring the growth and regression of solid tumors. However, a number of these markers are also present in low concentrations in blood obtained from healthy individuals and from patients...... of gene promoters. Because tumor cells naturally secrete DNA and upon cell death leak DNA, modified methylated DNA can be detected in blood, urine, sputum and other body fluids. At present international guidelines do not include recommendations for monitoring modified methylated DNA. The low level...... of evidence can partly be explained by incomplete collection of serial blood samples, by analytical challenges, and by lack of knowledge of how monitoring studies should be designed and how serial marker data obtained from individual patients should be interpreted. Here, we review the clinical validity...
Variation of global DNA methylation levels with age and in autistic children.
Tsang, Shui-Ying; Ahmad, Tanveer; Mat, Flora W K; Zhao, Cunyou; Xiao, Shifu; Xia, Kun; Xue, Hong
2016-09-23
The change in epigenetic signatures, in particular DNA methylation, has been proposed as risk markers for various age-related diseases. However, the course of variation in methylation levels with age, the difference in methylation between genders, and methylation-disease association at the whole genome level is unclear. In the present study, genome-wide methylation levels in DNA extracted from peripheral blood for 2116 healthy Chinese in the 2-97 age range and 280 autistic trios were examined using the fluorescence polarization-based genome-wide DNA methylation quantification method developed by us. Genome-wide or global DNA methylation levels proceeded through multiple phases of variation with age, consisting of a steady increase from age 2 to 25 (r = 0.382) and another rise from age 41 to 55 to reach a peak level of ~80 % (r = 0.265), followed by a sharp decrease to ~40 % in the mid-1970s (age 56 to 75; r = -0.395) and leveling off thereafter. Significant gender effect in methylation levels was observed only for the 41-55 age group in which methylation in females was significantly higher than in males (p = 0.010). In addition, global methylation level was significantly higher in autistic children than in age-matched healthy children (p < 0.001). The multiphasic nature of changes in global methylation levels with age was delineated, and investigation into the factors underlying this profile will be essential to a proper understanding of the aging process. Furthermore, this first report of global hypermethylation in autistic children also illustrates the importance of age-matched controls in characterization of disease-associated variations in DNA methylation.
Suicidal function of DNA methylation in age-related genome disintegration.
Mazin, Alexander L
2009-10-01
This article is dedicated to the 60th anniversary of 5-methylcytosine discovery in DNA. Cytosine methylation can affect genetic and epigenetic processes, works as a part of the genome-defense system and has mutagenic activity; however, the biological functions of this enzymatic modification are not well understood. This review will put forward the hypothesis that the host-defense role of DNA methylation in silencing and mutational destroying of retroviruses and other intragenomic parasites was extended during evolution to most host genes that have to be inactivated in differentiated somatic cells, where it acquired a new function in age-related self-destruction of the genome. The proposed model considers DNA methylation as the generator of 5mC>T transitions that induce 40-70% of all spontaneous somatic mutations of the multiple classes at CpG and CpNpG sites and flanking nucleotides in the p53, FIX, hprt, gpt human genes and some transgenes. The accumulation of 5mC-dependent mutations explains: global changes in the structure of the vertebrate genome throughout evolution; the loss of most 5mC from the DNA of various species over their lifespan and the Hayflick limit of normal cells; the polymorphism of methylation sites, including asymmetric mCpNpN sites; cyclical changes of methylation and demethylation in genes. The suicidal function of methylation may be a special genetic mechanism for increasing DNA damage and the programmed genome disintegration responsible for cell apoptosis and organism aging and death.
Non-Steroidal Anti-Inflammatory Drug Use and Genomic DNA Methylation in Blood.
Directory of Open Access Journals (Sweden)
Lauren E Wilson
Full Text Available Non-steroidal anti-inflammatory drug (NSAID use is associated with decreased risk of some cancers. NSAID use modulates the epigenetic profile of normal colonic epithelium and may reduce risk of colon cancer through this pathway; however, the effect of NSAID use on the DNA methylation profile of other tissues including whole blood has not yet been examined.Using the Sister Study cohort, we examined the association between NSAID usage and whole genome methylation patterns in blood DNA. Blood DNA methylation status across 27,589 CpG sites was evaluated for 871 women using the Illumina Infinium HumanMethylation27 Beadchip, and in a non-overlapping replication sample of 187 women at 485,512 CpG sites using the Infinium HumanMethylation450 Beadchip. We identified a number of CpG sites that were differentially methylated in regular, long-term users of NSAIDs in the discovery group, but none of these sites were statistically significant in our replication group.We found no replicable methylation differences in blood related to NSAID usage. If NSAID use does effect blood DNA methylation patterns, differences are likely small.
Rinaldi, Andrea; Mensah, Afua Adjeiwaa; Kwee, Ivo; Forconi, Francesco; Orlandi, Ester M; Lucioni, Marco; Gattei, Valter; Marasca, Roberto; Berger, Françoise; Cogliatti, Sergio; Cavalli, Franco; Zucca, Emanuele; Gaidano, Gianluca; Rossi, Davide; Bertoni, Francesco
2013-10-01
In a fraction of patients, chronic lymphocytic leukaemia (CLL) can transform to Richter syndrome (RS), usually a diffuse large B-cell lymphoma (DLBCL). We studied genome-wide promoter DNA methylation in RS and clonally related CLL-phases of transformed patients, alongside de novo DLBCL (of non-germinal centre B type), untransformed-CLL and normal B-cells. The greatest differences in global DNA methylation levels were observed between RS and DLBCL, indicating that these two diseases, although histologically similar, are epigenetically distinct. RS was more highly methylated for genes involved in cell cycle regulation. When RS was compared to the preceding CLL-phase and with untransformed-CLL, RS presented a higher degree of methylation for genes possessing the H3K27me3 mark and PRC2 targets, as well as for gene targets of TP53 and RB1. Comparison of the methylation levels of individual genes revealed that OSM, a stem cell regulatory gene, exhibited significantly higher methylation levels in RS compared to CLL-phases. Its transcriptional repression by DNA methylation was confirmed by 5-aza-2'deoxycytidine treatment of DLBCL cells, determining an increased OSM expression. Our results showed that methylation patterns in RS are largely different from de novo DLBCL. Stem cell-related genes and cell cycle regulation genes are targets of DNA methylation in RS. © 2013 John Wiley & Sons Ltd.
Association of season of birth with DNA methylation and allergic disease
Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.
Background Season of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie
Zhao, Jie-hong; Zhang, Ji-shun; Wang, Yi; Wang, Ren-gang; Wu, Chun; Fan, Long-jiang; Ren, Xue-liang
2011-01-01
DNA methylation plays an important role in the epigenetic regulation of gene expression during plant growth, development, and polyploidization. However, there is still no distinct evidence in tobacco regarding the distribution of the methylation pattern and whether it contributes to qualitative characteristics. We studied the levels and patterns of methylation polymorphism at CCGG sites in 48 accessions of allotetraploid flue-cured tobacco, Nicotiana tabacum, using a methylation-sensitive amplified polymorphism (MSAP) technique. The results showed that methylation existed at a high level among tobacco accessions, among which 49.3% sites were methylated and 69.9% allelic sites were polymorphic. A cluster analysis revealed distinct patterns of geography-specific groups. In addition, three polymorphic sites significantly related to tobacco mosaic virus (TMV) resistance were explored. This suggests that tobacco breeders should pay more attention to epigenetic traits. PMID:22042659
Zhao, Jie-hong; Zhang, Ji-shun; Wang, Yi; Wang, Ren-gang; Wu, Chun; Fan, Long-jiang; Ren, Xue-liang
2011-11-01
DNA methylation plays an important role in the epigenetic regulation of gene expression during plant growth, development, and polyploidization. However, there is still no distinct evidence in tobacco regarding the distribution of the methylation pattern and whether it contributes to qualitative characteristics. We studied the levels and patterns of methylation polymorphism at CCGG sites in 48 accessions of allotetraploid flue-cured tobacco, Nicotiana tabacum, using a methylation-sensitive amplified polymorphism (MSAP) technique. The results showed that methylation existed at a high level among tobacco accessions, among which 49.3% sites were methylated and 69.9% allelic sites were polymorphic. A cluster analysis revealed distinct patterns of geography-specific groups. In addition, three polymorphic sites significantly related to tobacco mosaic virus (TMV) resistance were explored. This suggests that tobacco breeders should pay more attention to epigenetic traits.
Bucher, Dominik B; Pilles, Bert M; Pfaffeneder, Toni; Carell, Thomas; Zinth, Wolfgang
2014-02-24
Methylated cytidine plays an important role as an epigenetic signal in gene regulation. Its oxidation products are assumed to be involved in active demethylation processes but also in damaging DNA. Here, we report the photochemical production of the 5-methyl-2'-deoxycytidine radical cation via a two-photon ionization process. The radical cation is detected by time-resolved IR spectroscopy and identified by band assignment using density functional theory calculations. Two final oxidation products are characterized with liquid chromatography coupled to mass spectrometry. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Fumiharu Ohka
Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.
Association of season of birth with DNA methylation and allergic disease
Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.
BackgroundSeason of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie the
Directory of Open Access Journals (Sweden)
Felipe Merino
2015-06-01
Full Text Available Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions.
Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.
Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N
1984-03-26
The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.
DNA methylation profiles of ovarian epithelial carcinoma tumors and cell lines.
Directory of Open Access Journals (Sweden)
Sahar Houshdaran
2010-02-01
Full Text Available Epithelial ovarian carcinoma is a significant cause of cancer mortality in women worldwide and in the United States. Epithelial ovarian cancer comprises several histological subtypes, each with distinct clinical and molecular characteristics. The natural history of this heterogeneous disease, including the cell types of origin, is poorly understood. This study applied recently developed methods for high-throughput DNA methylation profiling to characterize ovarian cancer cell lines and tumors, including representatives of three major histologies.We obtained DNA methylation profiles of 1,505 CpG sites (808 genes in 27 primary epithelial ovarian tumors and 15 ovarian cancer cell lines. We found that the DNA methylation profiles of ovarian cancer cell lines were markedly different from those of primary ovarian tumors. Aggregate DNA methylation levels of the assayed CpG sites tended to be higher in ovarian cancer cell lines relative to ovarian tumors. Within the primary tumors, those of the same histological type were more alike in their methylation profiles than those of different subtypes. Supervised analyses identified 90 CpG sites (68 genes that exhibited 'subtype-specific' DNA methylation patterns (FDR<1% among the tumors. In ovarian cancer cell lines, we estimated that for at least 27% of analyzed autosomal CpG sites, increases in methylation were accompanied by decreases in transcription of the associated gene.The significant difference in DNA methylation profiles between ovarian cancer cell lines and tumors underscores the need to be cautious in using cell lines as tumor models for molecular studies of ovarian cancer and other cancers. Similarly, the distinct methylation profiles of the different histological types of ovarian tumors reinforces the need to treat the different histologies of ovarian cancer as different diseases, both clinically and in biomarker studies. These data provide a useful resource for future studies, including those of
Methylation of deoxycytidine incorporated by excision-repair synthesis of DNA
International Nuclear Information System (INIS)
Kastan, M.B.; Gowans, B.J.; Lieberman, M.W.
1982-01-01
Methylation of deoxycytidine incorporated by DNA excision-repair was studied in human diploid fibroblasts following damage with ultraviolet radiation, N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene. In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication in logarithmic-phase cultures a steady state level of 3.4% 5-methylcytosine is reached in less than 2 hr after cells are labeled with 6- 3H-deoxycytidine, following ultraviolet-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approximately 2.0% 5-methylcytosine in the repair patch. In cells from cultures in logarithmic-phase growth, 5-methylcytosine formation in ultraviolet-induced repair patches occurs faster and to a greater extent, reaching a level of approximately 2.7% in 10-20 hr. Preexisting hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites
Directory of Open Access Journals (Sweden)
Wang Jinkai
2012-08-01
Full Text Available Abstract Background The highly improved cognitive function is the most significant change in human evolutionary history. Recently, several large-scale studies reported the evolutionary roles of DNA methylation; however, the role of DNA methylation on brain evolution is largely unknown. Results To test if DNA methylation has contributed to the evolution of human brain, with the use of MeDIP-Chip and SEQUENOM MassARRAY, we conducted a genome-wide analysis to identify differentially methylated regions (DMRs in the brain between humans and rhesus macaques. We first identified a total of 150 candidate DMRs by the MeDIP-Chip method, among which 4 DMRs were confirmed by the MassARRAY analysis. All 4 DMRs are within or close to the CpG islands, and a MIR3 repeat element was identified in one DMR, but no repeat sequence was observed in the other 3 DMRs. For the 4 DMR genes, their proteins tend to be conserved and two genes have neural related functions. Bisulfite sequencing and phylogenetic comparison among human, chimpanzee, rhesus macaque and rat suggested several regions of lineage specific DNA methylation, including a human specific hypomethylated region in the promoter of K6IRS2 gene. Conclusions Our study provides a new angle of studying human brain evolution and understanding the evolutionary role of DNA methylation in the central nervous system. The results suggest that the patterns of DNA methylation in the brain are in general similar between humans and non-human primates, and only a few DMRs were identified.
Watanabe, Tomohiro; Asano, Naoki; Meng, Guangxun; Yamashita, Kouhei; Arai, Yasuyuki; Sakurai, Toshiharu; Kudo, Masatoshi; Fuss, Ivan J; Kitani, Atsushi; Shimosegawa, Tooru; Chiba, Tsutomu; Strober, Warren
2014-01-01
It is well established that polymorphisms of the nucleotide-binding oligomerization domain 2 (NOD2) gene, a major risk factor in Crohn's disease (CD), lead to loss of NOD2 function. However, a molecular explanation of how such loss of function leads to increased susceptibility to CD has remained unclear. In a previous study exploring this question we reported that activation of NOD2 in human dendritic cells by its ligand, muramyl dipeptide (MDP) negatively regulates Toll-like receptor (TLR)-mediated inflammatory responses. Here we show that NOD2 activation results in increased interferon regulatory factor 4 (IRF4) expression and binding to TNF receptor associated factor 6 (TRAF6) and receptor interacting serine-threonine kinase (RICK). We then show that such binding leads to IRF4-mediated inhibition of Lys63-linked polyubiquitination of TRAF6 and RICK and thus to down-regulation of NF-κB activation. Finally, we demonstrate that protection of mice from the development of experimental colitis by MDP or IRF4 administration is accompanied by similar IRF4-mediated effects on polyubiquitination of TRAF6 and RICK in colonic lamina propria mononuclear cells. These findings thus define a mechanism of NOD2-mediated regulation of innate immune responses to intestinal microflora that could explain the relation of NOD2 polymorphisms and resultant NOD2 dysfunction to CD. PMID:24670424
The methylation of nuclear and mitochondrial DNA in ageing phenotypes and longevity.
Bacalini, Maria Giulia; D'Aquila, Patrizia; Marasco, Elena; Nardini, Christine; Montesanto, Alberto; Franceschi, Claudio; Passarino, Giuseppe; Garagnani, Paolo; Bellizzi, Dina
2017-07-01
An increasing body of data is progressively indicating that the comprehension of the epigenetic landscape, actively integrated with the genetic elements, is crucial to delineate the molecular basis of the inter-individual complexity of ageing process. Indeed, it has emerged that DNA methylation changes occur during ageing, consisting mainly in a progressive process of genome demethylation, in a hypermethylation of gene-specific CpG dinucleotides, as well as in an inter-individual divergence of the epigenome due to stochastic events and environmental exposures throughout life, namely as epigenetic drift. Additionally, it has also come to light an implication of the mitochondrial genome in the regulation of the intracellular epigenetic landscape, as demonstrated by the being itself object of epigenetic modifications. An overview of DNA methylation changes occurring during ageing process at both nuclear and mitochondrial level will be described in this review, also taking into account the recent and promising data available on the 5-hydroxymethylcytosine. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Vahid Omidvar
Full Text Available We reported earlier that 7B-1 mutant in tomato (Solanum lycopersicum L., cv. Rutgers, an ABA overproducer, is defective in blue light (B signaling leading to B-specific resistance to abiotic and biotic stresses. Using a methylation-sensitive amplified polymorphism (MSAP assay, a number of genes were identified, which were differentially methylated between 7B-1 and its wild type (WT seedlings in white (W, blue (B, red (R lights and dark (D or in response to exogenous ABA and mannitol-induced stresses. The genomic methylation level was almost similar in different lights between 7B-1 and WT seedlings, while significant differences were observed in response to stresses in D, but not B. Using a cDNA-AFLP assay, several transcripts were identified, which were differentially regulated between 7B-1 and WT by B or D or in response to stresses. Blue light receptors cryptochrome 1 and 2 (CRY1 and CRY2 and phototropin 1 and 2 (PHOT1 and PHOT2 were not affected by the 7B-1 mutation at the transcriptional level, instead the mutation had likely affected downstream components of the light signaling pathway. 5-azacytidine (5-azaC induced DNA hypomethylation, inhibited stem elongation and differentially regulated the expression of a number of genes in 7B-1. In addition, it was shown that mir167 and mir390 were tightly linked to auxin signaling pathway in 5-azaC-treated 7B-1 seedlings via the regulation of auxin-response factor (ARF transcripts. Our data showed that DNA methylation remodeling is an active epigenetic response to different lights and stresses in 7B-1 and WT, and highlighted the differences in epigenetic and transcriptional regulation of light and stress responses between 7B-1 and WT. Furthermore, it shed lights on the crosstalk between DNA hypomethylation and miRNA regulation of ARFs expression. This information could also be used as a benchmark for future studies of male-sterility in other crops.
Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O
2011-08-01
The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.
Axin gene methylation status correlates with radiosensitivity of lung cancer cells
International Nuclear Information System (INIS)
Yang, Lian-He; Stoecker, Maggie; Wang, Endi; Xu, Ke; Wang, En-Hua; Han, Yang; Li, Guang; Xu, Hong-Tao; Jiang, Gui-Yang; Miao, Yuan; Zhang, Xiu-Peng; Zhao, Huan-Yu; Xu, Zheng-Fan
2013-01-01
We previously reported that Axin1 (Axin) is down-regulated in many cases of lung cancer, and X-ray irradiation increased Axin expression and inhibited lung cancer cells. The mechanisms, however, were not clear. Four lung cancer cell lines were used to detect the methylation status of Axin with or without X-ray treatment. Real-time PCR was used to quantify the expression of Axin, and western blot analysis was applied to measure protein levels of Axin, β-catenin, Cyclin D1, MMP-7, DNMTS, MeCP2 and acetylated histones. Flow cytometric analysis, colony formation assay, transwell assay and xenograft growth experiment were used to study the biological behavior of the cells with hypermethylated or unmethylated Axin gene after X-ray treatment. Hypermethylated Axin gene was detected in 2 of 4 cell lines, and it correlated inversely with Axin expression. X-ray treatment significantly up-regulated Axin expression in H446 and H157 cells, which possess intrinsic hypermethylation of the Axin gene (P<0.01), but did not show up-regulation in LTE and H460 cells, which have unmethylated Axin gene. 2Gy X-ray significantly reduced colony formation (from 71% to 10.5%) in H157 cells, while the reduction was lower in LTE cells (from 71% to 20%). After X-ray irradiation, xenograft growth was significantly decreased in H157 cells (from 1.15 g to 0.28 g) in comparison with LTE cells (from 1.06 g to 0.65 g). Significantly decreased cell invasiveness and increased apoptosis were also observed in H157 cells treated with X-ray irradiation (P<0.01). Down-regulation of DNMTs and MeCP2 and up-regulation of acetylated histones could be detected in lung cancer cells. X-ray-induced inhibition of lung cancer cells may be mediated by enhanced expression of Axin via genomic DNA demethylation and histone acetylation. Lung cancer cells with a different methylation status of the Axin gene showed different radiosensitivity, suggesting that the methylation status of the Axin gene may be one important factor
Stress-induced DNA methylation changes and their heritability in asexual dandelions
Verhoeven, K.J.F.; Jansen, J.J.; Van Dijk, P.J.; Biere, A.
2010-01-01
• DNA methylation can cause heritable phenotypic modifications in the absence of changes in DNA sequence. Environmental stresses can trigger methylation changes and this may have evolutionary consequences, even in the absence of sequence variation. However, it remains largely unknown to what extent
Stress-induced DNA methylation changes and their heritability in asexual dandelions
Verhoeven, K.J.F.; Jansen, J.J.; Dijk, P.J.; Biere, A.
2010-01-01
DNA methylation can cause heritable phenotypic modifications in the absence of changes in DNA sequence. Environmental stresses can trigger methylation changes and this may have evolutionary consequences, even in the absence of sequence variation. However, it remains largely unknown to what extent
Cruz, Aline Fernanda; de Resende, Renata Gonçalves; de Lacerda, Júlio César Tanos; Pereira, Núbia Braga; Melo, Leonardo Augusto; Diniz, Marina Gonçalves; Gomes, Carolina Cavalieri; Gomez, Ricardo Santiago
2018-01-01
The oral lichen planus is a chronic inflammatory disease. Although its aetiology is not well understood, the role of T lymphocytes in its inflammatory events is recognised. Identifying the epigenetic mechanisms involved in the pathogenesis of this immune-mediated condition is fundamental for understanding the inflammatory reaction that occurs in the disease. The purpose of this work was to evaluate the methylation pattern of 21 immune response-related genes in the different clinical forms of oral lichen planus. A cross-sectional study was performed to analyse the DNA methylation patterns in three distinct groups of oral lichen planus: (i) reticular/plaque lesions; (ii) erosive lesions; (iii) normal oral mucosa (control group). After DNA extraction from biopsies, the samples were submitted to digestions by methylation-sensitive and methylation-dependent enzymes and double digestion. The relative percentage of methylated DNA for each gene was provided using real-time polymerase chain reaction arrays. Hypermethylation of the STAT5A gene was observed only in the control group (59.0%). A higher hypermethylation of the ELANE gene was found in reticular/plaque lesions (72.1%) compared to the erosive lesions (50.0%). Our results show variations in the methylation profile of immune response-related genes, according to the clinical type of oral lichen planus after comparing with the normal oral mucosa. Further studies are necessary to validate these findings using gene expression analysis. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Vanessa C McFadden
2017-02-01
Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.
Campos, Kelma; Gomes, Carolina Cavalieri; Farias, Lucyana Conceição; Silva, Renato Menezes; Letra, Ariadne; Gomez, Ricardo Santiago
2016-01-01
Matrix metalloproteinases (MMPs) are the major class of enzymes responsible for degradation of extracellular matrix components and participate in the pathogenesis of periapical inflammatory lesions. MMP expression may be regulated by DNA methylation. The purpose of the present investigation was to analyze the expression of MMP2 and MMP9 in periapical granulomas and radicular cysts and to test the hypothesis that, in these lesions, their transcription may be modulated by DNA methylation. Methylation-specific polymerase chain reaction was used to evaluate the DNA methylation pattern of the MMP2 gene in 13 fresh periapical granuloma samples and 10 fresh radicular cyst samples. Restriction enzyme digestion was used to assess methylation of the MMP9 gene in 12 fresh periapical granuloma samples and 10 fresh radicular cyst samples. MMP2 and MMP9 messenger RNA transcript levels were measured by quantitative real-time polymerase chain reaction. All periapical lesions and healthy mucosa samples showed partial methylation of the MMP2 gene; however, periapical granulomas showed higher MMP2 mRNA expression levels than healthy mucosa (P = .014). A higher unmethylated profile of the MMP9 gene was found in periapical granulomas and radicular cysts compared with healthy mucosa. In addition, higher MMP9 mRNA expression was observed in the periapical lesions compared with healthy tissues. The present study suggests that the unmethylated status of the MMP9 gene in periapical lesions may explain the observed up-regulation of messenger RNA transcription in these lesions. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Epigenetic Patterns of PTSD: DNA Methylation In Serum of OIF/OEF Servicemembers
2011-01-01
also have no data on other relevant exposures which are known to affect DNA methylation , such as dietary factors ( folate , vitamin B12 intake), (54, 55...ANSI Std. Z39.18 W81XWH-08-2-0053 31 MAR 2008 - 31 DEC 2010Final01-01-2011 Epigenetic Patterns of PTSD: DNA Methylation in Serum of OIF/OEF...distribution unlimited PTSD, epigenetics, DNA methylation , cytokines, serum, pre-deployment, post-deployment Abstract on next page. 38 jrusiecki@usuhs.mil
Frequent down-regulation of ABC transporter genes in prostate cancer.
Demidenko, Rita; Razanauskas, Deividas; Daniunaite, Kristina; Lazutka, Juozas Rimantas; Jankevicius, Feliksas; Jarmalaite, Sonata
2015-10-12
ATP-binding cassette (ABC) transporters are transmembrane proteins responsible for the efflux of a wide variety of substrates, including steroid metabolites, through the cellular membranes. For better characterization of the role of ABC transporters in prostate cancer (PCa) development, the profile of ABC transporter gene expression was analyzed in PCa and noncancerous prostate tissues (NPT). TaqMan Low Density Array (TLDA) human ABC transporter plates were used for the gene expression profiling in 10 PCa and 6 NPT specimens. ABCB1 transcript level was evaluated in a larger set of PCa cases (N = 78) and NPT (N = 15) by real-time PCR, the same PCa cases were assessed for the gene promoter hypermethylation by methylation-specific PCR. Expression of eight ABC transporter genes (ABCA8, ABCB1, ABCC6, ABCC9, ABCC10, ABCD2, ABCG2, and ABCG4) was significantly down-regulated in PCa as compared to NPT, and only two genes (ABCC4 and ABCG1) were up-regulated. Down-regulation of ABC transporter genes was prevalent in the TMPRSS2-ERG-negative cases. A detailed analysis of ABCB1 expression confirmed TLDA results: a reduced level of the transcript was identified in PCa in comparison to NPT (p = 0.048). Moreover, the TMPRSS2-ERG-negative PCa cases showed significantly lower expression of ABCB1 in comparison to NPT (p = 0.003) or the fusion-positive tumors (p = 0.002). Promoter methylation of ABCB1 predominantly occurred in PCa and was rarely detected in NPT (p ABC transporter genes in PCa, especially in the TMPRSS2-ERG-negative tumors.
Aberrant Methylation-Mediated Suppression of APAF1 in Myelodysplastic Syndrome.
Zaker, Farhad; Nasiri, Nahid; Amirizadeh, Naser; Razavi, Seyed Mohsen; Yaghmaie, Marjan; Teimoori-Toolabi, Ladan; Maleki, Ali; Bakhshayesh, Masoumeh
2017-04-01
Background: Myelodysplastic syndromes (MDSs) include a diverse group of clonal bone marrow disorders characterized by ineffective hematopoiesis and pancytopenia. It was found that down regulation of APAF1, a putative tumor suppressor gene (TSG), leads to resistance to chemotherapy and disease development in some cancers. In this study, we investigated the relation of APAF1 methylation status with its expression and clinicopathological factors in myelodysplastic syndrome (MDS) patients. Materials and Methods: Methylation Sensitive-High Resolution Melting Curve Analysis (MS-HRM) was employed in studying the methylation of CpG islands in the APAF1promoter region in MDS. Gene expression was analyzed by using real time RT-PCR. Results: 42.6% of patient samples were methylated in promoter region of APAF1analyzed, while methylation of the gene was not seen in controls (P<0.05). Methylation of APAF1was significantly associated with the suppression of its mRNA expression (P=0.00). The methylation status of APAF1in advanced-stage MDS patients (80%) was significantly higher than that of the early-stage MDS patients (28.2%) (P=0.001). The difference in frequency of hypermethylatedAPAF1 gene was significant between good (37.5%) and poor (85.71%) cytogenetic risk groups (P=0.043). In addition, a higher frequency of APAF1hypermethylation was observed in higher-risk MDS group (69.2%) compared to lower-risk MDS group (34.14%) (P=0.026). Conclusion: Our study indicated that APAF1hypermethylation in MDS was associated to high-risk disease classified according to the IPSS, WHO and cytogenetic risk.
Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt
2017-10-07
We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.
Directory of Open Access Journals (Sweden)
Gianpiero Marconi
Full Text Available Excessive soil salinity is a major ecological and agronomical problem, the adverse effects of which are becoming a serious issue in regions where saline water is used for irrigation. Plants can employ regulatory strategies, such as DNA methylation, to enable relatively rapid adaptation to new conditions. In this regard, cytosine methylation might play an integral role in the regulation of gene expression at both the transcriptional and post-transcriptional levels. Rapeseed, which is the most important oilseed crop in Europe, is classified as being tolerant of salinity, although cultivars can vary substantially in their levels of tolerance. In this study, the Methylation Sensitive Amplified Polymorphism (MSAP approach was used to assess the extent of cytosine methylation under salinity stress in salinity-tolerant (Exagone and salinity-sensitive (Toccata rapeseed cultivars. Our data show that salinity affected the level of DNA methylation. In particular methylation decreased in Exagone and increased in Toccata. Nineteen DNA fragments showing polymorphisms related to differences in methylation were sequenced. In particular, two of these were highly similar to genes involved in stress responses (Lacerata and trehalose-6-phosphatase synthase S4 and were chosen to further characterization. Bisulfite sequencing and quantitative RT-PCR analysis of selected MSAP loci showed that cytosine methylation changes under salinity as well as gene expression varied. In particular, our data show that salinity stress influences the expression of the two stress-related genes. Moreover, we quantified the level of trehalose in Exagone shoots and found that it was correlated to TPS4 expression and, therefore, to DNA methylation. In conclusion, we found that salinity could induce genome-wide changes in DNA methylation status, and that these changes, when averaged across different genotypes and developmental stages, accounted for 16.8% of the total site
Wang, Ting; Garcia, Joe Gn; Zhang, Wei
2012-12-01
Particulate matter (PM) air pollution exerts significant adverse health effects in global populations, particularly in developing countries with extensive air pollution. Understanding of the mechanisms of PM-induced health effects including the risk for cardiovascular diseases remains limited. In addition to the direct cellular physiological responses such as mitochondrial dysfunction and oxidative stress, PM mediates remarkable dysregulation of gene expression, especially in cardiovascular tissues. The PM-mediated gene dysregulation is likely to be a complex mechanism affected by various genetic and non-genetic factors. Notably, PM is known to alter epigenetic markers (e.g., DNA methylation and histone modifications), which may contribute to air pollution-mediated health consequences including the risk for cardiovascular diseases. Notably, epigenetic changes induced by ambient PM exposure have emerged to play a critical role in gene regulation. Though the underlying mechanism(s) are not completely clear, the available evidence suggests that the modulated activities of DNA methyltransferase (DNMT), histone acetylase (HAT) and histone deacetylase (HDAC) may contribute to the epigenetic changes induced by PM or PM-related chemicals. By employing genome-wide epigenomic and systems biology approaches, PM toxicogenomics could conceivably progress greatly with the potential identification of individual epigenetic loci associated with dysregulated gene expression after PM exposure, as well the interactions between epigenetic pathways and PM. Furthermore, novel therapeutic targets based on epigenetic markers could be identified through future epigenomic studies on PM-mediated cardiopulmonary toxicities. These considerations collectively inform the future population health applications of genomics in developing countries while benefiting global personalized medicine at the same time.