WorldWideScience

Sample records for dna hybrid molecules

  1. A polypeptide-DNA hybrid with selective linking capability applied to single molecule nano-mechanical measurements using optical tweezers.

    Directory of Open Access Journals (Sweden)

    Fatemeh Moayed

    Full Text Available Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an efficient, rapid and specific manner, based on the recently developed linkage between the protein StrepTactin (STN and the peptide StrepTag II (ST. We introduce a two-step approach, in which we first construct a hybrid between DNA and a tandem of two STs peptides (tST. In a second step, this hybrid is linked to polystyrene bead surfaces and Maltose Binding Protein (MBP using STN. Furthermore, we show the STN-tST linkage is more stable against forces applied by optical tweezers than the commonly used biotin-Streptavidin (STV linkage. It can be used in conjunction with Neutravidin (NTV-biotin linkages to form DNA tethers that can sustain applied forces above 65 pN for tens of minutes in a quarter of the cases. The method is general and can be applied to construct other surface-DNA and protein-DNA hybrids. The reversibility, high mechanical stability and specificity provided by this linking procedure make it highly suitable for single molecule mechanical studies, as well as biosensing and lab on chip applications.

  2. Scanning a DNA molecule for bound proteins using hybrid magnetic and optical tweezers.

    Directory of Open Access Journals (Sweden)

    Marijn T J van Loenhout

    Full Text Available The functional state of the genome is determined by its interactions with proteins that bind, modify, and move along the DNA. To determine the positions and binding strength of proteins localized on DNA we have developed a combined magnetic and optical tweezers apparatus that allows for both sensitive and label-free detection. A DNA loop, that acts as a scanning probe, is created by looping an optically trapped DNA tether around a DNA molecule that is held with magnetic tweezers. Upon scanning the loop along the λ-DNA molecule, EcoRI proteins were detected with ~17 nm spatial resolution. An offset of 33 ± 5 nm for the detected protein positions was found between back and forwards scans, corresponding to the size of the DNA loop and in agreement with theoretical estimates. At higher applied stretching forces, the scanning loop was able to remove bound proteins from the DNA, showing that the method is in principle also capable of measuring the binding strength of proteins to DNA with a force resolution of 0.1 pN/[Formula: see text]. The use of magnetic tweezers in this assay allows the facile preparation of many single-molecule tethers, which can be scanned one after the other, while it also allows for direct control of the supercoiling state of the DNA molecule, making it uniquely suitable to address the effects of torque on protein-DNA interactions.

  3. A Polypeptide-DNA Hybrid with Selective Linking Capability Applied to Single Molecule Nano-Mechanical Measurements Using Optical Tweezers

    NARCIS (Netherlands)

    Moayed, F.; Mashaghi, A.; Tans, S.J.

    2013-01-01

    Many applications in biosensing, biomaterial engineering and single molecule biophysics require multiple non-covalent linkages between DNA, protein molecules, and surfaces that are specific yet strong. Here, we present a novel method to join proteins and dsDNA molecule at their ends, in an

  4. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    Science.gov (United States)

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Hybrid molecule/superconductor assemblies

    International Nuclear Information System (INIS)

    McDevitt, J.T.; Haupt, S.G.; Riley, D.R.; Zhao, J.; Zhou, J.P., Jones, C.

    1993-01-01

    The fabrication of electronic devices from molecular materials has attracted much attention recently. Schottky diodes, molecular transistors, metal-insulator-semiconductor diodes, MIS field effect transistors and light emitting diodes have all been prepared utilizing such substances. The active elements in these devices have been constructed by depositing the molecular phase onto the surface of a metal, semiconductor or insulating substrate. With the recent discovery of high temperature superconductivity, new opportunities now exist for the study of molecule/superconductor interactions as well as for the construction of novel hybrid molecule/superconductor devices. In this paper, methods for preparing the initial two composite molecule/semiconductor devices will be reported. Consequently, light sensors based on dye-coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor microbridges will be discussed. Moreover, molecule/superconductor energy and electron transfer phenomena will be illustrated also for the first time

  6. Mechanisms of Surface-Mediated DNA Hybridization

    Science.gov (United States)

    2015-01-01

    Single-molecule total internal reflection fluorescence microscopy was employed in conjunction with resonance energy transfer (RET) to observe the dynamic behavior of donor-labeled ssDNA at the interface between aqueous solution and a solid surface decorated with complementary acceptor-labeled ssDNA. At least 100 000 molecular trajectories were determined for both complementary strands and negative control ssDNA. RET was used to identify trajectory segments corresponding to the hybridized state. The vast majority of molecules from solution adsorbed nonspecifically to the surface, where a brief two-dimensional search was performed with a 7% chance of hybridization. Successful hybridization events occurred with a characteristic search time of ∼0.1 s, and unsuccessful searches resulted in desorption from the surface, ultimately repeating the adsorption and search process. Hybridization was reversible, and two distinct modes of melting (i.e., dehybridization) were observed, corresponding to long-lived (∼15 s) and short-lived (∼1.4 s) hybridized time intervals. A strand that melted back onto the surface could rehybridize after a brief search or desorb from the interface. These mechanistic observations provide guidance for technologies that involve DNA interactions in the near-surface region, suggesting a need to design surfaces that both enhance the complex multidimensional search process and stabilize the hybridized state. PMID:24708278

  7. Control of DNA hybridization by photoswitchable molecular glue.

    Science.gov (United States)

    Dohno, Chikara; Nakatani, Kazuhiko

    2011-12-01

    Hybridization of DNA is one of the most intriguing events in molecular recognition and is essential for living matter to inherit life beyond generations. In addition to the function of DNA as genetic material, DNA hybridization is a key to control the function of DNA-based materials in nanoscience. Since the hybridization of two single stranded DNAs is a thermodynamically favorable process, dissociation of the once formed DNA duplex is normally unattainable under isothermal conditions. As the progress of DNA-based nanoscience, methodology to control the DNA hybridization process has become increasingly important. Besides many reports using the chemically modified DNA for the regulation of hybridization, we focused our attention on the use of a small ligand as the molecular glue for the DNA. In 2001, we reported the first designed molecule that strongly and specifically bound to the mismatched base pairs in double stranded DNA. Further studies on the mismatch binding molecules provided us a key discovery of a novel mode of the binding of a mismatch binding ligand that induced the base flipping. With these findings we proposed the concept of molecular glue for DNA for the unidirectional control of DNA hybridization and, eventually photoswitchable molecular glue for DNA, which enabled the bidirectional control of hybridization under photoirradiation. In this tutorial review, we describe in detail how we integrated the mismatch binding ligand into photoswitchable molecular glue for DNA, and the application and perspective in DNA-based nanoscience.

  8. Detection of DNA hybridizations using solid-state nanopores

    International Nuclear Information System (INIS)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng

    2010-01-01

    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  9. Detection of DNA hybridizations using solid-state nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)

    2010-08-20

    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  10. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  11. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  12. Difference Raman spectroscopy of DNA molecules

    International Nuclear Information System (INIS)

    Anokhin, Andrey S; Yuzyuk, Yury I; Gorelik, Vladimir S; Dovbeshko, Galina I; Pyatyshev, Alexander Yu

    2015-01-01

    In this paper the micro-Raman spectra of calf DNA for different points of DNA sample have been recorded. The Raman spectra were made with help of difference Raman spectroscopy technique. Raman spectra were recorded with high spatial resolution from different points of the wet and dry samples in different spectral range (100÷4000cm −1 ) using two lasers: argon (514.5 nm) and helium -neon (632.8 nm). The significant differences in the Raman spectra for dry and wet DNA and for different points of DNA molecules were observed. The obtained data on difference Raman scattering spectra of DNA molecules may be used for identification of DNA types and for analysis of genetic information associated with the molecular structure of this molecule

  13. Single-molecule mechanics of protein-labelled DNA handles

    Directory of Open Access Journals (Sweden)

    Vivek S. Jadhav

    2016-01-01

    Full Text Available DNA handles are often used as spacers and linkers in single-molecule experiments to isolate and tether RNAs, proteins, enzymes and ribozymes, amongst other biomolecules, between surface-modified beads for nanomechanical investigations. Custom DNA handles with varying lengths and chemical end-modifications are readily and reliably synthesized en masse, enabling force spectroscopic measurements with well-defined and long-lasting mechanical characteristics under physiological conditions over a large range of applied forces. Although these chemically tagged DNA handles are widely used, their further individual modification with protein receptors is less common and would allow for additional flexibility in grabbing biomolecules for mechanical measurements. In-depth information on reliable protocols for the synthesis of these DNA–protein hybrids and on their mechanical characteristics under varying physiological conditions are lacking in literature. Here, optical tweezers are used to investigate different protein-labelled DNA handles in a microfluidic environment under different physiological conditions. Digoxigenin (DIG-dsDNA-biotin handles of varying sizes (1000, 3034 and 4056 bp were conjugated with streptavidin or neutravidin proteins. The DIG-modified ends of these hybrids were bound to surface-modified polystyrene (anti-DIG beads. Using different physiological buffers, optical force measurements showed consistent mechanical characteristics with long dissociation times. These protein-modified DNA hybrids were also interconnected in situ with other tethered biotinylated DNA molecules. Electron-multiplying CCD (EMCCD imaging control experiments revealed that quantum dot–streptavidin conjugates at the end of DNA handles remain freely accessible. The experiments presented here demonstrate that handles produced with our protein–DNA labelling procedure are excellent candidates for grasping single molecules exposing tags suitable for molecular

  14. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  15. Application of a Novel and Automated Branched DNA in Situ Hybridization Method for the Rapid and Sensitive Localization of mRNA Molecules in Plant Tissues

    Directory of Open Access Journals (Sweden)

    Andrew J. Bowling

    2014-04-01

    Full Text Available Premise of the study: A novel branched DNA detection technology, RNAscope in situ hybridization (ISH, originally developed for use on human clinical and animal tissues, was adapted for use in plant tissue in an attempt to overcome some of the limitations associated with traditional ISH assays. Methods and Results: Zea mays leaf tissue was formaldehyde fixed and paraffin embedded (FFPE and then probed with the RNAscope ISH assay for two endogenous genes, phosphoenolpyruvate carboxylase (PEPC and phosphoenolpyruvate carboxykinase (PEPCK. Results from both manual and automated methods showed tissue- and cell-specific mRNA localization patterns expected from these well-studied genes. Conclusions: RNAscope ISH is a sensitive method that generates high-quality, easily interpretable results from FFPE plant tissues. Automation of the RNAscope method on the Ventana Discovery Ultra platform allows significant advantages for repeatability, reduction in variability, and flexibility of workflow processes.

  16. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  17. One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

    Science.gov (United States)

    Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

    2015-01-31

    A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

  18. Electrokinetic acceleration of DNA hybridization in microsystems.

    Science.gov (United States)

    Lei, Kin Fong; Wang, Yun-Hsiang; Chen, Huai-Yi; Sun, Jia-Hong; Cheng, Ji-Yen

    2015-06-01

    In this work, electrokinetic acceleration of DNA hybridization was investigated by different combinations of frequencies and amplitudes of actuating electric signals. Because the frequencies from low to high can induce different kinds of electrokinetic forces, i.e., electroosmotic to electrothermal forces, this work provides an in-depth investigation of electrokinetic enhanced hybridization. Concentric circular Cr/Au microelectrodes of 350 µm in diameter were fabricated on a glass substrate and probe DNA was immobilized on the electrode surface. Target DNA labeled with fluorescent dyes suspending in solution was then applied to the electrode. Different electrokinetic forces were induced by the application of different electric signals to the circular microelectrodes. Local microfluidic vortexes were generated to increase the collision efficiency between the target DNA suspending in solution and probe DNA immobilized on the electrode surface. DNA hybridization on the electrode surface could be accelerated by the electrokinetic forces. The level of hybridization was represented by the fluorescent signal intensity ratio. Results revealed that such 5-min dynamic hybridization increased 4.5 fold of signal intensity ratio as compared to a 1-h static hybridization. Moreover, dynamic hybridization was found to have better differentiation ability between specific and non-specific target DNA. This study provides a strategy to accelerate DNA hybridization in microsystems. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Electrical potential-assisted DNA hybridization. How to mitigate electrostatics for surface DNA hybridization.

    Science.gov (United States)

    Tymoczko, Jakub; Schuhmann, Wolfgang; Gebala, Magdalena

    2014-12-24

    Surface-confined DNA hybridization reactions are sensitive to the number and identity of DNA capture probes and experimental conditions such as the nature and the ionic strength of the electrolyte solution. When the surface probe density is high or the concentration of bulk ions is much lower than the concentration of ions within the DNA layer, hybridization is significantly slowed down or does not proceed at all. However, high-density DNA monolayers are attractive for designing high-sensitivity DNA sensors. Thus, circumventing sluggish DNA hybridization on such interfaces allows a high surface concentration of target DNA and improved signal/noise ratio. We present potential-assisted hybridization as a strategy in which an external voltage is applied to the ssDNA-modified interface during the hybridization process. Results show that a significant enhancement of hybridization can be achieved using this approach.

  20. Electron microscope autoradiography of isolated DNA molecules

    International Nuclear Information System (INIS)

    Delain, Etienne; Bouteille, Michel

    1980-01-01

    Autoradiographs of 3 H-thymidine-labelled DNA molecules were observed with an electron microscope. After ten months of exposure significant labelling was obtained with tritiated T7 DNA molecules which had a specific activity of 630,000 cpm/μg. Although isolated DNA molecules were not stretched out to such an extent that they could be rigorously compared to straight 'hot lines', the resolution was estimated and found to be similar to that obtained by autoradiography on thin plastic sections. The H.D. value was of the order of 1600A. From the known specific activity of the macromolecules, it was possible to compare the expected number of disintegrations from the samples to the number of grains obtained on the autoradiograms. This enabled us to calculate 1/ The absolute autoradiographic efficiency and 2/ The per cent ratio of thymidine residues labelled with tritium. These results throw some light on the resolution and sensitivity of electron microscope autoradiography of shadowed isolated macromolecules as compared to thin plastic sections

  1. DNA hybridization sensing for cytogenetic analysis

    DEFF Research Database (Denmark)

    Kwasny, Dorota; Dapra, Johannes; Brøgger, Anna Line

    2013-01-01

    are rearrangements between two chromosome arms that results in two derivative chromosomes having a mixed DNA sequence. The current detection method is a Fluorescent In situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the DNA sequences of two chromosomes involved...... in the translocation (Kwasny et al., 2012). We have developed a new double hybridization assay that allows for sorting of the DNA chromosomal fragments into separate compartment, moreover allowing for detection of the translocation. To detect the translocation it is necessary to determine that the two DNA sequences...... forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The first example of the translocation detection was presented on lab-on-a-disc using fluorescently labeled DNA fragments, representing the derivative chromosome (Brøgger et al., 2012). To allow...

  2. DNA-psoralen interaction: a single molecule experiment.

    Science.gov (United States)

    Rocha, M S; Viana, N B; Mesquita, O N

    2004-11-15

    By attaching one end of a single lambda-DNA molecule to a microscope coverslip and the other end to a polystyrene microsphere trapped by an optical tweezers, we can study the entropic elasticity of the lambda-DNA by measuring force versus extension as we stretch the molecule. This powerful method permits single molecule studies. We are particularly interested in the effects of the photosensitive drug psoralen on the elasticity of the DNA molecule. We have illuminated the sample with different light sources, studying how the different wavelengths affect the psoralen-DNA linkage. To do this, we measure the persistence length of individual DNA-psoralen complexes.

  3. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  4. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  5. Single Molecule Scanning of DNA Radiation Oxidative Damage, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — This proposal will develop an assay to map genomic DNA, at the single molecule level and in a nanodevice, for oxidative DNA damage arising from radiation exposure;...

  6. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    Science.gov (United States)

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  7. Probe Microscopic Studies of DNA Molecules on Carbon Nanotubes

    Directory of Open Access Journals (Sweden)

    Kazuo Umemura

    2016-10-01

    Full Text Available Hybrids of DNA and carbon nanotubes (CNTs are promising nanobioconjugates for nanobiosensors, carriers for drug delivery, and other biological applications. In this review, nanoscopic characterization of DNA-CNT hybrids, in particular, characterization by scanning probe microscopy (SPM, is summarized. In many studies, topographical imaging by atomic force microscopy has been performed. However, some researchers have demonstrated advanced SPM operations in order to maximize its unique and valuable functions. Such sophisticated approaches are attractive and will have a significant impact on future studies of DNA-CNT hybrids.

  8. DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

    Science.gov (United States)

    Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

    2017-01-11

    DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

  9. Effect of sample storage time on detection of hybridization signals in Checkerboard DNA-DNA hybridization.

    Science.gov (United States)

    do Nascimento, Cássio; Muller, Katia; Sato, Sandra; Albuquerque Junior, Rubens Ferreira

    2012-04-01

    Long-term sample storage can affect the intensity of the hybridization signals provided by molecular diagnostic methods that use chemiluminescent detection. The aim of this study was to evaluate the effect of different storage times on the hybridization signals of 13 bacterial species detected by the Checkerboard DNA-DNA hybridization method using whole-genomic DNA probes. Ninety-six subgingival biofilm samples were collected from 36 healthy subjects, and the intensity of hybridization signals was evaluated at 4 different time periods: (1) immediately after collecting (n = 24) and (2) after storage at -20 °C for 6 months (n = 24), (3) for 12 months (n = 24), and (4) for 24 months (n = 24). The intensity of hybridization signals obtained from groups 1 and 2 were significantly higher than in the other groups (p  0.05). The Checkerboard DNA-DNA hybridization method was suitable to detect hybridization signals from all groups evaluated, and the intensity of signals decreased significantly after long periods of sample storage.

  10. Automated DNA electrophoresis, hybridization and detection

    International Nuclear Information System (INIS)

    Zapolski, E.J.; Gersten, D.M.; Golab, T.J.; Ledley, R.S.

    1986-01-01

    A fully automated, computer controlled system for nucleic acid hybridization analysis has been devised and constructed. In practice, DNA is digested with restriction endonuclease enzyme(s) and loaded into the system by pipette; 32 P-labelled nucleic acid probe(s) is loaded into the nine hybridization chambers. Instructions for all the steps in the automated process are specified by answering questions that appear on the computer screen at the start of the experiment. Subsequent steps are performed automatically. The system performs horizontal electrophoresis in agarose gel, fixed the fragments to a solid phase matrix, denatures, neutralizes, prehybridizes, hybridizes, washes, dries and detects the radioactivity according to the specifications given by the operator. The results, printed out at the end, give the positions on the matrix to which radioactivity remains hybridized following stringent washing

  11. Mixed DNA/Oligo(ethylene glycol) Functionalized Gold Surface Improve DNA Hybridization in Complex Media

    International Nuclear Information System (INIS)

    Lee, C.; Gamble, L.; Grainger, D.; Castner, D.

    2006-01-01

    Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s→π* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein

  12. Quantifying DNA melting transitions using single-molecule force spectroscopy

    International Nuclear Information System (INIS)

    Calderon, Christopher P; Chen, W-H; Harris, Nolan C; Kiang, C-H; Lin, K-J

    2009-01-01

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  13. Quantifying DNA melting transitions using single-molecule force spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Calderon, Christopher P [Department of Computational and Applied Mathematics, Rice University, Houston, TX (United States); Chen, W-H; Harris, Nolan C; Kiang, C-H [Department of Physics and Astronomy, Rice University, Houston, TX (United States); Lin, K-J [Department of Chemistry, National Chung Hsing University, Taichung, Taiwan (China)], E-mail: chkiang@rice.edu

    2009-01-21

    We stretched a DNA molecule using an atomic force microscope (AFM) and quantified the mechanical properties associated with B and S forms of double-stranded DNA (dsDNA), molten DNA, and single-stranded DNA. We also fit overdamped diffusion models to the AFM time series and used these models to extract additional kinetic information about the system. Our analysis provides additional evidence supporting the view that S-DNA is a stable intermediate encountered during dsDNA melting by mechanical force. In addition, we demonstrated that the estimated diffusion models can detect dynamical signatures of conformational degrees of freedom not directly observed in experiments.

  14. Single-molecule chemical reactions on DNA origami

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther; Tørring, Thomas; Rotaru, Alexandru

    2010-01-01

    as templates for building materials with new functional properties. Relatively large nanocomponents such as nanoparticles and biomolecules can also be integrated into DNA nanostructures and imaged. Here, we show that chemical reactions with single molecules can be performed and imaged at a local position...... on a DNA origami scaffold by atomic force microscopy. The high yields and chemoselectivities of successive cleavage and bond-forming reactions observed in these experiments demonstrate the feasibility of post-assembly chemical modification of DNA nanostructures and their potential use as locally......DNA nanotechnology and particularly DNA origami, in which long, single-stranded DNA molecules are folded into predetermined shapes, can be used to form complex self-assembled nanostructures. Although DNA itself has limited chemical, optical or electronic functionality, DNA nanostructures can serve...

  15. Clinical strains of acinetobacter classified by DNA-DNA hybridization

    International Nuclear Information System (INIS)

    Tjernberg, I.; Ursing, J.

    1989-01-01

    A collection of Acinetobacter strains consisting of 168 consecutive clinical strains and 30 type and reference strains was studied by DNA-DNA hybridization and a few phenotypic tests. The field strains could be allotted to 13 DNA groups. By means of reference strains ten of these could be identified with groups described by Bouvet and Grimont (1986), while three groups were new; they were given the numbers 13-15. The type strain of A. radioresistens- recently described by Nishimura et al. (1988) - was shown to be a member of DNA group 12, which comprised 31 clinical isolates. Of the 19 strains of A. junii, eight showed hemolytic acitivity on sheep and human blood agar and an additional four strains on human blood agar only. Strains of this species have previously been regarded as non-hemolytic. Reciprocal DNA pairing data for the reference strains of the DNA gropus were treated by UPGMA clustering. The reference strains for A. calcoaceticus, A. baumannii and DNA groups 3 and 13 formed a cluster with about 70% relatedness within the cluster. Other DNA groups joined at levels below 60%. (author)

  16. Clinical strains of acinetobacter classified by DNA-DNA hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Tjernberg, I; Ursing, J [Department of Medical Microbiology, University of Lund, Malmoe General Hospital, Malmoe (Sweden)

    1989-01-01

    A collection of Acinetobacter strains consisting of 168 consecutive clinical strains and 30 type and reference strains was studied by DNA-DNA hybridization and a few phenotypic tests. The field strains could be allotted to 13 DNA groups. By means of reference strains ten of these could be identified with groups described by Bouvet and Grimont (1986), while three groups were new; they were given the numbers 13-15. The type strain of A. radioresistens- recently described by Nishimura et al. (1988) - was shown to be a member of DNA group 12, which comprised 31 clinical isolates. Of the 19 strains of A. junii, eight showed hemolytic acitivity on sheep and human blood agar and an additional four strains on human blood agar only. Strains of this species have previously been regarded as non-hemolytic. Reciprocal DNA pairing data for the reference strains of the DNA gropus were treated by UPGMA clustering. The reference strains for A. calcoaceticus, A. baumannii and DNA groups 3 and 13 formed a cluster with about 70% relatedness within the cluster. Other DNA groups joined at levels below 60%. (author).

  17. DNA analysis by single molecule stretching in nanofluidic biochips

    DEFF Research Database (Denmark)

    Abad, E.; Juarros, A.; Retolaza, A.

    2011-01-01

    Imprint Lithography (NIL) technology combined with a conventional anodic bonding of the silicon base and Pyrex cover. Using this chip, we have performed single molecule imaging on a bench-top fluorescent microscope system. Lambda phage DNA was used as a model sample to characterize the chip. Single molecules of λ-DNA......Stretching single DNA molecules by confinement in nanofluidic channels has attracted a great interest during the last few years as a DNA analysis tool. We have designed and fabricated a sealed micro/nanofluidic device for DNA stretching applications, based on the use of the high throughput Nano...... stained with the fluorescent dye YOYO-1 were stretched in the nanochannel array and the experimental results were analysed to determine the extension factor of the DNA in the chip and the geometrical average of the nanochannel inner diameter. The determination of the extension ratio of the chip provides...

  18. Surface density dependence of PCR amplicon hybridization on PNA/DNA probe layers

    DEFF Research Database (Denmark)

    Yao, Danfeng; Kim, Junyoung; Yu, Fang

    2005-01-01

    at an intermediate sodium concentration (approximately 100 mM). These effects were mainly ascribed to the electrostatic cross talk among the hybridized DNA molecules and the secondary structure of PCR amplicons. For the negatively charged DNA probes, the hybridization reaction was subjected additionally to the DNA....../DNA electrostatic barrier, particularly in lower ionic strength range (e.g., 10 approximately 150 mM Na(+)). The electrostatic cross talk was shown to be largely reduced if the PNA probe layer was sufficiently diluted by following a strategic templated immobilization method. As a consequence, a pseudo...

  19. Using Protein Dimers to Maximize the Protein Hybridization Efficiency with Multisite DNA Origami Scaffolds.

    Directory of Open Access Journals (Sweden)

    Vikash Verma

    Full Text Available DNA origami provides a versatile platform for conducting 'architecture-function' analysis to determine how the nanoscale organization of multiple copies of a protein component within a multi-protein machine affects its overall function. Such analysis requires that the copy number of protein molecules bound to the origami scaffold exactly matches the desired number, and that it is uniform over an entire scaffold population. This requirement is challenging to satisfy for origami scaffolds with many protein hybridization sites, because it requires the successful completion of multiple, independent hybridization reactions. Here, we show that a cleavable dimerization domain on the hybridizing protein can be used to multiplex hybridization reactions on an origami scaffold. This strategy yields nearly 100% hybridization efficiency on a 6-site scaffold even when using low protein concentration and short incubation time. It can also be developed further to enable reliable patterning of a large number of molecules on DNA origami for architecture-function analysis.

  20. Using Protein Dimers to Maximize the Protein Hybridization Efficiency with Multisite DNA Origami Scaffolds

    Science.gov (United States)

    Verma, Vikash; Mallik, Leena; Hariadi, Rizal F.; Sivaramakrishnan, Sivaraj; Skiniotis, Georgios; Joglekar, Ajit P.

    2015-01-01

    DNA origami provides a versatile platform for conducting ‘architecture-function’ analysis to determine how the nanoscale organization of multiple copies of a protein component within a multi-protein machine affects its overall function. Such analysis requires that the copy number of protein molecules bound to the origami scaffold exactly matches the desired number, and that it is uniform over an entire scaffold population. This requirement is challenging to satisfy for origami scaffolds with many protein hybridization sites, because it requires the successful completion of multiple, independent hybridization reactions. Here, we show that a cleavable dimerization domain on the hybridizing protein can be used to multiplex hybridization reactions on an origami scaffold. This strategy yields nearly 100% hybridization efficiency on a 6-site scaffold even when using low protein concentration and short incubation time. It can also be developed further to enable reliable patterning of a large number of molecules on DNA origami for architecture-function analysis. PMID:26348722

  1. Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.

    Science.gov (United States)

    Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L

    2016-03-15

    Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.

  2. How to read and write mechanical information in DNA molecules

    Science.gov (United States)

    Schiessel, Helmut

    In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

  3. A single molecule DNA flow stretching microscope for undergraduates

    NARCIS (Netherlands)

    Williams, Kelly; Grafe, Brendan; Burke, Kathryn M.; Tanner, Nathan; van Oijen, Antoine M.; Loparo, Joseph; Price, Allen C.

    2011-01-01

    The design of a simple, safe, and inexpensive single molecule flow stretching instrument is presented. The instrument uses a low cost upright microscope coupled to a webcam for imaging single DNA molecules that are tethered in an easy to construct microfluidic flow cell. The system requires no

  4. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  5. DNA molecules and human therapeutics | Danquah | African Journal ...

    African Journals Online (AJOL)

    Nucleic acid molecules are championing a new generation of reverse engineered biopharmaceuticals. In terms of potential application in gene medicine, plasmid DNA (pDNA) vectors have exceptional therapeutic and immunological profiles as they are free from safety concerns associated with viral vectors, display ...

  6. Visualizing Single-molecule DNA Replication with Fluorescence Microscopy

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Oijen, Antoine M. van

    2009-01-01

    We describe a simple fluorescence microscopy-based real-time method for observing DNA replication at the single-molecule level. A circular, forked DNA template is attached to a functionalized glass coverslip and replicated extensively after introduction of replication proteins and nucleotides. The

  7. Localized surface plasmon resonance (LSPR) study of DNA hybridization at single nanoparticle transducers

    International Nuclear Information System (INIS)

    Schneider, T.; Jahr, N.; Jatschka, J.; Csaki, A.; Stranik, O.; Fritzsche, W.

    2013-01-01

    The effect of DNA–DNA interaction on the localized surface plasmon resonance of single 80 nm gold nanoparticles is studied. Therefore, both the attachment of the capture DNA strands at the particle surface and the sequence-specific DNA binding (hybridization) of analyte DNA to the immobilized capture DNA is subject of investigations. The influence of substrate attachment chemistry, the packing density of DNA as controlled by an assisting layer of smaller molecules, and the distance as increased by a linker on the LSPR efficiency is investigated. The resulting changes in signal can be related to a higher hybridization efficiency of the analyte DNA to the immobilized capture DNA. The subsequent attachment of additional DNA strands to this system is studied, which allows for a multiple step detection of binding and an elucidation of the resulting resonance shifts. The detection limit was determined for the utilized DNA system by incubation with various concentration of analyte DNA. Although the method allows for a marker-free detection, we show that additional markers such as 20 nm gold particle labels increase the signal and thereby the sensitivity significantly. The study of resonance shift for various DNA lengths revealed that the resonance shift per base is stronger for shorter DNA molecules (20 bases) as compared to longer ones (46 bases).

  8. Fabrication and study of hybrid molecule/superconductor assemblies

    International Nuclear Information System (INIS)

    McDevitt, J.T.; Haupt, S.G.; Jurbergs, D.; Riley, D.R.; Zhao, J.; Zhou, J.P.; Lo, K.; Grassi, J.; Jones, C.

    1994-01-01

    The fabrication of electronic devices from molecular materials has attracted much attention recently. Schottky diodes, molecular transistors, metal-insulator-semiconductor diodes, MIS field effect transistors and light emitting diodes have all been prepared utilizing such substances. The active elements in these devices have been constructed by depositing the molecular phase onto the surface of a metal, semiconductor or insulating substrate. With the recent discovery of high temperature superconductivity, new opportunities now exist for the study of molecule/superconductor interactions as well as for the construction of novel hybrid molecule/superconductor devices. In this paper, methods for preparing the first two classes of composite molecule/superconductor devices are reported. Consequently, light sensors based on organic dye-coated superconductor junctions as well as molecular switches fashioned from organic conductive polymer-coated superconductor microbridges are discussed. Moreover, the initial results related to the study of molecule/superconductor energy and electron transfer phenomena are reported

  9. Effect of secondary structure on the thermodynamics and kinetics of PNA hybridization to DNA hairpins

    DEFF Research Database (Denmark)

    Kushon, S A; Jordan, J P; Seifert, J L

    2001-01-01

    The binding of a series of PNA and DNA probes to a group of unusually stable DNA hairpins of the tetraloop motif has been observed using absorbance hypochromicity (ABS), circular dichroism (CD), and a colorimetric assay for PNA/DNA duplex detection. These results indicate that both stable PNA...... structures in both target and probe molecules are shown to depress the melting temperatures and free energies of the probe-target duplexes. Kinetic analysis of hybridization yields reaction rates that are up to 160-fold slower than hybridization between two unstructured strands. The thermodynamic and kinetic...

  10. Highly parallel translation of DNA sequences into small molecules.

    Directory of Open Access Journals (Sweden)

    Rebecca M Weisinger

    Full Text Available A large body of in vitro evolution work establishes the utility of biopolymer libraries comprising 10(10 to 10(15 distinct molecules for the discovery of nanomolar-affinity ligands to proteins. Small-molecule libraries of comparable complexity will likely provide nanomolar-affinity small-molecule ligands. Unlike biopolymers, small molecules can offer the advantages of cell permeability, low immunogenicity, metabolic stability, rapid diffusion and inexpensive mass production. It is thought that such desirable in vivo behavior is correlated with the physical properties of small molecules, specifically a limited number of hydrogen bond donors and acceptors, a defined range of hydrophobicity, and most importantly, molecular weights less than 500 Daltons. Creating a collection of 10(10 to 10(15 small molecules that meet these criteria requires the use of hundreds to thousands of diversity elements per step in a combinatorial synthesis of three to five steps. With this goal in mind, we have reported a set of mesofluidic devices that enable DNA-programmed combinatorial chemistry in a highly parallel 384-well plate format. Here, we demonstrate that these devices can translate DNA genes encoding 384 diversity elements per coding position into corresponding small-molecule gene products. This robust and efficient procedure yields small molecule-DNA conjugates suitable for in vitro evolution experiments.

  11. Studying DNA looping by single-molecule FRET.

    Science.gov (United States)

    Le, Tung T; Kim, Harold D

    2014-06-28

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

  12. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  13. Developing DNA nanotechnology using single-molecule fluorescence.

    Science.gov (United States)

    Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

    2014-06-17

    CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

  14. Hybrid male sterility is caused by mitochondrial DNA deletion.

    Science.gov (United States)

    Hayashida, Kenji; Kohno, Shigeru

    2009-07-01

    Although it is known that the hybrid male mouse is sterile just like any other animal's heterogametic sex, the reason why only the male germ cells are impaired has yet to be discovered. TdT-mediated dUTP nick end labeling assay using a confocal fluorescence microscope and DNA fragmentation assay of hybrid testis indicated destruction of the mitochondrial DNA (mtDNA) rather than the nuclear DNA. Previously we reported that maternal mtDNA inheritance is through selective sperm mtDNA elimination based on the sperm factor and two egg factors, and expression of these three factors was recognized in the hybrid testis. It was thereby assumed that mtDNA destruction caused by the expression of maternal mtDNA inheritance system in male germ cells is implicated in the hybrid male sterility of mice.

  15. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  16. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  17. Analysis of DNA interactions using single-molecule force spectroscopy.

    Science.gov (United States)

    Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

    2013-06-01

    Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

  18. DNA replication at the single-molecule level

    NARCIS (Netherlands)

    Stratmann, S.A.; Oijen, A.M. van

    2014-01-01

    A cell can be thought of as a highly sophisticated micro factory: in a pool of billions of molecules – metabolites, structural proteins, enzymes, oligonucleotides – multi-subunit complexes assemble to perform a large number of basic cellular tasks, such as DNA replication, RNA/protein synthesis or

  19. A microfabricated hybrid device for DNA sequencing.

    Science.gov (United States)

    Liu, Shaorong

    2003-11-01

    We have created a hybrid device of a microfabricated round-channel twin-T injector incorporated with a separation capillary in order to extend the straight separation distance for high speed and long readlength DNA sequencing. Semicircular grooves on glass wafers are obtained using a photomask with a narrow line-width and a standard isotropic photolithographic etching process. Round channels are made when two etched wafers are face-to-face aligned and bonded. A two-mask fabrication process has been developed to make channels of two different diameters. The twin-T injector is formed by the smaller channels whose diameter matches the bore of the separation capillary, and the "usual" separation channel, now called the connection channel, is formed by the larger ones whose diameter matches the outer diameter of the separation capillary. The separation capillary is inserted through the connection channel all the way to the twin-T injector to allow the capillary bore flush with the twin-T injector channels. The total dead-volume of the connection is estimated to be approximately 5 pL. To demonstrate the efficiency of this hybrid device, we have performed four-color DNA sequencing on it. Using a 200 microm twin-T injector coupled with a separation capillary of 20 cm effective separation distance, we have obtained readlengths of 800 plus bases at an accuracy of 98.5% in 56 min, compared to about 650 bases in 100 min on a conventional 40 cm long capillary sequencing machine under similar conditions. At an increased separation field strength and using a diluted sieving matrix, the separation time has been reduced to 20 min with a readlength of 700 bases at 98.5% base-calling accuracy.

  20. Voltage dependency of transmission probability of aperiodic DNA molecule

    Science.gov (United States)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  1. Single Molecule Study of DNA Organization and Recombination

    Science.gov (United States)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

  2. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  3. DNA hybridization sensor based on pentacene thin film transistor.

    Science.gov (United States)

    Kim, Jung-Min; Jha, Sandeep Kumar; Chand, Rohit; Lee, Dong-Hoon; Kim, Yong-Sang

    2011-01-15

    A DNA hybridization sensor using pentacene thin film transistors (TFTs) is an excellent candidate for disposable sensor applications due to their low-cost fabrication process and fast detection. We fabricated pentacene TFTs on glass substrate for the sensing of DNA hybridization. The ss-DNA (polyA/polyT) or ds-DNA (polyA/polyT hybrid) were immobilized directly on the surface of the pentacene, producing a dramatic change in the electrical properties of the devices. The electrical characteristics of devices were studied as a function of DNA immobilization, single-stranded vs. double-stranded DNA, DNA length and concentration. The TFT device was further tested for detection of λ-phage genomic DNA using probe hybridization. Based on these results, we propose that a "label-free" detection technique for DNA hybridization is possible through direct measurement of electrical properties of DNA-immobilized pentacene TFTs. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.

    Science.gov (United States)

    Rubinovich, Leonid; Polak, Micha

    2013-05-08

    Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.

  5. DNA:DNA hybridization studies on the pink-pigmented facultative methylotrophs.

    Science.gov (United States)

    Hood, D W; Dow, C S; Green, P N

    1987-03-01

    The genomic relatedness among 36 strains of pink-pigmented facultatively methylotrophic bacteria (PPFMs) was estimated by determination of DNA base composition and by DNA:DNA hybridization studies. A reproducible hybridization system was developed for the rapid analysis of multiple DNA samples. Results indicated that the PPFMs comprise four major and several minor homology groups, and that they should remain grouped in a single genus, Methylobacterium.

  6. Inhibition of DNA glycosylases via small molecule purine analogs.

    Directory of Open Access Journals (Sweden)

    Aaron C Jacobs

    Full Text Available Following the formation of oxidatively-induced DNA damage, several DNA glycosylases are required to initiate repair of the base lesions that are formed. Recently, NEIL1 and other DNA glycosylases, including OGG1 and NTH1 were identified as potential targets in combination chemotherapeutic strategies. The potential therapeutic benefit for the inhibition of DNA glycosylases was validated by demonstrating synthetic lethality with drugs that are commonly used to limit DNA replication through dNTP pool depletion via inhibition of thymidylate synthetase and dihydrofolate reductase. Additionally, NEIL1-associated synthetic lethality has been achieved in combination with Fanconi anemia, group G. As a prelude to the development of strategies to exploit the potential benefits of DNA glycosylase inhibition, it was necessary to develop a reliable high-throughput screening protocol for this class of enzymes. Using NEIL1 as the proof-of-principle glycosylase, a fluorescence-based assay was developed that utilizes incision of site-specifically modified oligodeoxynucleotides to detect enzymatic activity. This assay was miniaturized to a 1536-well format and used to screen small molecule libraries for inhibitors of the combined glycosylase/AP lyase activities. Among the top hits of these screens were several purine analogs, whose postulated presence in the active site of NEIL1 was consistent with the paradigm of NEIL1 recognition and excision of damaged purines. Although a subset of these small molecules could inhibit other DNA glycosylases that excise oxidatively-induced DNA adducts, they could not inhibit a pyrimidine dimer-specific glycosylase.

  7. Single-molecule denaturation mapping of DNA in nanofluidic channels

    DEFF Research Database (Denmark)

    Reisner, Walter; Larsen, Niels Bent; Silahtaroglu, Asli

    2010-01-01

    Here we explore the potential power of denaturation mapping as a single-molecule technique. By partially denaturing YOYO (R)-1-labeled DNA in nanofluidic channels with a combination of formamide and local heating, we obtain a sequence-dependent "barcode" corresponding to a series of local dips...... and peaks in the intensity trace along the extended molecule. We demonstrate that this structure arises from the physics of local denaturation: statistical mechanical calculations of sequence-dependent melting probability can predict the barcode to be observed experimentally for a given sequence...

  8. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    International Nuclear Information System (INIS)

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  9. Electronic properties and assambly of DNA-based molecules on gold surfaces

    DEFF Research Database (Denmark)

    Salvatore, Princia

    , highly base specific voltammetric peak in the presence of spermidine ions. A capacitive origin was attributed to this peak, and a novel route to detection of hybridization and base pair mismatches proposed on the basis of the high sensitivity to base pair mismatches showed by such ON-based monolayers...... as widely employed as Au(111) surfaces). In particular, SERS offered a valuable and rapid way ofcharacterising interactions between the DNA-based molecules and the NP surface, with no need for complex sample preparation....

  10. Single molecule DNA detection with an atomic vapor notch filter

    Energy Technology Data Exchange (ETDEWEB)

    Uhland, Denis; Rendler, Torsten; Widmann, Matthias; Lee, Sang-Yun [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Wrachtrup, Joerg; Gerhardt, Ilja [University of Stuttgart and Stuttgart Research Center of Photonic Engineering (SCoPE) and IQST, 3rd Physics Institute, Stuttgart (Germany); Max Planck Institute for Solid State Research, Stuttgart (Germany)

    2015-12-01

    The detection of single molecules has facilitated many advances in life- and material-science. Commonly the fluorescence of dye molecules is detected, which are attached to a non-fluorescent structure under study. For fluorescence microscopy one desires to maximize the detection efficiency together with an efficient suppression of undesired laser leakage. Here we present the use of the narrow-band filtering properties of hot atomic sodium vapor to selectively filter the excitation light from the red-shifted fluorescence of dye labeled single-stranded DNA molecules. A statistical analysis proves an enhancement in detection efficiency of more than 15% in a confocal and in a wide-field configuration. (orig.)

  11. Spin interactions in Graphene-Single Molecule Magnets Hybrids

    Science.gov (United States)

    Cervetti, Christian; Rettori, Angelo; Pini, Maria Gloria; Cornia, Andrea; Repollés, Aña; Luis, Fernando; Rauschenbach, Stephan; Dressel, Martin; Kern, Klaus; Burghard, Marko; Bogani, Lapo

    2014-03-01

    Graphene is a potential component of novel spintronics devices owing to its long spin diffusion length. Besides its use as spin-transport channel, graphene can be employed for the detection and manipulation of molecular spins. This requires an appropriate coupling between the sheets and the single molecular magnets (SMM). Here, we present a comprehensive characterization of graphene-Fe4 SMM hybrids. The Fe4 clusters are anchored non-covalently to the graphene following a diffusion-limited assembly and can reorganize into random networks when subjected to slightly elevated temperature. Molecules anchored on graphene sheets show unaltered static magnetic properties, whilst the quantum dynamics is profoundly modulated. Interaction with Dirac fermions becomes the dominant spin-relaxation channel, with observable effects produced by graphene phonons and reduced dipolar interactions. Coupling to graphene drives the spins over Villain's threshold, allowing the first observation of strongly-perturbative tunneling processes. Preliminary spin-transport experiments at low-temperature are further presented.

  12. A study on interaction of DNA molecules and carbon nanotubes for an effective ejection of the molecules

    International Nuclear Information System (INIS)

    Wu, N.; Wang, Q.

    2012-01-01

    The ejection of DNA molecules from carbon nanotubes is reported from interaction energy perspectives by molecular dynamics simulations. The critical ejection energy, which is to be applied to a DNA molecule for a successful ejection from a carbon nanotube, is investigated based on a study on the friction and binding energy between the DNA molecule and the tube. An effective ejection is realized by subjecting a kinetic energy on the DNA molecule that is larger than the solved critical ejection energy. In addition, the relationship between ejection energies and sizes of DNA molecules and carbon nanotubes is investigated. -- Highlights: ► Report the ejection of DNA molecules from CNTs from interaction energy perspectives. ► Develop a methodology for the critical energy of an effective ejection of a DNA molecule from a CNT. ► Present the relationship between critical ejection energies and sizes of DNA molecules and CNTs. ► Provide a general guidance on the ejection of encapsulated molecules from CNTs.

  13. Hybridization thermodynamics of DNA bound to gold nanoparticles

    International Nuclear Information System (INIS)

    Lang, Brian

    2010-01-01

    Isothermal Titration Calorimetry (ITC) was used to study the thermodynamics of hybridization on DNA-functionalized colloidal gold nanoparticles. When compared to the thermodynamics of hybridization of DNA that is free in solution, the differences in the values of the Gibbs free energy of reaction, Δ r G o , the enthalpy, Δ r H o , and entropy, Δ r S o , were small. The change in Δ r G o between the free and bound states was always positive but with statistical significance outside the 95% confidence interval, implying the free DNA is slightly more stable than when in the bound state. Additionally, ITC was also able to reveal information about the binding stoichiometry of the hybridization reactions on the DNA-functionalized gold nanoparticles, and indicates that there is a significant fraction of the DNA on gold nanoparticle surface that is unavailable for DNA hybridization. Furthermore, the fraction of available DNA is dependent on the spacer group on the DNA that is used to span the gold surface from that to the probe DNA.

  14. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Building a Phylogenetic Tree of the Human and Ape Superfamily Using DNA-DNA Hybridization Data

    Science.gov (United States)

    Maier, Caroline Alexander

    2004-01-01

    The study describes the process of DNA-DNA hybridization and the history of its use by Sibley and Alquist in simple, straightforward, and interesting language that students easily understand to create their own phylogenetic tree of the hominoid superfamily. They calibrate the DNA clock and use it to estimate the divergence dates of the various…

  16. Physical manipulation of single-molecule DNA using microbead and its application to analysis of DNA-protein interaction

    International Nuclear Information System (INIS)

    Kurita, Hirofumi; Yasuda, Hachiro; Takashima, Kazunori; Katsura, Shinji; Mizuno, Akira

    2009-01-01

    We carried out an individual DNA manipulation using an optical trapping for a microbead. This manipulation system is based on a fluorescent microscopy equipped with an IR laser. Both ends of linear DNA molecule were labeled with a biotin and a thiol group, respectively. Then the biotinylated end was attached to a microbead, and the other was immobilized on a thiol-linkable glass surface. We controlled the form of an individual DNA molecule by moving the focal point of IR laser, which trapped the microbead. In addition, we applied single-molecule approach to analyze DNA hydrolysis. We also used microchannel for single-molecule observation of DNA hydrolysis. The shortening of DNA in length caused by enzymatic hydrolysis was observed in real-time. The single-molecule DNA manipulation should contribute to elucidate detailed mechanisms of DNA-protein interactions

  17. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  18. Direct immobilization and hybridization of DNA on group III nitride semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Xu Xiaobin; Jindal, Vibhu; Shahedipour-Sandvik, Fatemeh; Bergkvist, Magnus [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States); Cady, Nathaniel C. [College of Nanoscale Science and Engineering, University at Albany (SUNY), 255 Fuller Road, Albany, NY 12203 (United States)], E-mail: ncady@uamail.albany.edu

    2009-03-15

    A key concern for group III-nitride high electron mobility transistor (HEMT) biosensors is the anchoring of specific capture molecules onto the gate surface. To this end, a direct immobilization strategy was developed to attach single-stranded DNA (ssDNA) to AlGaN surfaces using simple printing techniques without the need for cross-linking agents or complex surface pre-functionalization procedures. Immobilized DNA molecules were stably attached to the AlGaN surfaces and were able to withstand a range of pH and ionic strength conditions. The biological activity of surface-immobilized probe DNA was also retained, as demonstrated by sequence-specific hybridization experiments. Probe hybridization with target ssDNA could be detected by PicoGreen fluorescent dye labeling with a minimum detection limit of 2 nM. These experiments demonstrate a simple and effective immobilization approach for attaching nucleic acids to AlGaN surfaces which can further be used for the development of HEMT-based DNA biosensors.

  19. Influence of thermodynamically unfavorable secondary structures on DNA hybridization kinetics

    Science.gov (United States)

    Hata, Hiroaki; Kitajima, Tetsuro

    2018-01-01

    Abstract Nucleic acid secondary structure plays an important role in nucleic acid–nucleic acid recognition/hybridization processes, and is also a vital consideration in DNA nanotechnology. Although the influence of stable secondary structures on hybridization kinetics has been characterized, unstable secondary structures, which show positive ΔG° with self-folding, can also form, and their effects have not been systematically investigated. Such thermodynamically unfavorable secondary structures should not be ignored in DNA hybridization kinetics, especially under isothermal conditions. Here, we report that positive ΔG° secondary structures can change the hybridization rate by two-orders of magnitude, despite the fact that their hybridization obeyed second-order reaction kinetics. The temperature dependence of hybridization rates showed non-Arrhenius behavior; thus, their hybridization is considered to be nucleation limited. We derived a model describing how ΔG° positive secondary structures affect hybridization kinetics in stopped-flow experiments with 47 pairs of oligonucleotides. The calculated hybridization rates, which were based on the model, quantitatively agreed with the experimental rate constant. PMID:29220504

  20. Dendrimer-based biosensor for chemiluminescent detection of DNA hybridization

    International Nuclear Information System (INIS)

    Liu, P.; Hun, X.; Qing, H.

    2011-01-01

    We report on a highly sensitive chemiluminescent (CL) biosensor for the sequence-specific detection of DNA using a novel bio barcode DNA probe modified with gold nanoparticles that were covered with a dendrimer. The modified probe is composed of gold nanoparticles, a dendrimer, the CL reagent, and the DNA. The capture probe DNA was immobilized on magnetic beads covered with gold. It first hybridizes with the target DNA and then with one terminal end of the signal DNA on the barcoded DNA probe. CL was generated by adding H 2 O 2 and Co(II) ions as the catalyst. The immobilization of dendrimer onto the gold nanoparticles can significantly enhance sensitivity and gives a detection limit of 6 fmol L -1 of target DNA. (author)

  1. Microcantilver-based DNA hybridization sensors for Salmonella identification

    Directory of Open Access Journals (Sweden)

    Carlo Ricciardi

    2012-02-01

    Full Text Available The detection of pathogenic microorganisms in foods remains a challenging since the safety of foodstuffs has to be ensured by the food producing companies. Conventional methods for the detection and identification of bacteria mainly rely on specific microbiological and biochemical identification. Biomolecular methods, are commonly used as a support for traditional techniques, thanks to their high sensitivity, specificity and not excessive costs. However, new methods like biosensors for example, can be an exciting alternative to the more traditional tecniques for the detection of pathogens in food. In this study we report Salmonella enterica serotype Enteritidis DNA detection through a novel class of label-free biosensors: microcantilevers (MCs. In general, MCs can operate as a microbalance and is used to detect the mass of the entities anchored to the cantilever surface using the decrease in the resonant frequency. We use DNA hybridization as model reaction system and for this reason, specific single stranded probe DNA of the pathogen and three different DNA targets (single-stranded complementary DNA, PCR product and serial dilutions of DNA extracted from S. Enteritidis strains were applied. Two protocols were reported in order to allow the probe immobilization on cantilever surface: i MC surface was functionalized with 3-aminopropyltriethoxysilane and glutaraldehyde and an amino-modified DNA probe was used; ii gold-coated sensors and thiolated DNA probes were used in order to generate a covalent bonding (Th-Au. For the first one, measures after hybridization with the PCR product showed related frequency shift 10 times higher than hybridization with complementary probe and detectable signals were obtained at the concentrations of 103 and 106 cfu/mL after hybridization with bacterial DNA. There are currently optimizations of the second protocol, where preliminary results have shown to be more uniform and therefore more precise within each of the

  2. Toxicology of organic-inorganic hybrid molecules: bio-organometallics and its toxicology.

    Science.gov (United States)

    Fujie, Tomoya; Hara, Takato; Kaji, Toshiyuki

    2016-01-01

    Bio-organometallics is a research strategy of biology that uses organic-inorganic hybrid molecules. The molecules are expected to exhibit useful bioactivities based on the unique structure formed by interaction between the organic structure and intramolecular metal(s). However, studies on both biology and toxicology of organic-inorganic hybrid molecules have been incompletely performed. There can be two types of toxicological studies of bio-organometallics; one is evaluation of organic-inorganic hybrid molecules and the other is analysis of biological systems from the viewpoint of toxicology using organic-inorganic hybrid molecules. Our recent studies indicate that cytotoxicity of hybrid molecules containing a metal that is nontoxic in inorganic forms can be more toxic than that of hybrid molecules containing a metal that is toxic in inorganic forms when the structure of the ligand is the same. Additionally, it was revealed that organic-inorganic hybrid molecules are useful for analysis of biological systems important for understanding the toxicity of chemical compounds including heavy metals.

  3. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S

    2008-01-01

    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  4. Multiplex single-molecule interaction profiling of DNA barcoded proteins

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

    2014-01-01

    In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

  5. The yeast three-hybrid system as an experimental platform to identify proteins interacting with small signaling molecules in plant cells: Potential and limitations

    Directory of Open Access Journals (Sweden)

    Stéphanie eCottier

    2011-12-01

    Full Text Available Chemical genetics is a powerful scientific strategy that utilizes small bioactive molecules as experimental tools to unravel biological processes. Bioactive compounds occurring in nature represent an enormous diversity of structures that can be used to dissect functions of biological systems. Once the bioactivity of a natural or synthetic compound has been critically evaluated the challenge remains to identify its molecular target and mode of action, which usually is a time consuming and labor-intensive process. To facilitate this task, we decided to implement the yeast three-hybrid (Y3H technology as a general experimental platform to scan the whole Arabidopsis proteome for targets of small signaling molecules. The Y3H technology is based on the yeast two-hybrid system and allows direct cloning of proteins that interact in vivo with a synthetic hybrid ligand, which comprises the biologically active molecule of interest covalently linked to methotrexate (Mtx. In yeast nucleus the hybrid ligand connects two fusion proteins: the Mtx part binding to dihydrofolate reductase fused to a DNA binding domain (encoded in the yeast strain, and the bioactive molecule part binding to its potential protein target fused to a DNA activating domain (encoded on a cDNA expression vector. During cDNA library screening, the formation of this ternary, transcriptional activator complex leads to reporter gene activation in yeast cells, and thereby allows selection of the putative targets of small bioactive molecules of interest. Here we present the strategy and experimental details for construction and application of a Y3H platform, including chemical synthesis of different hybrid ligands, construction of suitable cDNA libraries, the choice of yeast strains, and appropriate screening conditions. Based on the results obtained and the current literature we discussed the perspectives and limitations of the Y3H approach for identifying targets of small bioactive molecules.

  6. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    International Nuclear Information System (INIS)

    Li Li; Li Xincang; Li Lu; Wang Jinxing; Jin Wenrui

    2011-01-01

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10 -14 mol L -1 . Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  7. Ultra-sensitive DNA assay based on single-molecule detection coupled with fluorescent quantum dot-labeling and its application to determination of messenger RNA

    Energy Technology Data Exchange (ETDEWEB)

    Li Li [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Li Xincang [School of Life Sciences, Shandong University, Jinan 250100 (China); Li Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2011-01-24

    An ultra-sensitive single-molecule detection (SMD) method for quantification of DNA using total internal reflection fluorescence microscopy (TIRFM) coupled with fluorescent quantum dot (QD)-labeling was developed. In this method, the target DNA (tDNA) was captured by the capture DNA immobilized on the silanized coverslip blocked with ethanolamine and bovine serum albumin. Then, the QD-labeled probe DNA was hybridized to the tDNA. Ten fluorescent images of the QD-labeled sandwich DNA hybrids on the coverslip were taken by a high-sensitive CCD. The tDNA was quantified by counting the bright spots on the images using a calibration curve. The LOD of the method was 1 x 10{sup -14} mol L{sup -1}. Several key factors, including image acquirement, fluorescence probe, substrate preparation, noise elimination from solutions and glass coverslips, and nonspecific adsorption and binding of solution-phase detection probes were discussed in detail. The method could be applied to quantify messenger RNA (mRNA) in cells. In order to determine mRNA, double-stranded RNA-DNA hybrids consisting of mRNA and corresponding cDNA were synthesized from the cellular mRNA template using reverse transcription in the presence of reverse transcriptase. After removing the mRNA in the double-stranded hybrids using ribonuclease, cDNA was quantified using the SMD-based TIRFM. Osteopontin mRNA in decidual stromal cells was chosen as the model analyte.

  8. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    Science.gov (United States)

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  9. Fluorescent in situ hybridization of mitochondrial DNA and RNA

    Czech Academy of Sciences Publication Activity Database

    Alán, Lukáš; Zelenka, Jaroslav; Ježek, Jan; Dlasková, Andrea; Ježek, Petr

    2010-01-01

    Roč. 57, č. 4 (2010), s. 403-408 ISSN 0001-527X R&D Projects: GA ČR GAP302/10/0346; GA ČR GPP304/10/P204; GA AV ČR KJB500110902 Institutional research plan: CEZ:AV0Z50110509 Keywords : mitochondrial DNA and RNA * nucleoids of mitochondrial DNA * molecular beacon fluorescent hybridization probes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.234, year: 2010

  10. DNA hybridization on membrane-modified carbon electrodes

    Czech Academy of Sciences Publication Activity Database

    Kouřilová, Alena; Babkina, S. S.; Cahová, Kateřina; Havran, Luděk; Jelen, František; Paleček, Emil; Fojta, Miroslav

    2005-01-01

    Roč. 38, - (2005), s. 2493-2507 ISSN 0003-2719 R&D Projects: GA MPO(CZ) 1H-PK/42; GA AV ČR(CZ) IAA4004402; GA AV ČR(CZ) IBS5004355 Institutional research plan: CEZ:AV0Z50040507 Keywords : DNA hybridization * electrochemical DNA sensor * nitrocellulose membrane Subject RIV: BO - Biophysics Impact factor: 1.036, year: 2005

  11. Effects of humic substances on fluorometric DNA quantification and DNA hybridization

    NARCIS (Netherlands)

    Bachoon, DS; Otero, E; Hodson, RE

    2001-01-01

    DNA extracts from sediment and water samples are often contaminated with coextracted humic-like impurities, Estuarine humic substances and vascular plant extract were used to evaluate the effect of the presence of such impurities on DNA hybridization and quantification. The presence of humic

  12. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so......-megabase- to megabase-sized DNA molecules were recovered from the gel and analysed by denaturation-renaturation optical mapping. Size-selected molecules from the same gel were sequenced by NGS. The optically mapped molecules and the NGS reads showed enrichment from regions defined by NotI restriction sites. We...... demonstrate that the unannotated genome can be characterized in a locus-specific manner via molecules partially overlapping with the annotated genome. The method is a promising tool for investigation of structural variants in enriched human genomic regions for both research and diagnostic purposes. Our...

  13. Identification of DNA viruses by membrane filter hybridization.

    OpenAIRE

    Stålhandske, P; Pettersson, U

    1982-01-01

    The use of membrane filter hybridization for the identification of DNA viruses is described. We designed and used a procedure for identification of herpes simplex virus. This method can discriminate between herpes simplex virus types 1 and 2 in a simple way.

  14. Influence of DNA treatments on Southern blot hybridization analysis ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-03

    Jun 3, 2008 ... DNA samples obtained by a non-phenol/chloroform isolation method, from three races of Fusarium oxysporum f. sp. lycopersici ... Key words: Fusarium oxysporum, DIG-IGS Probe, Southern hybridization. INTRODUCTION .... Detection of Fusarium spp in plants with monoclonal antibody. Ann. Phytopathol.

  15. Enrichment of megabase-sized DNA molecules for single-molecule optical mapping and next-generation sequencing

    DEFF Research Database (Denmark)

    Łopacińska-Jørgensen, Joanna M; Pedersen, Jonas Nyvold; Bak, Mads

    2017-01-01

    Next-generation sequencing (NGS) has caused a revolution, yet left a gap: long-range genetic information from native, non-amplified DNA fragments is unavailable. It might be obtained by optical mapping of megabase-sized DNA molecules. Frequently only a specific genomic region is of interest, so...

  16. Advancing surgical guidance : from (hybrid) molecule to man and beyond

    NARCIS (Netherlands)

    Berg, van den N.S.

    2016-01-01

    The work described in this thesis shows how intraoperative lesion identification can be improved via the introduction of (hybrid) tracers and optimised (hybrid) imaging modalities capable of detecting this tracers. In part one, the reader is introduced to the concept of fluorescence image-guided

  17. Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy

    Energy Technology Data Exchange (ETDEWEB)

    McEwen, Gerald D.; Chen Fan [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States); Zhou Anhong, E-mail: Anhong.Zhou@usu.edu [Biological Engineering Program, Department of Biological and Irrigation Engineering, Utah State University, 4105 Old Main Hill, Logan, UT 84322-4105 (United States)

    2009-06-08

    Fundamental understanding of interfacial electron transfer (ET) among electrolyte/DNA/solid-surface will facilitate the design for electrical detection of DNA molecules. In this report, the electron transfer characteristics of synthetic DNA (sequence from pathogenic Cryptosporidium parvum) self-assembled on a gold surface was electrochemically studied. The effects of immobilization order on the interface ET related parameters such as diffusion coefficient (D{sub 0}), surface coverage ({theta}{sub R}), and monolayer thickness (d{sub i}) were determined by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). DNA surface density ({Gamma}{sub DNA}) was determined by the integration of the charge of the electro-oxidation current peaks during the initial cyclic voltammetry scans. It was found that the DNA surface densities at different modifications followed the order: {Gamma}{sub DNA} (dsS-DNA/Au) > {Gamma}{sub DNA} (MCH/dsS-DNA/Au) > {Gamma}{sub DNA} (dsS-DNA/MCH/Au). It was also revealed that the electro-oxidation of the DNA modified gold surface would involve the oxidation of nucleotides (guanine and adenine) with a 5.51 electron transfer mechanism and the oxidative desorption of DNA and MCH molecules by a 3 electron transfer mechanism. STM topography and current image analysis indicated that the surface conductivity after each surface modification followed the order: dsS-DNA/Au < MCH/dsS-DNA/Au < oxidized MCH/dsS-DNA/Au < Hoechst/oxidized MCH/dsS-DNA/Au. The results from this study suggested a combination of variations in immobilization order may provide an alternative approach for the optimization of DNA hybridization and the further development for electrical detection of DNA.

  18. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Science.gov (United States)

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  19. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    Directory of Open Access Journals (Sweden)

    Md. Mahbubur Rahman

    2015-02-01

    Full Text Available Conducting polymers (CPs are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  20. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  1. Nanostructured ZnO-based biosensor: DNA immobilization and hybridization

    Directory of Open Access Journals (Sweden)

    Ahmed Mishaal Mohammed

    2017-09-01

    Full Text Available An electrochemical DNA biosensor was successfully fabricated by using (3-aminopropyl triethoxysilane (APTES with zinc oxide (ZnO nanorods synthesized using microwave-assisted chemical bath deposition method on thermally oxidized SiO2 thin films. The structural quality and morphology of the ZnO nanorods were determined by employing scanning electron microscopy (SEM and X-ray diffraction (XRD, which show a hexagonal wurtzite structure with a preferred orientation along the (101 direction. The surface of the SiO2 thin films was chemically modified with ZnO. Label-free detection DNA immobilization and hybridization were performed using potassium hexacyanoferrate with cyclic voltammetry (CV measurements. The capacitance, permittivity, and conductivity profiles of the fabricated sensor clearly indicate DNA immobilization and hybridization. Results show that the capacitance values of bare, ZnO- modified surface immobilization, and target DNA hybridization were 46×10−12F, 47×10−8F, 27μF, and 17μF, respectively, at 1Hz. The permittivity measurement increased from 3.94×103 to 251×103 and 165×103 at the frequency range of approximately 200 to 1Hz for bare and DNA immobilization and hybridization, respectively. The measured conductivity values for the bare, ZnO, immobilized, and hybridization device were 2.4×10−9, 10×10−8, 1.6×10−7, and 1.3×10−7Scm−1, respectively. Keywords: Zinc oxide, Biosensor, Capacitance, Permittivity, Conductivity

  2. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  3. Multilayer DNA Origami Packed on Hexagonal and Hybrid Lattices

    DEFF Research Database (Denmark)

    Ke, Yonggang; Voigt, Niels Vinther; Shih, William M.

    2012-01-01

    “Scaffolded DNA origami” has been proven to be a powerful and efficient approach to construct two-dimensional or three-dimensional objects with great complexity. Multilayer DNA origami has been demonstrated with helices packing along either honeycomb-lattice geometry or square-lattice geometry....... Here we report successful folding of multilayer DNA origami with helices arranged on a close-packed hexagonal lattice. This arrangement yields a higher density of helical packing and therefore higher resolution of spatial addressing than has been shown previously. We also demonstrate hybrid multilayer...... DNA origami with honeycomb-lattice, square-lattice, and hexagonal-lattice packing of helices all in one design. The availability of hexagonal close-packing of helices extends our ability to build complex structures using DNA nanotechnology....

  4. Multilayer DNA origami packed on hexagonal and hybrid lattices.

    Science.gov (United States)

    Ke, Yonggang; Voigt, Niels V; Gothelf, Kurt V; Shih, William M

    2012-01-25

    "Scaffolded DNA origami" has been proven to be a powerful and efficient approach to construct two-dimensional or three-dimensional objects with great complexity. Multilayer DNA origami has been demonstrated with helices packing along either honeycomb-lattice geometry or square-lattice geometry. Here we report successful folding of multilayer DNA origami with helices arranged on a close-packed hexagonal lattice. This arrangement yields a higher density of helical packing and therefore higher resolution of spatial addressing than has been shown previously. We also demonstrate hybrid multilayer DNA origami with honeycomb-lattice, square-lattice, and hexagonal-lattice packing of helices all in one design. The availability of hexagonal close-packing of helices extends our ability to build complex structures using DNA nanotechnology. © 2011 American Chemical Society

  5. File list: Oth.ALL.10.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.10.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids All cell ...types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.ALL.10.DNA-RNA_hybrids.AllCell.bed ...

  6. File list: Oth.ALL.50.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.50.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids All cell ...types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.ALL.50.DNA-RNA_hybrids.AllCell.bed ...

  7. File list: Oth.Unc.20.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Unc.20.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Unclassif...ied http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.Unc.20.DNA-RNA_hybrids.AllCell.bed ...

  8. File list: Oth.ALL.05.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.05.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids All cell ...types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.ALL.05.DNA-RNA_hybrids.AllCell.bed ...

  9. File list: Oth.Unc.50.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Unc.50.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Unclassif...ied http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.Unc.50.DNA-RNA_hybrids.AllCell.bed ...

  10. File list: Oth.YSt.05.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.YSt.05.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Yeast str...ain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.YSt.05.DNA-RNA_hybrids.AllCell.bed ...

  11. File list: Oth.Unc.10.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Unc.10.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Unclassif...ied http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.Unc.10.DNA-RNA_hybrids.AllCell.bed ...

  12. File list: Oth.YSt.50.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.YSt.50.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Yeast str...ain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.YSt.50.DNA-RNA_hybrids.AllCell.bed ...

  13. File list: Oth.Unc.05.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.Unc.05.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Unclassif...ied http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.Unc.05.DNA-RNA_hybrids.AllCell.bed ...

  14. File list: Oth.ALL.20.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.ALL.20.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids All cell ...types http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.ALL.20.DNA-RNA_hybrids.AllCell.bed ...

  15. File list: Oth.YSt.20.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.YSt.20.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Yeast str...ain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.YSt.20.DNA-RNA_hybrids.AllCell.bed ...

  16. File list: Oth.YSt.10.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.YSt.10.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids Yeast str...ain http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.YSt.10.DNA-RNA_hybrids.AllCell.bed ...

  17. Studying DNA Looping by Single-Molecule FRET

    OpenAIRE

    Le, Tung T.; Kim, Harold D.

    2014-01-01

    Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can als...

  18. Application of DNA-DNA colony hybridization to the detection of catabolic genotypes in environmental samples

    International Nuclear Information System (INIS)

    Sayler, G.S.; Shields, M.S.; Tedford, E.T.; Breen, A.; Hooper, S.W.; Sirotkin, K.M.; Davis, J.W.

    1985-01-01

    The application of preexisting DNA hybridization techniques was investigated for potential in determining populations of specific gene sequences in environmental samples. Cross-hybridizations among two degradative plasmids, TOL and NAH, and two cloning vehicles, pLAFR1 and RSF1010, were determined. The detection limits for the TOL plasmid against a nonhomologous plasmid-bearing bacterial background was ascertained. The colony hybridization technique allowed detection of one colony containing TOL plasmid among 10(6) Escherichia coli colonies of nonhomologous DNA. Comparisons between population estimates derived from growth on selective substrates and from hybridizations were examined. Findings indicated that standard sole carbon source enumeration procedures for degradative populations lead to overestimations due to nonspecific growth of other bacteria on the microcontaminant carbon sources present in the media. Population estimates based on the selective growth of a microcosm population on two aromatic substrates (toluene and naphthalene) and estimates derived from DNA-DNA colony hybridizations, using the TOL or NAH plasmid as a probe, corresponded with estimates of substrate mineralization rates and past exposure to environmental contaminants. The applications of such techniques are hoped to eventually allow enumeration of any specific gene sequences in the environment, including both anabolic and catabolic genes. In addition, this procedure should prove useful in monitoring recombinant DNA clones released into environmental situations

  19. Techniques of DNA hybridization detect small numbers of mycobacteria with no cross-hybridization with non-mycobacterial respiratory organisms

    International Nuclear Information System (INIS)

    Shoemaker, S.A.; Fisher, J.H.; Scoggin, C.H.

    1985-01-01

    The traditional methods used in identifying mycobacteria, such as acid-fast bacillus stains and culture, are often time-consuming, insensitive, and nonspecific. As part of an ongoing program to improve diagnosis and characterization of mycobacteria, the authors have found that deoxyribonucleic acid (DNA) hybridization techniques using isotopically labeled, single-stranded, total DNA can be used to detect as little as 10(-4) micrograms of Mycobacterium tuberculosis (MTb) DNA. This amount of DNA represents approximately 2 X 10(4) genomes. They have also shown the MTb DNA is sufficiently different from the DNA of non-mycobacterial microorganisms such that cross-hybridization with MTb DNA does not occur under the hybridization conditions employed. The authors speculate that DNA hybridization techniques may allow the rapid, sensitive, and specific identification of mycobacteria

  20. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  1. Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

    Science.gov (United States)

    Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

    2016-07-15

    Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  3. Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase

    Science.gov (United States)

    Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.

    2014-01-01

    Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707

  4. Thermophoretic forces on DNA measured with a single-molecule spring balance

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Lüscher, Christopher James; Marie, Rodolphe

    2014-01-01

    We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement ....... We find the Soret coefficient per unit length of DNA at various ionic strengths. It agrees, with novel precision, with results obtained in bulk for DNA too short to shield itself and with the thermodynamic model of thermophoresis.......We stretch a single DNA molecule with thermophoretic forces and measure these forces with a spring balance: the DNA molecule itself. It is an entropic spring which we calibrate, using as a benchmark its Brownian motion in the nanochannel that contains and prestretches it. This direct measurement...

  5. Charge transfer through DNA/DNA duplexes and DNA/RNA hybrids: complex theoretical and experimental studies.

    Science.gov (United States)

    Kratochvílová, Irena; Vala, Martin; Weiter, Martin; Špérová, Miroslava; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Oligonucleotides conduct electric charge via various mechanisms and their characterization and understanding is a very important and complicated task. In this work, experimental (temperature dependent steady state fluorescence spectroscopy, time-resolved fluorescence spectroscopy) and theoretical (Density Functional Theory) approaches were combined to study charge transfer processes in short DNA/DNA and RNA/DNA duplexes with virtually equivalent sequences. The experimental results were consistent with the theoretical model - the delocalized nature of HOMO orbitals and holes, base stacking, electronic coupling and conformational flexibility formed the conditions for more effective short distance charge transfer processes in RNA/DNA hybrids. RNA/DNA and DNA/DNA charge transfer properties were strongly connected with temperature affected structural changes of molecular systems - charge transfer could be used as a probe of even tiny changes of molecular structures and settings. © 2013. Published by Elsevier B.V. All rights reserved.

  6. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Energy Technology Data Exchange (ETDEWEB)

    Umemura, Kazuo, E-mail: meicun2006@163.com; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Highlights: • Conjugates of protein, DNA, and SWNTs were observed by AFM in liquid. • Non-uniform binding of proteins was visualized in liquid. • Thickness of DNA molecules on SWNT surfaces was well characterized in liquid. - Abstract: Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA–SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA–SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA–SWNT hybrids. The morphology of the SSB–ssDNA–SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB–ssDNA–SWNT hybrids showed much larger variance than the ssDNA–SWNT hybrids.

  7. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Directory of Open Access Journals (Sweden)

    Yuji Miyahara

    2013-02-01

    Full Text Available Peptide nucleic acid (PNA has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry.

  8. Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

    Science.gov (United States)

    Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

    2013-01-01

    Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

  9. Ultrasensitive FRET-based DNA sensor using PNA/DNA hybridization.

    Science.gov (United States)

    Yang, Lan-Hee; Ahn, Dong June; Koo, Eunhae

    2016-12-01

    In the diagnosis of genetic diseases, rapid and highly sensitive DNA detection is crucial. Therefore, many strategies for detecting target DNA have been developed, including electrical, optical, and mechanical methods. Herein, a highly sensitive FRET based sensor was developed by using PNA (Peptide Nucleic Acid) probe and QD, in which red color QDs are hybridized with capture probes, reporter probes and target DNAs by EDC-NHS coupling. The hybridized probe with target DNA gives off fluorescent signal due to the energy transfer from QD to Cy5 dye in the reporter probe. Compared to the conventional DNA sensor using DNA probes, the DNA sensor using PNA probes shows higher FRET factor and efficiency due to the higher reactivity between PNA and target DNA. In addition, to elicit the effect of the distance between the donor and the acceptor, we have investigated two types of the reporter probes having Cy5 dyes attached at the different positions of the reporter probes. Results show that the shorter the distance between QDs and Cy5s, the stronger the signal intensity. Furthermore, based on the fluorescence microscopy images using microcapillary chips, the FRET signal is enhanced to be up to 276% times stronger than the signal obtained using the cuvette by the fluorescence spectrometer. These results suggest that the PNA probe system conjugated with QDs can be used as ultrasensitive DNA nanosensors. Copyright © 2016. Published by Elsevier B.V.

  10. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    Science.gov (United States)

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. DNA origami as biocompatible surface to match single-molecule and ensemble experiments

    Science.gov (United States)

    Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

    2012-01-01

    Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

  12. Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

    Science.gov (United States)

    Yadav, Hemendra; Sharma, Pulkit

    2017-11-01

    Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

    Science.gov (United States)

    Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

    2013-10-01

    Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

  14. Organophosphonate functionalized silicon nanowires for DNA hybridization studies

    Energy Technology Data Exchange (ETDEWEB)

    Pedone, Daniel; Cattani Scholz, Anna; Birner, Stefan; Abstreiter, Gerhard [WSI, TU Muenchen (Germany); Dubey, Manish; Schwartz, Jeffrey [Princeton University, NJ (United States); Tornow, Marc [IHT, TU Braunschweig (Germany)

    2007-07-01

    Semiconductor nanowire field effect devices have great appeal for label-free sensing applications due to their sensitivity to surface potential changes that may originate from charged adsorbates. In addition to requiring high sensitivity, suitable passivation and functionalization of the semiconductor surface is obligatory. We have fabricated both freely suspended and oxide-supported silicon nanowires from Silicon-on-Insulator substrates using standard nanopatterning methods (EBL, RIE) and sacrificial oxide layer etching. Subsequent to nanofabrication, the devices were first coated with an hydroxyalkylphosphonate monolayer and then bound via bifunctional linker groups to single stranded DNA or PNA oligonucleotides, respectively. We investigated DNA hybridization on such functionalized nanowires using a difference resistance setup, where subtracting the reference signal from a second wire could be used to exclude most non-specific effects. A net change in surface potential on the order of a few mV could be detected upon addition of the complementary DNA strand. This surface potential change corresponds to the hybridization of about 10{sup 10}cm{sup -2} probe strands according to our model calculations that takes into account the entire hybrid system in electrolyte solution.

  15. The elastic theory of a single DNA molecule

    Indian Academy of Sciences (India)

    methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.

  16. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    OpenAIRE

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  17. A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

    Science.gov (United States)

    Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

    Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

  18. Voltammetry of osmium-modified DNA at a mercury film electrode application in detecting DNA hybridization

    Czech Academy of Sciences Publication Activity Database

    Kostečka, Pavel; Havran, Luděk; Pivoňková, Hana; Fojta, Miroslav

    2004-01-01

    Roč. 63, 1-2 (2004), s. 245-248 ISSN 1567-5394 R&D Projects: GA AV ČR IAA4004108; GA AV ČR KJB4004302 Institutional research plan: CEZ:AV0Z5004920 Keywords : osmium * DNA hybridization * mercury film electrode Subject RIV: BO - Biophysics Impact factor: 2.261, year: 2004

  19. Diversity of DNA β, a satellite molecule associated with some monopartite begomoviruses

    International Nuclear Information System (INIS)

    Briddon, Rob W.; Bull, Simon E.; Amin, Imran; Idris, Ali M.; Mansoor, Shahid; Bedford, Ian D.; Dhawan, Poonam; Rishi, Narayan; Siwatch, Surender S.; Abdel-Salam, Aly M.; Brown, Judith K.; Zafar, Yusuf; Markham, Peter G.

    2003-01-01

    DNA β molecules are symptom-modulating, single-stranded DNA satellites associated with monopartite begomoviruses (family Geminiviridae). Such molecules have thus far been shown to be associated with Ageratum yellow vein virus from Singapore and Cotton leaf curl Multan virus from Pakistan. Here, 26 additional DNA β molecules, associated with diverse plant species obtained from different geographical locations, were cloned and sequenced. These molecules were shown to be widespread in the Old World, where monopartite begomoviruses are known to occur. Analysis of the sequences revealed a highly conserved organization for DNA β molecules consisting of a single conserved open reading frame, an adenine-rich region, and a region of high sequence conservation [the satellite conserved region (SCR)]. The SCR contains a potential hairpin structure with the loop sequence TAA/GTATTAC; similar to the origins of replication of geminiviruses and nanoviruses. Two major groups of DNA β satellites were resolved by phylogenetic analyses. One group originated from hosts within the Malvaceae and the second from a more diverse group of plants within the Solanaceae and Compositae. Within the two clusters, DNA β molecules showed relatedness based both on host and geographic origin. These findings strongly support coadaptation of DNA β molecules with their respective helper begomoviruses

  20. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  1. An insight into the biological activities of heterocyclic-fatty acid hybrid molecules.

    Science.gov (United States)

    Venepally, Vijayendar; Reddy Jala, Ram Chandra

    2017-12-01

    Heterocyclic compounds are the interesting core structures for the development of new bioactive compounds. Fatty acids are derived from renewable raw materials and exhibit various biological activities. Several researchers are amalgamating these two bioactive components to yield bioactive hybrid molecules with some desirable features. Heterocyclic-fatty acid hybrid derivatives are a new class of heterocyclic compounds with a broad range of biological activities and significance in the field of medicinal chemistry. Over the last few years, many research articles emphasized the significance of heterocyclic-fatty acid hybrid derivatives. The present review article focuses the developments in designing and biological evaluation of heterocyclic-fatty acid hybrid molecules. Copyright © 2017. Published by Elsevier Masson SAS.

  2. Polymer and small molecule based hybrid light source

    Science.gov (United States)

    Choong, Vi-En; Choulis, Stelios; Krummacher, Benjamin Claus; Mathai, Mathew; So, Franky

    2010-03-16

    An organic electroluminescent device, includes: a substrate; a hole-injecting electrode (anode) coated over the substrate; a hole injection layer coated over the anode; a hole transporting layer coated over the hole injection layer; a polymer based light emitting layer, coated over the hole transporting layer; a small molecule based light emitting layer, thermally evaporated over the polymer based light emitting layer; and an electron-injecting electrode (cathode) deposited over the electroluminescent polymer layer.

  3. Single Molecule Atomic Force Microscopy Studies of Photosensitized Singlet Oxygen Behavior on a DNA Origami Template

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelboe; Rotaru, Alexandru; Arian, Dumitru

    2010-01-01

    DNA origami, the folding of a long single-stranded DNA sequence (scaffold strand) by hundreds of short synthetic oligonucleotides (staple strands) into parallel aligned helices, is a highly efficient method to form advanced self-assembled DNA-architectures. Since molecules and various materials can...... be conjugated to each of the short staple strands, the origami method offers a unique possibility of arranging molecules and materials in well-defined positions on a structured surface. Here we combine the action of light with AFM and DNA nanostructures to study the production of singlet oxygen from a single...... photosensitizer molecule conjugated to a selected DNA origami staple strand on an origami structure. We demonstrate a distance-dependent oxidation of organic moieties incorporated in specific positions on DNA origami by singlet oxygen produced from a single photosensitizer located at the center of each origami....

  4. Single DNA molecules as probes for interrogating silica surfaces after various chemical treatments

    International Nuclear Information System (INIS)

    Liu Xia; Wu Zhan; Nie Huagui; Liu Ziling; He Yan; Yeung, E.S.

    2007-01-01

    We examined the adsorption of single YOYO-1-labeled λ-DNA molecules at glass surfaces after treatment with various chemical cleaning methods by using total internal reflection fluorescence microscopy (TIRFM). The characteristics of these surfaces were further assessed using contact angle (CA) measurements and atomic force microscopy (AFM). By recording the real-time dynamic motion of DNA molecules at the liquid/solid interface, subtle differences in adsorption affinities were revealed. The results indicate that the driving force for adsorption of DNA molecules on glass surfaces is mainly hydrophobic interaction. We also found that surface topography plays a role in the adsorption dynamics

  5. How to determine local stretching and tension in a flow-stretched DNA molecule

    DEFF Research Database (Denmark)

    Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders

    2016-01-01

    We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....

  6. The Smc5/6 complex regulates the yeast Mph1 helicase at RNA-DNA hybrid-mediated DNA damage

    DEFF Research Database (Denmark)

    Lafuente-Barquero, Juan; Luke-Glaser, Sarah; Graf, Marco

    2017-01-01

    of Fanconi anemia protein M (FANCM), is required for cell viability in the absence of RNase H enzymes. The integrity of the Mph1 helicase domain is crucial to prevent the accumulation of RNA-DNA hybrids and RNA-DNA hybrid-dependent DNA damage, as determined by Rad52 foci. Mph1 forms foci when RNA-DNA hybrids...

  7. Double positive effect of adding hexaethyelene glycol when optimizing the hybridization efficiency of a microring DNA detection assay

    Energy Technology Data Exchange (ETDEWEB)

    Van Eeghem, Anabelle, E-mail: anabelle.vaneeghem@gmail.com [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Center for Nano- and Biophotonics, Ghent University (Belgium); Werquin, Sam [Center for Nano- and Biophotonics, Ghent University (Belgium); Photonics Research Group, Department of Information Technology, Ghent University – IMEC (Belgium); Hoste, Jan-Willem, E-mail: janwillem.hoste@ugent.be [Center for Nano- and Biophotonics, Ghent University (Belgium); Photonics Research Group, Department of Information Technology, Ghent University – IMEC (Belgium); Goes, Arne [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Agrosavfe NV, Technologiepark 4 (Bio-incubator), Zwijnaarde (Belgium); Vanderleyden, Els [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Center for Nano- and Biophotonics, Ghent University (Belgium); Bienstman, Peter [Center for Nano- and Biophotonics, Ghent University (Belgium); Photonics Research Group, Department of Information Technology, Ghent University – IMEC (Belgium); Dubruel, Peter [Polymer Chemistry and Biomaterials Research Group, Department of Organic and Macromolecular Chemistry, Ghent University (Belgium); Center for Nano- and Biophotonics, Ghent University (Belgium)

    2017-05-31

    Highlights: • The hybridization efficiency of a DNA assay was investigated based on SOI microring resonators. • A 4-fold increase in efficiency was obtained by using HEG as backfilling agent, as well as improving robustness. • The dual polarization microring technique shows that HEG reorients the DNA in an upright position. • Hybridizing at 35 °C and with a buffer containing 50 v/v% of formamide greatly improves the robustness. - Abstract: In this paper, a method for detection of DNA molecules using silicon-on-insulator (SOI) microring resonators is described. The influence of temperature and the use of formamide on the hybridization efficiency were studied. It was shown that 50 v/v% of formamide in the hybridization buffer can ensure hybridization when working close to physiological temperature. Furthermore, the use of hexaethylene glycol (HEG) as backfilling agent was studied in order to resolve issues of non-specific adsorption to the surface. The results indicated that not only non-specific binding was reduced significantly but also that HEG improves the orientation of the DNA probes on the surface. This led to a 4-fold increase in hybridization efficiency and thus in an equal decrease in the detection limit, compared to hybridization without the use of HEG. An improvement in robustness of the assay was also observed. This DNA reorientation hypothesis was confirmed by studying the thickness and density of the layers by using dual polarization microring sensing. Finally, the different steps in the sensing experiment were characterized in more detail by static contact angle (SCA) and X-ray photoelectron spectroscopy (XPS) analysis. The results showed quantitatively that the surface modifications were successful.

  8. Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

    Science.gov (United States)

    Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

    DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

  9. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  10. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

    Science.gov (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

    2016-03-24

    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

    Science.gov (United States)

    Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

    2018-03-01

    CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of . Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

  12. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer; Vovusha, Hakkim; Kaewmaraya, Thanayut; Amornkitbamrung, Vittaya; Ahuja, Rajeev

    2017-01-01

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory

  13. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  14. Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

    Science.gov (United States)

    Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

    2003-01-01

    Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

  15. Label-free detection of DNA hybridization and single point mutations in a nano-gap biosensor

    International Nuclear Information System (INIS)

    Zaffino, R L; Mir, M; Samitier, J

    2014-01-01

    We describe a conductance-based biosensor that exploits DNA-mediated long-range electron transport for the label-free and direct electrical detection of DNA hybridization. This biosensor platform comprises an array of vertical nano-gap biosensors made of gold and fabricated through standard photolithography combined with focused ion beam lithography. The nano-gap walls are covalently modified with short, anti-symmetric thiolated DNA probes, which are terminated by 19 bases complementary to both the ends of a target DNA strand. The nano-gaps are separated by a distance of 50nm, which was adjusted to fit the length of the DNA target plus the DNA probes. The hybridization of the target DNA closes the gap circuit in a switch on/off fashion, in such a way that it is readily detected by an increase in the current after nano-gap closure. The nano-biosensor shows high specificity in the discrimination of base-pair mismatching and does not require signal indicators or enhancing molecules. The design of the biosensor platform is applicable for multiplexed detection in a straightforward manner. The platform is well-suited to mass production, point-of-care diagnostics, and wide-scale DNA analysis applications. (paper)

  16. DNA-Based Single-Molecule Electronics: From Concept to Function.

    Science.gov (United States)

    Wang, Kun

    2018-01-17

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

  17. DNA-Based Single-Molecule Electronics: From Concept to Function

    Science.gov (United States)

    2018-01-01

    Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

  18. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA moleculeDNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  19. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    International Nuclear Information System (INIS)

    Dallas, J.F.

    1988-01-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  20. Development of Cholinesterase Inhibitors Using (a)-Lipoic Acid-benzyl Piperazine Hybrid Molecules

    International Nuclear Information System (INIS)

    Kim, Beomcheol; Lee, Seunghwan; Jang, Mi; Shon, Min Young; Park, Jeong Ho

    2013-01-01

    A series of hybrid molecules between (α)-lipoic acid (ALA) and benzyl piperazines were synthesized and their in vitro cholinesterase [acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE)] inhibitory activities were evaluated. Even though the parent compounds did not show any inhibitory activity against cholinesterase (ChE), all hybrid molecules showed BuChE inhibitory activity. Some hybrid compounds also displayed AChE inhibitory activity. Specifically, ALA-1-(3-methylbenzyl)piperazine (15) was shown to be an effective inhibitor of both BuChE (IC 50 = 2.3 ± 0.7 μM) and AChE (IC 50 = 30.31 ± 0.64 μM). An inhibition kinetic study using compound 15 indicated a mixed inhibition type. Its binding affinity (K i ) value to BuChE is 2.91 ± 0.15 μM

  1. Development of Cholinesterase Inhibitors Using (a)-Lipoic Acid-benzyl Piperazine Hybrid Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Beomcheol; Lee, Seunghwan; Jang, Mi; Shon, Min Young; Park, Jeong Ho [Hanbat National Univ., Daejeon (Korea, Republic of)

    2013-11-15

    A series of hybrid molecules between (α)-lipoic acid (ALA) and benzyl piperazines were synthesized and their in vitro cholinesterase [acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE)] inhibitory activities were evaluated. Even though the parent compounds did not show any inhibitory activity against cholinesterase (ChE), all hybrid molecules showed BuChE inhibitory activity. Some hybrid compounds also displayed AChE inhibitory activity. Specifically, ALA-1-(3-methylbenzyl)piperazine (15) was shown to be an effective inhibitor of both BuChE (IC{sub 50} = 2.3 ± 0.7 μM) and AChE (IC{sub 50} = 30.31 ± 0.64 μM). An inhibition kinetic study using compound 15 indicated a mixed inhibition type. Its binding affinity (K{sub i}) value to BuChE is 2.91 ± 0.15 μM.

  2. Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

    Science.gov (United States)

    Zhang, Yuning; Reisner, Walter

    2013-03-01

    Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

  3. Single-molecule analysis of DNA replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Yardimci, Hasan; Loveland, Anna B.; van Oijen, Antoine M.; Walter, Johannes C.; Mechali, Marcel

    The recent advent in single-molecule imaging and manipulation methods has made a significant impact on the understanding of molecular mechanisms underlying many essential cellular processes. Single-molecule techniques such as electron microscopy and DNA fiber assays have been employed to study the

  4. Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

    Science.gov (United States)

    Izanloo, Cobra

    2017-09-02

    An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

  5. Effect of caffeine on the parameters of the motive and gamma-irradiated DNA molecules

    International Nuclear Information System (INIS)

    Osipov, N.D.; Kondrat'eva, O.P.; Erisman, Eh.V.

    1979-01-01

    The binding of caffeine with DNA and its pole as a DNA molecule protector against radiational damage have been studied. It is shown that with the ratio of DNA and caffeine concentrations used no complex formation occurs. The irradiation of the DNA solution by 1 krad dose of γ-rays causes only a few single-strand breaks which leads to the decrease in the volume macromolecules without changing its thermodynamic ligidity. The presence of caffeine in the DNA solution before its irradiation decreases considerably the extent of radiational damage

  6. Probing Electron-Induced Bond Cleavage at the Single-Molecule Level Using DNA Origami Templates

    DEFF Research Database (Denmark)

    Keller, Adrian Clemens; Bald, Ilko; Rotaru, Alexandru

    2012-01-01

    Low-energy electrons (LEEs) play an important role in nanolithography, atmospheric chemistry, and DNA radiation damage. Previously, the cleavage of specific chemical bonds triggered by LEEs has been demonstrated in a variety of small organic molecules such as halogenated benzenes and DNA nucleoba...

  7. Tertiary Structures of the Escherichia coli and Human Chromosome 21 Molecules of DNA

    Czech Academy of Sciences Publication Activity Database

    Hanzálek, Petr; Kypr, Jaroslav

    2001-01-01

    Roč. 283, č. 1 (2001), s. 219-223 ISSN 0006-291X R&D Projects: GA AV ČR IAA5004802 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA crystal structures * phosphorus atom representation * genomic DNA molecules Subject RIV: BO - Biophysics Impact factor: 2.946, year: 2001

  8. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  9. Real-time single-molecule observation of rolling-circle DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Loparo, Joseph J.; Hamdan, Samir M.; Jergic, Slobodan; Dixon, Nicholas E.; Oijen, Antoine M. van

    2009-01-01

    We present a simple technique for visualizing replication of individual DNA molecules in real time. By attaching a rolling-circle substrate to a TIRF microscope-mounted flow chamber, we are able to monitor the progression of single-DNA synthesis events and accurately measure rates and processivities

  10. Probing the Conformational Landscape of DNA Polymerases Using Diffusion-Based Single-Molecule FRET

    NARCIS (Netherlands)

    Hohlbein, J.; Kapanidis, A.N.

    2016-01-01

    Monitoring conformational changes in DNA polymerases using single-molecule Förster resonance energy transfer (smFRET) has provided new tools for studying fidelity-related mechanisms that promote the rejection of incorrect nucleotides before DNA synthesis. In addition to the previously known open

  11. See me, feel me: methods to concurrently visualize and manipulate single DNA molecules and associated proteins

    NARCIS (Netherlands)

    van Mameren, J.; Peterman, E.J.G.; Wuite, G.J.L.

    2008-01-01

    Direct visualization of DNA and proteins allows researchers to investigate DNA-protein interactions with great detail. Much progress has been made in this area as a result of increasingly sensitive single-molecule fluorescence techniques. At the same time, methods that control the conformation of

  12. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    Science.gov (United States)

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  13. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  14. Thermal stability of DNA quadruplex-duplex hybrids.

    Science.gov (United States)

    Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân

    2014-01-14

    DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.

  15. Systematic spatial bias in DNA microarray hybridization is caused by probe spot position-dependent variability in lateral diffusion.

    Science.gov (United States)

    Steger, Doris; Berry, David; Haider, Susanne; Horn, Matthias; Wagner, Michael; Stocker, Roman; Loy, Alexander

    2011-01-01

    The hybridization of nucleic acid targets with surface-immobilized probes is a widely used assay for the parallel detection of multiple targets in medical and biological research. Despite its widespread application, DNA microarray technology still suffers from several biases and lack of reproducibility, stemming in part from an incomplete understanding of the processes governing surface hybridization. In particular, non-random spatial variations within individual microarray hybridizations are often observed, but the mechanisms underpinning this positional bias remain incompletely explained. This study identifies and rationalizes a systematic spatial bias in the intensity of surface hybridization, characterized by markedly increased signal intensity of spots located at the boundaries of the spotted areas of the microarray slide. Combining observations from a simplified single-probe block array format with predictions from a mathematical model, the mechanism responsible for this bias is found to be a position-dependent variation in lateral diffusion of target molecules. Numerical simulations reveal a strong influence of microarray well geometry on the spatial bias. Reciprocal adjustment of the size of the microarray hybridization chamber to the area of surface-bound probes is a simple and effective measure to minimize or eliminate the diffusion-based bias, resulting in increased uniformity and accuracy of quantitative DNA microarray hybridization.

  16. Biophysics of DNA-Protein Interactions From Single Molecules to Biological Systems

    CERN Document Server

    Williams, Mark C

    2011-01-01

    This book presents a concise overview of current research on the biophysics of DNA-protein interactions. A wide range of new and classical methods are presented by authors investigating physical mechanisms by which proteins interact with DNA. For example, several chapters address the mechanisms by which proteins search for and recognize specific binding sites on DNA, a process critical for cellular function. Single molecule methods such as force spectroscopy as well as fluorescence imaging and tracking are described in these chapters as well as other parts of the book that address the dynamics of protein-DNA interactions. Other important topics include the mechanisms by which proteins engage DNA sequences and/or alter DNA structure. These simple but important model interactions are then placed in the broader biological context with discussion of larger protein-DNA complexes . Topics include replication forks, recombination complexes, DNA repair interactions, and ultimately, methods to understand the chromatin...

  17. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Science.gov (United States)

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Separation and Characterization of DNA Molecules and Intermolecular Interactions in Pressure-Driven Micro Flow

    Science.gov (United States)

    Friedrich, Sarah; Wang, Tza-Huei

    Pressure-driven flow in micron-sized diameter capillaries can be used to separate DNA molecules by size in a technique called Free Solution Hydrodynamic Separation. By coupling this technique with Cylindrical Illumination Confocal Spectroscopy, we have developed a highly sensitive and quantitative platform capable of separating DNA molecules by length over a large dynamic range (25 bp to 48 kbp) in a single run using only picoliters or femtograms of a DNA sample. The optical detection volume completely spans the capillary cross section, enabling highly efficient single molecule detection for enhanced sensitivity and quantification accuracy via single molecule counting. Because each DNA molecule generates its own fluorescent burst, these burst profiles can be further analyzed to individually characterize each DNA molecule's shape as it passes through the detection region. We exploit these burst profiles to visualize fluctuations in conformation under shear flow in microcapillaries, and utilizing combined mobility shift analysis, explore the complex relationship between molecular properties including length and conformation, hydrodynamic mobility, solution conditions including ion species and concentrations, and separation conditions including flow rate and capillary diameter.

  19. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  20. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  1. Radioprotection of DNA molecule by oxido-reduction's coenzymes

    International Nuclear Information System (INIS)

    Araos, M.S.; Fernandez, M.; Tomicic, I.; Toha, J.C.

    1978-01-01

    The radio protective action of respiratory coenzymes on DNA-water solutions is studied after irradiation with a 60 Co source. Coenzymes were used separately or in mixtures of their oxidized and reduced forms. The dose relative factor (DRF) values evaluated by uv absorbancy measurements of DNA damage were high: 18.03 for the (NAD-FAD-quinone) mixture (a respiratory chain model); 14.91 for (quinone-hydroquinone) mixtures; 14.46 for quinone; 14.27 for hydroquinone; 12.49 for FAD; 7.21 for the (NAD-NADH) mixture; 6.48 for NADH and 3.79 for NAD. No parallelism was found between the DNA coenzymes strong interactions and their protective action, performed by overcoming the indirect radiation damage. Besides, uv irradiation studies give no support to protection through direct energy transfer processes from excited DNA to coenzymes. The high efficiency of the mixtures of oxidized-reduced respiratory coenzymes is discussed in terms of simultaneous and equivalent trapping of recombinable radicals. The high tolerance of these protectors in living cells is emphasized. (author)

  2. Morse potential in DNA molecule – An experiment proposal

    Indian Academy of Sciences (India)

    2012-07-27

    Jul 27, 2012 ... We rely on the helicoidal Peyrard-Bishop model for DNA dynamics. Interaction between nucleotides at a same site belonging to different strands is modelled by a Morse potential energy. This potential depends on two parameters that are different for AT and CG pairs, which is a possible source for ...

  3. Conformational Selection and Induced Fit for RNA Polymerase and RNA/DNA Hybrid Backtracked Recognition

    Directory of Open Access Journals (Sweden)

    Haifeng eChen

    2015-11-01

    Full Text Available RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15 and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS P test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein.

  4. Conjugation of Organic Molecules to DNA and Their Application in DNA Nanotechnology

    DEFF Research Database (Denmark)

    Olsen, Eva Maria

    2012-01-01

    Denne PhD afhandling præsenterer fire kapitler, som omhandler det videnskabelige område DNA nanoteknologi. Kapitel 1 er en general introduktion til DNA nanoteknologi, som først beskriver opbygningen af DNA og efter flere underkapitler slutter med en gennemgang af nogle fantastiske dynamiske DNA s...

  5. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

    Science.gov (United States)

    Stigter, Dirk

    2004-07-01

    Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

  6. Direct squencing from the minimal number of DNA molecules needed to fill a 454 picotiterplate.

    Directory of Open Access Journals (Sweden)

    Mária Džunková

    Full Text Available The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA, mostly by multiple displacement amplification (MDA based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS, which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli fs 24 from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA.

  7. Probing the role of interfacial waters in protein-DNA recognition using a hybrid implicit/explicit solvation model

    Science.gov (United States)

    Li, Shen; Bradley, Philip

    2013-01-01

    When proteins bind to their DNA target sites, ordered water molecules are often present at the protein-DNA interface bridging protein and DNA through hydrogen bonds. What is the role of these ordered interfacial waters? Are they important determinants of the specificity of DNA sequence recognition, or do they act in binding in a primarily non-specific manner, by improving packing of the interface, shielding unfavorable electrostatic interactions, and solvating unsatisfied polar groups that are inaccessible to bulk solvent? When modeling details of structure and binding preferences, can fully implicit solvent models be fruitfully applied to protein-DNA interfaces, or must the individualistic properties of these interfacial waters be accounted for? To address these questions, we have developed a hybrid implicit/explicit solvation model that specifically accounts for the locations and orientations of small numbers of DNA-bound water molecules while treating the majority of the solvent implicitly. Comparing the performance of this model to its fully implicit counterpart, we find that explicit treatment of interfacial waters results in a modest but significant improvement in protein sidechain placement and DNA sequence recovery. Base-by-base comparison of the performance of the two models highlights DNA sequence positions whose recognition may be dependent on interfacial water. Our study offers large-scale statistical evidence for the role of ordered water for protein DNA recognition, together with detailed examination of several well-characterized systems. In addition, our approach provides a template for modeling explicit water molecules at interfaces that should be extensible to other systems. PMID:23444044

  8. Simple surface modification of poly(dimethylsiloxane) for DNA hybridization

    Science.gov (United States)

    Zhou, Jinwen; Voelcker, Nicolas H.; Ellis, Amanda V.

    2010-01-01

    Here, we present a simple chemical modification of poly(dimethylsiloxane) (PDMS) by curing a mixture of 2 wt% undecylenic acid (UDA) in PDMS prepolymer on a gold-coated glass slide. This gold slide had been previously pretreated with a self-assembled hydrophilic monolayer of 3-mercaptopropionic acid (MPA). During curing of the UDA∕PDMS prepolymer, the hydrophilic UDA carboxyl moieties diffuses toward the hydrophilic MPA carboxyl moieties on the gold surface. This diffusion of the UDA within the PDMS prepolymer to the surface is a direct result of surface energy minimization. Once completely cured, the PDMS is peeled off the gold substrate, thereby exposing the interfacial carboxyl groups. These groups are then available for subsequent attachment of 5′-amino terminated DNA oligonucleotides via amide linkages. Our results show that the covalently tethered oligonucleotides can successfully capture fluorescein-labeled complementary oligonucleotides via hybridization, which are visualized using fluorescence microscopy. PMID:21264061

  9. Droplet Microfluidics Approach for Single-DNA Molecule Amplification and Condensation into DNA-Magnesium-Pyrophosphate Particles

    Directory of Open Access Journals (Sweden)

    Greta Zubaite

    2017-02-01

    Full Text Available Protein expression in vitro has broad applications in directed evolution, synthetic biology, proteomics and drug screening. However, most of the in vitro expression systems rely on relatively high DNA template concentrations to obtain sufficient amounts of proteins, making it harder to perform in vitro screens on gene libraries. Here, we report a technique for the generation of condensed DNA particles that can serve as efficient templates for in vitro gene expression. We apply droplet microfluidics to encapsulate single-DNA molecules in 3-picoliter (pL volume droplets and convert them into 1 μm-sized DNA particles by the multiple displacement amplification reaction driven by phi29 DNA polymerase. In the presence of magnesium ions and inorganic pyrophosphate, the amplified DNA condensed into the crystalline-like particles, making it possible to purify them from the reaction mix by simple centrifugation. Using purified DNA particles, we performed an in vitro transcription-translation reaction and successfully expressed complex enzyme β-galactosidase in droplets and in the 384-well format. The yield of protein obtained from DNA particles was significantly higher than from the corresponding amount of free DNA templates, thus opening new possibilities for high throughput screening applications.

  10. The strategies of DNA immobilization and hybridization detection mechanism in the construction of electrochemical DNA sensor: A review

    Directory of Open Access Journals (Sweden)

    Jahwarhar Izuan Abdul Rashid

    2017-11-01

    Full Text Available In recent years, electrochemical deoxyribonucleic acid (DNA sensor has recently emerged as promising alternative clinical diagnostic devices especially for infectious disease by exploiting DNA recognition events and converting them into an electrochemical signal. This is because the existing DNA diagnostic method possesses certain drawbacks such as time-consuming, expensive, laborious, low selectivity and sensitivity. DNA immobilization strategies and mechanism of electrochemical detection are two the most important aspects that should be considered before developing highly selective and sensitive electrochemical DNA sensor. Here, we focus on some recent strategies for DNA probes immobilization on the surface of electrochemical transducer such as adsorption, covalent bonding and Avidin/Streptavidin-Biotin interaction on the electrode surface for specific interaction with its complementary DNA target. A numerous approach for DNA hybridization detection based electrochemical technique that frequently used including direct DNA electrochemical detection and label based electrochemical (redox-active indicator, enzyme label and nanoparticles were also discussed in aiming to provide general guide for the design of electrochemical DNA sensor. We also discussed the challenges and suggestions to improve the application of electrochemical DNA sensor at point-care setting. Keywords: Electrochemical DNA sensor, DNA immobilization, DNA hybridization, Electrochemical mechanism

  11. File list: Oth.NoD.50.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.NoD.50.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids No descri...ption http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.NoD.50.DNA-RNA_hybrids.AllCell.bed ...

  12. File list: Oth.NoD.20.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.NoD.20.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids No descri...ption http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.NoD.20.DNA-RNA_hybrids.AllCell.bed ...

  13. File list: Oth.NoD.10.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.NoD.10.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids No descri...ption http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.NoD.10.DNA-RNA_hybrids.AllCell.bed ...

  14. File list: Oth.NoD.05.DNA-RNA_hybrids.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Oth.NoD.05.DNA-RNA_hybrids.AllCell sacCer3 TFs and others DNA-RNA hybrids No descri...ption http://dbarchive.biosciencedbc.jp/kyushu-u/sacCer3/assembled/Oth.NoD.05.DNA-RNA_hybrids.AllCell.bed ...

  15. Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

    Science.gov (United States)

    Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

    2017-08-04

    Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

    Science.gov (United States)

    Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

    2012-02-01

    We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

  17. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    OpenAIRE

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double?stranded breaks, which are processed to yield single?stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single?molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA?ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 b...

  18. [The effect of spermine on acid-base equilibrium in DNA molecule].

    Science.gov (United States)

    Slonitskiĭ, S V; Kuptsov, V Iu

    1990-01-01

    The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

  19. Tuning the hybridization bandgap by meta-molecules with in-unit interaction

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Yongqiang; Li, Yunhui, E-mail: liyunhui@tongji.edu.cn; Wu, Qian; Jiang, Haitao; Zhang, Yewen; Chen, Hong [Key Laboratory of Advanced Micro-Structured Materials, Ministry of Education, School of Physics Science and Engineering, Tongji University, Shanghai 200092 (China)

    2015-09-07

    In this paper, we demonstrate that the hybridization bandgap (HBG) can be tuned conveniently by deep subwavelength meta-molecules with in-unit interaction. Spontaneous-emission-cancellation-like (SEC-like) effect is realized in a meta-molecule by introducing the destructive interference of two detuned meta-atoms. The meta-atoms consisting of subwavelength zero-index-metamaterial-based resonators are side-coupled to a microstrip. Compared to conventional HBG configurations, the presence of in-unit interaction between meta-atoms provides more flexibility in tuning the bandgap properties, keeping the device volume almost unchanged. Both numerical simulations and microwave experiments confirm that the width, depth, and spectrum shape of HBG can be tuned by simply introducing SEC-like interaction into the meta-molecule. Due to these features, our design may be promising to be applied in microwave or optics communications systems with strict limitation of device volume and flexible bandgap properties.

  20. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparisons with Other Methods

    International Nuclear Information System (INIS)

    Wu, Liyou; Yi, T.Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-01-01

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site (Hanford Reach of the Columbia River (HRCR), 11 strains), Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  1. Phylogenetic Analysis of Shewanella Strains by DNA Relatedness Derived from Whole Genome Microarray DNA-DNA Hybridization and Comparison with Other Methods

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy; Zhou, Jizhong

    2010-05-17

    Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the average nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.

  2. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  3. Functionalized Self-Assembled InAs/GaAs Quantum-Dot Structures Hybridized with Organic Molecules

    DEFF Research Database (Denmark)

    Chen, Miaoxiang Max; Kobashi, K.; Chen, B.

    2010-01-01

    Low-dimensional III-V semiconductors have many advantages over other semiconductors; however, they are not particularly stable under physiological conditions. Hybridizing biocompatible organic molecules with advanced optical and electronic semiconductor devices based on quantum dots (QDs...

  4. In Vitro Selection and Characterization of DNA Aptamers to a Small Molecule Target.

    Science.gov (United States)

    Ruscito, Annamaria; McConnell, Erin M; Koudrina, Anna; Velu, Ranganathan; Mattice, Christopher; Hunt, Vernon; McKeague, Maureen; DeRosa, Maria C

    2017-12-14

    Aptamers, synthetic oligonucleotide-based molecular recognition probes, have found use in a wide array of biosensing technologies based on their tight and highly selective binding to a variety of molecular targets. However, the inherent challenges associated with the selection and characterization of aptamers for small molecule targets have resulted in their underrepresentation, despite the need for small molecule detection in fields such as medicine, the environment, and agriculture. This protocol describes the steps in the selection, sequencing, affinity characterization, and truncation of DNA aptamers that are specific for small molecule targets. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  5. Repair of human DNA in molecules that replicate or remain unreplicated following ultraviolet irradiation

    International Nuclear Information System (INIS)

    Waters, R.

    1980-01-01

    The extent of DNA replication, the incidence of uv induced pyrimidine dimers and the repair replication observed after their excision was monitored in human fibroblasts uv irradiated with single or split uv doses. The excision repair processes were measured in molecules that remained unreplicated or in those that replicated after the latter uv irradiation. Less DNA replication was observed after a split as opposed to single uv irradiation. Furthermore, a split dose did not modify the excision parameters measured after a single irradiation, regardless of whether the DNA had replicated or not

  6. Adaptive resolution simulation of an atomistic DNA molecule in MARTINI salt solution

    NARCIS (Netherlands)

    Zavadlav, J.; Podgornik, R.; Melo, M.n.; Marrink, S.j.; Praprotnik, M.

    2016-01-01

    We present a dual-resolution model of a deoxyribonucleic acid (DNA) molecule in a bathing solution, where we concurrently couple atomistic bundled water and ions with the coarse-grained MAR- TINI model of the solvent. We use our fine-grained salt solution model as a solvent in the inner shell

  7. Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

    Science.gov (United States)

    Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

    2003-01-01

    We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

  8. Detection of DNA hybridization using graphene-coated black phosphorus surface plasmon resonance sensor

    Science.gov (United States)

    Pal, Sarika; Verma, Alka; Raikwar, S.; Prajapati, Y. K.; Saini, J. P.

    2018-05-01

    In this paper, graphene-coated black phosphorus at the metal surface for the detection of DNA hybridization event is numerically demonstrated. The strategy consists of placing the sensing medium on top of black phosphorus-graphene-coated SPR which interfaces with phosphate-buffered saline solution carrying single-stranded DNA. Upon hybridization with its complementary DNA, desorption of the nanostructures takes place and thus enables the sensitive detection of the DNA hybridization event. The proposed sensor exhibits a sensitivity (125 ο/RIU), detection accuracy (0.95) and quality factor (13.62 RIU-1) for complementary DNA. In comparison with other reported papers, our suggested sensor provides much better performance. Thus, this label-free DNA detection platform should spur off new interest towards the use of black phosphorus-graphene-coated SPR interfaces.

  9. Chromosomal Localization of DNA Amplifications in Neuroblastoma Tumors Using cDNA Microarray Comparative Genomic Hybridization

    Directory of Open Access Journals (Sweden)

    Ben Beheshti

    2003-01-01

    Full Text Available Conventional comparative genomic hybridization (CGH profiling of neuroblastomas has identified many genomic aberrations, although the limited resolution has precluded a precise localization of sequences of interest within amplicons. To map high copy number genomic gains in clinically matched stage IV neuroblastomas, CGH analysis using a 19,200-feature cDNA microarray was used. A dedicated (freely available algorithm was developed for rapid in silico determination of chromosomal localizations of microarray cDNA targets, and for generation of an ideogram-type profile of copy number changes. Using these methodologies, novel gene amplifications undetectable by chromosome CGH were identified, and larger MYCN amplicon sizes (in one tumor up to 6 Mb than those previously reported in neuroblastoma were identified. The genes HPCAL1, LPIN1/KIAA0188, NAG, and NSE1/LOC151354 were found to be coamplified with MYCN. To determine whether stage IV primary tumors could be further subclassified based on their genomic copy number profiles, hierarchical clustering was performed. Cluster analysis of microarray CGH data identified three groups: 1 no amplifications evident, 2 a small MYCN amplicon as the only detectable imbalance, and 3 a large MYCN amplicon with additional gene amplifications. Application of CGH to cDNA microarray targets will help to determine both the variation of amplicon size and help better define amplification-dependent and independent pathways of progression in neuroblastoma.

  10. Adsorption Characteristics of DNA Nucleobases, Aromatic Amino Acids and Heterocyclic Molecules on Silicene and Germanene Monolayers

    KAUST Repository

    Hussain, Tanveer

    2017-09-14

    Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.

  11. A DNA origami nanorobot controlled by nucleic acid hybridization

    KAUST Repository

    Torelli, Emanuela

    2014-03-20

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. A DNA origami nanorobot controlled by nucleic acid hybridization.

    Science.gov (United States)

    Torelli, Emanuela; Marini, Monica; Palmano, Sabrina; Piantanida, Luca; Polano, Cesare; Scarpellini, Alice; Lazzarino, Marco; Firrao, Giuseppe

    2014-07-23

    A prototype for a DNA origami nanorobot is designed, produced, and tested. The cylindrical nanorobot (diameter of 14 nm and length of 48 nm) with a switchable flap, is able to respond to an external stimulus and reacts by a physical switch from a disarmed to an armed configuration able to deliver a cellular compatible message. In the tested design the robot weapon is a nucleic acid fully contained in the inner of the tube and linked to a single point of the internal face of the flap. Upon actuation the nanorobot moves the flap extracting the nucleic acid that assembles into a hemin/G-quadruplex horseradish peroxidase mimicking DNAzyme catalyzing a colorimetric reaction or chemiluminescence generation. The actuation switch is triggered by an external nucleic acid (target) that interacts with a complementary nucleic acid that is beard externally by the nanorobot (probe). Hybridization of probe and target produces a localized structural change that results in flap opening. The flap movement is studied on a two-dimensional prototype origami using Förster resonance energy transfer and is shown to be triggered by a variety of targets, including natural RNAs. The nanorobot has potential for in vivo biosensing and intelligent delivery of biological activators. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  14. Antibacterial small molecules targeting the conserved TOPRIM domain of DNA gyrase.

    Directory of Open Access Journals (Sweden)

    Scott S Walker

    Full Text Available To combat the threat of antibiotic-resistant Gram-negative bacteria, novel agents that circumvent established resistance mechanisms are urgently needed. Our approach was to focus first on identifying bioactive small molecules followed by chemical lead prioritization and target identification. Within this annotated library of bioactives, we identified a small molecule with activity against efflux-deficient Escherichia coli and other sensitized Gram-negatives. Further studies suggested that this compound inhibited DNA replication and selection for resistance identified mutations in a subunit of E. coli DNA gyrase, a type II topoisomerase. Our initial compound demonstrated weak inhibition of DNA gyrase activity while optimized compounds demonstrated significantly improved inhibition of E. coli and Pseudomonas aeruginosa DNA gyrase and caused cleaved complex stabilization, a hallmark of certain bactericidal DNA gyrase inhibitors. Amino acid substitutions conferring resistance to this new class of DNA gyrase inhibitors reside exclusively in the TOPRIM domain of GyrB and are not associated with resistance to the fluoroquinolones, suggesting a novel binding site for a gyrase inhibitor.

  15. Atomistic details of the molecular recognition of DNA-RNA hybrid ...

    Indian Academy of Sciences (India)

    conformations corresponding to typical A- and B-type nucleic acids and the .... protein chains and five base pairs in DNA-RNA hybrid ... employed to treat the long range electrostatic interac- .... The solvent accessible surface areas (SASA) of.

  16. Production of solar chemicals: gaining selectivity with hybrid molecule/semiconductor assemblies.

    Science.gov (United States)

    Hennessey, Seán; Farràs, Pau

    2018-05-29

    Research on the production of solar fuels and chemicals has rocketed over the past decade, with a wide variety of systems proposed to harvest solar energy and drive chemical reactions. In this Feature Article we have focused on hybrid molecule/semiconductor assemblies in both powder and supported materials, summarising recent systems and highlighting the enormous possibilities offered by such assemblies to carry out highly demanding chemical reactions with industrial impact. Of relevance is the higher selectivity obtained in visible light-driven organic transformations when using molecular catalysts compared to photocatalytic materials.

  17. Nanotubule and Tour Molecule Based Molecular Electronics: Suggestion for a Hybrid Approach

    Science.gov (United States)

    Srivastava, Deepak; Saini, Subhash (Technical Monitor)

    1998-01-01

    Recent experimental and theoretical attempts and results indicate two distinct broad pathways towards future molecular electronic devices and architectures. The first is the approach via Tour type ladder molecules and their junctions which can be fabricated with solution phase chemical approaches. Second are fullerenes or nanotubules and their junctions which may have better conductance, switching and amplifying characteristics but can not be made through well controlled and defined chemical means. A hybrid approach combining the two pathways to take advantage of the characteristics of both is suggested. Dimension and scale of such devices would be somewhere in between isolated molecule and nanotubule based devices but it maybe possible to use self-assembly towards larger functional and logicalunits.

  18. Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

    Science.gov (United States)

    Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian

    2006-01-01

    We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

  19. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  20. DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

    Science.gov (United States)

    Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

    2017-12-06

    We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

  1. Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

    Science.gov (United States)

    Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

    2013-03-01

    The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

  2. Sequencing of megabase plus DNA by hybridization: Method development ENT. Final technical progress report

    Energy Technology Data Exchange (ETDEWEB)

    Crkvenjakov, R.; Drmanac, R.

    1991-01-31

    Sequencing by hybridization (SBH) is the only sequencing method based on the experimental determination of the content of oligonucleotide sequences. The data acquisition relies on the natural process of base pairing. It is possible to determine the content of complementary oligosequences in the target DNA by the process of hybridization with oligonucleotide probes of known sequences.

  3. Digital quantification of rolling circle amplified single DNA molecules in a resistive pulse sensing nanopore.

    Science.gov (United States)

    Kühnemund, M; Nilsson, M

    2015-05-15

    Novel portable, sensitive and selective DNA sensor methods for bio-sensing applications are required that can rival conventionally used non-portable and expensive fluorescence-based sensors. In this paper, rolling circle amplification (RCA) products are detected in solution and on magnetic particles using a resistive pulse sensing (RPS) nanopore. Low amounts of DNA molecules are detected by padlock probes which are circularized in a strictly target dependent ligation reaction. The DNA-padlock probe-complex is captured on magnetic particles by sequence specific capture oligonucleotides and amplified by a short RCA. Subsequent RPS analysis is used to identify individual particles with single attached RCA products from blank particles. This proof of concept opens up for a novel non-fluorescent digital DNA quantification method that can have many applications in bio-sensing and diagnostic approaches. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Non-Covalent Fluorescent Labeling of Hairpin DNA Probe Coupled with Hybridization Chain Reaction for Sensitive DNA Detection.

    Science.gov (United States)

    Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao

    2016-04-01

    An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.

  5. Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

    Science.gov (United States)

    de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

    2018-04-06

    Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

  6. Tail-labelling of DNA probes using modified deoxynucleotide triphosphates and terminal deoxynucleotidyl tranferase. Application in electrochemical DNA hybridization and protein-DNA binding assays

    Czech Academy of Sciences Publication Activity Database

    Horáková Brázdilová, Petra; Macíčková-Cahová, Hana; Pivoňková, Hana; Špaček, Jan; Havran, Luděk; Hocek, Michal; Fojta, Miroslav

    2011-01-01

    Roč. 9, č. 5 (2011), s. 1366-1371 ISSN 1477-0520 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk(CZ) LC512; GA AV ČR(CZ) IAA400040901 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702; CEZ:AV0Z40550506 Keywords : DNA tail- labelling * protein-DNA binding * DNA hybridization Subject RIV: BO - Biophysics Impact factor: 3.696, year: 2011

  7. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    Science.gov (United States)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit

  8. An efficient enzyme-powered micromotor device fabricated by cyclic alternate hybridization assembly for DNA detection.

    Science.gov (United States)

    Fu, Shizhe; Zhang, Xueqing; Xie, Yuzhe; Wu, Jie; Ju, Huangxian

    2017-07-06

    An efficient enzyme-powered micromotor device was fabricated by assembling multiple layers of catalase on the inner surface of a poly(3,4-ethylenedioxythiophene and sodium 4-styrenesulfonate)/Au microtube (PEDOT-PSS/Au). The catalase assembly was achieved by programmed DNA hybridization, which was performed by immobilizing a designed sandwich DNA structure as the sensing unit on the PEDOT-PSS/Au, and then alternately hybridizing with two assisting DNA to bind the enzyme for efficient motor motion. The micromotor device showed unique features of good reproducibility, stability and motion performance. Under optimal conditions, it showed a speed of 420 μm s -1 in 2% H 2 O 2 and even 51 μm s -1 in 0.25% H 2 O 2 . In the presence of target DNA, the sensing unit hybridized with target DNA to release the multi-layer DNA as well as the multi-catalase, resulting in a decrease of the motion speed. By using the speed as a signal, the micromotor device could detect DNA from 10 nM to 1 μM. The proposed micromotor device along with the cyclic alternate DNA hybridization assembly technique provided a new path to fabricate efficient and versatile micromotors, which would be an exceptional tool for rapid and simple detection of biomolecules.

  9. Quantification and Sequencing of Crossover Recombinant Molecules from Arabidopsis Pollen DNA.

    Science.gov (United States)

    Choi, Kyuha; Yelina, Nataliya E; Serra, Heïdi; Henderson, Ian R

    2017-01-01

    During meiosis, homologous chromosomes undergo recombination, which can result in formation of reciprocal crossover molecules. Crossover frequency is highly variable across the genome, typically occurring in narrow hotspots, which has a significant effect on patterns of genetic diversity. Here we describe methods to measure crossover frequency in plants at the hotspot scale (bp-kb), using allele-specific PCR amplification from genomic DNA extracted from the pollen of F 1 heterozygous plants. We describe (1) titration methods that allow amplification, quantification and sequencing of single crossover molecules, (2) quantitative PCR methods to more rapidly measure crossover frequency, and (3) application of high-throughput sequencing for study of crossover distributions within hotspots. We provide detailed descriptions of key steps including pollen DNA extraction, prior identification of hotspot locations, allele-specific oligonucleotide design, and sequence analysis approaches. Together, these methods allow the rate and recombination topology of plant hotspots to be robustly measured and compared between varied genetic backgrounds and environmental conditions.

  10. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization.

    Science.gov (United States)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E; Ding, Zhong-Tao

    2015-02-25

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Multiway study of hybridization in nanoscale semiconductor labeled DNA based on fluorescence resonance energy transfer

    DEFF Research Database (Denmark)

    Gholami, Somayeh; Kompany Zare, Mohsen

    2013-01-01

    donor-QD acceptor) upon hybridization with a label free target was monitored by two-dimensional photoluminescence excitation spectroscopy (2D-PLE). Detection of a target oligonucleotide strand, using sandwiched nanoassembly in a separation-free format, was performed with the appearance of a new feature...... and model based analysis of 2D-PLE data was implemented by means of PAR-AFAC and hard trilinear decomposition (HTD), allowing to fit a proper model for FRET-based sandwich DNA hybridization systems. This study is the first successful application of a multiway chemometric technique to consider FRET based DNA...... hybridization in sandwiched nanoassemblies. A multi-equilibria model was properly fitted to the data and confirmed there is a competition between ternary and binary complex formation. Equilibrium constants of DNA hybridization in sandwiched nanoassemblies were estimated for the first time. Equilibrium constants...

  12. Surface-enhanced localized surface plasmon resonance biosensing of avian influenza DNA hybridization using subwavelength metallic nanoarrays

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Shin Ae; Jang, Sung Min; Kim, Sung June [School of Electrical Engineering and Computer Science, Seoul National University, Seoul 151-742 (Korea, Republic of); Byun, Kyung Min [Department of Biomedical Engineering, Kyung Hee University, Yongin 446-701 (Korea, Republic of); Kim, Kyujung; Kim, Donghyun [Program of Nanomedical Science and Technology, Yonsei University, Seoul 120-749 (Korea, Republic of); Ma, Kyungjae; Oh, Youngjin [School of Electrical and Electronic Engineering, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Sung Guk [College of Veterinary Medicine, Cornell University, Ithaca, New York 14853 (United States); Shuler, Michael L, E-mail: kmbyun@khu.ac.kr [Department of Biomedical Engineering, Cornell University, Ithaca, New York 14853 (United States)

    2010-09-03

    We demonstrated enhanced localized surface plasmon resonance (SPR) biosensing based on subwavelength gold nanoarrays built on a thin gold film. Arrays of nanogratings (1D) and nanoholes (2D) with a period of 200 nm were fabricated by electron-beam lithography and used for the detection of avian influenza DNA hybridization. Experimental results showed that both nanoarrays provided significant sensitivity improvement and, especially, 1D nanogratings exhibited higher SPR signal amplification compared with 2D nanohole arrays. The sensitivity enhancement is associated with changes in surface-limited reaction area and strong interactions between bound molecules and localized plasmon fields. Our approach is expected to improve both the sensitivity and sensing resolution and can be applicable to label-free detection of DNA without amplification by polymerase chain reaction.

  13. Restriction endonuclease analysis of chloroplast DNA in interspecies somatic Hybrids of Petunia.

    Science.gov (United States)

    Kumar, A; Cocking, E C; Bovenberg, W A; Kool, A J

    1982-12-01

    Restriction endonuclease cleavage pattern analysis of chloroplast DNA (cpDNA) of three different interspecific somatic hybrid plants revealed that the cytoplasms of the hybrids contained only cpDNA of P. parodii. The somatic hybrid plants analysed were those between P. parodii (wild type) + P. hybrida (wild type); P. parodii (wild type)+P. inflata (cytoplasmic albino mutant); P. parodii (wild type) + P. parviflora (nuclear albino mutant). The presence of only P. parodii chloroplasts in the somatic hybrid of P. parodii + P. inflata is possibly due to the stringent selection used for somatic hybrid production. However, in the case of the two other somatic hybrids P. parodii + P. hybrida and P. parodii + P. parviflora it was not possible to determine whether the presence of only P. parodii chloroplasts in these somatic hybrid plants was due to the nature of the selection schemes used or simply occurred by chance. The relevance of such somatic hybrid material for the study of genomic-cytoplasmic interaction is discussed, as well as the use of restriction endonuclease fragment patterns for the analysis of taxonomic and evolutionary inter-relationships in the genus Petunia.

  14. Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

    Science.gov (United States)

    Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

    2017-01-01

    A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

  15. DNA origami-based shape IDs for single-molecule nanomechanical genotyping

    Science.gov (United States)

    Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

    2017-04-01

    Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

  16. Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

    Science.gov (United States)

    Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

    2014-11-27

    In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

  17. Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

    Science.gov (United States)

    Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

    2014-01-01

    Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

  18. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  19. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    Science.gov (United States)

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  20. Applications of DNA hybrids in biobased medicine and materials

    NARCIS (Netherlands)

    Liu, Qing

    2018-01-01

    In de wetenschappelijke wereld betekent DNA veel meer dan een genetische informatiedrager. Ingenieuze geesten hebben haar structuurinformatie geopenbaard en hebben daarmee in alle opzichten unieke toepassingen gebruikt. DNA kan bijvoorbeeld worden geprogrammeerd in vooraf ontworpen vormen. Deze

  1. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

    2018-01-01

    Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

  2. Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

    Science.gov (United States)

    Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

    2018-01-10

    Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

  3. Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

    Science.gov (United States)

    Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

    2003-10-01

    Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

  4. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  5. Single-Molecule Tethered Particle Motion: Stepwise Analyses of Site-Specific DNA Recombination

    Directory of Open Access Journals (Sweden)

    Hsiu-Fang Fan

    2018-05-01

    Full Text Available Tethered particle motion/microscopy (TPM is a biophysical tool used to analyze changes in the effective length of a polymer, tethered at one end, under changing conditions. The tether length is measured indirectly by recording the Brownian motion amplitude of a bead attached to the other end. In the biological realm, DNA, whose interactions with proteins are often accompanied by apparent or real changes in length, has almost exclusively been the subject of TPM studies. TPM has been employed to study DNA bending, looping and wrapping, DNA compaction, high-order DNA–protein assembly, and protein translocation along DNA. Our TPM analyses have focused on tyrosine and serine site-specific recombinases. Their pre-chemical interactions with DNA cause reversible changes in DNA length, detectable by TPM. The chemical steps of recombination, depending on the substrate and the type of recombinase, may result in a permanent length change. Single molecule TPM time traces provide thermodynamic and kinetic information on each step of the recombination pathway. They reveal how mechanistically related recombinases may differ in their early commitment to recombination, reversibility of individual steps, and in the rate-limiting step of the reaction. They shed light on the pre-chemical roles of catalytic residues, and on the mechanisms by which accessory proteins regulate recombination directionality.

  6. Single-molecule studies of DNA transcription using atomic force microscopy

    International Nuclear Information System (INIS)

    Billingsley, Daniel J; Crampton, Neal; Thomson, Neil H; Bonass, William A; Kirkham, Jennifer

    2012-01-01

    Atomic force microscopy (AFM) can detect single biomacromolecules with a high signal-to-noise ratio on atomically flat biocompatible support surfaces, such as mica. Contrast arises from the innate forces and therefore AFM does not require imaging contrast agents, leading to sample preparation that is relatively straightforward. The ability of AFM to operate in hydrated environments, including humid air and aqueous buffers, allows structure and function of biological and biomolecular systems to be retained. These traits of the AFM are ensuring that it is being increasingly used to study deoxyribonucleic acid (DNA) structure and DNA–protein interactions down to the secondary structure level. This report focuses in particular on reviewing the applications of AFM to the study of DNA transcription in reductionist single-molecule bottom-up approaches. The technique has allowed new insights into the interactions between ribonucleic acid (RNA) polymerase to be gained and enabled quantification of some aspects of the transcription process, such as promoter location, DNA wrapping and elongation. More recently, the trend is towards studying the interactions of more than one enzyme operating on a single DNA template. These methods begin to reveal the mechanics of gene expression at the single-molecule level and will enable us to gain greater understanding of how the genome is transcribed and translated into the proteome. (topical review)

  7. Single molecule localization imaging of telomeres and centromeres using fluorescence in situ hybridization and semiconductor quantum dots.

    Science.gov (United States)

    Wang, Le; Zong, Shenfei; Wang, Zhuyuan; Lu, Ju; Chen, Chen; Zhang, Ruohu; Cui, Yiping

    2018-07-13

    Single molecule localization microscopy (SMLM) is a powerful tool for imaging biological targets at the nanoscale. In this report, we present SMLM imaging of telomeres and centromeres using fluorescence in situ hybridization (FISH). The FISH probes were fabricated by decorating CdSSe/ZnS quantum dots (QDs) with telomere or centromere complementary DNA strands. SMLM imaging experiments using commercially available peptide nucleic acid (PNA) probes labeled with organic fluorophores were also conducted to demonstrate the advantages of using QDs FISH probes. Compared with the PNA probes, the QDs probes have the following merits. First, the fluorescence blinking of QDs can be realized in aqueous solution or PBS buffer without thiol, which is a key buffer component for organic fluorophores' blinking. Second, fluorescence blinking of the QDs probe needs only one excitation light (i.e. 405 nm). While fluorescence blinking of the organic fluorophores usually requires two illumination lights, that is, the activation light (i.e. 405 nm) and the imaging light. Third, the high quantum yield, multiple switching times and a good optical stability make the QDs more suitable for long-term imaging. The localization precision achieved in telomeres and centromeres imaging experiments is about 30 nm, which is far beyond the diffraction limit. SMLM has enabled new insights into telomeres or centromeres on the molecular level, and it is even possible to determine the length of telomere and become a potential technique for telomere-related investigation.

  8. Distribution of 45S rDNA in Modern Rose Cultivars (Rosa hybrida), Rosa rugosa, and Their Interspecific Hybrids Revealed by Fluorescence in situ Hybridization.

    Science.gov (United States)

    Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang

    2016-01-01

    To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.

  9. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-05-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners and the mechanism of facilitated diffusion along the DNA. The large numbers of interacting partners makes PCNA a necessary factor to consider when studying DNA replication, either in vitro or in vivo. The mechanism of facilitated diffusion along the DNA, i.e. sliding along the duplex, reduces the six degrees of freedom of the molecule, three degrees of freedom of translation and three degrees of freedom of rotation, to only two, translation along the duplex and rotational tracking of the helix. Through this mechanism PCNA can recruit its partner proteins and localize them to the right spot on the DNA, maybe in the right spatial orientation, more effectively and in coordination with other proteins. Passive loading of the closed PCNA ring on the DNA without free ends is a topologically forbidden process. Replication factor C (RFC) uses energy of ATP hydrolysis to mechanically open the PCNA ring and load it on the dsDNA. The first half of the introduction gives overview of PCNA and RFC and the loading mechanism of PCNA on dsDNA. The second half is dedicated to a diffusion model and to an algorithm for analyzing PCNA sliding. PCNA and RFC were successfully purified, simulations and a mean squared displacement analysis algorithm were run and showed good stability and experimental PCNA sliding data was analyzed and led to parameters similar to the ones in literature.

  10. Sensitive electrochemical monitoring of nucleic acids coupling DNA nanostructures with hybridization chain reaction

    International Nuclear Information System (INIS)

    Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping

    2013-01-01

    Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling

  11. Improved efficiency in organic/inorganic hybrid solar cells by interfacial modification of ZnO nanowires with small molecules

    International Nuclear Information System (INIS)

    Chang, Sehoon; Park, Hyesung; Cheng, Jayce J; Rekemeyer, Paul H; Gradečak, Silvija

    2014-01-01

    We demonstrate improved photovoltaic performance of ZnO nanowire/poly(3-hexylthiophene) (P3HT) nanofiber hybrid devices using an interfacial modification of ZnO nanowires. Formation of cascade energy levels between the ZnO nanowire and P3HT nanofiber was achieved by interfacial modification of ZnO nanowires using small molecules tetraphenyldibenzoperiflanthene (DBP) and 3,4,9,10-perylenetetracarboxylic bisbenzimidazole (PTCBI). The successful demonstration of improved device performance owing to the cascade energy levels by small molecule modification is a promising approach toward highly efficient organic/inorganic hybrid solar cells. (paper)

  12. Photoelectronic characterization of IgG antibody molecule-quantum dot hybrid as biosensing probe

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Hye-Weon; Kim, Sung-Jo; Kim, In S [School of Environmental Science and Engineering, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea, Republic of); Lee, Jinwook; Kim, Sungyoun, E-mail: iskim@gist.ac.kr [Center for Seawater Desalination Plant, Gwangju Institute of Science and Technology (GIST), 261 Cheomdan-gwagiro, Buk-gu, Gwangju 500-712 (Korea, Republic of)

    2010-10-22

    Quantum dot (QD)-based biomolecule hybrids have recently attracted much attention in specifically identifying and labeling target proteins. In this study, QD encapsulated with immunoglobulin antibodies, as a labeling building block in biosensors, was investigated to clarify the most efficient configuration and photoluminescence behavior. Both the biological recognition capacity and photoluminescence emitting signal of the antibody-coupled nanocrystal were validated through a photoelectrical characterization procedure. Derivation of the optimum number of antibody molecules to be packed onto the QD surface yielded the highest binding capacity for the target antigen. During formation of the bioactive layer, the intrinsic photoluminescence response of the QDs significantly decreased due to photoinduced hole transfer according to their rearranged electronic structure. The thorough study of this assembly provides a validation approach for the careful titration of biosensor probes for optimal reaction kinetics. Furthermore, it contributes to the development of an effective tool for the application and interpretation of QD-based labeling techniques.

  13. Photoelectronic characterization of IgG antibody molecule-quantum dot hybrid as biosensing probe

    International Nuclear Information System (INIS)

    Yu, Hye-Weon; Kim, Sung-Jo; Kim, In S; Lee, Jinwook; Kim, Sungyoun

    2010-01-01

    Quantum dot (QD)-based biomolecule hybrids have recently attracted much attention in specifically identifying and labeling target proteins. In this study, QD encapsulated with immunoglobulin antibodies, as a labeling building block in biosensors, was investigated to clarify the most efficient configuration and photoluminescence behavior. Both the biological recognition capacity and photoluminescence emitting signal of the antibody-coupled nanocrystal were validated through a photoelectrical characterization procedure. Derivation of the optimum number of antibody molecules to be packed onto the QD surface yielded the highest binding capacity for the target antigen. During formation of the bioactive layer, the intrinsic photoluminescence response of the QDs significantly decreased due to photoinduced hole transfer according to their rearranged electronic structure. The thorough study of this assembly provides a validation approach for the careful titration of biosensor probes for optimal reaction kinetics. Furthermore, it contributes to the development of an effective tool for the application and interpretation of QD-based labeling techniques.

  14. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET

    Directory of Open Access Journals (Sweden)

    Mengyi Yang

    2018-01-01

    Full Text Available Summary: Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. : Yang et al. revealed significant conformational dynamics of Cas9 at global and local scales using single-molecule FRET. They uncovered surprising long-range allosteric communication between the HNH nuclease domain and the RNA/DNA heteroduplex at the PAM-distal end that serves as a proofreading checkpoint to govern the nuclease activity and specificity of Cas9. Keywords: CRISPR, Cas9, single-molecule, FRET, conformational dynamics, proofreading, off-target, allosteric communication, genome editing

  15. An efficient algorithm for the stochastic simulation of the hybridization of DNA to microarrays

    Directory of Open Access Journals (Sweden)

    Laurenzi Ian J

    2009-12-01

    Full Text Available Abstract Background Although oligonucleotide microarray technology is ubiquitous in genomic research, reproducibility and standardization of expression measurements still concern many researchers. Cross-hybridization between microarray probes and non-target ssDNA has been implicated as a primary factor in sensitivity and selectivity loss. Since hybridization is a chemical process, it may be modeled at a population-level using a combination of material balance equations and thermodynamics. However, the hybridization reaction network may be exceptionally large for commercial arrays, which often possess at least one reporter per transcript. Quantification of the kinetics and equilibrium of exceptionally large chemical systems of this type is numerically infeasible with customary approaches. Results In this paper, we present a robust and computationally efficient algorithm for the simulation of hybridization processes underlying microarray assays. Our method may be utilized to identify the extent to which nucleic acid targets (e.g. cDNA will cross-hybridize with probes, and by extension, characterize probe robustnessusing the information specified by MAGE-TAB. Using this algorithm, we characterize cross-hybridization in a modified commercial microarray assay. Conclusions By integrating stochastic simulation with thermodynamic prediction tools for DNA hybridization, one may robustly and rapidly characterize of the selectivity of a proposed microarray design at the probe and "system" levels. Our code is available at http://www.laurenzi.net.

  16. Silicon based nanogap device for studying electrical transport phenomena in molecule-nanoparticle hybrids

    International Nuclear Information System (INIS)

    Strobel, Sebastian; Hernandez, Rocio Murcia; Hansen, Allan G; Tornow, Marc

    2008-01-01

    We report the fabrication and characterization of vertical nanogap electrode devices using silicon-on-insulator substrates. Using only standard silicon microelectronic process technology, nanogaps down to 26 nm electrode separation were prepared. Transmission electron microscopy cross-sectional analysis revealed the well defined material architecture of the nanogap, comprising two electrodes of dissimilar geometrical shape. This asymmetry is directly reflected in transport measurements on molecule-nanoparticle hybrid systems formed by self-assembling a monolayer of mercaptohexanol on the electrode surface and the subsequent dielectrophoretic trapping of 30 nm diameter Au nanoparticles. The observed Coulomb staircase I-V characteristic measured at T = 4.2 K is in excellent agreement with theoretical modelling, whereby junction capacitances of the order of a few 10 -18 farad and asymmetric resistances of 30 and 300 MΩ, respectively, are also supported well by our independent estimates for the formed double barrier tunnelling system. We propose our nanoelectrode system for integrating novel functional electronic devices such as molecular junctions or nanoparticle hybrids into existing silicon microelectronic process technology

  17. Silicon based nanogap device for studying electrical transport phenomena in molecule-nanoparticle hybrids

    Energy Technology Data Exchange (ETDEWEB)

    Strobel, Sebastian; Hernandez, Rocio Murcia [Walter Schottky Institut, Technische Universitaet Muenchen, Am Coulombwall 3, 85748 Garching (Germany); Hansen, Allan G; Tornow, Marc [Institut fuer Halbleitertechnik, Technische Universitaet Braunschweig, Hans-Sommer-Strasse 66, 38106 Braunschweig (Germany)], E-mail: m.tornow@tu-bs.de

    2008-09-17

    We report the fabrication and characterization of vertical nanogap electrode devices using silicon-on-insulator substrates. Using only standard silicon microelectronic process technology, nanogaps down to 26 nm electrode separation were prepared. Transmission electron microscopy cross-sectional analysis revealed the well defined material architecture of the nanogap, comprising two electrodes of dissimilar geometrical shape. This asymmetry is directly reflected in transport measurements on molecule-nanoparticle hybrid systems formed by self-assembling a monolayer of mercaptohexanol on the electrode surface and the subsequent dielectrophoretic trapping of 30 nm diameter Au nanoparticles. The observed Coulomb staircase I-V characteristic measured at T = 4.2 K is in excellent agreement with theoretical modelling, whereby junction capacitances of the order of a few 10{sup -18} farad and asymmetric resistances of 30 and 300 M{omega}, respectively, are also supported well by our independent estimates for the formed double barrier tunnelling system. We propose our nanoelectrode system for integrating novel functional electronic devices such as molecular junctions or nanoparticle hybrids into existing silicon microelectronic process technology.

  18. Silicon based nanogap device for studying electrical transport phenomena in molecule-nanoparticle hybrids.

    Science.gov (United States)

    Strobel, Sebastian; Hernández, Rocío Murcia; Hansen, Allan G; Tornow, Marc

    2008-09-17

    We report the fabrication and characterization of vertical nanogap electrode devices using silicon-on-insulator substrates. Using only standard silicon microelectronic process technology, nanogaps down to 26 nm electrode separation were prepared. Transmission electron microscopy cross-sectional analysis revealed the well defined material architecture of the nanogap, comprising two electrodes of dissimilar geometrical shape. This asymmetry is directly reflected in transport measurements on molecule-nanoparticle hybrid systems formed by self-assembling a monolayer of mercaptohexanol on the electrode surface and the subsequent dielectrophoretic trapping of 30 nm diameter Au nanoparticles. The observed Coulomb staircase I-V characteristic measured at T = 4.2 K is in excellent agreement with theoretical modelling, whereby junction capacitances of the order of a few 10(-18) farad and asymmetric resistances of 30 and 300 MΩ, respectively, are also supported well by our independent estimates for the formed double barrier tunnelling system. We propose our nanoelectrode system for integrating novel functional electronic devices such as molecular junctions or nanoparticle hybrids into existing silicon microelectronic process technology.

  19. DNA fingerprinting of Kentucky bluegrass cultivars and hybrids

    Science.gov (United States)

    As a high polyploidy, apomictic, self-incompatible, perennial grass, Kentucky bluegrass has such complex genetic architecture that conducting standard Mendelian genetic selection is currently impossible. One large hurdle is the inability to differentiate true hybrids from other apomictic progenies....

  20. Multilayer DNA Origami Packed on Hexagonal and Hybrid Lattices

    OpenAIRE

    Ke, Yonggang; Voigt, Niels V.; Gothelf, Kurt V.; Shih, William M.

    2012-01-01

    “Scaffolded DNA origami” has been proven to be a powerful and efficient approach to construct two-dimensional or three-dimensional objects with great complexity. Multilayer DNA origami has been demonstrated with helices packing along either honeycomb-lattice geometry or square-lattice geometry. Here we report successful folding of multilayer DNA origami with helices arranged on a close-packed hexagonal lattice. This arrangement yields a higher density of helical packing and therefore higher r...

  1. Single-molecule analysis reveals the kinetics and physiological relevance of MutL-ssDNA binding.

    Directory of Open Access Journals (Sweden)

    Jonghyun Park

    2010-11-01

    Full Text Available DNA binding by MutL homologs (MLH/PMS during mismatch repair (MMR has been considered based on biochemical and genetic studies. Bulk studies with MutL and its yeast homologs Mlh1-Pms1 have suggested an integral role for a single-stranded DNA (ssDNA binding activity during MMR. We have developed single-molecule Förster resonance energy transfer (smFRET and a single-molecule DNA flow-extension assays to examine MutL interaction with ssDNA in real time. The smFRET assay allowed us to observe MutL-ssDNA association and dissociation. We determined that MutL-ssDNA binding required ATP and was the greatest at ionic strength below 25 mM (K(D = 29 nM while it dramatically decreases above 100 mM (K(D>2 µM. Single-molecule DNA flow-extension analysis suggests that multiple MutL proteins may bind ssDNA at low ionic strength but this activity does not enhance stability at elevated ionic strengths. These studies are consistent with the conclusion that a stable MutL-ssDNA interaction is unlikely to occur at physiological salt eliminating a number of MMR models. However, the activity may infer some related dynamic DNA transaction process during MMR.

  2. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  3. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-01-01

    and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image

  4. Tungsten polyoxometalate molecules as active nodes for dynamic carrier exchange in hybrid molecular/semiconductor capacitors

    International Nuclear Information System (INIS)

    Balliou, A.; Douvas, A. M.; Normand, P.; Argitis, P.; Glezos, N.; Tsikritzis, D.; Kennou, S.

    2014-01-01

    In this work we study the utilization of molecular transition metal oxides known as polyoxometalates (POMs), in particular the Keggin structure anions of the formula PW 12 O 40 3− , as active nodes for potential switching and/or fast writing memory applications. The active molecules are being integrated in hybrid Metal-Insulator/POM molecules-Semiconductor capacitors, which serve as prototypes allowing investigation of critical performance characteristics towards the design of more sophisticated devices. The charging ability as well as the electronic structure of the molecular layer is probed by means of electrical characterization, namely, capacitance-voltage and current-voltage measurements, as well as transient capacitance measurements, C (t), under step voltage polarization. It is argued that the transient current peaks observed are manifestations of dynamic carrier exchange between the gate electrode and specific molecular levels, while the transient C (t) curves under conditions of molecular charging can supply information for the rate of change of the charge that is being trapped and de-trapped within the molecular layer. Structural characterization via surface and cross sectional scanning electron microscopy as well as atomic force microscopy, spectroscopic ellipsometry, UV and Fourier-transform IR spectroscopies, UPS, and XPS contribute to the extraction of accurate electronic structure characteristics and open the path for the design of new devices with on-demand tuning of their interfacial properties via the controlled preparation of the POM layer.

  5. Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

    Science.gov (United States)

    Ares, Manuel

    2014-01-01

    This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

  6. Photoluminescence Enhancement of Poly(3-methylthiophene Nanowires upon Length Variable DNA Hybridization

    Directory of Open Access Journals (Sweden)

    Jingyuan Huang

    2018-01-01

    Full Text Available The use of low-dimensional inorganic or organic nanomaterials has advantages for DNA and protein recognition due to their sensitivity, accuracy, and physical size matching. In this research, poly(3-methylthiophene (P3MT nanowires (NWs are electrochemically prepared with dopant followed by functionalization with probe DNA (pDNA sequence through electrostatic interaction. Various lengths of pDNA sequences (10-, 20- and 30-mer are conjugated to the P3MT NWs respectively followed with hybridization with their complementary target DNA (tDNA sequences. The nanoscale photoluminescence (PL properties of the P3MT NWs are studied throughout the whole process at solid state. In addition, the correlation between the PL enhancement and the double helix DNA with various lengths is demonstrated.

  7. A Novel Method for Rapid Hybridization of DNA to a Solid Support

    Science.gov (United States)

    Pettersson, Erik; Ahmadian, Afshin; Ståhl, Patrik L.

    2013-01-01

    Here we present a novel approach entitled Magnetic Forced Hybridization (MFH) that provides the means for efficient and direct hybridization of target nucleic acids to complementary probes immobilized on a glass surface in less than 15 seconds at ambient temperature. In addition, detection is carried out instantly since the beads become visible on the surface. The concept of MFH was tested for quality control of array manufacturing, and was combined with a multiplex competitive hybridization (MUCH) approach for typing of Human Papilloma Virus (HPV). Magnetic Forced Hybridization of bead-DNA constructs to a surface achieves a significant reduction in diagnostic testing time. In addition, readout of results by visual inspection of the unassisted eye eliminates the need for additional expensive instrumentation. The method uses the same set of beads throughout the whole process of manipulating and washing DNA constructs prior to detection, as in the actual detection step itself. PMID:23950946

  8. Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens

    International Nuclear Information System (INIS)

    Weng, X.; Jiang, H.; Li, D.

    2012-01-01

    We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)

  9. DNA-dispersed graphene/NiO hybrid materials for highly sensitive non-enzymatic glucose sensor

    International Nuclear Information System (INIS)

    Lv Wei; Jin Fengmin; Guo Quangui; Yang Quanhong; Kang Feiyu

    2012-01-01

    Highlights: ► We investigated the potential of GNS/NiO/DNA hybrid used as a nonenzymatic sensor. ► DNA is a highly efficient disperse agent for GNS/NiO hybrid than ionic surfactants. ► GNS/NiO/DNA hybrid shows fast electron transfer in the electrochemical reaction. ► GNS/NiO/DNA hybrid shows good detection performance towards glucose. - Abstract: We demonstrate graphene nanosheet/NiO hybrids (GNS/NiO) as the active material for high-performance non-enzymatic glucose sensors. Such sensors are fabricated by DNA-dispersed GNS/NiO suspension deposited on glassy carbon electrodes. ss-DNA shows strong dispersing ability for the GNS/NiO hybrid materials resulting in stable water-dispersible GNS/NiO/DNA hybrids with fully separated layers. The GNS/NiO/DNA hybrids show enhanced electron transfer in the electrocatalytic reaction process, and accordingly, such hybrids modified electrodes show good sensing performance towards glucose and are characterized by large detection ranges, short response periods, low detection limit and high sensitivity and stability.

  10. Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

    Science.gov (United States)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2018-02-01

    Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA moleculesDNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

  11. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  12. DNA hybridization evidence for the Australasian affinity of the American marsupial Dromiciops australis.

    OpenAIRE

    Kirsch, J A; Dickerman, A W; Reig, O A; Springer, M S

    1991-01-01

    DNA hybridization was used to compare representatives of the major groups of marsupials and a eutherian outgroup. Because of the large genetic distances separating marsupial families, trees were calculated from normalized percentages of hybridization; thermal-melting statistics, however, gave identical topologies for the well-supported clades. The most notable results were the association of the only extant microbiotheriid, Dromiciops australis, an American marsupial, with the Australasian Di...

  13. Colloidal Au-enhanced surface plasmon resonance imaging: application in a DNA hybridization process

    International Nuclear Information System (INIS)

    Manera, M G; Spadavecchia, J; Taurino, A; Rella, R

    2010-01-01

    The detection of the DNA hybridization mechanism using monodispersed gold nanoparticles as labels is an interesting alternative to increase the sensitivity of the SPR imaging technique. DNA-modified Au nanoparticles (DNA-Au NPs) containing single-stranded (ss) portions of DNA were prepared by monitoring their monolayer formation by UV–vis spectroscopy. The hybridization process between specific thio-oligonucleotides immobilized on the DNA–Au NPs and the corresponding complementary strands is reported and compared with the traditional hybridization process on properly self-assembled thin gold films deposited on glass substrates. A remarkable signal amplification is observed, following the incorporation of colloidal Au into a SPR biosensing experiment, resulting in an increased SPR response to DNA–DNA interactions. In particular Fusarium thiolated DNA (5'HS poly(T) 15 ATC CCT CAA AAA CTG CCG CT-3) and trichothecenes complementary DNA (5'-AGC GGC AGT TTT TGA GGG AT-3') sequences have been explored due to their possible application to agro-industry for the control of food quality

  14. Femtomolar detection of single mismatches by discriminant analysis of DNA hybridization events using gold nanoparticles.

    Science.gov (United States)

    Ma, Xingyi; Sim, Sang Jun

    2013-03-21

    Even though DNA-based nanosensors have been demonstrated for quantitative detection of analytes and diseases, hybridization events have never been numerically investigated for further understanding of DNA mediated interactions. Here, we developed a nanoscale platform with well-designed capture and detection gold nanoprobes to precisely evaluate the hybridization events. The capture gold nanoprobes were mono-laid on glass and the detection probes were fabricated via a novel competitive conjugation method. The two kinds of probes combined in a suitable orientation following the hybridization with the target. We found that hybridization efficiency was markedly dependent on electrostatic interactions between DNA strands, which can be tailored by adjusting the salt concentration of the incubation solution. Due to the much lower stability of the double helix formed by mismatches, the hybridization efficiencies of single mismatched (MMT) and perfectly matched DNA (PMT) were different. Therefore, we obtained an optimized salt concentration that allowed for discrimination of MMT from PMT without stringent control of temperature or pH. The results indicated this to be an ultrasensitive and precise nanosensor for the diagnosis of genetic diseases.

  15. A novel SERRS sandwich-hybridization assay to detect specific DNA target.

    Directory of Open Access Journals (Sweden)

    Cécile Feuillie

    Full Text Available In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR. In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics.

  16. Mixing of maize and wheat genomic DNA by somatic hybridization in regenerated sterile maize plants.

    Science.gov (United States)

    Szarka, B.; Göntér, I.; Molnár-Láng, M.; Mórocz, S.; Dudits, D.

    2002-07-01

    Intergeneric somatic hybridization was performed between albino maize ( Zea mays L.) protoplasts and mesophyll protoplasts of wheat ( Triticum aestivum L.) by polyethylene glycol (PEG) treatments. None of the parental protoplasts were able to produce green plants without fusion. The maize cells regenerated only rudimentary albino plantlets of limited viability, and the wheat mesophyll protoplasts were unable to divide. PEG-mediated fusion treatments resulted in hybrid cells with mixed cytoplasm. Six months after fusion green embryogenic calli were selected as putative hybrids. The first-regenerates were discovered as aborted embryos. Regeneration of intact, green, maize-like plants needed 6 months of further subcultures on hormone-free medium. These plants were sterile, although had both male and female flowers. The cytological analysis of cells from callus tissues and root tips revealed 56 chromosomes, but intact wheat chromosomes were not observed. Using total DNA from hybrid plants, three RAPD primer combinations produced bands resembling the wheat profile. Genomic in situ hybridization (GISH) using total wheat DNA as a probe revealed the presence of wheat DNA islands in the maize chromosomal background. The increased viability and the restored green color were the most-significant new traits as compared to the original maize parent. Other intermediate morphological traits of plants with hybrid origin were not found.

  17. Correlation between ultraviolet survival and DNA repair efficiency in mouse cell hybrids and their parent lines

    International Nuclear Information System (INIS)

    Limbosch, S.

    1982-01-01

    Three hybrid cell lines formed between mouse lymphoma (LS) and mouse fibroblasts (A9) have been tested for their capacity to perform unscheduled DNA synthesis; their recovery characteristics after uv irradiation have also been studied to determine if DNA repair is implicated in the high survival observed in one hybrid (clone 3). The results of these investigations indicate that hybrid clone 3 was distinguishable from the more uv sensitive parental and other hybrid cell lines by its higher uv-induced unscheduled DNA synthesis, its greater clonogenic survival in plateau phase, and its faster recovery when maintained in conditioned medium after irradiation. The simultaneous increase of these three properties in hybrid clone 3 suggest that, by three different approaches, we have evidenced the same molecular process, a process involved in the elimination of potentially lethal damage, most probably the excision repair pathway. This report also shows that the low efficiency in excision repair in the parent line A9 is probably not due to deletion but rather to repression of the relevant gene(s) and that somatic cell hybridization can result in a stimulation of a previously poorly expressed repair process

  18. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  19. Synthesis and structural characterization of piperazino-modified DNA that favours hybridization towards DNA over RNA

    DEFF Research Database (Denmark)

    Skov, Joan; Bryld, Torsten; Lindegaard, Dorthe

    2011-01-01

    We report the synthesis of two C4'-modified DNA analogues and characterize their structural impact on dsDNA duplexes. The 4'-C-piperazinomethyl modification stabilizes dsDNA by up to 5°C per incorporation. Extension of the modification with a butanoyl-linked pyrene increases the dsDNA stabilizati...

  20. Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

    Science.gov (United States)

    Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

    2014-01-01

    Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

  1. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  2. Bonding character and s-p hybridization of orbitals of hydride molecules according to photoelectron spectroscopy data

    International Nuclear Information System (INIS)

    Vovna, V.I.

    1988-01-01

    In consideration of the electron structure of the molecules in terms of canonical many-centered orbitals by s-p hybridization we mean mixture of the ns and np orbitals of an atom into one molecular orbital. The PE spectra of the valence levels of the molecules give direct information on the influence of s-p hybridization on the bonding character and energies of the levels [1, 3]. In this article we discuss the influence of hybridization on the bonding character of the MO of the isoelectronic series A 7 H - A 6 H 2 - A 5 H 2 - A 4 H 4 according to the results of PE spectroscopy. To simplify the discussion we adopt the approximation of Kupmans theorem IP i = -var epsilon i

  3. Multiply osmium-labeled reporter probes for electrochemical DNA hybridization assays: detection of trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Fojta, Miroslav; Havran, Luděk; Kizek, René; Paleček, Emil

    2004-01-01

    Roč. 20, č. 5 (2004), s. 985-994 ISSN 0956-5663 R&D Projects: GA MPO 1H-PK/42; GA AV ČR IAA4004108; GA AV ČR IBS5004355; GA AV ČR KJB4004302; GA AV ČR KSK4055109 Institutional research plan: CEZ:AV0Z5004920 Keywords : electrochemical sensors * DNA hybridization * DNA labeling Subject RIV: BO - Biophysics Impact factor: 3.251, year: 2004

  4. Detection of TTV-DNA in PBMC using digoxigenin labelled probe by in situ hybridization

    International Nuclear Information System (INIS)

    Liu Yang; Qi Qige

    2002-01-01

    To determine TTV-DNA in PBMC in patients with viral hepatitis, a study of in situ hybridization using digoxigenin labelled probe by PCR method to the TTV ORF1 region was performed on PBMC. Results showed that the detection rate of TTV-DNA using double-stranded probe in TTV-DNA positive group in sera was 58.06 (18/31), and the detection rate of TTV-DNA using double-stranded probe in TTV-DNA negative group in sera was 27.59 (8/29). For TTV-DNA positive group detected by double- stranded probe, then we use negative- stranded probe to detect their replication. The detection rate was 22.2%(4/18). Conclusions: TTV can infect PBMC and replicate in PBMC

  5. Mycobacterium smegmatis Lhr Is a DNA-dependent ATPase and a 3'-to-5' DNA translocase and helicase that prefers to unwind 3'-tailed RNA:DNA hybrids.

    Science.gov (United States)

    Ordonez, Heather; Shuman, Stewart

    2013-05-17

    We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3'-to-5' translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1-856) is an autonomous ATPase, 3'-to-5' translocase, and RNA:DNA helicase. Lhr-(1-856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli).

  6. A bio-hybrid DNA rotor-stator nanoengine that moves along predefined tracks.

    Science.gov (United States)

    Valero, Julián; Pal, Nibedita; Dhakal, Soma; Walter, Nils G; Famulok, Michael

    2018-06-01

    Biological motors are highly complex protein assemblies that generate linear or rotary motion, powered by chemical energy. Synthetic motors based on DNA nanostructures, bio-hybrid designs or synthetic organic chemistry have been assembled. However, unidirectionally rotating biomimetic wheel motors with rotor-stator units that consume chemical energy are elusive. Here, we report a bio-hybrid nanoengine consisting of a catalytic stator that unidirectionally rotates an interlocked DNA wheel, powered by NTP hydrolysis. The engine consists of an engineered T7 RNA polymerase (T7RNAP-ZIF) attached to a dsDNA nanoring that is catenated to a rigid rotating dsDNA wheel. The wheel motor produces long, repetitive RNA transcripts that remain attached to the engine and are used to guide its movement along predefined ssDNA tracks arranged on a DNA nanotube. The simplicity of the design renders this walking nanoengine adaptable to other biological nanoarchitectures, facilitating the construction of complex bio-hybrid structures that achieve NTP-driven locomotion.

  7. Towards observing the encounter of the T7 DNA replication fork with a lesion site at the Single molecule level

    KAUST Repository

    Shirbini, Afnan

    2017-05-01

    Single-molecule DNA flow-stretching assays have been a powerful approach to study various aspects on the mechanism of DNA replication for more than a decade. This technique depends on flow-induced force on a bead attached to a surface-tethered DNA. The difference in the elastic property between double-strand DNA (long) and single-strand DNA (short) at low regime force allows the observation of the beads motion when the dsDNA is converted to ssDNA by the replisome machinery during DNA replication. Here, I aim to develop an assay to track in real-time the encounter of the bacteriophage T7 replisome with abasic lesion site inserted on the leading strand template. I optimized methods to construct the DNA substrate that contains the abasic site and established the T7 leading strand synthesis at the single molecule level. I also optimized various control experiments to remove any interference from the nonspecific interactions of the DNA with the surface. My work established the foundation to image the encounter of the T7 replisome with abasic site and to characterize how the interactions between the helicase and the polymerase could influence the polymerase proofreading ability and its direct bypass of this highly common DNA damage type.

  8. Applications of Engineered DNA-Binding Molecules Such as TAL Proteins and the CRISPR/Cas System in Biology Research

    Directory of Open Access Journals (Sweden)

    Toshitsugu Fujita

    2015-09-01

    Full Text Available Engineered DNA-binding molecules such as transcription activator-like effector (TAL or TALE proteins and the clustered regularly interspaced short palindromic repeats (CRISPR and CRISPR-associated proteins (Cas (CRISPR/Cas system have been used extensively for genome editing in cells of various types and species. The sequence-specific DNA-binding activities of these engineered DNA-binding molecules can also be utilized for other purposes, such as transcriptional activation, transcriptional repression, chromatin modification, visualization of genomic regions, and isolation of chromatin in a locus-specific manner. In this review, we describe applications of these engineered DNA-binding molecules for biological purposes other than genome editing.

  9. Hybrid-hybrid matrix structural refinement of a DNA three-way junction from 3D NOESY-NOESY

    International Nuclear Information System (INIS)

    Thiviyanathan, Varatharasa; Luxon, Bruce A.; Leontis, Neocles B.; Illangasekare, Nishantha; Donne, David G.; Gorenstein, David G.

    1999-01-01

    Homonuclear 3D NOESY-NOESY has shown great promise for the structural refinement of large biomolecules. A computationally efficient hybrid-hybrid relaxation matrix refinement methodology, using 3D NOESY-NOESY data, was used to refine the structure of a DNA three-way junction having two unpaired bases at the branch point of the junction. The NMR data and the relaxation matrix refinement confirm that the DNA three-way junction exists in a folded conformation with two of the helical stems stacked upon each other. The third unstacked stem extends away from the junction, forming an acute angle (∼60 deg.) with the stacked stems. The two unpaired bases are stacked upon each other and are exposed to the solvent. Helical parameters for the bases in all three strands show slight deviations from typical values expected for right-handed B-form DNA. Inter-nucleotide imino-imino NOEs between the bases at the branch point of the junction show that the junction region is well defined. The helical stems show mobility (± 20 deg.) indicating dynamic processes around the junction region. The unstacked helical stem adjacent to the unpaired bases shows greater mobility compared to the other two stems. The results from this study indicate that the 3D hybrid-hybrid matrix MORASS refinement methodology, by combining the spectral dispersion of 3D NOESY-NOESY and the computational efficiency of 2D refinement programs, provides an accurate and robust means for structure determination of large biomolecules. Our results also indicate that the 3D MORASS method gives higher quality structures compared to the 2D complete relaxation matrix refinement method

  10. Branched-DNA signal amplification combined with paper chromatography hybridization assay and used in hepatitis B virus DNA detection

    International Nuclear Information System (INIS)

    Fu, F.Z.; Liu, L.X.; Wang, W.Q.; Sun, S. H.; Liu, L.B.

    2002-01-01

    Nucleic acids detection method is vital to the clinical pathogen diagnosis. The established method can be classified into target direct amplification and signal amplification format according to the target DNA or RNA being directly amplified or not. Those methods have advantages and disadvantages respectively in the clinical application. In the United States of American, branched-DNA as a strong signal amplifier is broadly used in the quantification of the nucleic acids. To gain satisfied sensitivity, some expensive label molecular and instruments should be adopted. Personnel should be special trained to perform. Hence, those can't be widely carried out in the Third World. To avoid those disadvantages, we used the branched-DNA amplifier in the paper chromatography hybridization assay. Methods: Branched DNA signal amplifier and series of probes complementary to the nucleic acid sequence of hepatitis B virus (HBV) have been synthesized. HBV-DNA or it's capture probe were immobilized on the high flow nitrocellulose strip. Having loaded at one end of the strip in turn, probes or HBV-DNA in the hybridization solution migrate to the opposite end of the strip by capillary forces and hybridizes to the immobilized DNA. The branched-DNA signal amplifier and probe labeled with biotin or 32P were then loaded. Through streptavidin-alkaline phosphatase (SA-AP) conjugate and NBT/BCIP ( the specific chromogenic substrate of AP) or autoradiography, the result can be visualized by color reaction or image production on the X-ray film. Results: The sensitivity of this HBV-DNA detection method used probe labeled with biotin and 32P are 1ng and 10pg. The method using the probe labeled with biotin is simple and rapid (2h) without depending on special instruments, it also avoids the pollution of EtBr which can lead to tumor. And the method using the probe labeled with 32P is simple and sensitive, with the exception of long time autoradiography and the inconvenient isotopic disposal

  11. High-throughput screening of suppression subtractive hybridization cDNA libraries using DNA microarray analysis

    CSIR Research Space (South Africa)

    Van den Berg, N

    2004-11-01

    Full Text Available Efficient construction of cDNA libraries enriched for differentially expressed transcripts is an important first step in many biological investigations. We present a quantitative procedure for screening cDNA libraries constructed by suppression...

  12. Molecular modeling of cationic porphyrin-anthraquinone hybrids as DNA topoisomerase IIβ inhibitors.

    Science.gov (United States)

    Arba, Muhammad; Ruslin; Ihsan, Sunandar; Tri Wahyudi, Setyanto; Tjahjono, Daryono H

    2017-12-01

    Human DNA Topoisomerase II has been regarded as a promising target in anticancer drug discovery. In the present study, we designed six porphyrin-anthraquinone hybrids bearing pyrazole or pyridine group as meso substituents and evaluated their potentials as DNA Topoisomerase IIβ inhibitor. First, we investigated the binding orientation of porphyrin hybrids into DNA topoisomerase IIβ employing AutoDock 4.2 and then performed 20-ns molecular dynamics simulations to see the dynamic stability of each porphyrin-Topo IIβ complex using Amber 14. We found that the binding of porphyrin hybrids occured through intercalation and groove binding mode in addition interaction with the amino acid residues constituting the active cavity of Topo IIβ. Each porphyrin-Topo IIβ complex was stabilized during 20-ns dynamics simulations. The MM-PBSA free energy calculation shows that the binding affinities of porphyrin hybrids were modified with the number of meso substituent. Interestingly, the affinity of all porphyrin hybrids to Topo IIβ was stronger than that of native ligand (EVP), indicating the potential of the designed porphyrin to be considered in experimental research. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Applying Mesoporous Silica SBA-15 in Electrochemical Detection of DNA Hybridization

    Czech Academy of Sciences Publication Activity Database

    Josypčuk, Oksana; Fojta, Miroslav; Daňhel, Aleš; Josypčuk, Bohdan

    2016-01-01

    Roč. 28, č. 8 (2016), s. 1860-1864 ISSN 1040-0397 R&D Projects: GA ČR GAP206/11/1638 Institutional support: RVO:68081707 ; RVO:61388955 Keywords : voltammetry * sensor DNA hybridization * mesoporous silica Subject RIV: CG - Electrochemistry Impact factor: 2.851, year: 2016

  14. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    Science.gov (United States)

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R.; Stedtfeld, Robert D.; Gulari, Erdogan; Tiedje, James M.; Hashsham, Syed A.

    2017-01-01

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131). PMID:28555058

  15. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    Directory of Open Access Journals (Sweden)

    Ahsan Munir

    2017-05-01

    Full Text Available Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs. Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131.

  16. Parental DNA methylation states are associated with heterosis in epigenetic hybrids

    NARCIS (Netherlands)

    Lauss, Kathrin; Wardenaar, René; Oka, Rurika; van Hulten, Marieke H A; Guryev, Victor; Keurentjes, Joost J B; Stam, Maike; Johannes, Frank

    Despite the importance and wide exploitation of heterosis in commercial crop breeding, the molecular mechanisms behind this phenomenon are not completely understood. Recent studies have implicated changes in DNA methylation and small RNAs in hybrid performance, however, it remains unclear whether

  17. Parental DNA methylation states are associated with heterosis in epigenetic hybrids

    NARCIS (Netherlands)

    Lauss, K.; Wardenaar, R.; Oka, R.; van Hulten, M.H.A.; Guryev, V.; Keurentjes, J.J.B.; Stam, M.; Johannes, F.

    Despite the importance and wide exploitation of heterosis in commercial crop breeding, the molecular mechanisms behind this phenomenon are not completely understood. Recent studies have implicated changes in DNA methylation and small RNAs in hybrid performance; however, it remains unclear whether

  18. Parental DNA methylation states are associated with heterosis in epigenetic hybrids

    NARCIS (Netherlands)

    Lauss, Kathrin; Wardenaar, R.; Oka, Rurika; Hulten, M.H.A.; Guryev, Victor; Keurentjes, J.J.B.; Stam, Maike; Johannes, Frank

    2018-01-01

    Despite the importance and wide exploitation of heterosis in commercial crop breeding, the molecular mechanisms behind this phenomenon are not completely understood. Recent studies have implicated changes in DNA methylation and small RNAs in hybrid performance, however, it remains unclear whether

  19. Natural hybridization in tropical spikerushes of Eleocharis subgenus Limnochloa (Cyperaceae): Evidence from morphology and DNA markers

    Czech Academy of Sciences Publication Activity Database

    Košnar, J.; Košnar, Ji.; Macek, Petr; Herbstová, Miroslava; Rejmánková, E.; Stech, M.

    2010-01-01

    Roč. 97, č. 7 (2010), s. 1229-1240 ISSN 0002-9122 Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z50510513 Keywords : Belize * Cyperaceae * DNA markers * hybridization Subject RIV: EB - Genetics ; Molecular Biology; EB - Genetics ; Molecular Biology (BU-J) Impact factor: 3.052, year: 2010

  20. A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

    Science.gov (United States)

    Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

    2017-07-01

    We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. The Conformational Dynamics of Cas9 Governing DNA Cleavage Are Revealed by Single-Molecule FRET.

    Science.gov (United States)

    Yang, Mengyi; Peng, Sijia; Sun, Ruirui; Lin, Jingdi; Wang, Nan; Chen, Chunlai

    2018-01-09

    Off-target binding and cleavage by Cas9 pose major challenges in its application. How the conformational dynamics of Cas9 govern its nuclease activity under on- and off-target conditions remains largely unknown. Here, using intra-molecular single-molecule fluorescence resonance energy transfer measurements, we revealed that Cas9 in apo, sgRNA-bound, and dsDNA/sgRNA-bound forms spontaneously transits among three major conformational states, mainly reflecting significant conformational mobility of the catalytic HNH domain. We also uncovered surprising long-range allosteric communication between the HNH domain and the RNA/DNA heteroduplex at the PAM-distal end to ensure correct positioning of the catalytic site, which demonstrated that a unique proofreading mechanism served as the last checkpoint before DNA cleavage. Several Cas9 residues were likely to mediate the allosteric communication and proofreading step. Modulating interactions between Cas9 and heteroduplex at the PAM-distal end by introducing mutations on these sites provides an alternative route to improve and optimize the CRISPR/Cas9 toolbox. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  2. Impact of temperature and time storage on the microbial detection of oral samples by Checkerboard DNA-DNA hybridization method.

    Science.gov (United States)

    do Nascimento, Cássio; dos Santos, Janine Navarro; Pedrazzi, Vinícius; Pita, Murillo Sucena; Monesi, Nadia; Ribeiro, Ricardo Faria; de Albuquerque, Rubens Ferreira

    2014-01-01

    Molecular diagnosis methods have been largely used in epidemiological or clinical studies to detect and quantify microbial species that may colonize the oral cavity in healthy or disease. The preservation of genetic material from samples remains the major challenge to ensure the feasibility of these methodologies. Long-term storage may compromise the final result. The aim of this study was to evaluate the effect of temperature and time storage on the microbial detection of oral samples by Checkerboard DNA-DNA hybridization. Saliva and supragingival biofilm were taken from 10 healthy subjects, aliquoted (n=364) and processed according to proposed protocols: immediate processing and processed after 2 or 4 weeks, and 6 or 12 months of storage at 4°C, -20°C and -80°C. Either total or individual microbial counts were recorded in lower values for samples processed after 12 months of storage, irrespective of temperatures tested. Samples stored up to 6 months at cold temperatures showed similar counts to those immediately processed. The microbial incidence was also significantly reduced in samples stored during 12 months in all temperatures. Temperature and time of oral samples storage have relevant impact in the detection and quantification of bacterial and fungal species by Checkerboard DNA-DNA hybridization method. Samples should be processed immediately after collection or up to 6 months if conserved at cold temperatures to avoid false-negative results. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. An impedimetric study of DNA hybridization on paper-supported inkjet-printed gold electrodes

    International Nuclear Information System (INIS)

    Ihalainen, Petri; Määttänen, Anni; Peltonen, Jouko; Pettersson, Fredrik; Pesonen, Markus; Österbacka, Ronald; Viitala, Tapani

    2014-01-01

    In this study, two different supramolecular recognition architectures for impedimetric detection of DNA hybridization have been formed on disposable paper-supported inkjet-printed gold electrodes. The gold electrodes were fabricated using a gold nanoparticle based ink. The first recognition architecture consists of subsequent layers of biotinylated self-assembly monolayer (SAM), streptavidin and biotinylated DNA probe. The other recognition architecture is constructed by immobilization of thiol-functionalized DNA probe (HS-DNA) and subsequent backfill with 11-mercapto-1-undecanol (MUOH) SAM. The binding capacity and selectivity of the recognition architectures were examined by surface plasmon resonance (SPR) measurements. SPR results showed that the HS-DNA/MUOH system had a higher binding capacity for the complementary DNA target. Electrochemical impedance spectroscopy (EIS) measurements showed that the hybridization can be detected with impedimetric spectroscopy in picomol range for both systems. EIS signal indicated a good selectivity for both recognition architectures, whereas SPR showed very high unspecific binding for the HS-DNA/MUOH system. The factors affecting the impedance signal were interpreted in terms of the complexity of the supramolecular architecture. The more complex architecture acts as a less ideal capacitive sensor and the impedance signal is dominated by the resistive elements. (paper)

  4. Nuclear DNA content of the hybrid plant pathogen Phytophthora andina determined by flow cytometry.

    Science.gov (United States)

    Wang, Jianan; Presser, Jackson W; Goss, Erica M

    2016-09-01

    Phytophthora andina is a heterothallic plant pathogen of Andean solanaceous hosts and is an interspecific hybrid of P. infestans and an unknown Phytophthora species. The objective of this study was to estimate the nuclear DNA content of isolates in three clonal lineages of P. andina relative to P. infestans Twelve isolates of P. andina and six isolates of P. infestans were measured for nuclear DNA content by propidium iodide-stained flow cytometry. We found that the DNA content of P. andina was similar but slightly smaller, on average, than that of our sample of P. infestans isolates. This is consistent with P. andina being a homoploid hybrid rather than allopolyploid hybrid. Nuclear DNA content was more variable among a smaller sample of P. infestans isolates, including a putative triploid isolate from Mexico, but small differences in nuclear DNA content were also observed among P. andina isolates. Both species appear to be able to tolerate significant variation in genome size. © 2016 by The Mycological Society of America.

  5. Alien DNA introgression and wheat DNA rearrangements in a stable wheat line derived from the early generation of distant hybridization.

    Science.gov (United States)

    Zhang, Lianquan; Liu, Dengcai; Yan, Zehong; Zheng, Youliang

    2005-10-01

    Polyploidy has been found to be common in plants. Bread or common wheat (Triticum aestivum L., 2n=42) is a good example of allopolyploid made up of three diploid genomes A, B and D. In recent years, by the study of mimicking the origination of common wheat, it was found that changes of DNA sequence and gene expression occurred at the early stages of artificial allohexaploid between tetraploid wheat and Aegilops tauschii, which was probably favorable to genetic diploidization of new synthetic hexaploid wheat. Common wheat 99L2 is a new line stable in genetic, which was derived from the early self-pollinated generation of wide hybrids between common wheat and rye. In this study, it was found that at least two rye DNA segments had been introgressed into 99L2. This result suggested that a mechanism of alien DNA introgression may exist, which was different from the traditional mechanism of chromosome pairing and DNA recombination between wheat and alien species. Meanwhile, during the introgression process of alien rye DNA segments, the changes in DNA sequences of wheat itself occurred.

  6. Molecular Processes Studied at a Single-Molecule Level Using DNA Origami Nanostructures and Atomic Force Microscopy

    Directory of Open Access Journals (Sweden)

    Ilko Bald

    2014-09-01

    Full Text Available DNA origami nanostructures allow for the arrangement of different functionalities such as proteins, specific DNA structures, nanoparticles, and various chemical modifications with unprecedented precision. The arranged functional entities can be visualized by atomic force microscopy (AFM which enables the study of molecular processes at a single-molecular level. Examples comprise the investigation of chemical reactions, electron-induced bond breaking, enzymatic binding and cleavage events, and conformational transitions in DNA. In this paper, we provide an overview of the advances achieved in the field of single-molecule investigations by applying atomic force microscopy to functionalized DNA origami substrates.

  7. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  8. In-Channel-Grown Polypyrrole Nanowire for the Detection of DNA Hybridization in an Electrochemical Microfluidic Biosensor

    Directory of Open Access Journals (Sweden)

    Thi Luyen Tran

    2015-01-01

    Full Text Available A triple electrode setup with a Pt pseudo-reference electrode integrated in a polydimethylsiloxane- (PDMS- based microchamber was designed and fabricated. The integrated electrodes were deposited onto SiO2/Si substrate by sputtering. The PDMS microchamber was patterned using an SU-8 mold and sealed with electrodes in oxygen plasma. Polypyrrole nanowires (PPy NWs were electrochemically grown in situ at an accurate position of the working electrode in the sealed microchamber instead of in an open system. The DNA probe sequences were simply introduced into the channel to form bonds with the nanowires. A detection limit of 20 pM was achieved using a lock-in amplifier. The electrochemical characteristics produced by the hybridization of DNA strands in the microchamber showed a good signal/noise ratio and high sensitivity. Measurement of the DNA sensor in narrow space also required much less volume of the analytical sample compared with that in an open measuring cell. Results showed that this simple system can potentially fabricate nanostructures and detect bio/chemical molecules in a sealed system.

  9. Hybrid DNA i-motif: Aminoethylprolyl-PNA (pC5) enhance the stability of DNA (dC5) i-motif structure.

    Science.gov (United States)

    Gade, Chandrasekhar Reddy; Sharma, Nagendra K

    2017-12-15

    This report describes the synthesis of C-rich sequence, cytosine pentamer, of aep-PNA and its biophysical studies for the formation of hybrid DNA:aep-PNAi-motif structure with DNA cytosine pentamer (dC 5 ) under acidic pH conditions. Herein, the CD/UV/NMR/ESI-Mass studies strongly support the formation of stable hybrid DNA i-motif structure with aep-PNA even near acidic conditions. Hence aep-PNA C-rich sequence cytosine could be considered as potential DNA i-motif stabilizing agents in vivo conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Synthesis of DNA block copolymers with extended nucleic acid segments by enzymatic ligation : cut and paste large hybrid architectures

    NARCIS (Netherlands)

    Ayaz, Meryem S.; Kwak, Minseok; Alemdaroglu, Fikri E.; Wang, Jie; Berger, Ruediger; Herrmann, Andreas; Berger, Rüdiger

    2011-01-01

    Ultra-high molecular weight DNA/polymer hybrid materials were prepared employing molecular biology techniques. Nucleic acid restriction and ligation enzymes were used to generate linear DNA di- and triblock copolymers that contain up to thousands of base pairs in the DNA segments.

  11. Nanofluidic single-molecule sorting of DNA: a new concept in separation and analysis of biomolecules towards ultimate level performance

    International Nuclear Information System (INIS)

    Yamamoto, Takatoki; Fujii, Teruo

    2010-01-01

    Separation and separation-based analysis of biomolecules are fundamentally important techniques in the field of biotechnology. These techniques, however, depend on stochastic processes that intrinsically involve uncertainty, and thus it is not possible to achieve 100% separation accuracy. Theoretically, the ultimate resolution and sensitivity should be realized in a single-molecule system because of the deterministic nature of single-molecule manipulation. Here, we have proposed and experimentally demonstrated the concept of a 'single-molecule sorter' that detects and correctly identifies individual single molecules, realizing the ultimate level of resolution and sensitivity for any separation-based technology. The single-molecule sorter was created using a nanofluidic network consisting of a single inlet channel that branches off into multiple outlet channels. It includes two major functional elements, namely a single-molecule detection and identification element and a flow path switching element to accurately separate single molecules. With this system we have successfully demonstrated the world's first single-molecule sorting using DNA as a sample molecule. In the future, we hope to expand the application of such devices to comprehensive sorting of single-proteins from a single cell. We also believe that in addition to the single-molecule sorting method reported here, other types of single-molecule based processes will emerge and find use in a wide variety of applications.

  12. Universal huygen's principle of synchronization andcoordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Many objects in Nature elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are built as self-consistent hierarchical systems and have the same homological constructions in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to the above-said the corresponding partial motions are determinate. This determinism arises as a consequence of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe

  13. In silico single-molecule manipulation of DNA with rigid body dynamics.

    Directory of Open Access Journals (Sweden)

    Pascal Carrivain

    2014-02-01

    Full Text Available We develop a new powerful method to reproduce in silico single-molecule manipulation experiments. We demonstrate that flexible polymers such as DNA can be simulated using rigid body dynamics thanks to an original implementation of Langevin dynamics in an open source library called Open Dynamics Engine. We moreover implement a global thermostat which accelerates the simulation sampling by two orders of magnitude. We reproduce force-extension as well as rotation-extension curves of reference experimental studies. Finally, we extend the model to simulations where the control parameter is no longer the torsional strain but instead the torque, and predict the expected behavior for this case which is particularly challenging theoretically and experimentally.

  14. Immobilization/hybridization of amino-modified DNA on plasma-polymerized allyl chloride

    International Nuclear Information System (INIS)

    Zhang Zhihong; Feng Chuanliang

    2007-01-01

    The present work describes the fabrication and characterization of chloride-derivatized polymer coatings prepared by continuous wave (cw) plasma polymerization as adhesion layers in DNA immobilization/hybridization. The stability of plasma-polymerized allyl chloride (ppAC) in H 2 O was characterized by variation of the thickness of polymer films and its wettability was examined by water contact angle technique. Fourier transform infrared spectroscopy (FTIR) and X-ray photoelectron spectroscopy (XPS) were used to study polymer matrix properties and oligonucleotide/DNA binding interaction. With the same carrier gas rate and process pressure, plasma polymers deposited at different input powers show various comparable immobilization properties; nevertheless, low input power plasma-polymerized films gives a lower sensitivity toward DNA binding than that from high input power plasma-deposited films. The following DNA immobilization on chloride-functionalized surfaces was found dependence on the macromolecular architecture of the plasma films. The hybridization between probe DNA and total mismatch target DNA shows no non-specific adsorption between target and ppAC

  15. Detection of DNA hybridization based on SnO2 nanomaterial enhanced fluorescence

    International Nuclear Information System (INIS)

    Gu Cuiping; Huang Jiarui; Ni Ning; Li Minqiang; Liu Jinhuai

    2008-01-01

    In this paper, enhanced fluorescence emissions were firstly investigated based on SnO 2 nanomaterial, and its application in the detection of DNA hybridization was also demonstrated. The microarray of SnO 2 nanomaterial was fabricated by the vapour phase transport method catalyzed by patterned Au nanoparticles on a silicon substrate. A probe DNA was immobilized on the substrate with patterned SnO 2 nanomaterial, respectively, by covalent and non-covalent linking schemes. When a fluorophore labelled target DNA was hybridized with a probe DNA on the substrate, fluorescence emissions were only observed on the surface of SnO 2 nanomaterial, which indicated the property of enhancing fluorescence signals from the SnO 2 nanomaterial. By comparing the different fluorescence images from covalent and non-covalent linking schemes, the covalent method was confirmed to be more effective for immobilizing a probe DNA. With the combined use of SnO 2 nanomaterial and the covalent linking scheme, the target DNA could be detected at a very low concentration of 10 fM. And the stability of SnO 2 nanomaterial under the experimental conditions was also compared with silicon nanowires. The findings strongly suggested that SnO 2 nanomaterial could be extensively applied in detections of biological samples with enhancing fluorescence property and high stability

  16. Thermodynamic framework to assess low abundance DNA mutation detection by hybridization

    Science.gov (United States)

    Willems, Hanny; Jacobs, An; Hadiwikarta, Wahyu Wijaya; Venken, Tom; Valkenborg, Dirk; Van Roy, Nadine; Vandesompele, Jo; Hooyberghs, Jef

    2017-01-01

    The knowledge of genomic DNA variations in patient samples has a high and increasing value for human diagnostics in its broadest sense. Although many methods and sensors to detect or quantify these variations are available or under development, the number of underlying physico-chemical detection principles is limited. One of these principles is the hybridization of sample target DNA versus nucleic acid probes. We introduce a novel thermodynamics approach and develop a framework to exploit the specific detection capabilities of nucleic acid hybridization, using generic principles applicable to any platform. As a case study, we detect point mutations in the KRAS oncogene on a microarray platform. For the given platform and hybridization conditions, we demonstrate the multiplex detection capability of hybridization and assess the detection limit using thermodynamic considerations; DNA containing point mutations in a background of wild type sequences can be identified down to at least 1% relative concentration. In order to show the clinical relevance, the detection capabilities are confirmed on challenging formalin-fixed paraffin-embedded clinical tumor samples. This enzyme-free detection framework contains the accuracy and efficiency to screen for hundreds of mutations in a single run with many potential applications in molecular diagnostics and the field of personalised medicine. PMID:28542229

  17. Single-molecule packaging initiation in real time by a viral DNA packaging machine from bacteriophage T4.

    Science.gov (United States)

    Vafabakhsh, Reza; Kondabagil, Kiran; Earnest, Tyler; Lee, Kyung Suk; Zhang, Zhihong; Dai, Li; Dahmen, Karin A; Rao, Venigalla B; Ha, Taekjip

    2014-10-21

    Viral DNA packaging motors are among the most powerful molecular motors known. A variety of structural, biochemical, and single-molecule biophysical approaches have been used to understand their mechanochemistry. However, packaging initiation has been difficult to analyze because of its transient and highly dynamic nature. Here, we developed a single-molecule fluorescence assay that allowed visualization of packaging initiation and reinitiation in real time and quantification of motor assembly and initiation kinetics. We observed that a single bacteriophage T4 packaging machine can package multiple DNA molecules in bursts of activity separated by long pauses, suggesting that it switches between active and quiescent states. Multiple initiation pathways were discovered including, unexpectedly, direct DNA binding to the capsid portal followed by recruitment of motor subunits. Rapid succession of ATP hydrolysis was essential for efficient initiation. These observations have implications for the evolution of icosahedral viruses and regulation of virus assembly.

  18. Ultra-high-density 3D DNA arrays within nanoporous biocompatible membranes for single-molecule-level detection and purification of circulating nucleic acids

    Science.gov (United States)

    Aramesh, M.; Shimoni, O.; Fox, K.; Karle, T. J.; Lohrmann, A.; Ostrikov, K.; Prawer, S.; Cervenka, J.

    2015-03-01

    Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated alumina membrane. The few nanometer-thick, yet perfect and continuous DLC-coating confers the chemical stability and biocompatibility of the sensor, allowing its direct application in biological conditions. The selective detection is based on complementary hybridization of a fluorescently-tagged circulating cancer oncomarker (a 21-mer nucleic acid) with covalently immobilized DNA on the surface of the membrane. The captured DNAs are detected in the nanoporous structure of the sensor using confocal scanning laser microscopy. The flow-through membrane sensor demonstrates broad-range sensitivity, spanning from 1015 molecules per cm2 down to single molecules, which is several orders of magnitude improvement compared to the flat DNA microarrays. Our study suggests that these flow-through type nanoporous sensors represent a new powerful platform for large volume sampling and ultrasensitive detection of different chemical biomarkers.Extracellular nucleic acids freely circulating in blood and other physiologic fluids are important biomarkers for non-invasive diagnostics and early detection of cancer and other diseases, yet difficult to detect because they exist in very low concentrations and large volumes. Here we demonstrate a new broad-range sensor platform for ultrasensitive and selective detection of circulating DNA down to the single-molecule level. The biosensor is based on a chemically functionalized nanoporous diamond-like carbon (DLC) coated

  19. Human cDNA mapping using fluorescence in situ hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Korenberg, J.R.

    1993-03-04

    Genetic mapping is approached using the techniques of high resolution fluorescence in situ hybridization (FISH). This technology and the results of its application are designed to rapidly generate whole genome as tool box of expressed sequence to speed the identification of human disease genes. The results of this study are intended to dovetail with and to link the results of existing technologies for creating backbone YAC and genetic maps. In the first eight months, this approach generated 60--80% of the expressed sequence map, the remainder expected to be derived through more long-term, labor-intensive, regional chromosomal gene searches or sequencing. The laboratory has made significant progress in the set-up phase, in mapping fetal and adult brain and other cDNAs, in testing a model system for directly linking genetic and physical maps using FISH with small fragments, in setting up a database, and in establishing the validity and throughput of the system.

  20. Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.

    Science.gov (United States)

    Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng

    2014-01-29

    We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.

  1. Simulation Assisted Analysis of the Intrinsic Stiffness for Short DNA Molecules Imaged with Scanning Atomic Force Microscopy.

    Directory of Open Access Journals (Sweden)

    Haowei Wang

    Full Text Available Studying the mechanical properties of short segments of dsDNA can provide insight into various biophysical phenomena, from DNA looping to the organization of nucleosomes. Scanning atomic force microscopy (AFM is able to acquire images of single DNA molecules with near-basepair resolution. From many images, one may use equilibrium statistical mechanics to quantify the intrinsic stiffness (or persistence length of the DNA. However, this approach is highly dependent upon both the correct microscopic polymer model and a correct image analysis of DNA contours. These complications have led to significant debate over the flexibility of dsDNA at short length scales. We first show how to extract accurate measures of DNA contour lengths by calibrating to DNA traces of simulated AFM data. After this calibration, we show that DNA adsorbed on an aminopropyl-mica surface behaves as a worm-like chain (WLC for contour lengths as small as ~20 nm. We also show that a DNA binding protein can modify the mechanics of the DNA from that of a WLC.

  2. Hybrid Origins of Citrus Varieties Inferred from DNA Marker Analysis of Nuclear and Organelle Genomes

    Science.gov (United States)

    Kitajima, Akira; Nonaka, Keisuke; Yoshioka, Terutaka; Ohta, Satoshi; Goto, Shingo; Toyoda, Atsushi; Fujiyama, Asao; Mochizuki, Takako; Nagasaki, Hideki; Kaminuma, Eli; Nakamura, Yasukazu

    2016-01-01

    Most indigenous citrus varieties are assumed to be natural hybrids, but their parentage has so far been determined in only a few cases because of their wide genetic diversity and the low transferability of DNA markers. Here we infer the parentage of indigenous citrus varieties using simple sequence repeat and indel markers developed from various citrus genome sequence resources. Parentage tests with 122 known hybrids using the selected DNA markers certify their transferability among those hybrids. Identity tests confirm that most variant strains are selected mutants, but we find four types of kunenbo (Citrus nobilis) and three types of tachibana (Citrus tachibana) for which we suggest different origins. Structure analysis with DNA markers that are in Hardy–Weinberg equilibrium deduce three basic taxa coinciding with the current understanding of citrus ancestors. Genotyping analysis of 101 indigenous citrus varieties with 123 selected DNA markers infers the parentages of 22 indigenous citrus varieties including Satsuma, Temple, and iyo, and single parents of 45 indigenous citrus varieties, including kunenbo, C. ichangensis, and Ichang lemon by allele-sharing and parentage tests. Genotyping analysis of chloroplast and mitochondrial genomes using 11 DNA markers classifies their cytoplasmic genotypes into 18 categories and deduces the combination of seed and pollen parents. Likelihood ratio analysis verifies the inferred parentages with significant scores. The reconstructed genealogy identifies 12 types of varieties consisting of Kishu, kunenbo, yuzu, koji, sour orange, dancy, kobeni mikan, sweet orange, tachibana, Cleopatra, willowleaf mandarin, and pummelo, which have played pivotal roles in the occurrence of these indigenous varieties. The inferred parentage of the indigenous varieties confirms their hybrid origins, as found by recent studies. PMID:27902727

  3. Magnetoresistive sensors for measurements of DNA hybridization kinetics - effect of TINA modifications

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Dufva, Martin; Hansen, Mikkel Fougt

    2017-01-01

    We present the use of magnetoresistive sensors integrated in a microfluidic system for real-time studies of the hybridization kinetics of DNA labeled with magnetic nanoparticles to an array of surface-tethered probes. The nanoparticles were magnetized by the magnetic field from the sensor current....... A local negative reference ensured that only the specific binding signal was measured. Analysis of the real-time hybridization using a two-compartment model yielded both the association and dissociation constants kon, and koff. The effect of probe modifications with ortho-Twisted Intercalating Nucleic...

  4. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Science.gov (United States)

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  5. A hybrid swarm population of Pinus densiflora x P. sylvestris hybrids inferred from sequence analysis of chloroplast DNA and morphological characters

    Science.gov (United States)

    To confirm a hybrid swarm population of Pinus densiflora × P. sylvestris in Jilin, China and to study whether shoot apex morphology of 4-year old seedlings can be correlated with the sequence of a chloroplast DNA simple sequence repeat marker (cpDNA SSR), needles and seeds from P. densiflora, P. syl...

  6. A novel small molecule inhibitor of the DNA repair protein Ku70/80.

    Science.gov (United States)

    Weterings, Eric; Gallegos, Alfred C; Dominick, Lauren N; Cooke, Laurence S; Bartels, Trace N; Vagner, Josef; Matsunaga, Terry O; Mahadevan, Daruka

    2016-07-01

    Non-Homologous End-Joining (NHEJ) is the predominant pathway for the repair of DNA double strand breaks (DSBs) in human cells. The NHEJ pathway is frequently upregulated in several solid cancers as a compensatory mechanism for a separate DSB repair defect or for innate genomic instability, making this pathway a powerful target for synthetic lethality approaches. In addition, NHEJ reduces the efficacy of cancer treatment modalities which rely on the introduction of DSBs, like radiation therapy or genotoxic chemotherapy. Consequently, inhibition of the NHEJ pathway can modulate a radiation- or chemo-refractory disease presentation. The Ku70/80 heterodimer protein plays a pivotal role in the NHEJ process. It possesses a ring-shaped structure with high affinity for DSBs and serves as the first responder and central scaffold around which the rest of the repair complex is assembled. Because of this central position, the Ku70/80 dimer is a logical target for the disruption of the entire NHEJ pathway. Surprisingly, specific inhibitors of the Ku70/80 heterodimer are currently not available. We here describe an in silico, pocket-based drug discovery methodology utilizing the crystal structure of the Ku70/80 heterodimer. We identified a novel putative small molecule binding pocket and selected several potential inhibitors by computational screening. Subsequent biological screening resulted in the first identification of a compound with confirmed Ku-inhibitory activity in the low micro-molar range, capable of disrupting the binding of Ku70/80 to DNA substrates and impairing Ku-dependent activation of another NHEJ factor, the DNA-PKCS kinase. Importantly, this compound synergistically sensitized human cell lines to radiation treatment, indicating a clear potential to diminish DSB repair. The chemical scaffold we here describe can be utilized as a lead-generating platform for the design and development of a novel class of anti-cancer agents. Copyright © 2016 Elsevier B.V. All

  7. Neighboring genes for DNA-binding proteins rescue male sterility in Drosophila hybrids.

    Science.gov (United States)

    Liénard, Marjorie A; Araripe, Luciana O; Hartl, Daniel L

    2016-07-19

    Crosses between closely related animal species often result in male hybrids that are sterile, and the molecular and functional basis of genetic factors for hybrid male sterility is of great interest. Here, we report a molecular and functional analysis of HMS1, a region of 9.2 kb in chromosome 3 of Drosophila mauritiana, which results in virtually complete hybrid male sterility when homozygous in the genetic background of sibling species Drosophila simulans. The HMS1 region contains two strong candidate genes for the genetic incompatibility, agt and Taf1 Both encode unrelated DNA-binding proteins, agt for an alkyl-cysteine-S-alkyltransferase and Taf1 for a subunit of transcription factor TFIID that serves as a multifunctional transcriptional regulator. The contribution of each gene to hybrid male sterility was assessed by means of germ-line transformation, with constructs containing complete agt and Taf1 genomic sequences as well as various chimeric constructs. Both agt and Taf1 contribute about equally to HMS1 hybrid male sterility. Transgenes containing either locus rescue sterility in about one-half of the males, and among fertile males the number of offspring is in the normal range. This finding suggests compensatory proliferation of the rescued, nondysfunctional germ cells. Results with chimeric transgenes imply that the hybrid incompatibilities result from interactions among nucleotide differences residing along both agt and Taf1 Our results challenge a number of preliminary generalizations about the molecular and functional basis of hybrid male sterility, and strongly reinforce the role of DNA-binding proteins as a class of genes contributing to the maintenance of postzygotic reproductive isolation.

  8. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    Science.gov (United States)

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. DNA origami/gold nanorod hybrid nanostructures for the circumvention of drug resistance.

    Science.gov (United States)

    Song, Linlin; Jiang, Qiao; Liu, Jianbing; Li, Na; Liu, Qing; Dai, Luru; Gao, Yuan; Liu, Weili; Liu, Dongsheng; Ding, Baoquan

    2017-06-14

    We herein demonstrate that DNA origami can work as a multifunctional platform integrating a chemotherapeutic drug (doxorubicin), gold nanorods and a tumour-specific aptamer MUC-1, to realize the effective circumvention of drug resistance. Doxorubicin (DOX) was loaded efficiently onto DNA origami through base pair intercalation and surface-modified gold nanorods (AuNRs) were assembled onto the DNA origami through DNA hybridization. Due to the active targeting effect of the assembled aptamers, the multifunctional nanostructures achieved increased cellular internalization of DOX and AuNRs. Upon near-infrared (NIR) laser irradiation, the P-glycoprotein (multidrug resistance pump) expression of multidrug resistant MCF-7 (MCF-7/ADR) cells was down-regulated, achieving the synergistically chemotherapeutic (DOX) and photothermal (AuNRs) effects.

  10. Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

    Science.gov (United States)

    Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

    2017-11-01

    The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Single molecule measurements of DNA helicase activity with magnetic tweezers and t-test based step-finding analysis

    Science.gov (United States)

    Seol, Yeonee; Strub, Marie-Paule; Neuman, Keir C.

    2016-01-01

    Magnetic tweezers is a versatile and easy to implement single-molecule technique that has become increasingly prevalent in the study of nucleic acid based molecular motors. Here, we provide a description of the magnetic tweezers instrument and guidelines for measuring and analyzing DNA helicase activity. Along with experimental methods, we describe a robust method of single-molecule trajectory analysis based on the Student’s t-test that accommodates continuous transitions in addition to the discrete transitions assumed in most widely employed analysis routines. To illustrate the single-molecule unwinding assay and the analysis routine, we provide DNA unwinding measurements of Escherichia coli RecQ helicase under a variety of conditions (Na+, ATP, temperature, and DNA substrate geometry). These examples reveal that DNA unwinding measurements under various conditions can aid in elucidating the unwinding mechanism of DNA helicase but also emphasize that environmental effects on DNA helicase activity must be considered in relation to in vivo activity and mechanism. PMID:27131595

  12. Biosensors for DNA sequence detection

    Science.gov (United States)

    Vercoutere, Wenonah; Akeson, Mark

    2002-01-01

    DNA biosensors are being developed as alternatives to conventional DNA microarrays. These devices couple signal transduction directly to sequence recognition. Some of the most sensitive and functional technologies use fibre optics or electrochemical sensors in combination with DNA hybridization. In a shift from sequence recognition by hybridization, two emerging single-molecule techniques read sequence composition using zero-mode waveguides or electrical impedance in nanoscale pores.

  13. Voltammetric behavior of osmium-labeled DNA at mercury meniscus-modified solid amalgam electrodes. Detecting DNA hybridization

    Czech Academy of Sciences Publication Activity Database

    Josypčuk, Bohdan; Fojta, Miroslav; Havran, Luděk; Heyrovský, Michael; Paleček, Emil

    2006-01-01

    Roč. 18, č. 2 (2006), s. 186-194 ISSN 1040-0397 R&D Projects: GA MPO 1H-PK/42; GA AV ČR IAA4004402; GA AV ČR KJB4004302; GA AV ČR IBS5004355 Institutional research plan: CEZ:AV0Z40400503; CEZ:AV0Z50040507 Keywords : voltammetry * solid amalgam electrodes * DNA-osmium complex * hybridization * catalytic hydrogen evolution Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.444, year: 2006

  14. The objective of this program is to develop innovative DNA detection technologies to achieve fast microbial community assessment. The specific approaches are (1) to develop inexpensive and reliable sequence-proof hybridization DNA detection technology (2) to develop quantitative DNA hybridization technology for microbial community assessment and (3) to study the microbes which have demonstrated the potential to have nuclear waste bioremediation

    International Nuclear Information System (INIS)

    Chen, Chung H.

    2004-01-01

    The objective of this program is to develop innovative DNA detection technologies to achieve fast microbial community assessment. The specific approaches are (1) to develop inexpensive and reliable sequence-proof hybridization DNA detection technology (2) to develop quantitative DNA hybridization technology for microbial community assessment and (3) to study the microbes which have demonstrated the potential to have nuclear waste bioremediation

  15. Single-molecule studies of DNA replication : Visualization of DNA replication by the T7 bacteriophage replisome at a single-molecule level

    NARCIS (Netherlands)

    Geertsema, Hylkje

    2014-01-01

    De replicatie van DNA speelt een centrale rol in het overbrengen van genetische informatie van cel naar cel. Ons DNA wordt gerepliceerd door een machine van verschillende eiwitten, die elk een verschillende taak hebben maar nauw samenwerken. Eén eiwit zorgt er bijvoorbeeld voor dat het dubbelstrengs

  16. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  17. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  18. Enzymatic Amplification of DNA/RNA Hybrid Molecular Beacon Signaling in Nucleic Acid Detection

    OpenAIRE

    Jacroux, Thomas; Rieck, Daniel C.; Cui, Rong; Ouyang, Yexin; Dong, Wen-Ji

    2012-01-01

    A rapid assay operable under isothermal or non-isothermal conditions is described wherein the sensitivity of a typical molecular beacon (MB) system is improved by utilizing thermostable RNase H to enzymatically cleave an MB comprised of a DNA stem and RNA loop (R/D-MB). Upon hybridization of the R/D-MB to target DNA, there was a modest increase in fluorescence intensity (~5.7x above background) due to an opening of the probe and concomitant reduction in the Förster resonance energy transfer e...

  19. "Multicolor" electrochemical labeling of DNA hybridization probes with osmium tetroxide complexes

    Czech Academy of Sciences Publication Activity Database

    Fojta, Miroslav; Kostečka, Pavel; Trefulka, Mojmír; Havran, Luděk; Paleček, Emil

    2007-01-01

    Roč. 79, č. 3 (2007), s. 1022-1029 ISSN 0003-2700 R&D Projects: GA AV ČR(CZ) IAA4004402; GA ČR(CZ) GA203/05/0043; GA ČR(CZ) GA203/04/1325; GA MPO(CZ) 1H-PK/42; GA MŠk(CZ) LC06035 Institutional research plan: CEZ:AV0Z50040507 Keywords : DNA labeling * osmium tetroxide complexes * DNA hybridization Subject RIV: BO - Biophysics Impact factor: 5.287, year: 2007

  20. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Soria, G; Mansilla, S; Belluscio, L; Speroni, J; D' Alessio, C; Gottifredi, V [Fundacion Leloir, Buenos Aires (Argentina); Essers, J; Kanaar, R [Erasmus Medical Center, Rotterdam (Netherlands)

    2009-07-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol {eta} ({eta}). The current model implies that Pol {eta} activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol {eta} behaviour after DNA-damage. We show that Pol {eta} is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol {eta} to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  1. Sub-nuclear irradiation, in-vivo microscopy and single-molecule imaging to study a DNA Polymerase

    International Nuclear Information System (INIS)

    Soria, G.; Mansilla, S.; Belluscio, L.; Speroni, J.; D'Alessio, C.; Gottifredi, V.; Essers, J.; Kanaar, R.

    2009-01-01

    When the DNA is damaged in cells progressing through S phase, replication blockage can be avoided by TLS (Translesion DNA synthesis). This is an auxiliary replication mechanism that relies on the function of specialized polymerases that accomplish DNA damage bypass. An example of a classical TLS polymerase is Pol η (eta). The current model implies that Pol η activity is circumscribed to S-phase. Here we perform a systematic characterization of Pol η behaviour after DNA-damage. We show that Pol η is recruited to UV-induced DNA lesions in cells outside S phase including cells permanently arrested in G1. This observation was confirmed by different sub-nuclear damage strategies including global UV irradiation, local UV irradiation and local multi-photon laser irradiation of single nuclei in living cells. By local UV irradiation and alpha particle irradiation we evaluated the potential connection between Pol h recruitment to DNA lesions outside S phase and Homologous recombination repair (HRR) or Nucleotide excision repair (NER). Finally, we employ a single-molecule imaging approach (known as DNA fiber-assay) to determine how Pol h influences the progression of the replication fork. Our data reveals that the re-localization of Pol η to DNA lesions might be temporally and mechanistically uncoupled from replicative DNA synthesis and from DNA damage processing. (authors)

  2. Blue shift of CdSe/ZnS nanocrystal-labels upon DNA-hybridization

    Directory of Open Access Journals (Sweden)

    Palme Klaus

    2008-05-01

    Full Text Available Abstract Luminescence color multiplexing is one of the most intriguing benefits, which might occur by using semiconductor Quantum Dots (QDs as labels for biomolecules. It was found, that the luminescence of QDs can be quenched, and replaced by a luminescence peak at approximately 460 nm on hybridization with certain regions of Arabidopsis thaliana tissue. This effect is site selective, and it is unclear whether it occurs due to an energy transfer process, or due to quenching and scattering of the excitation light. The article describes methods for phase-transfer of differently coloured, hydrophobically ligated QDs, coupling of DNA strands to the QD's surface, and hybridization of the labelled DNA to different cell types of Arabidopsis thaliana. The reason for the luminescence blue-shift was studied systematically, and narrowed down to the above mentioned causes.

  3. Exciton-controlled fluorescence: application to hybridization-sensitive fluorescent DNA probe.

    Science.gov (United States)

    Okamoto, Akimitsu; Ikeda, Shuji; Kubota, Takeshi; Yuki, Mizue; Yanagisawa, Hiroyuki

    2009-01-01

    A hybridization-sensitive fluorescent probe has been designed for nucleic acid detection, using the concept of fluorescence quenching caused by the intramolecular excitonic interaction of fluorescence dyes. We synthesized a doubly thiazole orange-labeled nucleotide showing high fluorescence intensity for a hybrid with the target nucleic acid and effective quenching for the single-stranded state. This exciton-controlled fluorescent probe was applied to living HeLa cells using microinjection to visualize intracellular mRNA localization. Immediately after injection of the probe into the cell, fluorescence was observed from the probe hybridizing with the target RNA. This fluorescence rapidly decreased upon addition of a competitor DNA. Multicoloring of this probe resulted in the simple simultaneous detection of plural target nucleic acid sequences. This probe realized a large, rapid, reversible change in fluorescence intensity in sensitive response to the amount of target nucleic acid, and facilitated spatiotemporal monitoring of the behavior of intracellular RNA.

  4. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    Science.gov (United States)

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  5. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  6. Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

    Science.gov (United States)

    Paximadis, M; Rey, M E

    2001-12-01

    The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

  7. Universal Huygens's principle of synchronization and coordination in the DNA and cell molecules

    International Nuclear Information System (INIS)

    Gareev, F.A.; Gareeva, G.F.

    2001-01-01

    Full text: Many objects in Nature - elementary particles, nuclei, atoms, molecules, DNA, proteins, etc. are build as self-consistent hierarchical systems and have the same homological construction in the sense that they are found by the same fundamental physical laws: energy-momentum conservation law and sectoral conservation law (the second Kepler law). Schroedinger wrote that an interaction between microscopic physical objects is controlled by specific resonance laws. According to these laws any interaction in a microscopic hierarchic wave system exhibits the resonance character. Due to above said the corresponding partial motion are determinate. This determinism arises as a consequences of the energy conservation law. As the resonance condition arises from the fundamental energy conservation law, the rhythms and synchronization of the majority of phenomena to be observed are the reflection of the universal property of self-organization of the Universe. The Huygens synchronization principle is substantiated at the microscopic level as the consequence of energy conservation law and resonance character of any interaction between wave systems. In this paper we demonstrated the universality of the Huygens synchronization principle independent of substance, fields, and interactions for microsystems. Thereby, webbing some arguments in favor of the mechanism - ORDER from ORDER, declared by Schrodinger is fundamental problem of contemporary science. We came to conclusion that a stable proton and neutron play the role of standard for other elementary particles and nuclei. They contain all necessary information about structure of other particles and nuclei. This information is used and reproduced by simple rational relations, according to the fundamental conservation law of energy momentum. We originated from the principles of commensurability and self-similarity. The commensurability and self-similarity result in the very unity of the world. The principle of

  8. Hybridization change of DNA and nuclear RNA synthesized immediately after ionizing irradiation in spleen cells isolated from 615 mice

    International Nuclear Information System (INIS)

    Meng Ziqiang

    1986-01-01

    DNA hybridization with nuclear RNA(nRNA) synthesized immediately after 60 Co Gamma-irradiation in the spleen cells freshly isolated from inbred line 615 mice was investigated, using the technique of Gillespie and Spiegelman. In RNA/DNA hybridization percentage experiment, it was showed that the hybridization of normal DNA with labelled nRNA synthesized in irradiated cells reached the saturation point at a much faster rate than with labelled normal nRNA. The hybridization percentage of nRNA synthesized in irradiated cells was higher than that of normal nRNA during the different reaction time before the saturation point of DNA with nRNA synthesized in irradiated cells, but it was lower than that of normal nRNA after the zone of high repetitive DNA sequences was stimulated, however, the transcription of some base sequences in the zone of low repetitive DNA sequences was seriously inhibited. Measurements of the exhaustion rates of pulse-labelled nRNA were carried out as described by Greene and Flickinger Biochim. In these studies, pulse-labelled nRNA synthesized in unirradiated and irradiated cells were compared by exhausion with DNA at hybridization time of 4 or 24 hours, When the hybridization time was 4 hours, the nRNA synthesized in irradiated cells displayed a faster exhaustion rate than the control nRNA. But if the hybridization time was 24 hours, the exhaustion rate of nRNA synthesized in irradiated cells reduced. These results demostrated that Gamma-irradiation changed the proportion of transcription of some nRNA species and implayed that the sensitivities of the transcription activeties of the different repetitive DNA sequences to Gamma-irradiation were different, and so were the transcription activeties of the different base sequences in the same repetitive DNA sequences

  9. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio

    2002-01-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  10. Chromosome specific DNA hybridization in suspension for flow cytometric detection of chimerism in bone marrow transplantation and leukemia

    NARCIS (Netherlands)

    G.J.A. Arkesteijn (Ger); C.A.J. Erpelinck (Claudia); A.C.M. Martens (Anton); A. Hagenbeek (Anton)

    1995-01-01

    textabstractFlow cytometry was used to measure the fluorescence intensity of nuclei that were subjected to fluorescent in situ hybridization in suspension with chromosome specific DNA probes. Paraformaldehyde-fixed nuclei were protein digested with trypsin and hybridized simultaneously with a

  11. Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

    Science.gov (United States)

    Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

    2010-04-22

    Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

  12. Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.

    Science.gov (United States)

    Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui

    2017-07-05

    Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.

  13. EVOLUTIONARY RELATIONSHIPS BETWEEN 4 SPECIES OF CLADOPHORA (CLADOPHORALES, CHLOROPHYTA) BASED ON DNA-DNA HYBRIDIZATION

    NARCIS (Netherlands)

    BOT, PVM; BRUSSAARD, CPD; STAM, WT; VANDENHOEK, C

    1991-01-01

    Analysis of the reassociation kinetics of the DNA from Cladophora pellucida (Huds.) Kutz. indicates that the genome of this benthic alga is comprised of approximately 75% repetitive sequences. Single-copy sequences reassociated with a rate constant of 1.8 x 10(-3) M-1.s-1, which corresponds to a

  14. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Directory of Open Access Journals (Sweden)

    Hong Long

    Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  15. Synthesis, spectroscopic and catalytic properties of some new boron hybrid molecule derivatives by BF2 and BPh2 chelation

    Science.gov (United States)

    Kilic, Ahmet; Alcay, Ferhat; Aydemir, Murat; Durgun, Mustafa; Keles, Armagan; Baysal, Akın

    2015-05-01

    A new series of Schiff base ligands (L1-L3) and their corresponding fluorine/phenyl boron hybrid complexes [LnBF2] and [LnBPh2] (n = 1, 2 or 3) have been synthesized and well characterized by both analytical and spectroscopic methods. The Schiff base ligands and their corresponding fluorine/phenyl boron hybrid complexes have been characterized by NMR (1H, 13C and 19F), FT-IR, UV-Vis, LC-MS, and fluorescence spectroscopy as well as melting point and elemental analysis. The fluorescence efficiencies of phenyl chelate complexes are greatly red-shifted compared to those of the fluorine chelate analogs based on the same ligands, presumably due to the large steric hindrance and hard π → π∗ transition of the diphenyl boron chelation, which can effectively prevent molecular aggregation. The boron hybrid complexes were applied to the transfer hydrogenation of acetophenone derivatives to 1-phenylethanol derivatives in the presence of 2-propanol as the hydrogen source. The catalytic studies showed that boron hybrid complexes are good catalytic precursors for transfer hydrogenation of aromatic ketones in 0.1 M iso-PrOH solution. Also, we have found that both steric and electronic factors have a significant impact on the catalytic properties of this class of molecules.

  16. Extensive genetic and DNA methylation variation contribute to heterosis in triploid loquat hybrids.

    Science.gov (United States)

    Liu, Chao; Wang, Mingbo; Wang, Lingli; Guo, Qigao; Liang, Guolu

    2018-04-24

    We aim to overcome the unclear origin of the loquat and elucidate the heterosis mechanism of the triploid loquat. Here we investigated the genetic and epigenetic variations between the triploid plant and its parental lines using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified fragment length polymorphism (MSAP) analyses. We show that in addition to genetic variations, extensive DNA methylation variation occurred during the formation process of triploid loquat, with the triploid hybrid having increased DNA methylation compared to the parents. Furthermore, a correlation existed between genetic variation and DNA methylation remodeling, suggesting that genome instability may lead to DNA methylation variation or vice versa. Sequence analysis of the MSAP bands revealed that over 53% of them overlap with protein-coding genes, which may indicate a functional role of the differential DNA methylation in gene regulation and hence heterosis phenotypes. Consistent with this, the genetic and epigenetic alterations were associated closely to the heterosis phenotypes of triploid loquat, and this association varied for different traits. Our results suggested that the formation of triploid is accompanied by extensive genetic and DNA methylation variation, and these changes contribute to the heterosis phenotypes of the triploid loquats from the two cross lines.

  17. Sequence-selective single-molecule alkylation with a pyrrole-imidazole polyamide visualized in a DNA nanoscaffold.

    Science.gov (United States)

    Yoshidome, Tomofumi; Endo, Masayuki; Kashiwazaki, Gengo; Hidaka, Kumi; Bando, Toshikazu; Sugiyama, Hiroshi

    2012-03-14

    We demonstrate a novel strategy for visualizing sequence-selective alkylation of target double-stranded DNA (dsDNA) using a synthetic pyrrole-imidazole (PI) polyamide in a designed DNA origami scaffold. Doubly functionalized PI polyamide was designed by introduction of an alkylating agent 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI) and biotin for sequence-selective alkylation at the target sequence and subsequent streptavidin labeling, respectively. Selective alkylation of the target site in the substrate DNA was observed by analysis using sequencing gel electrophoresis. For the single-molecule observation of the alkylation by functionalized PI polyamide using atomic force microscopy (AFM), the target position in the dsDNA (∼200 base pairs) was alkylated and then visualized by labeling with streptavidin. Newly designed DNA origami scaffold named "five-well DNA frame" carrying five different dsDNA sequences in its cavities was used for the detailed analysis of the sequence-selectivity and alkylation. The 64-mer dsDNAs were introduced to five individual wells, in which target sequence AGTXCCA/TGGYACT (XY = AT, TA, GC, CG) was employed as fully matched (X = G) and one-base mismatched (X = A, T, C) sequences. The fully matched sequence was alkylated with 88% selectivity over other mismatched sequences. In addition, the PI polyamide failed to attach to the target sequence lacking the alkylation site after washing and streptavidin treatment. Therefore, the PI polyamide discriminated the one mismatched nucleotide at the single-molecule level, and alkylation anchored the PI polyamide to the target dsDNA.

  18. Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

    Science.gov (United States)

    Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

    2015-12-28

    The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.

  19. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  20. Inhibiting prolyl isomerase activity by hybrid organic-inorganic molecules containing rhodium(II) fragments.

    Science.gov (United States)

    Coughlin, Jane M; Kundu, Rituparna; Cooper, Julian C; Ball, Zachary T

    2014-11-15

    A small molecule containing a rhodium(II) tetracarboxylate fragment is shown to be a potent inhibitor of the prolyl isomerase FKBP12. The use of small molecules conjugates of rhodium(II) is presented as a general strategy for developing new protein inhibitors based on distinct structural and sequence features of the enzyme active site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Nanofabrication Yields. Hybridization and Click-Fixation of Polycyclic DNA Nanoassemblies

    KAUST Repository

    Lundberg, Erik P.

    2011-09-27

    We demonstrate the stepwise assembly of a fully addressable polycyclic DNA hexagon nanonetwork for the preparation of a four-ring system, one of the biggest networks yet constructed from tripodal building blocks. We find that the yield exhibits a distinct upper level <100%, a fundamental problem of thermodynamic DNA assembly that appears to have been overlooked in the DNA nanotechnology literature. A simplistic model based on a single step-yield parameter y can quantitatively describe the total yield of DNA assemblies in one-pot reactions as Y = yduplex n, with n the number of hybridization steps. Experimental errors introducing deviations from perfect stoichiometry and the thermodynamics of hybridization equilibria contribute to decreasing the value of yduplex (on average y = 0.96 for our 10 base pair hybridization). For the four-ring system (n = 31), the total yield is thus less than 30%, which is clearly unsatisfactory if bigger nanoconstructs of this class are to be designed. Therefore, we introduced site-specific click chemistry for making and purifying robust building blocks for future modular constructs of larger assemblies. Although the present yield of this robust module was only about 10%, it demonstrates a first step toward a general fabrication approach. Interestingly, we find that the click yields follow quantitatively a binomial distribution, the predictability of which indicates the usefulness of preparing pools of pure and robust building blocks in this way. The binomial behavior indicates that there is no interference between the six simultaneous click reactions but that step-yield limiting factors such as topological constraints and Cu(I) catalyst concentration are local and independent. © 2011 American Chemical Society.

  2. Detection of genetic changes in Barrett's adenocarcinoma and Barrett's esophagus by DNA in situ hybridization and immunohistochemistry

    NARCIS (Netherlands)

    Krishnadath, K. K.; Tilanus, H. W.; Alers, J. C.; Mulder, A. H.; van Dekken, H.

    1994-01-01

    We have investigated the occurrence of chromosomal DNA and cell cycle-related protein changes in Barrett's epithelium and adenocarcinoma. The presence of numerical chromosomal aberrations was studied by applying nonisotopic in situ hybridization (ISH) with (peri-)centromeric DNA probes, specific for

  3. Two human cDNA molecules coding for the Duchenne muscular dystrophy (DMD) locus are highly homologous

    Energy Technology Data Exchange (ETDEWEB)

    Rosenthal, A.; Speer, A.; Billwitz, H. (Zentralinstitut fuer Molekularbiologie, Berlin-Buch (Germany Democratic Republic)); Cross, G.S.; Forrest, S.M.; Davies, K.E. (Univ. of Oxford (England))

    1989-07-11

    Recently the complete sequence of the human fetal cDNA coding for the Duchenne muscular dystrophy (DMD) locus was reported and a 3,685 amino acid long, rod-shaped cytoskeletal protein (dystrophin) was predicted as the protein product. Independently, the authors have isolated and sequenced different DMD cDNA molecules from human adult and fetal muscle. The complete 12.5 kb long sequence of all their cDNA clones has now been determined and they report here the nucleotide (nt) and amino acid (aa) differences between the sequences of both groups. The cDNA sequence comprises the whole coding region but lacks the first 110 nt from the 5{prime}-untranslated region and the last 1,417 nt of the 3{prime}-untranslated region. They have found 11 nt differences (approximately 99.9% homology) from which 7 occurred at the aa level.

  4. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  5. Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

    Science.gov (United States)

    Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

    2007-12-15

    The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

  6. The mitochondrial and plastid genomes of Volvox carteri: bloated molecules rich in repetitive DNA

    Directory of Open Access Journals (Sweden)

    Lee Robert W

    2009-03-01

    Full Text Available Abstract Background The magnitude of noncoding DNA in organelle genomes can vary significantly; it is argued that much of this variation is attributable to the dissemination of selfish DNA. The results of a previous study indicate that the mitochondrial DNA (mtDNA of the green alga Volvox carteri abounds with palindromic repeats, which appear to be selfish elements. We became interested in the evolution and distribution of these repeats when, during a cursory exploration of the V. carteri nuclear DNA (nucDNA and plastid DNA (ptDNA sequences, we found palindromic repeats with similar structural features to those of the mtDNA. Upon this discovery, we decided to investigate the diversity and evolutionary implications of these palindromic elements by sequencing and characterizing large portions of mtDNA and ptDNA and then comparing these data to the V. carteri draft nuclear genome sequence. Results We sequenced 30 and 420 kilobases (kb of the mitochondrial and plastid genomes of V. carteri, respectively – resulting in partial assemblies of these genomes. The mitochondrial genome is the most bloated green-algal mtDNA observed to date: ~61% of the sequence is noncoding, most of which is comprised of short palindromic repeats spread throughout the intergenic and intronic regions. The plastid genome is the largest (>420 kb and most expanded (>80% noncoding ptDNA sequence yet discovered, with a myriad of palindromic repeats in the noncoding regions, which have a similar size and secondary structure to those of the mtDNA. We found that 15 kb (~0.01% of the nuclear genome are homologous to the palindromic elements of the mtDNA, and 50 kb (~0.05% are homologous to those of the ptDNA. Conclusion Selfish elements in the form of short palindromic repeats have propagated in the V. carteri mtDNA and ptDNA, resulting in the distension of these genomes. Copies of these same repeats are also found in a small fraction of the nucDNA, but appear to be inert in this

  7. Hybrid magnet devices for molecule manipulation and small scale high gradient-field applications

    Science.gov (United States)

    Humphries, David E [El Cerrito, CA; Hong, Seok-Cheol [Seoul, KR; Cozzarelli, legal representative, Linda A.; Pollard, Martin J [El Cerrito, CA; Cozzarelli, Nicholas R [Berkeley, CA

    2009-01-06

    The present disclosure provides a high performance hybrid magnetic structure made from a combination of permanent magnets and ferromagnetic pole materials which are assembled in a predetermined array. The hybrid magnetic structure provides means for separation and other biotechnology applications involving holding, manipulation, or separation of magnetizable molecular structures and targets. Also disclosed are hybrid magnetic tweezers able to exert approximately 1 nN of force to 4.5 .mu.m magnetic bead. The maximum force was experimentally measured to be .about.900 pN which is in good agreement with theoretical estimations and other measurements. In addition, a new analysis scheme that permits fast real-time position measurement in typical geometry of magnetic tweezers has been developed and described in detail.

  8. Electrochemically fabricated polyaniline nanowire-modified electrode for voltammetric detection of DNA hybridization

    International Nuclear Information System (INIS)

    Zhu Ningning; Chang Zhu; He Pingang; Fang Yuzhi

    2006-01-01

    A novel and sensitive electrochemical DNA biosensor based on electrochemically fabricated polyaniline nanowire and methylene blue for DNA hybridization detection is presented. Nanowires of conducting polymers were directly synthesized through a three-step electrochemical deposition procedure in an aniline-containing electrolyte solution, by using the glassy carbon electrode (GCE) as the working electrode. The morphology of the polyaniline films was examined using a field emission scanning electron microscope (SEM). The diameters of the nanowires range from 80 to 100 nm. The polyaniline nanowires-coated electrode exhibited very good electrochemical conductivity. Oligonucleotides with phosphate groups at the 5' end were covalently linked onto the amino groups of polyaniline nanowires on the electrode. The hybridization events were monitored with differential pulse voltammetry (DPV) measurement using methylene blue (MB) as an indicator. The approach described here can effectively discriminate complementary from non-complementary DNA sequence, with a detection limit of 1.0 x 10 -12 mol l -1 of complementary target, suggesting that the polyaniline nanowires hold great promises for sensitive electrochemical biosensor applications

  9. AFM Imaging of Hybridization Chain Reaction Mediated Signal Transmission between Two DNA Origami Structures.

    Science.gov (United States)

    Helmig, Sarah; Gothelf, Kurt Vesterager

    2017-10-23

    Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Identification of Putative Coffee Rust Mycoparasites via Single-Molecule DNA Sequencing of Infected Pustules.

    Science.gov (United States)

    James, Timothy Y; Marino, John A; Perfecto, Ivette; Vandermeer, John

    2016-01-15

    The interaction of crop pests with their natural enemies is a fundament to their control. Natural enemies of fungal pathogens of crops are poorly known relative to those of insect pests, despite the diversity of fungal pathogens and their economic importance. Currently, many regions across Latin America are experiencing unprecedented epidemics of coffee rust (Hemileia vastatrix). Identification of natural enemies of coffee rust could aid in developing management strategies or in pinpointing species that could be used for biocontrol. In the present study, we characterized fungal communities associated with coffee rust lesions by single-molecule DNA sequencing of fungal rRNA gene bar codes from leaf discs (≈28 mm(2)) containing rust lesions and control discs with no rust lesions. The leaf disc communities were hyperdiverse in terms of fungi, with up to 69 operational taxonomic units (putative species) per control disc, and the diversity was only slightly reduced in rust-infected discs, with up to 63 putative species. However, geography had a greater influence on the fungal community than whether the disc was infected by coffee rust. Through comparisons between control and rust-infected leaf discs, as well as taxonomic criteria, we identified 15 putative mycoparasitic fungi. These fungi are concentrated in the fungal family Cordycipitaceae and the order Tremellales. These data emphasize the complexity of diverse fungi of unknown ecological function within a leaf that might influence plant disease epidemics or lead to the development of species for biocontrol of fungal disease. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  12. DNA hybridization evidence for the Australasian affinity of the American marsupial Dromiciops australis.

    Science.gov (United States)

    Kirsch, J A; Dickerman, A W; Reig, O A; Springer, M S

    1991-01-01

    DNA hybridization was used to compare representatives of the major groups of marsupials and a eutherian outgroup. Because of the large genetic distances separating marsupial families, trees were calculated from normalized percentages of hybridization; thermal-melting statistics, however, gave identical topologies for the well-supported clades. The most notable results were the association of the only extant microbiotheriid, Dromiciops australis, an American marsupial, with the Australasian Diprotodontia, and of both together with the Dasyuridae. Estimates of the rate of divergence among marsupial genomes suggest that the Dromiciops-Diprotodontia split occurred approximately 50 million years ago, well after the establishment of the major clades of marsupials but before deep oceanic barriers prohibited dispersal among Australia, Antarctica, and South America. Because Dromiciops is nested within an Australasian group, it seems likely that dispersal from Australia accounts for its present distribution. Images PMID:1961710

  13. RNA/DNA Hybrid Interactome Identifies DXH9 as a Molecular Player in Transcriptional Termination and R-Loop-Associated DNA Damage.

    Science.gov (United States)

    Cristini, Agnese; Groh, Matthias; Kristiansen, Maiken S; Gromak, Natalia

    2018-05-08

    R-loops comprise an RNA/DNA hybrid and displaced single-stranded DNA. They play important biological roles and are implicated in pathology. Even so, proteins recognizing these structures are largely undefined. Using affinity purification with the S9.6 antibody coupled to mass spectrometry, we defined the RNA/DNA hybrid interactome in HeLa cells. This consists of known R-loop-associated factors SRSF1, FACT, and Top1, and yet uncharacterized interactors, including helicases, RNA processing, DNA repair, and chromatin factors. We validate specific examples of these interactors and characterize their involvement in R-loop biology. A top candidate DHX9 helicase promotes R-loop suppression and transcriptional termination. DHX9 interacts with PARP1, and both proteins prevent R-loop-associated DNA damage. DHX9 and other interactome helicases are overexpressed in cancer, linking R-loop-mediated DNA damage and disease. Our RNA/DNA hybrid interactome provides a powerful resource to study R-loop biology in health and disease. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

    Science.gov (United States)

    Yamamoto, F; Yamamoto, M

    2004-07-01

    We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

  15. Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

    Science.gov (United States)

    Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

    2013-04-08

    Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

  16. Counting molecules in cell-free DNA and single cells RNA

    OpenAIRE

    Karlsson, Kasper

    2016-01-01

    The field of Molecular Biology got started in earnest with the discovery of the molecular structure of DNA. This lead to a surge of interest into the relationships between DNA, RNA and proteins, and to the development of fundamental tools for manipulating those substances, such as cutting, ligating, amplifying, visualizing and size-selecting DNA. With these tools at hand it was possible to begin sequencing DNA, a process that took a leap forward in 2005 with the advent of Next Generation Sequ...

  17. A single thiazole orange molecule forms an exciplex in a DNA i-motif.

    Science.gov (United States)

    Xu, Baochang; Wu, Xiangyang; Yeow, Edwin K L; Shao, Fangwei

    2014-06-18

    A fluorescent exciplex of thiazole orange (TO) is formed in a single-dye conjugated DNA i-motif. The exciplex fluorescence exhibits a large Stokes shift, high quantum yield, robust response to pH oscillation and little structural disturbance to the DNA quadruplex, which can be used to monitor the folding of high-order DNA structures.

  18. Label-free detection of DNA hybridization using transistors based on CVD grown graphene.

    Science.gov (United States)

    Chen, Tzu-Yin; Loan, Phan Thi Kim; Hsu, Chang-Lung; Lee, Yi-Hsien; Tse-Wei Wang, Jacob; Wei, Kung-Hwa; Lin, Cheng-Te; Li, Lain-Jong

    2013-03-15

    The high transconductance and low noise of graphene-based field-effect transistors based on large-area monolayer graphene produced by chemical vapor deposition are used for label-free electrical detection of DNA hybridization. The gate materials, buffer concentration and surface condition of graphene have been optimized to achieve the DNA detection sensitivity as low as 1 pM (10(-12) M), which is more sensitive than the existing report based on few-layer graphene. The graphene films obtained using conventional PMMA-assisted transfer technique exhibits PMMA residues, which degrade the sensing performance of graphene. We have demonstrated that the sensing performance of the graphene samples prepared by gold-transfer is largely enhanced (by 125%). Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  20. Reticulate evolution: frequent introgressive hybridization among chinese hares (genus lepus revealed by analyses of multiple mitochondrial and nuclear DNA loci

    Directory of Open Access Journals (Sweden)

    Wu Shi-Fang

    2011-07-01

    Full Text Available Abstract Background Interspecific hybridization may lead to the introgression of genes and genomes across species barriers and contribute to a reticulate evolutionary pattern and thus taxonomic uncertainties. Since several previous studies have demonstrated that introgressive hybridization has occurred among some species within Lepus, therefore it is possible that introgressive hybridization events also occur among Chinese Lepus species and contribute to the current taxonomic confusion. Results Data from four mtDNA genes, from 116 individuals, and one nuclear gene, from 119 individuals, provides the first evidence of frequent introgression events via historical and recent interspecific hybridizations among six Chinese Lepus species. Remarkably, the mtDNA of L. mandshuricus was completely replaced by mtDNA from L. timidus and L. sinensis. Analysis of the nuclear DNA sequence revealed a high proportion of heterozygous genotypes containing alleles from two divergent clades and that several haplotypes were shared among species, suggesting repeated and recent introgression. Furthermore, results from the present analyses suggest that Chinese hares belong to eight species. Conclusion This study provides a framework for understanding the patterns of speciation and the taxonomy of this clade. The existence of morphological intermediates and atypical mitochondrial gene genealogies resulting from frequent hybridization events likely contribute to the current taxonomic confusion of Chinese hares. The present study also demonstrated that nuclear gene sequence could offer a powerful complementary data set with mtDNA in tracing a complete evolutionary history of recently diverged species.

  1. Inclusion of methoxy groups inverts the thermodynamic stabilities of DNA-RNA hybrid duplexes: A molecular dynamics simulation study.

    Science.gov (United States)

    Suresh, Gorle; Priyakumar, U Deva

    2015-09-01

    Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. B-G cDNA clones have multiple small repeats and hybridize to both chicken MHC regions

    DEFF Research Database (Denmark)

    Kaufman, J; Salomonsen, J; Skjødt, K

    1989-01-01

    We used rabbit antisera to the chicken MHC erythrocyte molecule B-G and to the class I alpha chain (B-F) to screen lambda gt11 cDNA expression libraries made with RNA selected by oligo-dT from bone marrow cells of anemic B19 homozygous chickens. Eight clones were found to encode B-G molecules which...

  3. Stabilization of Pt nanoparticles by single stranded DNA and the binary assembly of Au and Pt nanoparticles without hybridization

    International Nuclear Information System (INIS)

    Yang, J.; Lee, Jim Yang; Too, Heng-Phon; Chow, Gan-Moog; Gan, Leong M.

    2006-01-01

    The non-specific interaction between single stranded DNA (ssDNA) and 12 nm Pt nanoparticles is investigated in this work. The data show a strong and non-specific interaction between the two which can be exploited for the stabilization of Pt nanoparticles in aqueous solutions. Based on the experimental findings, a non-hybridization based protocol to assemble 17 nm Au and Pt nanoparticles (12 nm cubic and 3.6 nm spherical) by single-stranded DNA was developed. Transmission electron microscopy (TEM) and UV-visible spectroscopy confirmed that Au and Pt nanoparticles could be assembled by the non-specific interaction in an orderly manner. The experimental results also caution against the potential pitfalls in using DNA melting point analysis to infer metal nanoparticle assembly by DNA hybridization

  4. Comparison of field-collected ascovirus isolates by DNA hybridization, host range, and histopathology.

    Science.gov (United States)

    Hamm, J J; Styer, E L; Federici, B A

    1998-09-01

    Six field-collected ascovirus isolates obtained from five noctuid species in the continental United States were compared with respect to the general relatedness of their DNA, host range, and histopathology. Two isolates were from Spodoptera frugiperda, and the other four were from Autographa precationis, Heliothis virescens, Helicoverpa zea, and Trichoplusia ni. DNA-DNA hybridization studies showed that the six isolates belonged to three distinct viral species, with the isolates from S. frugiperda composing one species, those from A. precationis and H. virescens a second species, and those from H. zea and T. ni a third species. The host range and histopathology of each isolate was studied in eight noctuid species, S. frugiperda, Spodoptera ornithogalli, Spodoptera exigua, Spodoptera eridania, H. virescens, H. zea, A. precationis, and Feltia subterranea. Though some variation existed between the different isolates of each viral species, distinct patterns were apparent for each. The viral species from S. frugiperda had a host range that was limited primarily to Spodoptera species and both isolates of this virus only replicated and caused significant pathology in the fat body, whereas the viral species from A. precationis and H. virescens had a much broader host range that included most of the species tested, but also had a tissue tropism primarily restricted to the fat body. The viral species from T. ni and H. zea readily infected all the hosts tested, where the principal site of replication and significant pathology was the epidermis. In many test hosts, however, this viral species also replicated and caused significant pathology in the tracheal epithelium and to a lesser extent in the fat body. Aside from contributing to knowledge of ascovirus biology, these studies indicate that DNA hybridization profiles combined with studies of host range and tissue tropism can be used as characters for defining ascovirus species. Copyright 1998 Academic Press.

  5. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  6. Studies of G-quadruplex DNA structures at the single molecule level

    DEFF Research Database (Denmark)

    Kragh, Sofie Louise

    2015-01-01

    Folding of G-quaduplex structures adopted by the human telomeric repeat is here studied by single molecule FRET microscopy. This method allows for the investigation of G-quadruplex structures and their conformational dynamic. Telomeres are located at the ends of our chromosomes and end in a single...... with human telomeric repeat adopt several different G-quadruplex conformations in the presence of K+ ions. G-quadruplexes inhibit telomerase activity and are therefore potential targets for anti-cancer drugs, which can be small molecule ligands capable of stabilizing G-quadruplex structures. Understanding...... range. FRET spectroscopy can be performed on an ensemble of molecules, or on the single molecule level. In single molecule FRET experiments it is possible to follow the behaviour in time for each molecule independently, allowing insight into both dynamically and statistically heterogeneous molecular...

  7. Guanine is indispensable for immunoglobulin switch region RNA-DNA hybrid formation

    International Nuclear Information System (INIS)

    Mizuta, Ryushin; Mizuta, Midori; Kitamura, Daisuke

    2005-01-01

    It is suggested that the formation of the switch (S) region RNA-DNA hybrid and the subsequent generation of higher-order chromatin structures including R-loop initiate a class switch recombination of the immunoglobulin gene. The primary factor of this recombination is the S-region derived noncoding RNA. However, the biochemical character of this guanine-rich (G-rich) transcript is poorly understood. The present study was performed to analyze the structure of this G-rich RNA using atomic force microscope (AFM). The in vitro transcribed S-region RNA was spread on a mica plate, air-dried and observed by non-contact mode AFM in air. The G-rich transcripts tend to aggregate on the template DNA and to generate a higher-order RNA-DNA complex. However, the transcripts that incorporated guanine analogues as substitutes for guanine neither aggregated nor generated higher-order structures. Incorporation of guanine analogues in transcribes RNA partially disrupts hydrogen bonds related to guanine, such as Watson-Crick GC-base pair and Hoogsteen bond GG-base pair. Thus, aggregation of S-region RNA and generation of the higher-order RNA-DNA complex are attributed to hydrogen bonds of guanine. (author)

  8. DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

    Science.gov (United States)

    Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

    2009-03-01

    The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

  9. Comparative genomic analysis of single-molecule sequencing and hybrid approaches for finishing the Clostridium autoethanogenum JA1-1 strain DSM 10061 genome

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Steven D [ORNL; Nagaraju, Shilpa [LanzaTech; Utturkar, Sagar M [ORNL; De Tissera, Sashini [LanzaTech; Segovia, Simón [LanzaTech; Mitchell, Wayne [LanzaTech; Land, Miriam L [ORNL; Dassanayake, Asela [LanzaTech; Köpke, Michael [LanzaTech

    2014-01-01

    Background Clostridium autoethanogenum strain JA1-1 (DSM 10061) is an acetogen capable of fermenting CO, CO2 and H2 (e.g. from syngas or waste gases) into biofuel ethanol and commodity chemicals such as 2,3-butanediol. A draft genome sequence consisting of 100 contigs has been published. Results A closed, high-quality genome sequence for C. autoethanogenum DSM10061 was generated using only the latest single-molecule DNA sequencing technology and without the need for manual finishing. It is assigned to the most complex genome classification based upon genome features such as repeats, prophage, nine copies of the rRNA gene operons. It has a low G + C content of 31.1%. Illumina, 454, Illumina/454 hybrid assemblies were generated and then compared to the draft and PacBio assemblies using summary statistics, CGAL, QUAST and REAPR bioinformatics tools and comparative genomic approaches. Assemblies based upon shorter read DNA technologies were confounded by the large number repeats and their size, which in the case of the rRNA gene operons were ~5 kb. CRISPR (Clustered Regularly Interspaced Short Paloindromic Repeats) systems among biotechnologically relevant Clostridia were classified and related to plasmid content and prophages. Potential associations between plasmid content and CRISPR systems may have implications for historical industrial scale Acetone-Butanol-Ethanol (ABE) fermentation failures and future large scale bacterial fermentations. While C. autoethanogenum contains an active CRISPR system, no such system is present in the closely related Clostridium ljungdahlii DSM 13528. A common prophage inserted into the Arg-tRNA shared between the strains suggests a common ancestor. However, C. ljungdahlii contains several additional putative prophages and it has more than double the amount of prophage DNA compared to C. autoethanogenum. Other differences include important metabolic genes for central metabolism (as an additional hydrogenase and the absence of a

  10. Photophysical properties of novel small acceptor molecules and their application in hybrid small-molecular/polymeric organic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Inal, Sahika; Castellani, Mauro; Neher, Dieter [Universitaet Potsdam, Institut fuer Physik und Astronomie, Potsdam-Golm (Germany); Sellinger, Alan [Institute of Materials Research and Engineering, Singapore (Singapore)

    2009-07-01

    Recent experimental investigations revealed that the photovoltaic properties of our devices are related to the balance between recombination and field-induced dissociation of interfacial excited states such as exciplexes or geminate polaron pairs. This balance was shown to be affected by the nanomorphology at the heterojunction. We have analyzed the photophysical properties of a new materials couple comprising an electron-donating PPV copolymer and a vinazene-based small molecule acceptor. Steady state and time-resolved photoluminescence (PL) spectroscopy in solution and in the solid state showed the formation of excimers within the acceptor. The associated long-range diffusion promise efficient energy harvesting at the heterojunction. On the other hand, blends of the PPV-derivative and the small molecule revealed strong exciplex formation. Therefore, bilayered hybrid small-molecular/polymeric solar cells have been fabricated by consequently spin-coating the macromolecular donor and the small molecule acceptor from two different solvents. The bilayer architecture limits recombination processes enabling high FFs of around 44% and a technologically important open circuit voltage of 1Volt.

  11. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  12. Patterns of DNA methylation in development, division of labor and hybridization in an ant with genetic caste determination.

    Directory of Open Access Journals (Sweden)

    Chris R Smith

    Full Text Available BACKGROUND: DNA methylation is a common regulator of gene expression, including acting as a regulator of developmental events and behavioral changes in adults. Using the unique system of genetic caste determination in Pogonomyrmex barbatus, we were able to document changes in DNA methylation during development, and also across both ancient and contemporary hybridization events. METHODOLOGY/PRINCIPAL FINDINGS: Sodium bisulfite sequencing demonstrated in vivo methylation of symmetric CG dinucleotides in P. barbatus. We also found methylation of non-CpG sequences. This validated two bioinformatics methods for predicting gene methylation, the bias in observed to expected ratio of CpG dinucleotides and the density of CpG/TpG single nucleotide polymorphisms (SNP. Frequencies of genomic DNA methylation were determined for different developmental stages and castes using ms-AFLP assays. The genetic caste determination system (GCD is probably the product of an ancestral hybridization event between P. barbatus and P. rugosus. Two lineages obligately co-occur within a GCD population, and queens are derived from intra-lineage matings whereas workers are produced from inter-lineage matings. Relative DNA methylation levels of queens and workers from GCD lineages (contemporary hybrids were not significantly different until adulthood. Virgin queens had significantly higher relative levels of DNA methylation compared to workers. Worker DNA methylation did not vary among developmental stages within each lineage, but was significantly different between the currently hybridizing lineages. Finally, workers of the two genetic caste determination lineages had half as many methylated cytosines as workers from the putative parental species, which have environmental caste determination. CONCLUSIONS/SIGNIFICANCE: These results suggest that DNA methylation may be a conserved regulatory mechanism moderating division of labor in both bees and ants. Current and historic

  13. Geant4-DNA coupling and validation in the GATE Monte Carlo platform for DNA molecules irradiation in a calculation grid environment

    International Nuclear Information System (INIS)

    Pham, Quang Trung

    2014-01-01

    The Monte Carlo simulation methods are successfully being used in various areas of medical physics but also at different scales, for example, from the radiation therapy treatment planning systems to the prediction of the effects of radiation in cancer cells. The Monte Carlo simulation platform GATE based on the Geant4 tool-kit offers features dedicated to simulations in medical physics (nuclear medicine and radiotherapy). For radiobiology applications, the Geant4-DNA physical models are implemented to track particles till very low energy (eV) and are adapted for estimation of micro-dosimetric quantities. In order to implement a multi-scale Monte Carlo platform, we first validated the physical models of Geant4-DNA, and integrated them into GATE. Finally, we validated this implementation in the context of radiation therapy and proton therapy. In order to validate the Geant4-DNA physical models, dose point kernels for monoenergetic electrons (10 keV to 100 keV) were simulated using the physical models of Geant4-DNA and were compared to those simulated with Geant4 Standard physical models and another Monte Carlo code EGSnrc. The range and the stopping powers of electrons (7.4 eV to 1 MeV) and protons (1 keV to 100 MeV) calculated with GATE/Geant4-DNA were then compared with literature. We proposed to simulate with the GATE platform the impact of clinical and preclinical beams on cellular DNA. We modeled a clinical proton beam of 193.1 MeV, 6 MeV clinical electron beam and a X-ray irradiator beam. The beams models were validated by comparing absorbed dose computed and measured in liquid water. Then, the beams were used to calculate the frequency of energy deposits in DNA represented by different geometries. First, the DNA molecule was represented by small cylinders: 2 nm x 2 nm (∼10 bp), 5 nm x 10 nm (nucleosome) and 25 nm x 25 nm (chromatin fiber). All these cylinders were placed randomly in a sphere of liquid water (500 nm radius). Then we reconstructed the DNA

  14. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  15. Direct Atomic Force Microscopy Observation of DNA Tile Crystal Growth at the Single-Molecule Level

    OpenAIRE

    Evans, Constantine G.; Hariadi, Rizal F.; Winfree, Erik

    2012-01-01

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detach...

  16. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  17. AFM Imaging of Hybridization Chain Reaction-Mediated Signal Transmission Between two DNA Origami Structures

    DEFF Research Database (Denmark)

    Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager

    2017-01-01

    transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...

  18. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    International Nuclear Information System (INIS)

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.

    1990-01-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus

  19. Resolution-improved in situ DNA hybridization detection based on microwave photonic interrogation.

    Science.gov (United States)

    Cao, Yuan; Guo, Tuan; Wang, Xudong; Sun, Dandan; Ran, Yang; Feng, Xinhuan; Guan, Bai-ou

    2015-10-19

    In situ bio-sensing system based on microwave photonics filter (MPF) interrogation method with improved resolution is proposed and experimentally demonstrated. A microfiber Bragg grating (mFBG) is used as sensing probe for DNA hybridization detection. Different from the traditional wavelength monitoring technique, we use the frequency interrogation scheme for resolution-improved bio-sensing detection. Experimental results show that the frequency shift of MPF notch presents a linear response to the surrounding refractive index (SRI) change over the range of 1.33 to 1.38, with a SRI resolution up to 2.6 × 10(-5) RIU, which has been increased for almost two orders of magnitude compared with the traditional fundamental mode monitoring technique (~3.6 × 10(-3) RIU). Due to the high Q value (about 27), the whole process of DNA hybridization can be in situ monitored. The proposed MPF-based bio-sensing system provides a new interrogation method over the frequency domain with improved sensing resolution and rapid interrogation rate for biochemical and environmental measurement.

  20. Direct atomic force microscopy observation of DNA tile crystal growth at the single-molecule level.

    Science.gov (United States)

    Evans, Constantine G; Hariadi, Rizal F; Winfree, Erik

    2012-06-27

    While the theoretical implications of models of DNA tile self-assembly have been extensively researched and such models have been used to design DNA tile systems for use in experiments, there has been little research testing the fundamental assumptions of those models. In this paper, we use direct observation of individual tile attachments and detachments of two DNA tile systems on a mica surface imaged with an atomic force microscope (AFM) to compile statistics of tile attachments and detachments. We show that these statistics fit the widely used kinetic Tile Assembly Model and demonstrate AFM movies as a viable technique for directly investigating DNA tile systems during growth rather than after assembly.

  1. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  2. ZRBA1, a Mixed EGFR/DNA Targeting Molecule, Potentiates Radiation Response Through Delayed DNA Damage Repair Process in a Triple Negative Breast Cancer Model

    Energy Technology Data Exchange (ETDEWEB)

    Heravi, Mitra [Department of Human Genetics, McGill University, Montreal (Canada); Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Kumala, Slawomir [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada); Rachid, Zakaria; Jean-Claude, Bertrand J. [Cancer Drug Research Laboratory, McGill University Health Center, Montreal (Canada); Radzioch, Danuta [Department of Human Genetics, McGill University, Montreal (Canada); Muanza, Thierry M., E-mail: tmuanza@yahoo.com [Department of Radiation Oncology, McGill University, Montreal (Canada); Segal Cancer Center, Jewish General Hospital, Montreal (Canada)

    2015-06-01

    Purpose: ZRBA1 is a combi-molecule designed to induce DNA alkylating lesions and to block epidermal growth factor receptor (EGFR) TK domain. Inasmuch as ZRBA1 downregulates the EGFR TK-mediated antisurvival signaling and induces DNA damage, we postulated that it might be a radiosensitizer. The aim of this study was to further investigate the potentiating effect of ZRBA1 in combination with radiation and to elucidate the possible mechanisms of interaction between these 2 treatment modalities. Methods and Materials: The triple negative human breast MDA-MB-468 cancer cell line and mouse mammary cancer 4T1 cell line were used in this study. Clonogenic assay, Western blot analysis, and DNA damage analysis were performed at multiple time points after treatment. To confirm our in vitro findings, in vivo tumor growth delay assay was performed. Results: Our results show that a combination of ZRBA1 and radiation increases the radiation sensitivity of both cell lines significantly with a dose enhancement factor of 1.56, induces significant numbers of DNA strand breaks, prolongs higher DNA damage up to 24 hours after treatment, and significantly increases tumor growth delay in a syngeneic mouse model. Conclusions: Our data suggest that the higher efficacy of this combination could be partially due to increased DNA damage and delayed DNA repair process and to the inhibition of EGFR. The encouraging results of this combination demonstrated a significant improvement in treatment efficiency and therefore could be applicable in early clinical trial settings.

  3. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  4. Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization

    Science.gov (United States)

    Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

    2015-06-01

    Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

  5. Targeting Jurkat T Lymphocyte Leukemia Cells by an Engineered Interferon-Alpha Hybrid Molecule

    Directory of Open Access Journals (Sweden)

    Dehai Yu

    2017-06-01

    Full Text Available Background/Aims: Adult T-cell leukemia/lymphoma (ATL is a very aggressive T cell malignancy that carries a poor prognosis, primarily due to its resistance to chemotherapy and to life-threatening infectious complications. Interferon-alpha (IFNα has been used in combination with the anti-retroviral drug zidovudine to treat patients with ATL. However, the efficacy of long-term therapy is significantly limited due to the systemic toxicity of IFNα. Methods: We utilized phage display library screening to identify short peptides that specifically bind to Jurkat T lymphocyte leukemia cells. By fusing the Jurkat-binding peptide to the C-terminus of IFNα, we constructed an engineered chimeric IFNα molecule (IFNP for the treatment of ATL. Results: We found that IFNP exhibited significantly higher activity than wild type IFNα in inhibiting the growth of leukemia cells and inducing cell blockage at the G0/G1 phase. The synthetic IFNP molecule exerted its antitumor activity by upregulating the downstream genes involved in the STAT1 pathway and in apoptosis. Using a cell receptor binding assay, we showed that this Jurkat-binding peptide facilitated the binding affinity of IFNα to the cell surface type I IFN receptor. Conclusion: The isolated Jurkat-binding peptide significantly potentiates the therapeutic activity of IFNα in T lymphocyte leukemia cells. The engineered IFNP molecule may prove to a novel antitumor approach in the treatment of patients with ATL.

  6. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  7. DNA Methylation Alterations at 5'-CCGG Sites in the Interspecific and Intraspecific Hybridizations Derived from Brassica rapa and B. napus.

    Directory of Open Access Journals (Sweden)

    Wanshan Xiong

    Full Text Available DNA methylation is an important regulatory mechanism for gene expression that involved in the biological processes of development and differentiation in plants. To investigate the association of DNA methylation with heterosis in Brassica, a set of intraspecific hybrids in Brassica rapa and B. napus and interspecific hybrids between B. rapa and B. napus, together with parental lines, were used to monitor alterations in cytosine methylation at 5'-CCGG sites in seedlings and buds by methylation-sensitive amplification polymorphism analysis. The methylation status of approximately a quarter of the methylation sites changed between seedlings and buds. These alterations were related closely to the genomic structure and heterozygous status among accessions. The methylation status in the majority of DNA methylation sites detected in hybrids was the same as that in at least one of the parental lines in both seedlings and buds. However, the association between patterns of cytosine methylation and heterosis varied among different traits and between tissues in hybrids of Brassica, although a few methylation loci were associated with heterosis. Our data suggest that changes in DNA methylation at 5'-CCGG sites are not associated simply with heterosis in the interspecific and intraspecific hybridizations derived from B. rapa and B. napus.

  8. Probing into hybrid organic-molecule and InAs quantum-dots nanosystem with multistacked dots-in-a-well units

    DEFF Research Database (Denmark)

    Chen, Miaoxiang Max; Kobashi, Kazufumi

    2012-01-01

    Hybridizing air-stable organic-molecules with advanced III-V semiconductor quantum-dots (QDs) structures can be utilized to create a new generation of biochemical sensing devices. In order to enhance their optical performances, the active regions in these QDs structures commonly consist of multis......Hybridizing air-stable organic-molecules with advanced III-V semiconductor quantum-dots (QDs) structures can be utilized to create a new generation of biochemical sensing devices. In order to enhance their optical performances, the active regions in these QDs structures commonly consist...

  9. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  10. The mouse hybrid zone in Central Europe: from morphology to molecules

    Czech Academy of Sciences Publication Activity Database

    Ďureje, Ľudovít; Macholán, Miloš; Baird, Stuart J. E.; Piálek, Jaroslav

    2012-01-01

    Roč. 61, 3-4 (2012), s. 308-318 ISSN 0139-7893 R&D Projects: GA ČR GA206/08/0640 Institutional support: RVO:68081766 ; RVO:67985904 Keywords : geography * introgression * mtDNA * Mus musculus musculus * Mus musculus domesticus * X chromosome * Y chromosome Subject RIV: EG - Zoology; EB - Genetics ; Molecular Biology (UZFG-Y) Impact factor: 0.494, year: 2012

  11. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  12. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an

  13. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH).

    Science.gov (United States)

    Cortés-Gutiérrez, Elva I; Ortíz-Hernández, Brenda L; Dávila-Rodríguez, Martha I; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

    2013-02-19

    We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  14. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH

    Directory of Open Access Journals (Sweden)

    Jaime Gosálvez

    2013-02-01

    Full Text Available We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH. A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL, 10 with high-grade SIL (HG-SIL, and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  15. Detection of a variable number of ribosomal DNA loci by fluorescent in situ hybridization in Populus species.

    Science.gov (United States)

    Prado, E A; Faivre-Rampant, P; Schneider, C; Darmency, M A

    1996-10-01

    Fluorescent in situ hybridization (FISH) was applied to related Populus species (2n = 19) in order to detect rDNA loci. An interspecific variability in the number of hybridization sites was revealed using as probe an homologous 25S clone from Populus deltoides. The application of image analysis methods to measure fluorescence intensity of the hybridization signals has enabled us to characterize major and minor loci in the 18S-5.8S-25S rDNA. We identified one pair of such rDNA clusters in Populus alba; two pairs, one major and one minor, in both Populus nigra and P. deltoides; and three pairs in Populus balsamifera, (two major and one minor) and Populus euroamericana (one major and two minor). FISH results are in agreement with those based on RFLP analysis. The pBG13 probe containing 5S sequence from flax detected two separate clusters corresponding to the two size classes of units that coexist within 5S rDNA of most Populus species. Key words : Populus spp., fluorescent in situ hybridization, FISH, rDNA variability, image analysis.

  16. Development of Ionic Liquid Modified Disposable Graphite Electrodes for Label-Free Electrochemical Detection of DNA Hybridization Related to Microcystis spp.

    Directory of Open Access Journals (Sweden)

    Ceren Sengiz

    2015-09-01

    Full Text Available In this present study, ionic liquid (1-butyl-3-methylimidazolium hexafluorophosphate (IL modified pencil graphite electrode (IL-PGEs was developed for electrochemical monitoring of DNA hybridization related to Microcystis spp. (MYC. The characterization of IL-PGEs was performed using microscopic and electrochemical techniques. DNA hybridization related to MYC was then explored at the surface of IL-PGEs using differential pulse voltammetry (DPV technique. After the experimental parameters were optimized, the sequence-selective DNA hybridization related to MYC was performed in the case of hybridization between MYC probe and its complementary DNA target, noncomplementary (NC or mismatched DNA sequence (MM, or and in the presence of mixture of DNA target: NC (1:1 and DNA target: MM (1:1.

  17. MITOCHONDRIAL DNA ANALYSES AND THE ORIGIN AND RELATIVE AGE OF PARTHENOGENETIC CNEMIDOPHORUS: PHYLOGENETIC CONSTRAINTS ON HYBRID ORIGINS.

    Science.gov (United States)

    Moritz, C; Wright, J W; Brown, W M

    1992-02-01

    Within the genus Cnemidophorus, parthenogenesis has arisen by hybridization several times. This provides the opportunity to investigate general features of hybridization events that result in the formation of parthenogenetic lineages. The relationships of mtDNA from all bisexual species of Cnemidophorus known to be parents of parthenogens were investigated to evaluate phylogenetic constraints on the hybrid-origin of parthenogenesis. No phylogenetic clustering of the parental species, either maternal or paternal, was apparent. However, the combination of bisexual species that have resulted in parthenogenetic lineages are generally distantly related or genetically divergent. This contrasts with the expectation if parthenogenesis in hybrids is due to the action of a single rare allele, but is consistent with the hypothesis that some minimal level of divergence is necessary to stimulate parthenogenetic reproduction in hybrids. © 1992 The Society for the Study of Evolution.

  18. 77 FR 54584 - Final Action Under the NIH Guidelines for Research Involving Recombinant DNA Molecules (NIH...

    Science.gov (United States)

    2012-09-05

    ... changes. Human gene transfer also raises scientific, medical, social, and ethical considerations that... currently reviewed under Section III-B-1, Experiments Involving the Cloning of Toxin Molecules with LD50 of...

  19. Patterns of DNA Methylation in Development, Division of Labor and Hybridization in an Ant with Genetic Caste Determination

    OpenAIRE

    Smith, Chris R.; Mutti, Navdeep S.; Jasper, W. Cameron; Naidu, Agni; Smith, Christopher D.; Gadau, Jürgen

    2012-01-01

    BACKGROUND: DNA methylation is a common regulator of gene expression, including acting as a regulator of developmental events and behavioral changes in adults. Using the unique system of genetic caste determination in Pogonomyrmex barbatus, we were able to document changes in DNA methylation during development, and also across both ancient and contemporary hybridization events. METHODOLOGY/PRINCIPAL FINDINGS: Sodium bisulfite sequencing demonstrated in vivo methylation of symmetric CG dinucle...

  20. Detection of human DNA polymorphisms with a simplified denaturing gradient gel electrophoresis technique.

    OpenAIRE

    Noll, W W; Collins, M

    1987-01-01

    Single base pair differences between otherwise identical DNA molecules can result in altered melting behavior detectable by denaturing gradient gel electrophoresis. We have developed a simplified procedure for using denaturing gradient gel electrophoresis to detect base pair changes in genomic DNA. Genomic DNA is digested with restriction enzymes and hybridized in solution to labeled single-stranded probe DNA. The excess probe is then hybridized to complementary phage M13 template DNA, and th...

  1. Interaction of Proliferating Cell Nuclear Antigen With DNA at the Single Molecule Level

    KAUST Repository

    Raducanu, Vlad-Stefan

    2016-01-01

    Proliferating cell nuclear antigen (PCNA) is a key factor involved in Eukaryotic DNA replication and repair, as well as other cellular pathways. Its importance comes mainly from two aspects: the large numbers of interacting partners

  2. Size and number of DNA molecules from Chinese hamster ovary cells determined by molecular autoradiography

    International Nuclear Information System (INIS)

    Todd, M.B.

    1980-06-01

    A new method for visualization of separable subunits of DNA is described. Autoradiography of tritium-labeled DNA from one or a few nuclei, lysed with detergent, moderate salt, and proteases, and gently deposited on a filter, allows determination of subunit molecular weight, size distribution, number per nucleus, and organization. The shape of the size distribution of CHO subunit images is similar to that of CHO mitotic chromosomes, and the numbers of subunits per nucleus supports a model of eight subunits per chromosome

  3. Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

    Science.gov (United States)

    Hatlo, Marius M.; Panja, Debabrata; van Roij, René

    2011-08-01

    Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

  4. Oligonucleotide PIK3CA/Chromosome 3 Dual in Situ Hybridization Automated Assay with Improved Signals, One-Hour Hybridization, and No Use of Blocking DNA.

    Science.gov (United States)

    Zhang, Wenjun; Hubbard, Antony; Baca-Parkinson, Leslie; Stanislaw, Stacey; Vladich, Frank; Robida, Mark D; Grille, James G; Maxwell, Daniel; Tsao, Tsu-Shuen; Carroll, William; Gardner, Tracie; Clements, June; Singh, Shalini; Tang, Lei

    2015-09-01

    The PIK3CA gene at chromosome 3q26.32 was found to be amplified in up to 45% of patients with squamous cell carcinoma of the lung. The strong correlation between PIK3CA amplification and increased phosphatidylinositol 3-kinase (PI3K) pathway activities suggested that PIK3CA gene copy number is a potential predictive biomarker for PI3K inhibitors. Currently, all microscopic assessments of PIK3CA and chromosome 3 (CHR3) copy numbers use fluorescence in situ hybridization. PIK3CA probes are derived from bacterial artificial chromosomes whereas CHR3 probes are derived mainly from the plasmid pHS05. These manual fluorescence in situ hybridization assays mandate 12- to 18-hour hybridization and use of blocking DNA from human sources. Moreover, fluorescence in situ hybridization studies provide limited morphologic assessment and suffer from signal decay. We developed an oligonucleotide-based bright-field in situ hybridization assay that overcomes these shortcomings. This assay requires only a 1-hour hybridization with no need for blocking DNA followed by indirect chromogenic detection. Oligonucleotide probes produced discrete and uniform CHR3 stains superior to those from the pHS05 plasmid. This assay achieved successful staining in 100% of the 195 lung squamous cell carcinoma resections and in 94% of the 33 fine-needle aspirates. This robust automated bright-field dual in situ hybridization assay for the simultaneous detection of PIK3CA and CHR3 centromere provides a potential clinical diagnostic method to assess PIK3CA gene abnormality in lung tumors. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  5. An Estimation of Hybrid Quantum Mechanical Molecular Mechanical Polarization Energies for Small Molecules Using Polarizable Force-Field Approaches.

    Science.gov (United States)

    Huang, Jing; Mei, Ye; König, Gerhard; Simmonett, Andrew C; Pickard, Frank C; Wu, Qin; Wang, Lee-Ping; MacKerell, Alexander D; Brooks, Bernard R; Shao, Yihan

    2017-02-14

    In this work, we report two polarizable molecular mechanics (polMM) force field models for estimating the polarization energy in hybrid quantum mechanical molecular mechanical (QM/MM) calculations. These two models, named the potential of atomic charges (PAC) and potential of atomic dipoles (PAD), are formulated from the ab initio quantum mechanical (QM) response kernels for the prediction of the QM density response to an external molecular mechanical (MM) environment (as described by external point charges). The PAC model is similar to fluctuating charge (FQ) models because the energy depends on external electrostatic potential values at QM atomic sites; the PAD energy depends on external electrostatic field values at QM atomic sites, resembling induced dipole (ID) models. To demonstrate their uses, we apply the PAC and PAD models to 12 small molecules, which are solvated by TIP3P water. The PAC model reproduces the QM/MM polarization energy with a R 2 value of 0.71 for aniline (in 10,000 TIP3P water configurations) and 0.87 or higher for other 11 solute molecules, while the PAD model has a much better performance with R 2 values of 0.98 or higher. The PAC model reproduces reference QM/MM hydration free energies for 12 solute molecules with a RMSD of 0.59 kcal/mol. The PAD model is even more accurate, with a much smaller RMSD of 0.12 kcal/mol, with respect to the reference. This suggests that polarization effects, including both local charge distortion and intramolecular charge transfer, can be well captured by induced dipole type models with proper parametrization.

  6. Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

    Science.gov (United States)

    Qian, Yong; Wang, Chunyan; Gao, Fenglei

    2015-01-15

    A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2015-01-07

    Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

  8. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  9. Electrochemical label-free and sensitive nanobiosensing of DNA hybridization by graphene oxide modified pencil graphite electrode.

    Science.gov (United States)

    Ahour, F; Shamsi, A

    2017-09-01

    Based on the strong interaction between single-stranded DNA (ss-DNA) and graphene material, we have constructed a novel label-free electrochemical biosensor for rapid and facile detection of short sequences ss-DNA molecules related to hepatitis C virus 1a using graphene oxide modified pencil graphite electrode. The sensing mechanism is based on the superior adsorption of single-stranded DNA to GO over double stranded DNA (ds-DNA). The intrinsic guanine oxidation signal measured by differential pulse voltammetry (DPV) has been used for duplex DNA formation detection. The probe ss-DNA adsorbs onto the surface of GO via the π- π* stacking interactions leading to a strong background guanine oxidation signal. In the presence of complementary target, formation of helix which has weak binding ability to GO induced ds-DNA to release from the electrode surface and significant variation in differential pulse voltammetric response of guanine bases. The results indicated that the oxidation peak current was proportional to the concentration of complementary strand in the range of 0.1 nM-0.5 μM with a detection limit of 4.3 × 10 -11  M. The simple fabricated electrochemical biosensor has high sensitivity, good selectivity, and could be applied as a new platform for a range of target molecules in future. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Molecular dynamics simulation studies of radiation damaged DNA. Molecules and repair enzymes

    International Nuclear Information System (INIS)

    Pinak, Miroslav

    2004-12-01

    Molecular dynamics (MD) studies on several radiation damages to DNA and their recognition by repair enzymes are introduced in order to describe the stepwise description of molecular process observed at radiation lesion sites. MD studies were performed on pyrimidine (thymine dimer, thymine glycol) and purine (8-oxoguanine) lesions using an MD simulation code AMBER 5.0. The force field was modified for each lesion. In all cases the significant structural changes in the DNA double helical structure were observed; a) the breaking of hydrogen bond network between complementary bases and resulting opening of the double helix (8-oxoguanine); b) the sharp bending of the DNA helix centered at the lesion site (thymine dimer, thymine glycol); and c) the flipping-out base on the strand complementary to the lesion (8-oxoguanine). These changes were related to the overall collapsing double helical structure around the lesion and might facilitate the docking of the repair enzyme into the DNA and formation of DNA-enzyme complex. In addition to the structural changes, at lesion sites there were found electrostatic interaction energy values different from those at native sites (thymine dimer -10 kcal/mol, thymine glycol -26 kcal/mol, 8-oxoguanine -48 kcal/mol). These values of electrostatic energy may discriminate lesion from values at native sites (thymine 0 kcal/mol, guanine -37 kcal/mol) and enable a repair enzyme to recognize a lesion during scanning DNA surface. The observed specific structural conformation and energetic properties at the lesions sites are factors that guide a repair enzyme to discriminate lesions from non-damaged native DNA segments. (author)

  11. Study of Auger effect in DNA when bound to molecules containing platinum. A possible application to hadrontherapy

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, K.; Usami, N.; Sasaki, I.; Frohlich, H.; Le Sech, C. E-mail: lesech@lcam.u-psud.fr

    2003-01-01

    Complexes made of DNA and Cyclo-Pt bound to plasmid DNA, were placed in aqueous solution and irradiated with monochromatic X-rays in the range E=8.5-13 keV, including the resonant photoabsorption energy of the L{sub III} shell of the platinum atom. The number of single- and double-strand breaks (ssb and dsb) induced by irradiation on a supercoiled DNA plasmid was measured by the production of circular-nicked and linear forms. In order to disentangle the contribution of the direct effects imparted to ionization, and the indirect effects due to a free radical attack, experiments have been performed in the presence of a small concentration (64 mmol l{sup -1}) of hydroxyl free radical scavenger dimethyl sulfoxide (DMSO). An enhancement of the number of ssb and dsb is observed when the plasmids contain the Pt intercalating molecules. Even when off-resonant X-rays are used, the strand break efficiency remains higher than expected based upon the absorption cross-section, as if the Pt bound to DNA is increasing the yield of strand breaks. A mechanism is suggested, involving photoelectrons generated from the ionization of water which efficiently ionize Pt atoms. This observation may provide an insight to understanding the effects of new radiotherapy protocols, associated chemotherapeutic agents such as cisplatin and ordinary radiotherapy for tumoral treatments.

  12. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    International Nuclear Information System (INIS)

    Zhou, Fuyi; Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang; Gao, Fenglei; Wang, Po

    2017-01-01

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH 4 oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10 −15 to 10 −11  g mL −1 and a detection limit of 0.43 × 10 −15  g mL −1 . Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10 −16  g mL −1 . And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10 −16  g mL −1 level with a dynamic range spanning 5 orders of magnitude.

  13. Detecting a single molecule using a micropore-nanopore hybrid chip.

    Science.gov (United States)

    Liu, Lei; Zhu, Lizhong; Ni, Zhonghua; Chen, Yunfei

    2013-11-21

    Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing.

  14. Accurate detection of male subclinical genital tract infection via cervical culture and DNA hybridization assay of the female partner

    NARCIS (Netherlands)

    Trum, J. W.; Pannekoek, Y.; Spanjaard, L.; Bleker, O. P.; van der Veen, F.

    2000-01-01

    The accuracy of the PACE2 DNA hybridization assay of the cervix and cervical culture in female partners for the diagnosis of male subclinical genital tract infection were assessed in a male infertility population. A total of 184 men were screened for the presence of Chlamydia trachomatis, Ureaplasma

  15. A new fast algorithm for solving the minimum spanning tree problem based on DNA molecules computation.

    Science.gov (United States)

    Wang, Zhaocai; Huang, Dongmei; Meng, Huajun; Tang, Chengpei

    2013-10-01

    The minimum spanning tree (MST) problem is to find minimum edge connected subsets containing all the vertex of a given undirected graph. It is a vitally important NP-complete problem in graph theory and applied mathematics, having numerous real life applications. Moreover in previous studies, DNA molecular operations usually were used to solve NP-complete head-to-tail path search problems, rarely for NP-hard problems with multi-lateral path solutions result, such as the minimum spanning tree problem. In this paper, we present a new fast DNA algorithm for solving the MST problem using DNA molecular operations. For an undirected graph with n vertex and m edges, we reasonably design flexible length DNA strands representing the vertex and edges, take appropriate steps and get the solutions of the MST problem in proper length range and O(3m+n) time complexity. We extend the application of DNA molecular operations and simultaneity simplify the complexity of the computation. Results of computer simulative experiments show that the proposed method updates some of the best known values with very short time and that the proposed method provides a better performance with solution accuracy over existing algorithms. Copyright © 2013 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  16. HyDEn: A Hybrid Steganocryptographic Approach for Data Encryption Using Randomized Error-Correcting DNA Codes

    Directory of Open Access Journals (Sweden)

    Dan Tulpan

    2013-01-01

    Full Text Available This paper presents a novel hybrid DNA encryption (HyDEn approach that uses randomized assignments of unique error-correcting DNA Hamming code words for single characters in the extended ASCII set. HyDEn relies on custom-built quaternary codes and a private key used in the randomized assignment of code words and the cyclic permutations applied on the encoded message. Along with its ability to detect and correct errors, HyDEn equals or outperforms existing cryptographic methods and represents a promising in silico DNA steganographic approach.

  17. Radioactive and enzymatic cloned cDNA probes for bovine enteric coronavirus detection by molecular hybridization

    International Nuclear Information System (INIS)

    Collomb, J.; Finance, C.; Alabouch, S.; Laporte, J.

    1992-01-01

    Genomic RNA of F15 strain bovine enteric coronavirus (BECV) was cloned in E. coli. Three clones (174, 160, PG 78), selected in the cDNA library, including a large portion of the nucleocapsid (N), matrix (M) and peplomeric (S) protein genes , were used as probes for a slot blot hybridization assay. Two probe labelling techniques were compared, radiolabelling with 32 P and enzymatic labelling through covalent linkage to peroxidase and chemiluminescence detection. The radioactive probe 174 detected as little as 1 to 3 pg of viral RNA, while the less sensitive enzymatic probe could not reveal more than 100 pg of RNA. No significant detection amplification was achieved when a mixture of the three probes was used. Probe 174 allowed specific identification for BECV. No hybridization was noticed either with rotaviruses or even with other antigenically unrelated members of the family Coronaviridae such as transmissible gastroenteritis virus. The test proved valid for detection of BECV in the supernatant of infected HRT-18 cells: genomic RNA could be detected after direct spotting of samples, but prior nucleic acid extraction after proteinase K treatment improved virus detection. BECV diagnosis in faecal samples using enzymatic probe was compared with conventional diagnostic methods. (authors)

  18. Radioactive and enzymatic cloned cDNA probes for bovine enteric coronavirus detection by molecular hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Collomb, J; Finance, C; Alabouch, S [Lab. de Microbiologie Moleculaire, Faculte des Sciences Pharmaceutiques et Biologiques, Univ. de Nancy I, Nancy (France); Laporte, J [Station de Virologie et d' Immunologie Moleculaires, INRA, Jouy-en-Josas (France)

    1992-01-01

    Genomic RNA of F15 strain bovine enteric coronavirus (BECV) was cloned in E. coli. Three clones (174, 160, PG 78), selected in the cDNA library, including a large portion of the nucleocapsid (N), matrix (M) and peplomeric (S) protein genes , were used as probes for a slot blot hybridization assay. Two probe labelling techniques were compared, radiolabeled with [sup 32]P and enzymatic labeled through covalent linkage to peroxidase for chemiluminescence detection. The radioactive probe 174 detected as little as 1-3 pg of viral RNA, while the less sensitive enzymatic probe could not reveal more than 100 pg of RNA. No significant detection amplification was achieved when a mixture of the three probes was used. Probe 174 allowed specific identification for BECV. No hybridization was noticed either with rotaviruses or even with other antigenically unrelated members of the family Coronaviridae such as transmissible gastroenteritis virus. The test proved valid for detection of BECV in the supernatant of infected HRT-18 cells: genomic RNA could be detected after direct spotting of samples, but prior nucleic acid extraction after proteinase K treatment improved virus detection. BECV diagnosis in fecal samples using enzymatic probe was compared with conventional diagnostic methods. (authors).

  19. Nanoconfinement-enhanced conformational response of single DNA molecules to changes in ionic environment

    DEFF Research Database (Denmark)

    Reisner, Walter; Beech, J. P.; Larsen, Niels Bent

    2007-01-01

    100×100 nm in dimension. Surprisingly, we find that the variation of the persistence length alone with ionic strength is not enough to explain our results. The effect is due mainly to increasing self-avoidance created by the reduced screening of electrostatic interactions at low ionic strength......We show that the ionic environment plays a critical role in determining the configurational properties of DNA confined in silica nanochannels. The extension of DNA in the nanochannels increases as the ionic strength is reduced, almost tripling over two decades in ionic strength for channels around....... To quantify the increase in self-avoidance, we introduce a new parameter into the de Gennes theory: an effective DNA width that gives the increase in the excluded volume due to electrostatic repulsion....

  20. The chloroplast and mitochondrial DNA type are correlated with the nuclear composition of somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia.

    Science.gov (United States)

    Wolters, A M; Koornneef, M; Gilissen, L J

    1993-09-01

    This paper describes the analysis of chloroplast (cp) DNA and mitochondrial (mt) DNA in 21 somatic hybrid calli of Solanum tuberosum and Nicotiana plumbaginifolia by means of Southern-blot hybridization. Each of these calli contained only one type of cpDNA; 14 had the N. plumbaginifolia (Np) type and seven the S. tuberosum (St) type. N. plumbaginifolia cpDNA was present in hybrids previously shown to contain predominantly N. plumbaginifolia chromosomes whereas hybrids in which S. tuberosum chromosomes predominated possessed cpDNA from potato. We have analyzed the mtDNA of these 21 somatic hybrid calli using four restriction enzyme/probe combinations. Most fusion products had only, or mostly, mtDNA fragments from the parent that predominated in the nucleus. The hybrids containing mtDNA fragments from only one parent (and new fragments) also possessed chloroplasts from the same species. The results suggest the existence of a strong nucleo-cytoplasmic incongruity which affects the genome composition of somatic hybrids between distantly related species.

  1. Synthetic models related to DNA-intercalating molecules. Interactions between 8-alkoxypsoralen and adenine

    International Nuclear Information System (INIS)

    Decout, J.L.; Lhomme, J.

    1983-01-01

    To investigate the interactions and the photoreactions between furocoumarins and adenine, compounds in which a psoralen molecule is linked by different polymethylene bridges have been synthesised. Ring-ring intramolecular interactions are observed by UV spectroscopy. Thermodynamic parameters of these hydrophobic interactions are determined by the study of the variation of the hypochromic effect with temperature. (author)

  2. Integrated view of genome structure and sequence of a single DNA molecule in a nanofluidic device

    DEFF Research Database (Denmark)

    Marie, Rodolphe; Pedersen, Jonas Nyvold; L. V. Bauer, David

    2013-01-01

    as well as unique structural variation. Following its mapping, a molecule of interest was rescued fromthe chip;amplified and localized to a chromosome by FISH; and interrogated down to 1-bp resolution with a commercial sequencer, thereby reconciling haplotype-phased chromosome substructure with sequence....

  3. Therapeutic potential of the novel hybrid molecule JM-20 against focal cortical ischemia in rats

    Directory of Open Access Journals (Sweden)

    Yanier Núñez Figueredo

    2016-08-01

    Full Text Available Context: Despite the great mortality and morbidity of stroke, treatment options remain limited. We previously showed that JM-20, a novel synthetic molecule, possessed a strong neuroprotective effect in rats subjected to transient middle cerebral artery occlusion. However, to verify the robustness of the pre-clinical neuroprotective effects of JM-20 to get good prognosis in the translation to the clinic, it is necessary to use other experimental models of brain ischemia. Aims: To evaluate the neuroprotective effects of JM-20 following the onset of permanent focal cerebral ischemia induced in rats by thermocoagulation of blood into pial blood vessels of cerebral cortices. Methods: Ischemic lesion was induced by thermocoagulation of blood into pial blood vessels of primary motor and somatosensory cortices. Behavioral performance was evaluated by the cylinder testing for a period of 2, 3 and 7 days after surgery, and was followed by histopathological study in brain cortex stained with hematoxylin- eosin. Results: Ischemic injury resulted in impaired function of the forelimb evidenced by high asymmetry punctuation, and caused histopathological alterations indicative of tissue damage at cerebral cortex. JM-20 treatment (4 and 8 mg/kg significantly decreased asymmetry scores and histological alterations with a marked preservation of cortical neurons. Conclusions: The effects of permanent brain ischemia were strongly attenuated by JM-20 administration, which expands and improves the current preclinical data of JM-20 as neuroprotector against cerebral ischemia, and strongly support the examination of its translation to the clinic to treat acute ischemic stroke.

  4. Plasmon-enhanced absorption in a metal nanoparticles and photosynthetic molecules hybrid system

    Science.gov (United States)

    Fan, Zhiyuan; Govorov, Alexander

    2010-03-01

    Photosystem I from cyanobacteria is one of nature's most efficient light harvesting complexes, converting light energy into electronic energy with a quantum yield of 100% and an energy yield about 58%. It is very attractive to the nanotechnology community because of its nanoscale dimensions and excellent optoelectronic properties. This protein has the potential to be utilized in devices such as solar cells, electric switches, photo-detectors, etc. However, there is one limiting factor for potential applications of a single monolayer of these photosynthetic proteins. One monolayer absorbs less than 1% of sunlight's energy, despite their excellent optoelectronic properties. Recently, experiments [1] have been conducted to enhance light absorption with the assistance of metal nanoparticles as artificial antenna for the photosystem I. Here, we present a theoretical description of the strong plasmon-assisted interactions between the metal nanoparticles and the optical dipoles of the reaction centers observed in the experiments. The resonance and off-resonance plasmon effects enhance the electromagnetic fields around the photosystem-I molecules and, in this way, lead to enhanced absorption. [4pt] [1] I. Carmeli, I. Lieberman, L. Kraversky, Zhiyuan Fan, A. O. Govorov, G. Markovich, and S. Richter, submitted.

  5. Gold nano particle decorated graphene core first generation PAMAM dendrimer for label free electrochemical DNA hybridization sensing.

    Science.gov (United States)

    Jayakumar, K; Rajesh, R; Dharuman, V; Venkatasan, R; Hahn, J H; Pandian, S Karutha

    2012-01-15

    A novel first generation (G1) poly(amidoamine) dendrimer (PAMAM) with graphene core (GG1PAMAM) was synthesized for the first time. Single layer of GG1PAMAM was immobilized covalently on mercaptopropionic acid (MPA) monolayer on Au transducer. This allows cost effective and easy deposition of single layer graphene on the Au transducer surface than the advanced vacuum techniques used in the literature. Au nano particles (17.5 nm) then decorated the GG1PAMAM and used for electrochemical DNA hybridization sensing. The sensor discriminates selectively and sensitively the complementary double stranded DNA (dsDNA, hybridized), non-complementary DNA (ssDNA, un-hybridized) and single nucleotide polymorphism (SNP) surfaces. Interactions of the MPA, GG1PAMAM and the Au nano particles were characterized by Ultra Violet (UV), Fourier Transform Infrared (FTIR), Raman spectroscopy (RS), Thermo gravimetric analysis (TGA), Scanning Electron Microscopy (SEM), Atomic Force Microscopy (AFM), Cyclic Voltmetric (CV), Impedance spectroscopy (IS) and Differntial Pulse Voltammetry (DPV) techniques. The sensor showed linear range 1×10(-6) to 1×10(-12) M with lowest detection limit 1 pM which is 1000 times lower than G1PAMAM without graphene core. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. [Oligonucleotide derivatives in the nucleic acid hybridization analysis. II. Isothermal signal amplification in process of DNA analysis by minisequencing].

    Science.gov (United States)

    Dmitrienko, E V; Khomiakova, E A; Pyshnaia; Bragin, A G; Vedernikov, V E; Pyshnyĭ, D V

    2010-01-01

    The isothermal amplification of reporter signal via limited probe extension (minisequencing) upon hybridization of nucleic acids has been studied. The intensity of reporter signal has been shown to increase due to enzymatic labeling of multiple probes upon consecutive hybridization with one DNA template both in homophase and heterophase assays using various kinds of detection signal: radioisotope label, fluorescent label, and enzyme-linked assay. The kinetic scheme of the process has been proposed and kinetic parameters for each step have been determined. The signal intensity has been shown to correlate with physicochemical characteristics of both complexes: probe/DNA and product/DNA. The maximum intensity has been observed at minimal difference between the thermodynamic stability of these complexes, provided the reaction temperature has been adjusted near their melting temperature values; rising or lowering the reaction temperature reduces the amount of reporting product. The signal intensity has been shown to decrease significantly upon hybridization with the DNA template containing single-nucleotide mismatches. Limited probe extension assay is useful not only for detection of DNA template but also for its quantitative characterization.

  7. Light of DNA-alkylating agents in castration-resistant prostate cancer cells: a novel mixed EGFR/DNA targeting combi-molecule.

    Science.gov (United States)

    Liang, Guan-Can; Zheng, Hao-Feng; Chen, Yan-Xiong; Li, Teng-Cheng; Liu, Wei; Fang, You-Qiang

    2017-01-01

    The mechanism underlying the therapeutic effects of combi-molecule JDF12 on prostate cancer (PCa) DU145 cells remains still unclear. This study aimed to investigate the proteomic profile after JDF12 treatment in DU145 cells by comparing with that in Iressa treated cells and untreated cells. MTT was used to evaluate drug cytotoxicity, DAPI staining was done to assess apoptosis of cells, and flow cytometry was used to analyze cell cycle. iTRAQ and qPCR were employed to obtain the proteomic profiles of JDF12 treated, Iressa treated, and untreated DU145 cells, and validate the expression of selected differentially expressed proteins, respectively. JDF12 could significantly inhibit the proliferation and increase the apoptosis of DU145 cells when compared with Iressa or blank group. In total, 5071 proteins were obtained, out of which, 42, including 21 up-regulated and 21 down-regulated proteins, were differentially expressed in JDF12 group when compared with Iressa and blank groups. The up-regulated proteins were mainly involved in DNA damage/repair and energy metabolism; while the down-regulated proteins were mainly associated with cell apoptosis. qPCR confirmed the expression of several biologically important proteins in DU145 cells after JDF12 treatment. The molecular mechanisms of DNA alkylating agents on PCa therapy that with the assistant of EGFR-blocker were revealed on proteomic level, which may increase the possible applications of DNA alkylating agents and JDF12 on PCa therapy.

  8. Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

    Directory of Open Access Journals (Sweden)

    Li Zhao

    2014-03-01

    Full Text Available A gene vector consisting of nanodiamond, polyglycerol, and basic polypeptide (ND-PG-BPP has been designed, synthesized, and characterized. The ND-PG-BPP was synthesized by PG functionalization of ND through ring-opening polymerization of glycidol on the ND surface, multistep organic transformations (–OH → –OTs (tosylate → –N3 in the PG layer, and click conjugation of the basic polypeptides (Arg8, Lys8 or His8 terminated with propargyl glycine. The ND-PG-BPP exhibited good dispersibility in water (>1.0 mg/mL and positive zeta potential ranging from +14.2 mV to +44.1 mV at neutral pH in Milli-Q water. It was confirmed by gel retardation assay that ND-PG-Arg8 and ND-PG-Lys8 with higher zeta potential hybridized with plasmid DNA (pDNA through electrostatic attraction, making them promising as nonviral vectors for gene delivery.

  9. Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

    Science.gov (United States)

    Zhao, Li; Nakae, Yuki; Qin, Hongmei; Ito, Tadamasa; Kimura, Takahide; Kojima, Hideto; Chan, Lawrence

    2014-01-01

    Summary A gene vector consisting of nanodiamond, polyglycerol, and basic polypeptide (ND-PG-BPP) has been designed, synthesized, and characterized. The ND-PG-BPP was synthesized by PG functionalization of ND through ring-opening polymerization of glycidol on the ND surface, multistep organic transformations (–OH → –OTs (tosylate) → –N3) in the PG layer, and click conjugation of the basic polypeptides (Arg8, Lys8 or His8) terminated with propargyl glycine. The ND-PG-BPP exhibited good dispersibility in water (>1.0 mg/mL) and positive zeta potential ranging from +14.2 mV to +44.1 mV at neutral pH in Milli-Q water. It was confirmed by gel retardation assay that ND-PG-Arg8 and ND-PG-Lys8 with higher zeta potential hybridized with plasmid DNA (pDNA) through electrostatic attraction, making them promising as nonviral vectors for gene delivery. PMID:24778723

  10. Assembling high activity phosphotriesterase composites using hybrid nanoparticle peptide-DNA scaffolded architectures

    Science.gov (United States)

    Breger, Joyce C.; Buckhout-White, Susan; Walper, Scott A.; Oh, Eunkeu; Susumu, Kimihiro; Ancona, Mario G.; Medintz, Igor L.

    2017-06-01

    Nanoparticle (NP) display potentially offers a new way to both stabilize and, in many cases, enhance enzyme activity over that seen for native protein in solution. However, the large, globular and sometimes multimeric nature of many enzymes limits their ability to attach directly to the surface of NPs, especially when the latter are colloidally stabilized with bulky PEGylated ligands. Engineering extended protein linkers into the enzymes to achieve direct attachment through the PEG surface often detrimentally alters the enzymes catalytic ability. Here, we demonstrate an alternate, hybrid biomaterials-based approach to achieving directed enzyme assembly on PEGylated NPs. We self-assemble a unique architecture consisting of a central semiconductor quantum dot (QD) scaffold displaying controlled ratios of extended peptide-DNA linkers which penetrate through the PEG surface to directly couple enzymes to the QD surface. As a test case, we utilize phosphotriesterase (PTE), an enzyme of bio-defense interest due to its ability to hydrolyze organophosphate nerve agents. Moreover, this unique approach still allows PTE to maintain enhanced activity while also suggesting the ability of DNA to enhance enzyme activity in and of itself.

  11. Hybrid Taguchi DNA Swarm Intelligence for Optimal Inverse Kinematics Redundancy Resolution of Six-DOF Humanoid Robot Arms

    Directory of Open Access Journals (Sweden)

    Hsu-Chih Huang

    2014-01-01

    Full Text Available This paper presents a hybrid Taguchi deoxyribonucleic acid (DNA swarm intelligence for solving the inverse kinematics redundancy problem of six degree-of-freedom (DOF humanoid robot arms. The inverse kinematics problem of the multi-DOF humanoid robot arm is redundant and has no general closed-form solutions or analytical solutions. The optimal joint configurations are obtained by minimizing the predefined performance index in DNA algorithm for real-world humanoid robotics application. The Taguchi method is employed to determine the DNA parameters to search for the joint solutions of the six-DOF robot arms more efficiently. This approach circumvents the disadvantage of time-consuming tuning procedure in conventional DNA computing. Simulation results are conducted to illustrate the effectiveness and merit of the proposed methods. This Taguchi-based DNA (TDNA solver outperforms the conventional solvers, such as geometric solver, Jacobian-based solver, genetic algorithm (GA solver and ant, colony optimization (ACO solver.

  12. DNA: The Molecule of Life. A Multimedia CD-ROM. [CD-ROM].

    Science.gov (United States)

    2001

    This CD-ROM is designed for classroom and individual use to teach and learn about DNA. Integrated animations, custom graphics, three-dimensional representations, photographs, and sound are featured for use in user-controlled activities. Interactive lessons are available to reinforce the subject material. Pre- and post-testing sections are also…

  13. True single-molecule DNA sequencing of a pleistocene horse bone

    DEFF Research Database (Denmark)

    Orlando, Ludovic Antoine Alexandre; Ginolhac, Aurélien; Raghavan, Maanasa

    2011-01-01

    -preserved Pleistocene horse bone using the Helicos HeliScope and Illumina GAIIx platforms, respectively. We find that the percentage of endogenous DNA sequences derived from the horse is higher among the Helicos data than Illumina data. This result indicates that the molecular biology tools used to generate sequencing...

  14. Detection of human papillomavirus type 6/11 DNA in conjunctival papillomas by in situ hybridization with radioactive probes

    International Nuclear Information System (INIS)

    McDonnell, P.J.; McDonnell, J.M.; Kessis, T.; Green, W.R.; Shah, K.V.

    1987-01-01

    Twenty-three conjunctival papillomas and 28 conjunctival dysplasias were examined for human papillomavirus (HPV)-DNA sequences by in situ hybridization with nick-translated 35 S-labeled HPV probes. Adjacent paraffin sections were hybridized with HPV type 2, 6, 16, and 18 probes at Tm - 17 degrees C. Fifteen tissues, all papillomas, displayed positive hybridization with the HPV-6 probe. Infection with HPV-6 (or the closely related HPV-11) appeared to be responsible for most of the conjunctival papillomas of children and young adults. The presence of genital tract HPV-6 in these lesions suggests that some of the infections were acquired during passage through an infected birth canal. The lack of hybridization in adult conjunctival dysplasias indicates either that HPVs are not associated with this condition or that the probes and the technique utilized were not adequate for demonstration of this association

  15. A novel technique using DNA denaturation to detect multiply induced single-strand breaks in a hydrated plasmid DNA molecule by X-ray and 4He2+ ion irradiation

    International Nuclear Information System (INIS)

    Yokoya, A.; Shikazono, N.; Fujii, K.; Noguchi, M.; Urushibara, A.

    2011-01-01

    To detect multiple single-strand breaks (SSBs) produced in plasmid DNA molecules by direct energy deposition from radiation tracks, we have developed a novel technique using DNA denaturation by which irradiated DNA is analysed as single-strand DNA (SS-DNA). The multiple SSBs that arise in both strands of DNA, but do not induce a double-strand break, are quantified as loss of SS-DNA using agarose gel electrophoresis. We have applied this method to X-ray and 4 He 2+ ion-irradiated samples of fully hydrated pUC18 plasmid DNA. The fractions of both SS-DNA and closed circular DNA (CC-DNA) exponentially decrease with the increasing dose of X rays and 4 He 2+ ions. The efficiency of the loss of SS-DNA was half that of CC-DNA for both types of irradiation, indicating that one of two strands in DNA is not broken when one SSB is produced in CC-DNA by irradiation. Contrary to our initial expectation, these results indicate that SSBs are not multiply induced even by high linear energy transfer radiation distributed in both strands. (authors)

  16. Recent introgressive hybridization revealed by exclusive mtDNA transfer from Oreochromis leucostictus (Trewavas, 1933) to Oreochromis niloticus (Linnaeus, 1758) in Lake Baringo, Kenya

    OpenAIRE

    Nyingi, Dorothy W.; Agnèse, Jean-François

    2007-01-01

    Nuclear DNA and mtDNA polymorphisms were surveyed in various species of East African Oreochromis. In Lake Baringo, where only Oreochromis niloticus baringoensis is present, alien mtDNA haplotypes were observed, apparently the result of introgressive hybridization with Oreochromis leucostictus. This introgression is not accompanied by any substantial or recorded transfer of nuclear genes into O. n. baringoensis.

  17. Investigation of sliding DNA clamp dynamics by single-molecule fluorescence, mass spectrometry and structure-based modeling

    Science.gov (United States)

    Gadkari, Varun V; Harvey, Sophie R; Raper, Austin T; Chu, Wen-Ting; Wang, Jin; Wysocki, Vicki H; Suo, Zucai

    2018-01-01

    Abstract Proliferating cell nuclear antigen (PCNA) is a trimeric ring-shaped clamp protein that encircles DNA and interacts with many proteins involved in DNA replication and repair. Despite extensive structural work to characterize the monomeric, dimeric, and trimeric forms of PCNA alone and in complex with interacting proteins, no structure of PCNA in a ring-open conformation has been published. Here, we use a multidisciplinary approach, including single-molecule Förster resonance energy transfer (smFRET), native ion mobility-mass spectrometry (IM-MS), and structure-based computational modeling, to explore the conformational dynamics of a model PCNA from Sulfolobus solfataricus (Sso), an archaeon. We found that Sso PCNA samples ring-open and ring-closed conformations even in the absence of its clamp loader complex, replication factor C, and transition to the ring-open conformation is modulated by the ionic strength of the solution. The IM-MS results corroborate the smFRET findings suggesting that PCNA dynamics are maintained in the gas phase and further establishing IM-MS as a reliable strategy to investigate macromolecular motions. Our molecular dynamic simulations agree with the experimental data and reveal that ring-open PCNA often adopts an out-of-plane left-hand geometry. Collectively, these results implore future studies to define the roles of PCNA dynamics in DNA loading and other PCNA-mediated interactions. PMID:29529283

  18. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    Science.gov (United States)

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  19. Interactive measurement and characterization of DNA molecules by analysis of AFM images

    Czech Academy of Sciences Publication Activity Database

    Marek, J.; Demjénová, E.; Tomori, Z.; Janáček, Jiří; Zolotová, I.; Valle, F.; Favre, M.; Dietler, G.

    2005-01-01

    Roč. 63, č. 2 (2005), s. 87-93 ISSN 1552-4922 Grant - others:VEGA(SK) 5048; VEGA(SK) 2185; CZ-SK(CZ) KONTAKT 139; Swiss National Science Foundation(CH) 2100-063746.00/1 Institutional research plan: CEZ:AV0Z5011922 Keywords : DNA * atomic force microscopy * interactive image analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.115, year: 2005

  20. Function of the UVR marker in dark repair of DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Sedliakova, M; Brozmanova, J; Slezarikova, V; Masek, F; Fandlova, E [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Vyskumny Ustav Onkologicky

    1975-01-01

    It was found earlier that the excision repair mechanism in Escherichia coli B/r Hcr/sup +/ could be depressed by pre-irradiation, amino acid and thymine starvation; such interference proved to have no appreciable influence on survival after ultraviolet irradiation. A comparison between Hcr/sup +/ and Hcr/sup -/ cells revealed that the former were capable of tolerating a greater amount of unexcised dimers than the latter. It is demonstrated in this paper that the above-mentioned pretreatment will depress excision activity also in cultures of E. coli K12 and E. coli 15T, both strains of the uvr/sup +/ rec/sup +/ genotype. A comparison of two E. coli K12 strains of the uvr/sup +/ and uvr/sup -/ genotype shows that uvr/sup +/ cells also have a greater capacity to tolerate unexcised dimers. To throw light on the nature of the increased capacity to tolerate unexcised dimers the restoration of DNA daughter chains in cells of the uvr/sup +/ and uvr/sup -/ genotype was compared and it was found that the integrity of uvr loci is a conditio sine qua non for an effective restoration of daughter chains, but that depression of excision activity by the mentioned pretreatment does not influence the restoration of DNA daughter chains. This suggests that uvr loci are involved not only in excision but also in the post-replication mechanism of DNA repair.

  1. Optimized assembly and covalent coupling of single-molecule DNA origami nanoarrays.

    Science.gov (United States)

    Gopinath, Ashwin; Rothemund, Paul W K

    2014-12-23

    Artificial DNA nanostructures, such as DNA origami, have great potential as templates for the bottom-up fabrication of both biological and nonbiological nanodevices at a resolution unachievable by conventional top-down approaches. However, because origami are synthesized in solution, origami-templated devices cannot easily be studied or integrated into larger on-chip architectures. Electrostatic self-assembly of origami onto lithographically defined binding sites on Si/SiO2 substrates has been achieved, but conditions for optimal assembly have not been characterized, and the method requires high Mg2+ concentrations at which most devices aggregate. We present a quantitative study of parameters affecting origami placement, reproducibly achieving single-origami binding at 94±4% of sites, with 90% of these origami having an orientation within ±10° of their target orientation. Further, we introduce two techniques for converting electrostatic DNA-surface bonds to covalent bonds, allowing origami arrays to be used under a wide variety of Mg2+-free solution conditions.

  2. Aptamer-conjugated DNA nano-ring as the carrier of drug molecules

    Science.gov (United States)

    Srivithya, Vellampatti; Roun, Heo; Sekhar Babu, Mitta; Hyung, Park Jae; Ha, Park Sung

    2018-03-01

    Due to its predictable self-assembly and structural stability, structural DNA nanotechnology is considered one of the main interdisciplinary subjects encompassing conventional nanotechnology and biotechnology. Here we have fabricated the mucin aptamer (MUC1)˗conjugated DNA nano˗ring intercalated with doxorubicin (DNRA˗DOX) as potential therapeutics for breast cancer. DNRA˗DOX exhibited significantly higher cytotoxicity to the MCF˗7 breast cancer cells than the controls, including DOX alone and the aptamer deficient DNA nano˗ring (DNR) with doxorubicin. Interactions between DOX and DNRA were studied using spectrophotometric measurements. Dose-dependent cytotoxicity was performed to prove that both DNR and DNRA were non-toxic to the cells. The drug release profile showed a controlled release of DOX at normal physiological pH 7.4, with approximately 61% released, but when exposed to lysosomal of pH 5.5, the corresponding 95% was released within 48 h. Owing to the presence of the aptamer, DNRA˗DOX was effectively taken up by the cancer cells, as confirmed by confocal microscopy, implying that it has potential for use in targeted drug delivery.

  3. The effect of environmental factors on the electrical conductivity of a single oligo-DNA molecule measured using single-walled carbon nanotube nanoelectrodes

    International Nuclear Information System (INIS)

    Vedala, Harindra; Roy, Somenath; Choi, Wonbong; Doud, Melissa; Mathee, Kalai; Hwang, Sookhyun; Jeon, Minhyon

    2008-01-01

    We present an electrical conductivity study on a double-stranded DNA molecule bridging a single-walled carbon nanotube (SWNT) gap. The amine terminated DNA molecule was trapped between carboxyl functionalized SWNT electrodes by dielectrophoresis. The conductivity of DNA was measured while under the influence of various environmental factors, including salt concentration, counterion variation, pH and temperature. Typically, a current of tens of picoamperes at 1 V was observed at ambient conditions, with a decrease in conductance of about 33% in high vacuum conditions. The counterion variation was analyzed by changing the buffer from sodium acetate to tris(hydroxymethyl) aminomethane, which resulted in a two orders of magnitude increase in the conductivity of the DNA. A reversible shift in the current signal was observed for pH variation. An increase in conductivity of the DNA was also observed at high salt concentrations

  4. Development of a PCR/LDR/flow-through hybridization assay using a capillary tube, probe DNA-immobilized magnetic beads and chemiluminescence detection.

    Science.gov (United States)

    Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

    2013-01-01

    A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.

  5. Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

    Energy Technology Data Exchange (ETDEWEB)

    Żurek-Biesiada, Dominika [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Szczurek, Aleksander T. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Prakash, Kirti [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Mohana, Giriram K. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Lee, Hyun-Keun [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Roignant, Jean-Yves [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Birk, Udo J. [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany); Dobrucki, Jurek W., E-mail: jerzy.dobrucki@uj.edu.pl [Laboratory of Cell Biophysics, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Kraków (Poland); Cremer, Christoph, E-mail: c.cremer@imb-mainz.de [Institute of Molecular Biology (IMB), Ackermannweg 4, 55128 Mainz (Germany); Institute for Pharmacy and Molecular Biotechnology (IPMB), University of Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg (Germany); Department of Physics, University of Mainz (JGU), Staudingerweg 7, 55128 Mainz (Germany)

    2016-05-01

    Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.

  6. Integration of Multiplexed Microfluidic Electrokinetic Concentrators with a Morpholino Microarray via Reversible Surface Bonding for Enhanced DNA Hybridization.

    Science.gov (United States)

    Martins, Diogo; Wei, Xi; Levicky, Rastislav; Song, Yong-Ak

    2016-04-05

    We describe a microfluidic concentration device to accelerate the surface hybridization reaction between DNA and morpholinos (MOs) for enhanced detection. The microfluidic concentrator comprises a single polydimethylsiloxane (PDMS) microchannel onto which an ion-selective layer of conductive polymer poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) ( PSS) was directly printed and then reversibly surface bonded onto a morpholino microarray for hybridization. Using this electrokinetic trapping concentrator, we could achieve a maximum concentration factor of ∼800 for DNA and a limit of detection of 10 nM within 15 min. In terms of the detection speed, it enabled faster hybridization by around 10-fold when compared to conventional diffusion-based hybridization. A significant advantage of our approach is that the fabrication of the microfluidic concentrator is completely decoupled from the microarray; by eliminating the need to deposit an ion-selective layer on the microarray surface prior to device integration, interfacing between both modules, the PDMS chip for electrokinetic concentration and the substrate for DNA sensing are easier and applicable to any microarray platform. Furthermore, this fabrication strategy facilitates a multiplexing of concentrators. We have demonstrated the proof-of-concept for multiplexing by building a device with 5 parallel concentrators connected to a single inlet/outlet and applying it to parallel concentration and hybridization. Such device yielded similar concentration and hybridization efficiency compared to that of a single-channel device without adding any complexity to the fabrication and setup. These results demonstrate that our concentrator concept can be applied to the development of a highly multiplexed concentrator-enhanced microarray detection system for either genetic analysis or other diagnostic assays.

  7. Cleavable DNA-protein hybrid molecular beacon: A novel efficient signal translator for sensitive fluorescence anisotropy bioassay.

    Science.gov (United States)

    Hu, Pan; Yang, Bin

    2016-01-15

    Due to its unique features such as high sensitivity, homogeneous format, and independence on fluorescent intensity, fluorescence anisotropy (FA) assay has become a hotspot of study in oligonucleotide-based bioassays. However, until now most FA probes require carefully customized structure designs, and thus are neither generalizable for different sensing systems nor effective to obtain sufficient signal response. To address this issue, a cleavable DNA-protein hybrid molecular beacon was successfully engineered for signal amplified FA bioassay, via combining the unique stable structure of molecular beacon and the large molecular mass of streptavidin. Compared with single DNA strand probe or conventional molecular beacon, the DNA-protein hybrid molecular beacon exhibited a much higher FA value, which was potential to obtain high signal-background ratio in sensing process. As proof-of-principle, this novel DNA-protein hybrid molecular beacon was further applied for FA bioassay using DNAzyme-Pb(2+) as a model sensing system. This FA assay approach could selectively detect as low as 0.5nM Pb(2+) in buffer solution, and also be successful for real samples analysis with good recovery values. Compatible with most of oligonucleotide probes' designs and enzyme-based signal amplification strategies, the molecular beacon can serve as a novel signal translator to expand the application prospect of FA technology in various bioassays. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. A DNA-Mediated Homogeneous Binding Assay for Proteins and Small Molecules

    DEFF Research Database (Denmark)

    Zhang, Zhao; Hejesen, Christian; Kjelstrup, Michael Brøndum

    2014-01-01

    . The shift occurs upon binding of a protein, for example, an antibody to its target. We demonstrate nanomolar detection of small molecules such as biotin, digoxigenin, vitamin D, and folate, in buffer and in plasma. The method is flexible, and we also show nanomolar detection of the respective antibodies......Optical detection of molecular targets typically requires immobilization, separation, or chemical or enzymatic processing. An important exception is aptamers that allow optical detection in solution based on conformational changes. This method, however, requires the laborious selection of aptamers...

  9. Thermodynamics on Soluble Carbon Nanotubes: How Do DNA Molecules Replace Surfactants on Carbon Nanotubes?

    Science.gov (United States)

    Kato, Yuichi; Inoue, Ayaka; Niidome, Yasuro; Nakashima, Naotoshi

    2012-01-01

    Here we represent thermodynamics on soluble carbon nanotubes that enables deep understanding the interactions between single-walled carbon nanotubes (SWNTs) and molecules. We selected sodium cholate and single-stranded cytosine oligo-DNAs (dCn (n = 4, 5, 6, 7, 8, 10, 15, and 20)), both of which are typical SWNT solubilizers, and successfully determined thermodynamic properties (ΔG, ΔH and ΔS values) for the exchange reactions of sodium cholate on four different chiralities of SWNTs ((n,m) = (6,5), (7,5), (10,2), and (8,6)) for the DNAs. Typical results contain i) the dC5 exhibited an exothermic exchange, whereas the dC6, 8, 10, 15, and 20 materials exhibited endothermic exchanges, and ii) the energetics of the dC4 and dC7 exchanges depended on the associated chiral indices and could be endothermic or exothermic. The presented method is general and is applicable to any molecule that interacts with nanotubes. The study opens a way for science of carbon nanotube thermodynamics. PMID:23066502

  10. Nucleic acids in mummified plant seeds: screening of twelve specimens by gel-electrophoresis, molecular hybridization and DNA cloning.

    Science.gov (United States)

    Rollo, F; La Marca, A; Amici, A

    1987-02-01

    Twelve seed specimens of varying ages and from different archaeological sites were analyzed for the presence of polymerized DNA and RNA. Amongst the samples tested, one of Vitis vinifera from an archaeological site in Iran (2,000-3,000 B.C.) was found to be completely devoid of nucleic acids. Zea mais seeds of Precolumbial age from Peru (about 800 A.D.) contained depolymerized DNA and RNA. Samples of Vitis vinifera and Rubus sp. from a Lombard archaeological site (800 A.D.) as well as radiocarbon dated seeds from the site of the "Spring Sanctuary" near Metaponto (I-IV century B.C.) were found to contain polymerized DNA and rRNA bands. However the electrophoretic properties of the rRNAs in one case and hybridization experiments performed with cloned seed DNA in the other, clearly demonstrated that the polymerized nucleic acids were not of plant origin.

  11. Quantitative PCR--new diagnostic tool for quantifying specific mRNA and DNA molecules

    DEFF Research Database (Denmark)

    Schlemmer, B O; Sorensen, B S; Overgaard, J

    2004-01-01

    of a subset of ligands from the EGF system is increased in bladder cancer. Furthermore, measurement of the mRNA concentration gives important information such as the expression of these ligands correlated to the survival of the patients. In addition to the alterations at the mRNA level, changes also can occur...... at the DNA level in the EGF system. Thus, it has been demonstrated that the number of genes coding for the human epidermal growth factor receptor 2 (HER2) is increased in a number of breast tumors. It is now possible to treat breast cancer patients with a humanized antibody reacting with HER2...... of mRNA or DNA in biological samples. In this study quantitative PCR was used to investigate the role of the EGF (epidermal growth factor) system in cancer both for measurements of mRNA concentrations and for measurements of the number of copies of specific genes. It is shown that the mRNA expression...

  12. Sorting through the chaff, nDNA gene trees for phylogenetic inference and hybrid identification of annual sunflowers (Helianthus sect. Helianthus).

    Science.gov (United States)

    Moody, Michael L; Rieseberg, Loren H

    2012-07-01

    The annual sunflowers (Helianthus sect. Helianthus) present a formidable challenge for phylogenetic inference because of ancient hybrid speciation, recent introgression, and suspected issues with deep coalescence. Here we analyze sequence data from 11 nuclear DNA (nDNA) genes for multiple genotypes of species within the section to (1) reconstruct the phylogeny of this group, (2) explore the utility of nDNA gene trees for detecting hybrid speciation and introgression; and (3) test an empirical method of hybrid identification based on the phylogenetic congruence of nDNA gene trees from tightly linked genes. We uncovered considerable topological heterogeneity among gene trees with or without three previously identified hybrid species included in the analyses, as well as a general lack of reciprocal monophyly of species. Nonetheless, partitioned Bayesian analyses provided strong support for the reciprocal monophyly of all species except H. annuus (0.89 PP), the most widespread and abundant annual sunflower. Previous hypotheses of relationships among taxa were generally strongly supported (1.0 PP), except among taxa typically associated with H. annuus, apparently due to the paraphyly of the latter in all gene trees. While the individual nDNA gene trees provided a useful means for detecting recent hybridization, identification of ancient hybridization was problematic for all ancient hybrid species, even when linkage was considered. We discuss biological factors that affect the efficacy of phylogenetic methods for hybrid identification.

  13. Evaluation of PCR and DNA hybridization protocols for detection of viable enterotoxigenic Clostridium perfringens in irradiated beef

    International Nuclear Information System (INIS)

    Baez, L.A.; Juneja, V.K.; Thayer, D.W.; Sackitey, S.

    1997-01-01

    The sensitivity of DNA hybridization and polymerase chain reaction (PCR), was evaluated in irradiated cooked and raw beef samples. A membrane-based colony hybridization assay and a PCR protocol, both with specificity for the enterotoxin A gene of Clostridium perfringens, were compared with viable plate counts. The results of the colony hybridization procedure were in agreement with viable plate counts for detection and enumeration of enterotoxigenic C. perfringens. The PCR procedure combined a 4 h enrichment followed by a nucleic acid extraction step and assessed the amplification of 183 and 750 base pair enterotoxin gene targets. Detection of C. perfringens by PCR did not show a reliable correlation with viable plate counts or the colony hybridization assay. C. perfringens killed by irradiation were not detected by the plate count or colony hybridization methods; however, killed cells were detected with the PCR technique. By relying on the growth of viable cells for detection and/or enumeration, the colony hybridization and plate count methods provided a direct correlation with the presence of viable bacteria

  14. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  15. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  16. Immunoglobulin heavy-chain fluorescence in situ hybridization-chromogenic in situ hybridization DNA probe split signal in the clonality assessment of lymphoproliferative processes on cytological samples.

    Science.gov (United States)

    Zeppa, Pio; Sosa Fernandez, Laura Virginia; Cozzolino, Immacolata; Ronga, Valentina; Genesio, Rita; Salatiello, Maria; Picardi, Marco; Malapelle, Umberto; Troncone, Giancarlo; Vigliar, Elena

    2012-12-25

    The human immunoglobulin heavy-chain (IGH) locus at chromosome 14q32 is frequently involved in different translocations of non-Hodgkin lymphoma (NHL), and the detection of any breakage involving the IGH locus should identify a B-cell NHL. The split-signal IGH fluorescence in situ hybridization-chromogenic in situ hybridization (FISH-CISH) DNA probe is a mixture of 2 fluorochrome-labeled DNAs: a green one that binds the telomeric segment and a red one that binds the centromeric segment, both on the IGH breakpoint. In the current study, the authors tested the capability of the IGH FISH-CISH DNA probe to detect IGH translocations and diagnose B-cell lymphoproliferative processes on cytological samples. Fifty cytological specimens from cases of lymphoproliferative processes were tested using the split-signal IGH FISH-CISH DNA probe and the results were compared with light-chain assessment by flow cytometry (FC), IGH status was tested by polymerase chain reaction (PCR), and clinicohistological data. The signal score produced comparable results on FISH and CISH analysis and detected 29 positive, 15 negative, and 6 inadequate cases; there were 29 true-positive cases (66%), 9 true-negative cases (20%), 6 false-negative cases (14%), and no false-positive cases (0%). Comparing the sensitivity of the IGH FISH-CISH DNA split probe with FC and PCR, the highest sensitivity was obtained by FC, followed by FISH-CISH and PCR. The split-signal IGH FISH-CISH DNA probe is effective in detecting any translocation involving the IGH locus. This probe can be used on different samples from different B-cell lymphoproliferative processes, although it is not useful for classifying specific entities. Cancer (Cancer Cytopathol) 2012;. © 2012 American Cancer Society. Copyright © 2012 American Cancer Society.

  17. Quantitive DNA Fiber Mapping

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Chun-Mei; Wang, Mei; Greulich-Bode, Karin M.; Weier, Jingly F.; Weier, Heinz-Ulli G.

    2008-01-28

    Several hybridization-based methods used to delineate single copy or repeated DNA sequences in larger genomic intervals take advantage of the increased resolution and sensitivity of free chromatin, i.e., chromatin released from interphase cell nuclei. Quantitative DNA fiber mapping (QDFM) differs from the majority of these methods in that it applies FISH to purified, clonal DNA molecules which have been bound with at least one end to a solid substrate. The DNA molecules are then stretched by the action of a receding meniscus at the water-air interface resulting in DNA molecules stretched homogeneously to about 2.3 kb/{micro}m. When non-isotopically, multicolor-labeled probes are hybridized to these stretched DNA fibers, their respective binding sites are visualized in the fluorescence microscope, their relative distance can be measured and converted into kilobase pairs (kb). The QDFM technique has found useful applications ranging from the detection and delineation of deletions or overlap between linked clones to the construction of high-resolution physical maps to studies of stalled DNA replication and transcription.

  18. Xeroderma pigmentosum and other diseases of human premature aging and DNA repair: Molecules to patients

    Science.gov (United States)

    Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.

    2012-01-01

    A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183

  19. Electronic Detection of DNA Hybridization by Coupling Organic Field-Effect Transistor-Based Sensors and Hairpin-Shaped Probes

    Directory of Open Access Journals (Sweden)

    Corrado Napoli

    2018-03-01

    Full Text Available In this paper, the electronic transduction of DNA hybridization is presented by coupling organic charge-modulated field-effect transistors (OCMFETs and hairpin-shaped probes. These probes have shown interesting properties in terms of sensitivity and selectivity in other kinds of assays, in the form of molecular beacons (MBs. Their integration with organic-transistor based sensors, never explored before, paves the way to a new class of low-cost, easy-to-use, and portable genetic sensors with enhanced performances. Thanks to the peculiar characteristics of the employed sensor, measurements can be performed at relatively high ionic strengths, thus optimizing the probes’ functionality without affecting the detection ability of the device. A complete electrical characterization of the sensor is reported, including calibration with different target concentrations in the measurement environment and selectivity evaluation. In particular, DNA hybridization detection for target concentration as low as 100 pM is demonstrated.

  20. DNA repair characteristics of a hybrid cell clone between xeroderma pigmentosum and Potorous tridactilis

    International Nuclear Information System (INIS)

    Ida, Kenji

    1986-01-01

    A hybrid cell clone PX1 was isolated by fusing UV sensitive XP20S(SV)neo, an SV-40-transformed, neomycin-resistant xeroderma pigmentosum (XP) cell line, and Pt K2, a rat kangaroo (Potorous tridactilis) cell line. The UV-survival curve of PX1 cells fell midway between those of Pt K2 and XP20S(SV)neo cells, since mean lethal doses(D 0 ) were 2.5, 4.7 and 0.27 J/m 2 for PX1, Pt K2 and XP20S(SV)neo, respectively. Amounts of unscheduled DNA synthesis (UDS) after UV, relative to normal human cells, were 60.4 % for Pt K2, 37.7 % for PX1 and 0.1 % for XP20S(SV)neo. Such relative UDS capacities for excision repair of Pt K2, PX1 and XP20S(SV)neo were also consistent with the respective relative capacities of host cell reactivation (HCR) of UV-irradiated Herpes simplex virus. Apparently, there was no single Pt K2 chromosome in the PX1 cells. One possibility is that a gene which may account for the partial restoration of the UV resistance has been transferred from Pt K2 to PX1. (author)

  1. A RNA-DNA Hybrid Aptamer for Nanoparticle-Based Prostate Tumor Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    John C. Leach

    2016-03-01

    Full Text Available The side effects of radio- and chemo-therapy pose long-term challenges on a cancer patient’s health. It is, therefore, highly desirable to develop more effective therapies that can specifically target carcinoma cells without damaging normal and healthy cells. Tremendous efforts have been made in the past to develop targeted drug delivery systems for solid cancer treatment. In this study, a new aptamer, A10-3-J1, which recognizes the extracellular domain of the prostate specific membrane antigen (PSMA, was designed. A super paramagnetic iron oxide nanoparticle-aptamer-doxorubicin (SPIO-Apt-Dox was fabricated and employed as a targeted drug delivery platform for cancer therapy. This DNA RNA hybridized aptamer antitumor agent was able to enhance the cytotoxicity of targeted cells while minimizing collateral damage to non-targeted cells. This SPIO-Apt-Dox nanoparticle has specificity to PSMA+ prostate cancer cells. Aptamer inhibited nonspecific uptake of membrane-permeable doxorubic to the non-target cells, leading to reduced untargeted cytotoxicity and endocytic uptake while enhancing targeted cytotoxicity and endocytic uptake. The experimental results indicate that the drug delivery platform can yield statistically significant effectiveness being more cytotoxic to the targeted cells as opposed to the non-targeted cells.

  2. The formation of diploid and triploid hybrids of female grass carp × male blunt snout bream and their 5S rDNA analysis.

    Science.gov (United States)

    He, Weiguo; Xie, Lihua; Li, Tangluo; Liu, Shaojun; Xiao, Jun; Hu, Jie; Wang, Jing; Qin, Qinbo; Liu, Yun

    2013-11-23

    Hybridization is a useful strategy to alter the genotypes and phenotypes of the offspring. It could transfer the genome of one species to another through combing the different genome of parents in the hybrid offspring. And the offspring may exhibit advantages in growth rate, disease resistance, survival rate and appearance, which resulting from the combination of the beneficial traits from both parents. Diploid and triploid hybrids of female grass carp (Ctenopharyngodon idellus, GC, Cyprininae, 2n = 48) × male blunt snout bream (Megalobrama amblycephala, BSB, Cultrinae, 2n = 48) were successfully obtained by distant hybridization. Diploid hybrids had 48 chromosomes, with one set from GC and one set from BSB. Triploid hybrids possessed 72 chromosomes, with two sets from GC and one set from BSB.The morphological traits, growth rates, and feeding ecology of the parents and hybrid offspring were compared and analyzed. The two kinds of hybrid offspring exhibited significantly phenotypic divergence from GC and BSB. 2nGB hybrids showed similar growth rate compared to that of GC, and 3nGB hybrids significantly higher results. Furthermore, the feeding ecology of hybrid progeny was omnivorous.The 5S rDNA of GC, BSB and their hybrid offspring were also cloned and sequenced. There was only one type of 5S rDNA (designated type I: 180 bp) in GC and one type of 5S rDNA (designated type II: 188 bp) in BSB. However, in the hybrid progeny, diploid and triploid hybrids both inherited type I and type II from their parents, respectively. In addition, a chimera of type I and type II was observed in the genome of diploid and triploid hybrids, excepting a 10 bp of polyA insertion in type II sequence of the chimera of the diploid hybrids. This is the first report of diploid and triploid hybrids being produced by crossing GC and BSB, which have the same chromosome number. The obtainment of two new hybrid offspring has significance in fish genetic breeding. The results illustrate the effect

  3. Proximity hybridization-regulated catalytic DNA hairpin assembly for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Fuyi [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China); Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Yao, Yao; Luo, Jianjun; Zhang, Xing; Zhang, Yu; Yin, Dengyang [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Gao, Fenglei, E-mail: jsxzgfl@sina.com [Jiangsu Key Laboratory of New Drug Research and Clinical Pharmacy, Department of Pharmaceutical Analysis, School of Pharmacy, Xuzhou Medical College, 221004, Xuzhou (China); Wang, Po, E-mail: wangpo@jsnu.edu.cn [School of Chemistry and Chemical Engineering, Jiangsu Normal University, Xuzhou 221116 (China)

    2017-05-29

    Novel hybridization proximity-regulated catalytic DNA hairpin assembly strategy has been proposed for electrochemical immunoassay based on in situ DNA template-synthesized Pd nanoparticles as signal label. The DNA template-synthesized Pd nanoparticles were characterized with atomic force microscopic and X-ray photoelectron spectroscopy. The highly efficient electrocatalysis by DNA template synthesized Pd nanoparticles for NaBH{sub 4} oxidation produced an intense detection signal. The label-free electrochemical method achieved the detection of carcinoembryonic antigen (CEA) with a linear range from 10{sup −15} to 10{sup −11} g mL{sup −1} and a detection limit of 0.43 × 10{sup −15} g mL{sup −1}. Through introducing a supersandwich reaction to increase the DNA length, the electrochemical signal was further amplified, leading to a detection limit of 0.52 × 10{sup −16} g mL{sup −1}. And it rendered satisfactory analytical performance for the determination of CEA in serum samples. Furthermore, it exhibited good reproducibility and stability; meanwhile, it also showed excellent specificity due to the specific recognition of antigen by antibody. Therefore, the DNA template synthesized Pd nanoparticles based signal amplification approach has great potential in clinical applications and is also suitable for quantification of biomarkers at ultralow level. - Graphical abstract: A novel label-free and enzyme-free electrochemical immunoassay based on proximity hybridization-regulated catalytic DNA hairpin assemblies for recycling of the CEA. - Highlights: • A novel enzyme-free electrochemical immunosensor was developed for detection of CEA. • The signal amplification was based on catalytic DNA hairpin assembly and DNA-template-synthesized Pd nanoparticles. • The biosensor could detect CEA down to 0.52 × 10{sup −16} g mL{sup −1} level with a dynamic range spanning 5 orders of magnitude.

  4. Application of DNA Hybridization Biosensor as a Screening Method for the Detection of Genetically Modified Food Components

    Directory of Open Access Journals (Sweden)

    Marian Filipiak

    2008-03-01

    Full Text Available An electrochemical biosensor for the detection of genetically modified food components is presented. The biosensor was based on 21-mer single-stranded oligonucleotide (ssDNA probe specific to either 35S promoter or nos terminator, which are frequently present in transgenic DNA cassettes. ssDNA probe was covalently attached by 5’-phosphate end to amino group of cysteamine self-assembled monolayer (SAM on gold electrode surface with the use of activating reagents – water soluble 1-ethyl-3(3’- dimethylaminopropyl-carbodiimide (EDC and N-hydroxy-sulfosuccinimide (NHS. The hybridization reaction on the electrode surface was detected via methylene blue (MB presenting higher affinity to ssDNA probe than to DNA duplex. The electrode modification procedure was optimized using 19-mer oligoG and oligoC nucleotides. The biosensor enabled distinction between DNA samples isolated from soybean RoundupReady® (RR soybean and non-genetically modified soybean. The frequent introduction of investigated DNA sequences in other genetically modified organisms (GMOs give a broad perspectives for analytical application of the biosensor.

  5. Nuclear and mitochondrial DNA analysis reveals that hybridization between Fasciola hepatica and Fasciola gigantica occurred in China.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Peng, Mao; Hayashi, Kei; Shoriki, Takuya; Mohanta, Uday Kumar; Shibahara, Toshiyuki; Itagaki, Tadashi

    2017-02-01

    The well-known pathogens of fasciolosis, Fasciola hepatica (Fh) and Fasciola Gigantica (Fg), possess abundant mature sperms in their seminal vesicles, and thus, they reproduce bisexually. On the other hand, aspermic Fasciola flukes reported from Asian countries, which have no sperm in their seminal vesicles, probably reproduce parthenogenetically. The aim of this study was to reveal the origin of aspermic Fasciola flukes. The nuclear single copy markers, phosphoenolpyruvate carboxykinase and DNA polymerase delta, were employed for analysis of Fasciola species from China. The hybrid origin of aspermic Fasciola flukes was strongly suggested by the presence of the Fh/Fg type, which includes DNA fragments of both F. hepatica and F. gigantica. China can be regarded as the cradle of the interspecific hybridization because F. hepatica and F. gigantica were detected in the northern and southern parts of China, respectively, and hybrids flukes were distributed between the habitats of the two species. The Chinese origin was supported by the fact that a larger number of mitochondrial NADH dehydrogenase subunit 1 (nad1) haplotypes was detected in Chinese aspermic Fasciola populations than in aspermic populations from the neighbouring countries. Hereafter, 'aspermic' Fasciola flukes should be termed as 'hybrid' Fasciola flukes.

  6. Application of DNA hybridization techniques in the assessment of diarrheal disease among refugess in Thailand. [Shigella; Escherichia coli; Campylobacter; Cryptosporidium

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, D.N.; Echeverria, P.; Pitarangsi, C.; Seriwatana, J.; Sethabutr, O.; Bodhidatta, L.; Brown, C.; Herrmann, J.E.; Blacklow, N.R.

    1988-01-01

    The epidemiology and etiology of acute diarrheal disease were determined in a Hmong refugee camp on the Thai-Laotian border from April 11 to May 14, 1985. DNA hybridization techniques were used to detect Shigella species, enteroinvasive Escherichia coli, and enterotoxigenic E. coli. A monoclonal enzyme-linked immunosorbent assay was used to detect rotavirus, and standard microbiology was used to detect other enteropathogens. The age-specific diarrheal disease rates were 47 episodes per month per 1000 children less than five years old and 113 episodes per month per 1000 children less than one year old. Rotavirus, enterotoxigenic E. coli, Campylobacter, and Cryptosporidium were the predominant pathogens in children less than two years old. The DNA probe hybridized with 94% of 31 specimens identified as enterotoxigenic E. coli by the standard assays and with none of the specimens in which the standard assays were negative. The probe for Shigella and enteroinvasive E. coli hybridized in eight of 10 stools that contained Shigella and four of 314 stools from which Shigella and enteroinvasive E. coli were not isolated. The use of DNA probes allows specimens to be collected in remote areas with a minimum amount of equipment and technical expertise so that they can be easily transported to a central laboratory for further processing.

  7. Recognition of RNA by amide modified backbone nucleic acids: molecular dynamics simulations of DNA-RNA hybrids in aqueous solution.

    Science.gov (United States)

    Nina, Mafalda; Fonné-Pfister, Raymonde; Beaudegnies, Renaud; Chekatt, Habiba; Jung, Pierre M J; Murphy-Kessabi, Fiona; De Mesmaeker, Alain; Wendeborn, Sebastian

    2005-04-27

    Thermodynamic and structural properties of a chemically modified DNA-RNA hybrid in which a phosphodiester linkage is replaced by a neutral amide-3 linkage (3'-CH(2)-CONH-5') were investigated using UV melting experiments, molecular dynamics simulations in explicit water, and continuum solvent models. van't Hoff analysis of the experimental UV melting curves suggests that the significant increase of the thermodynamic stability of a 15-mer DNA-RNA with seven alternated amide-3 modifications (+11 degrees C) is mainly due to an increased binding enthalpy. To further evaluate the origin in the observed affinities differences, the electrostatic contribution to the binding free energy was calculated by solving the Poisson-Boltzmann equation numerically. The nonelectrostatic contribution was estimated as the product of a hydrophobic surface tension coefficient and the surface area that is buried upon double strand formation. Structures were taken from 10 ns molecular dynamics simulations computed in a consistent fashion using explicit solvent, counterions, and the particle-mesh Ewald procedure. The present preliminary thermodynamic study suggests that the favorable binding free energy of the amide-3 DNA single strand to the complementary RNA is equally driven by electrostatic and nonpolar contributions to the binding compared to their natural analogues. In addition, molecular dynamics simulations in explicit water were performed on an amide-3 DNA single strand and the corresponding natural DNA. Results from the conformations cluster analysis of the simulated amide-3 DNA single strand ensembles suggest that the 25% of the population sampled within 10 ns has a pre-organized conformation where the sugar C3' endo pucker is favored at the 3'-flanking nucleotides. These structural and thermodynamic features contribute to the understanding of the observed increased affinities of the amide-3 DNA-RNA hybrids at the microscopic level.

  8. Self-assembly of multiferroic core-shell particulate nanocomposites through DNA-DNA hybridization and magnetic field directed assembly of superstructures

    Energy Technology Data Exchange (ETDEWEB)

    Sreenivasulu, Gollapudi; Srinivasan, Gopalan, E-mail: srinivas@oakland.edu, E-mail: chavez@oakland.edu [Department of Physics, Oakland University, Rochester, MI 48309-4401 (United States); Lochbiler, Thomas A.; Panda, Manashi; Chavez, Ferman A., E-mail: srinivas@oakland.edu, E-mail: chavez@oakland.edu [Department of Chemistry, Oakland University, Rochester, MI 48309-4401 (United States)

    2016-04-15

    Multiferroic composites of ferromagnetic and ferroelectric phases are of importance for studies on mechanical strain mediated coupling between the magnetic and electric subsystems. This work is on DNA-assisted self-assembly of superstructures of such composites with nanometer periodicity. The synthesis involved oligomeric DNA-functionalized ferroelectric and ferromagnetic nanoparticles, 600 nm BaTiO{sub 3} (BTO) and 200 nm NiFe{sub 2}O{sub 4} (NFO), respectively. Mixing BTO and NFO particles, possessing complementary DNA sequences, resulted in the formation of ordered core-shell heteronanocomposites held together by DNA hybridization. The composites were imaged by scanning electron microscopy and scanning microwave microscopy. The presence of heteroassemblies along with core-shell architecture is clearly observed. The reversible nature of the DNA hybridization allows for restructuring the composites into mm-long linear chains and 2D-arrays in the presence of a static magnetic field and ring-like structures in a rotating-magnetic field. Strong magneto-electric (ME) coupling in as-assembled composites is evident from static magnetic field H induced polarization and low-frequency magnetoelectric voltage coefficient measurements. Upon annealing the nanocomposites at high temperatures, evidence for the formation of bulk composites with excellent cross-coupling between the electric and magnetic subsystems is obtained by H-induced polarization and low-frequency ME voltage coefficient. The ME coupling strength in the self-assembled composites is measured to be much stronger than in bulk composites with randomly distributed NFO and BTO prepared by direct mixing and sintering.

  9. Computational Characterization of Small Molecules Binding to the Human XPF Active Site and Virtual Screening to Identify Potential New DNA Repair Inhibitors Targeting the ERCC1-XPF Endonuclease

    Directory of Open Access Journals (Sweden)

    Francesco Gentile

    2018-04-01

    Full Text Available The DNA excision repair protein ERCC-1-DNA repair endonuclease XPF (ERCC1-XPF is a heterodimeric endonuclease essential for the nucleotide excision repair (NER DNA repair pathway. Although its activity is required to maintain genome integrity in healthy cells, ERCC1-XPF can counteract the effect of DNA-damaging therapies such as platinum-based chemotherapy in cancer cells. Therefore, a promising approach to enhance the effect of these therapies is to combine their use with small molecules, which can inhibit the repair mechanisms in cancer cells. Currently, there are no structures available for the catalytic site of the human ERCC1-XPF, which performs the metal-mediated cleavage of a DNA damaged strand at 5′. We adopted a homology modeling strategy to build a structural model of the human XPF nuclease domain which contained the active site and to extract dominant conformations of the domain using molecular dynamics simulations followed by clustering of the trajectory. We investigated the binding modes of known small molecule inhibitors targeting the active site to build a pharmacophore model. We then performed a virtual screening of the ZINC Is Not Commercial 15 (ZINC15 database to identify new ERCC1-XPF endonuclease inhibitors. Our work provides structural insights regarding the binding mode of small molecules targeting the ERCC1-XPF active site that can be used to rationally optimize such compounds. We also propose a set of new potential DNA repair inhibitors to be considered for combination cancer therapy strategies.

  10. Parallel characterization of anaerobic toluene- and ethylbenzene-degrading microbial consortia by PCR-denaturing gradient gel electrophoresis, RNA-DNA membrane hybridization, and DNA microarray technology

    Science.gov (United States)

    Koizumi, Yoshikazu; Kelly, John J.; Nakagawa, Tatsunori; Urakawa, Hidetoshi; El-Fantroussi, Said; Al-Muzaini, Saleh; Fukui, Manabu; Urushigawa, Yoshikuni; Stahl, David A.

    2002-01-01

    A mesophilic toluene-degrading consortium (TDC) and an ethylbenzene-degrading consortium (EDC) were established under sulfate-reducing conditions. These consortia were first characterized by denaturing gradient gel electrophoresis (DGGE) fingerprinting of PCR-amplified 16S rRNA gene fragments, followed by sequencing. The sequences of the major bands (T-1 and E-2) belonging to TDC and EDC, respectively, were affiliated with the family Desulfobacteriaceae. Another major band from EDC (E-1) was related to an uncultured non-sulfate-reducing soil bacterium. Oligonucleotide probes specific for the 16S rRNAs of target organisms corresponding to T-1, E-1, and E-2 were designed, and hybridization conditions were optimized for two analytical formats, membrane and DNA microarray hybridization. Both formats were used to characterize the TDC and EDC, and the results of both were consistent with DGGE analysis. In order to assess the utility of the microarray format for analysis of environmental samples, oil-contaminated sediments from the coast of Kuwait were analyzed. The DNA microarray successfully detected bacterial nucleic acids from these samples, but probes targeting specific groups of sulfate-reducing bacteria did not give positive signals. The results of this study demonstrate the limitations and the potential utility of DNA microarrays for microbial community analysis.

  11. Expression of proto-oncogenes in non-Hodgkin's lymphomas by in situ hybridization with biotinylated DNA probes

    International Nuclear Information System (INIS)

    Hamatani, Kiyohiro; Yoshida, Kuniko; Abe, Masumi; Shimaoka, Katsutaro; Shiku, Hiroshi; Akiyama, Mitoshi; Kondo, Hisayoshi.

    1989-11-01

    Expression of six proto-oncogenes (fos, myc, myb, Ki-ras, Ha-ras, and N-ras) in 43 cases of non-Hodgkin's lymphoma was analyzed by means of in situ hybridization. Biotinylated DNA probes of the six oncogenes and those of the immunoglobulin H-chain (IgH) gene and the T cell receptor β-chain (TCRβ) gene were used. The results of in situ hybridization performed under blind conditions by IgH and TCRβ gene probes were compatible with those of typing by cell surface markers. The nuclear protein-related proto-oncogenes, fos myc, and myb, were expressed in about 70 % - 80 % of all cases regardless of phenotypes, histology or histologic grade. On the contrary, genes of the ras family were expressed in fewer cases except for the Ki-ras gene which was more frequently expressed by cases of the T cell immunophenotype with a high malignancy grade. The results of dot hybridization with RNA extracted from some cases were compatible with those of in situ hybridization, further demonstrating the specificity of in situ hybridization. (author)

  12. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA.

    Science.gov (United States)

    Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina

    2014-01-01

    Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.

  13. Production of gamma induced reactive oxygen species and damage of DNA molecule in HaCaT cells under euoxic and hypoxic condition

    International Nuclear Information System (INIS)

    Joseph, P.; Bhat, N.N.; Copplestone, D.; Narayana, Y.

    2014-01-01

    The paper deals with the study of gamma radiation induced reactive oxygen species (ROS) generation in normal human keratinocytes (HaCaT) cells and quantification of subsequent damages induced on DNA molecules. The DNA damages induced in cells after gamma irradiation has been analyzed using Alkaline comet assay. The ROS produced in the cells were quantified by measuring fluorescence after loading the cells with 2', 7' dichlorofluorescin diacetate, a dye that is oxidized into a highly fluorescent form in the presence of peroxides. Studies reveal that in HaCaT cells radical generation occurs when exposed to ionizing radiation and it increases with dose. The induced DNA damages also increases with dose and ROS generation. The study clearly shows the importance of ROS in DNA damage induction and the cells possessing elevated levels of DNA damage after radiation exposure is due to the effect of increased levels of intracellular ROS. (author)

  14. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  15. Sensitive optical bio-sensing of p-type WSe2 hybridized with fluorescent dye attached DNA by doping and de-doping effects

    Science.gov (United States)

    Han, Kyu Hyun; Kim, Jun Young; Jo, Seong Gi; Seo, Changwon; Kim, Jeongyong; Joo, Jinsoo

    2017-10-01

    Layered transition metal dichalcogenides, such as MoS2, WSe2 and WS2, are exciting two-dimensional (2D) materials because they possess tunable optical and electrical properties that depend on the number of layers. In this study, the nanoscale photoluminescence (PL) characteristics of the p-type WSe2 monolayer, and WSe2 layers hybridized with the fluorescent dye Cy3 attached to probe-DNA (Cy3/p-DNA), have been investigated as a function of the concentration of Cy3/DNA by using high-resolution laser confocal microscopy. With increasing concentration of Cy3/p-DNA, the measured PL intensity decreases and its peak is red-shifted, suggesting that the WSe2 layer has been p-type doped with Cy3/p-DNA. Then, the PL intensity of the WSe2/Cy3/p-DNA hybrid system increases and the peak is blue-shifted through hybridization with relatively small amounts of target-DNA (t-DNA) (50-100 nM). This effect originates from charge and energy transfer from the Cy3/DNA to the WSe2. For t-DNA detection, our systems using p-type WSe2 have the merit in terms of the increase of PL intensity. The p-type WSe2 monolayers can be a promising nanoscale 2D material for sensitive optical bio-sensing based on the doping and de-doping responses to biomaterials.

  16. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Science.gov (United States)

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  17. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  18. Hybridization, mitochondrial DNA phylogeography, and prediction of the early stages of reproductive isolation: lessons from New Zealand cicadas (genus Kikihia).

    Science.gov (United States)

    Marshall, David C; Hill, Kathy B R; Cooley, John R; Simon, Chris

    2011-07-01

    One of the major tenets of the modern synthesis is that genetic differentiation among subpopulations is translated over time into genetic differentiation among species. Phylogeographic exploration is therefore essential to the study of speciation because it can reveal the presence of subpopulations that may go on to become species or that may already represent cryptic species. Acoustic species-specific mating signals provide a significant advantage for the recognition of cryptic or incipient species. Because the majority of species do not have such easily recognized premating signals, data from acoustically signaling species can serve as a valuable heuristic tool. Acoustic signals are also convenient tools for recognizing hybridization events. Here, we demonstrate that evidence of hybridization in the form of intermediate song phenotypes is present in many contact zones between species of the New Zealand grass cicadas of the Kikihia muta species complex and that recurring mitochondrial DNA (mtDNA) introgression has created misleading patterns that make it difficult to identify certain taxa using song or mtDNA alone. In one case, introgression appears to have occurred between allopatric taxa by dispersal of introgressed populations of an intermediary species ("hybridization by proxy"). We also present a comparison of mtDNA-tree- and song-based taxonomies obtained for the K. muta complex. We find that 12 mtDNA candidate species are identified using shifts in phylogenetic branching rate found by a single-threshold mixed Yule-coalescent lineage model, while only 7 candidate species are identified using songs. Results from the Yule-coalescent model are dependent on factors such as the number of modeled thresholds and the inclusion of duplicate haplotypes. Genetic distances within song species reach a maximum at about 0.028 substitutions/site when likely cases of hybridization and introgression are excluded. Large genetic breaks or "gaps" are not observed between some

  19. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    Science.gov (United States)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

  20. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    Science.gov (United States)

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.