Boyko, Alex; Kovalchuk, Igor
2010-01-01
Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
International Nuclear Information System (INIS)
Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.
1990-01-01
A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate
Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis
International Nuclear Information System (INIS)
Lau How Mooi
1998-01-01
Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured
Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L
2018-04-12
Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods
Directory of Open Access Journals (Sweden)
Sedlackova Tatiana
2013-02-01
Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.
Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms
Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.
1987-01-01
DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers
Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.
Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A
2016-06-01
Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.
Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh
2016-04-01
Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.
Linkage map of the fragments of herpesvirus papio DNA.
Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H
1981-01-01
Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015
Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.
Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F
1976-09-01
Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.
Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.
Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.
Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M
2018-02-01
To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.
High efficiency hydrodynamic DNA fragmentation in a bubbling system
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling
2017-01-01
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage
Directory of Open Access Journals (Sweden)
Carol Coughlan
2015-01-01
Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
Bacterial natural transformation by highly fragmented and damaged DNA
DEFF Research Database (Denmark)
Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre
2013-01-01
for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...
DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.
García-Vilchis, David; Aranda-Anzaldo, Armando
2017-12-01
Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
FragIdent--automatic identification and characterisation of cDNA-fragments.
Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin
2009-03-02
Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I
2016-01-01
Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.
Amplification of deoxyribonucleic acid (DNA) fragment using two ...
African Journals Online (AJOL)
user
2011-04-11
Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...
DEFF Research Database (Denmark)
Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.
1995-01-01
Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...
Quantification of DNA fragmentation in processed foods using real-time PCR.
Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi
2017-07-01
DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Kosaka, T.; Kuwabara, M.; Koide, F.
1992-01-01
Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking
Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana
2013-04-01
An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Synthesis and NMR of {sup 15}N-labeled DNA fragments
Energy Technology Data Exchange (ETDEWEB)
Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)
1994-12-01
DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.
Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.
De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C
2015-03-01
Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.
FragIdent – Automatic identification and characterisation of cDNA-fragments
Directory of Open Access Journals (Sweden)
Goehler Heike
2009-03-01
Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Cheng, Xin; Ivessa, Andreas S
2012-10-01
Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.
Real-time Tracking of DNA Fragment Separation by Smartphone.
Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori
2017-06-01
Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.
Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes
2005-10-01
1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as
DEFF Research Database (Denmark)
Christensen, Laurids Siig; Sørensen, K. J.; Lei, J. C.
1987-01-01
Purified DNA from 42 isolates of Suid herpesvirus 1 (SHV-1) collected during 1985 from clinical outbreaks of Aujezsky's disease on Danish farms was compared by restriction fragment pattern (RFP) analysis. The BamHI generated RFPs were found to be distinguishable, thus confirming RFP analysis...
Directory of Open Access Journals (Sweden)
Barbara Dariš
2018-02-01
Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))
1994-08-01
The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
Energy Technology Data Exchange (ETDEWEB)
Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)
2000-06-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
International Nuclear Information System (INIS)
Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.
2000-01-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America
Fragmentation of sperm DNA using the TUNEL method.
Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R
2014-11-01
To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.
Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.
Warwicker, J; Ollis, D; Richards, F M; Steitz, T A
1985-12-05
The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.
Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P
2013-10-01
Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The
A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food
International Nuclear Information System (INIS)
Jones, J.L.; Bulford, B.B.
1990-07-01
The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)
Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.
2015-07-01
Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.
Directory of Open Access Journals (Sweden)
Gosalvez Jaime
2009-04-01
Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.
Luciferase assay to study the activity of a cloned promoter DNA fragment.
Solberg, Nina; Krauss, Stefan
2013-01-01
Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.
DEFF Research Database (Denmark)
Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E
1995-01-01
Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
International Nuclear Information System (INIS)
Evenson, Donald P.; Wixon, Regina
2005-01-01
Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated
Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis
van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland
2006-01-01
We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893
Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.
Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime
2006-12-01
The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.
No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus
DEFF Research Database (Denmark)
Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens
2013-01-01
It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....
(PCR) for direct cloning of blunt-end DNA fragments
African Journals Online (AJOL)
Administrator
2011-09-19
Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).
Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.
1996-01-01
We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes
International Nuclear Information System (INIS)
Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge
2006-01-01
Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra
2018-02-01
Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.
Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P
2017-10-01
A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.
Global patterns of fragmentation and connectivity of mammalian carnivore habitat
Crooks, Kevin R.; Burdett, Christopher L.; Theobald, David M.; Rondinini, Carlo; Boitani, Luigi
2011-01-01
Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges...
Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.
2014-01-01
Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...
Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles
Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin
2010-01-01
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be
International Nuclear Information System (INIS)
D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.
1988-01-01
cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus
Influence of DNA conformation on radiation-induced single-strand breaks
International Nuclear Information System (INIS)
Barone, F.; Belli, M.; Mazzei, F.
1994-01-01
We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)
The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.
2015-01-01
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667
Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments
International Nuclear Information System (INIS)
Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.
1979-01-01
Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)
Predicting fragmentation sizing profiles for different blasting patterns
International Nuclear Information System (INIS)
Sheikh, A.M.; Chung, S.H.
1987-01-01
This paper evaluates the efficiency of blasting in a large scale underground heap leaching operation. The prediction model is based on the dynamic tensile breaking strength of rock formation, the detonation characteristics of the explosives and the drill hole pattern. The modelling includes crack pattern development and fragmentation computation fitted by the Rosin-Rammler distribution equation
The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F
2015-05-15
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet
2018-03-23
To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.
Fraser, L; Strzezek, J
2007-07-15
In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in
Energy Technology Data Exchange (ETDEWEB)
Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor
2001-09-15
We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.
Holley, W. R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the
International Nuclear Information System (INIS)
Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.
1986-01-01
The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides
Glavac, Damjan; Potocnik, Uros; Podpecnik, Darja; Zizek, Teofil; Smerkolj, Sava; Ravnik-Glavac, Metka
2002-04-01
We have studied 57 different mutations within three beta-globin gene promoter fragments with sizes 52 bp, 77 bp, and 193 bp by fluorescent capillary electrophoresis CE-SSCP analysis. For each mutation and wild type, energetically most-favorable predicted secondary structures were calculated for sense and antisense strands using the MFOLD DNA-folding algorithm in order to investigate if any correlation exists between predicted DNA structures and actual CE migration time shifts. The overall CE-SSCP detection rate was 100% for all mutations in three studied DNA fragments. For shorter 52 bp and 77 bp DNA fragments we obtained a positive correlation between the migration time shifts and difference in free energy values of predicted secondary structures at all temperatures. For longer 193 bp beta-globin gene fragments with 46 mutations MFOLD predicted different secondary structures for 89% of mutated strands at 25 degrees C and 40 degrees C. However, the magnitude of the mobility shifts did not necessarily correlate with their secondary structures and free energy values except for the sense strand at 40 degrees C where this correlation was statistically significant (r = 0.312, p = 0.033). Results of this study provided more direct insight into the mechanism of CE-SSCP and showed that MFOLD prediction could be helpful in making decisions about the running temperatures and in prediction of CE-SSCP data patterns, especially for shorter (50-100 bp) DNA fragments. Copyright 2002 Wiley-Liss, Inc.
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-09-24
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA
International Nuclear Information System (INIS)
Yakura, Kimitaka; Tanifuji, Shigeyuki.
1983-01-01
EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)
Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J
2010-08-01
In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.
Birla, Bhagyashree S; Chou, Hui-Hsien
2015-01-01
Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Directory of Open Access Journals (Sweden)
Bhagyashree S Birla
Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Wehrmann, A; Eggeling, L; Sahm, H
1994-12-01
In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.
Nature of defects produced on thymine fragment by gamma irradiation of DNA
International Nuclear Information System (INIS)
Teoule, R.; Bonicel, A.
1975-01-01
A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions
A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment
Directory of Open Access Journals (Sweden)
Manesh Kumar Panner Selvam
2018-03-01
Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay
ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH
CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
International Nuclear Information System (INIS)
Jackson, Christopher B.; Gallati, Sabina; Schaller, André
2012-01-01
Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
Energy Technology Data Exchange (ETDEWEB)
Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Wolbachia and DNA barcoding insects: patterns, potential, and problems.
Smith, M Alex; Bertrand, Claudia; Crosby, Kate; Eveleigh, Eldon S; Fernandez-Triana, Jose; Fisher, Brian L; Gibbs, Jason; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hind, Katharine; Hrcek, Jan; Huang, Da-Wei; Janda, Milan; Janzen, Daniel H; Li, Yanwei; Miller, Scott E; Packer, Laurence; Quicke, Donald; Ratnasingham, Sujeevan; Rodriguez, Josephine; Rougerie, Rodolphe; Shaw, Mark R; Sheffield, Cory; Stahlhut, Julie K; Steinke, Dirk; Whitfield, James; Wood, Monty; Zhou, Xin
2012-01-01
Wolbachia is a genus of bacterial endosymbionts that impacts the breeding systems of their hosts. Wolbachia can confuse the patterns of mitochondrial variation, including DNA barcodes, because it influences the pathways through which mitochondria are inherited. We examined the extent to which these endosymbionts are detected in routine DNA barcoding, assessed their impact upon the insect sequence divergence and identification accuracy, and considered the variation present in Wolbachia COI. Using both standard PCR assays (Wolbachia surface coding protein--wsp), and bacterial COI fragments we found evidence of Wolbachia in insect total genomic extracts created for DNA barcoding library construction. When >2 million insect COI trace files were examined on the Barcode of Life Datasystem (BOLD) Wolbachia COI was present in 0.16% of the cases. It is possible to generate Wolbachia COI using standard insect primers; however, that amplicon was never confused with the COI of the host. Wolbachia alleles recovered were predominantly Supergroup A and were broadly distributed geographically and phylogenetically. We conclude that the presence of the Wolbachia DNA in total genomic extracts made from insects is unlikely to compromise the accuracy of the DNA barcode library; in fact, the ability to query this DNA library (the database and the extracts) for endosymbionts is one of the ancillary benefits of such a large scale endeavor--which we provide several examples. It is our conclusion that regular assays for Wolbachia presence and type can, and should, be adopted by large scale insect barcoding initiatives. While COI is one of the five multi-locus sequence typing (MLST) genes used for categorizing Wolbachia, there is limited overlap with the eukaryotic DNA barcode region.
Directory of Open Access Journals (Sweden)
Beiyu Liu
2009-09-01
Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.
Directory of Open Access Journals (Sweden)
Agustín García-Peiró
2014-01-01
Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W
1991-01-01
Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.
Nugraha, Fitra Arya Dwi; Holil, Kholifah; Kurniawan, Nia
2017-05-01
Ecological damages to the Lagoon of Segara Anakan, Central Java, as well as large-scale and continuous exploitation are threatening the sustainability of fine shrimp, Metapenaeus elegans, and resources. Information in regards to genetic resources is crucial to establish long-term conservation programs and to preserve germplasm quality. This study aims to evaluate the number and size of the fragment which is digested with restriction enzyme Hind III. Seven individuals of Metapenaeus elegans from the Lagoon of Segara Anakan were examined using Hind III. Amplification of mitochondrial DNA resulted in 950 bp, and the digestion using Hind III generated four fragments consisting of 114 bp, 200 bp, 250 bp, and 386 bp, which formed a monomorphic pattern. The restriction pattern showed the probability of homozygosity of alleles that restricted using Hind III. Homozygosity indicates no variation of DNA sequence.
Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M
1986-09-01
The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].
Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D
2011-01-01
The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
International Nuclear Information System (INIS)
Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie
2012-01-01
Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
Energy Technology Data Exchange (ETDEWEB)
Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)
2012-04-20
Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
International Nuclear Information System (INIS)
Zhu Shoupeng; Xiao Dong; Han Xiaofeng
1997-01-01
The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
Directory of Open Access Journals (Sweden)
Jiabing Ji
Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.
Global patterns of fragmentation and connectivity of mammalian carnivore habitat.
Crooks, Kevin R; Burdett, Christopher L; Theobald, David M; Rondinini, Carlo; Boitani, Luigi
2011-09-27
Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation.
Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments
International Nuclear Information System (INIS)
Sage, E.; Moustacchi, E.
1987-01-01
The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA
DNA-imprinted polymer nanoparticles with monodispersity and prescribed DNA-strand patterns
Trinh, Tuan; Liao, Chenyi; Toader, Violeta; Barłóg, Maciej; Bazzi, Hassan S.; Li, Jianing; Sleiman, Hanadi F.
2018-02-01
As colloidal self-assembly increasingly approaches the complexity of natural systems, an ongoing challenge is to generate non-centrosymmetric structures. For example, patchy, Janus or living crystallization particles have significantly advanced the area of polymer assembly. It has remained difficult, however, to devise polymer particles that associate in a directional manner, with controlled valency and recognition motifs. Here, we present a method to transfer DNA patterns from a DNA cage to a polymeric nanoparticle encapsulated inside the cage in three dimensions. The resulting DNA-imprinted particles (DIPs), which are 'moulded' on the inside of the DNA cage, consist of a monodisperse crosslinked polymer core with a predetermined pattern of different DNA strands covalently 'printed' on their exterior, and further assemble with programmability and directionality. The number, orientation and sequence of DNA strands grafted onto the polymeric core can be controlled during the process, and the strands are addressable independently of each other.
Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi
2008-12-15
The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.
Arora, Shagun; Tandon, Simran
2015-01-01
In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
S. Yu. Borovets
2017-01-01
Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level
Directory of Open Access Journals (Sweden)
Jorge A. Bertolotto
2016-06-01
Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Bertolotto, Jorge A.; Umazano, Juan P.
2016-06-01
In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser
de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson
2015-03-01
Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.
Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V
2016-06-20
Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.
The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation
Directory of Open Access Journals (Sweden)
George Anifandis
2018-05-01
Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.
Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge
2017-12-01
In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.
Effect of superoxide dismutase supplementation on sperm DNA fragmentation
Directory of Open Access Journals (Sweden)
Luciano Negri
2017-10-01
Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD
Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei
2013-01-01
A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746
International Nuclear Information System (INIS)
Al-Gubory, Kais H.
2005-01-01
The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals
Directory of Open Access Journals (Sweden)
Leclerc Xavier
2009-04-01
Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.
International Nuclear Information System (INIS)
Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert
1987-01-01
The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)
Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping
2004-10-01
Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.
International Nuclear Information System (INIS)
Holley, W.R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs
Fragmentation patterns of evergreen oak woodlands in Southwestern Iberia
DEFF Research Database (Denmark)
Costa, A.; Madeira, M.; Lima Santos, J.
2014-01-01
Mediterranean evergreen oak woodlands (composed of Quercus suber L. and Quercus rotundifolia Lam.) are becoming increasingly fragmented in the human-modified landscapes of Southwestern Portugal and Spain. Previous studies have largely neglected to assess the spatial changes of oak woodlands...... patterns of oak recruitment and therefore, its study may be helpful in highlighting future baselines for the sustainable management of oak woodlands....
International Nuclear Information System (INIS)
Dallas, J.F.
1988-01-01
A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species
Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena
2016-09-01
Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.
Richardson, Ruth E.; Suzuki, Yo
2015-01-01
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330
Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan
2009-02-01
To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.
Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu
2015-08-01
In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.
Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.
1974-01-01
By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397
Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi
2011-07-15
presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices
Yan, Hao; Labean, Thomas H.; Feng, Liping; Reif, John H.
2003-07-01
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping.
Directory of Open Access Journals (Sweden)
Cheuk-Chun Szeto
Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.
Origin of DNA in human serum and usefulness of serum as a material for DNA typing.
Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I
2001-06-01
The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.
DNA pattern recognition using canonical correlation algorithm.
Sarkar, B K; Chakraborty, Chiranjib
2015-10-01
We performed canonical correlation analysis as an unsupervised statistical tool to describe related views of the same semantic object for identifying patterns. A pattern recognition technique based on canonical correlation analysis (CCA) was proposed for finding required genetic code in the DNA sequence. Two related but different objects were considered: one was a particular pattern, and other was test DNA sequence. CCA found correlations between two observations of the same semantic pattern and test sequence. It is concluded that the relationship possesses maximum value in the position where the pattern exists. As a case study, the potential of CCA was demonstrated on the sequence found from HIV-1 preferred integration sites. The subsequences on the left and right flanking from the integration site were considered as the two views, and statistically significant relationships were established between these two views to elucidate the viral preference as an important factor for the correlation.
Zweig, Christa L.; Reichert, Brian E.; Kitchens, Wiley M.
2011-01-01
Large wetlands around the world face the possibility of degradation, not only from complete conversion, but also from subtle changes in their structure and function. While fragmentation and isolation of wetlands within heterogeneous landscapes has received much attention, the disruption of spatial patterns/processes within large wetland systems and the resulting fragmentation of community components are less well documented. A greater understanding of pattern/process relationships and landscape gradients, and what occurs when they are altered, could help avoid undesirable consequences of restoration actions. The objective of this study is to determine the amount of fragmentation of sawgrass ridges due to artificial impoundment of water and how that may be differentially affected by spatial position relative to north and south levees. We also introduce groundbreaking evidence of landscape-level discontinuous elevation gradients within WCA3AS by comparing generalized linear and generalized additive models. These relatively abrupt breaks in elevation may have non-linear effects on hydrology and vegetation communities and would be crucial in restoration considerations. Modeling suggests there are abrupt breaks in elevation as a function of northing (Y-coordinate). Fragmentation indices indicate that fragmentation is a function of elevation and easting (X-coordinate), and that fragmentation has increased from 1988-2002. When landscapes change and the changes are compounded by non-linear landscape variables that are described herein, the maintenance processes change with them, creating a degraded feedback loop that alters the system's response to structuring variables and diminishes our ability to predict the effects of restoration projects or climate change. Only when these landscape variables and linkages are clearly defined can we predict the response to potential perturbations and apply the knowledge to other landscape-level wetland systems in need of future
DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure
International Nuclear Information System (INIS)
Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo
2010-01-01
Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.
DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure
Energy Technology Data Exchange (ETDEWEB)
Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)
2010-01-05
Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.
He, Shou-Pu; Sun, Jun-Ling; Zhang, Chao; Du, Xiong-Ming
2011-01-01
The impact of alien DNA fragments on plant genome has been studied in many species. However, little is known about the introgression lines of Gossypium. To study the consequences of introgression in Gossypium, we investigated 2000 genomic and 800 epigenetic sites in three typical cotton introgression lines, as well as their cultivar (Gossypium hirsutum) and wild parents (Gossypium bickii), by amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified polymorphism (MSAP). The results demonstrate that an average of 0.5% of exotic DNA segments from wild cotton is transmitted into the genome of each introgression line, with the addition of other forms of genetic variation. In total, an average of 0.7% of genetic variation sites is identified in introgression lines. Simultaneously, the overall cytosine methylation level in each introgression line is very close to that of the upland cotton parent (an average of 22.6%). Further dividing patterns reveal that both hypomethylation and hypermethylation occurred in introgression lines in comparison with the upland cotton parent. Sequencing of nine methylation polymorphism fragments showed that most (7 of 9) of the methylation alternations occurred in the noncoding sequences. The molecular evidence of introgression from wild cotton into introgression lines in our study is identified by AFLP. Moreover, the causes of petal variation in introgression lines are discussed.
International Nuclear Information System (INIS)
Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich
1998-01-01
The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)
J. Rogan; T.M. Wright; J. Cardille; H. Pearsall; Y. Ogneva-Himmelberger; Rachel Riemann; Kurt Riitters; K. Partington
2016-01-01
Forest fragmentation has been studied extensively with respect to biodiversity loss, disruption of ecosystem services, and edge effects although the relationship between forest fragmentation and human activities is still not well understood. We classified the pattern of forests in Massachusetts using fragmentation indicators to address...
Bille, Todd W; Cromartie, Carter; Farr, Matthew
2009-09-01
This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.
Directory of Open Access Journals (Sweden)
Kotoka Masuyama
Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.
Freeman, S.; Pham, M.; Rodriguez, R.J.
1993-01-01
Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.
DEFF Research Database (Denmark)
Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta
2012-01-01
Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...
Energy Technology Data Exchange (ETDEWEB)
Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)
2012-07-29
Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.
Patterning nanocrystals using DNA
Energy Technology Data Exchange (ETDEWEB)
Williams, Shara Carol [Univ. of California, Berkeley, CA (United States)
2003-01-01
One of the goals of nanotechnology is to enable programmed self-assembly of patterns made of various materials with nanometer-sized control. This dissertation describes the results of experiments templating arrangements of gold and semiconductor nanocrystals using 2'-deoxyribonucleic acid (DNA). Previously, simple DNA-templated linear arrangements of two and three nanocrystals structures have been made.[1] Here, we have sought to assemble larger and more complex nanostructures. Gold-DNA conjugates with 50 to 100 bases self-assembled into planned arrangements using strands of DNA containing complementary base sequences. We used two methods to increase the complexity of the arrangements: using branched synthetic doublers within the DNA covalent backbone to create discrete nanocrystal groupings, and incorporating the nanocrystals into a previously developed DNA lattice structure [2][3] that self-assembles from tiles made of DNA double-crossover molecules to create ordered nanoparticle arrays. In the first project, the introduction of a covalently-branched synthetic doubler reagent into the backbone of DNA strands created a branched DNA ''trimer.'' This DNA trimer templated various structures that contained groupings of three and four gold nanoparticles, giving promising, but inconclusive transmission electron microscopy (TEM) results. Due to the presence of a variety of possible structures in the reaction mixtures, and due to the difficulty of isolating the desired structures, the TEM and gel electrophoresis results for larger structures having four particles, and for structures containing both 5 and 10 nm gold nanoparticles were inconclusive. Better results may come from using optical detection methods, or from improved sample preparation. In the second project, we worked toward making two-dimensional ordered arrays of nanocrystals. We replicated and improved upon previous results for making DNA lattices, increasing the size of the lattices
M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale
1994-01-01
A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....
Directory of Open Access Journals (Sweden)
Olga Makarova
Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.
Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C
2001-01-01
Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.
Costa, Augusta; Madeira, Manuel; Lima Santos, José; Plieninger, Tobias; Seixas, Júlia
2014-01-15
Mediterranean evergreen oak woodlands (composed of Quercus suber L. and Quercus rotundifolia Lam.) are becoming increasingly fragmented in the human-modified landscapes of Southwestern Portugal and Spain. Previous studies have largely neglected to assess the spatial changes of oak woodlands in relation to their surrounding landscape matrix, and to characterize and quantify woodland boundaries and edges. The present study aims to fill this gap by analyzing fragmentation patterns of oak woodlands over a 50-year period (1958-2007) in three landscapes. Using archived aerial imagery from 1958, 1995 and 2007, for two consecutive periods (1958-1995 and 1995-2007), we calculated a set of landscape metrics to compare woodland fragmentation over time. Our results indicated a continuous woodland fragmentation characterized by their edge dynamics. From 1958 to 2007, the replacement of open farmland by shrubland and by new afforestation areas in the oak woodland landscape surrounding matrix, led to the highest values for edge contrast length trends of 5.0 and 12.3, respectively. Linear discriminant analysis was performed to delineate fragmented woodland structures and identify metric variables that characterize woodland spatial configuration. The edge contrast length with open farmland showed a strong correlation with F1 (correlations ranging between 0.55 and 0.98) and may be used as a proxy for oak woodland mixedness in landscape matrix. The edge dynamics of oak woodlands may result in different patterns of oak recruitment and therefore, its study may be helpful in highlighting future baselines for the sustainable management of oak woodlands. Copyright © 2013 Elsevier Ltd. All rights reserved.
Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru
2017-01-01
Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096
Cells immobilized on patterns printed in DNA by an inkjet printer.
Sakurai, Kengo; Teramura, Yuji; Iwata, Hiroo
2011-05-01
The ability to two-dimensionally align various kinds of cells freely onto substrate would be a useful tool for analysis of cell-cell interactions. In this study, we aimed to establish a method for attaching cells to the substrate, in which the pattern is drawn by an inkjet printer. Poly-deoxyribonucleic acid (DNA) was immobilized onto the cell surface by use of DNA-conjugated poly(ethylene) glycol-phospholipid (DNA-PEG-lipid), which is the amphiphilic conjugate of PEG-lipid and single-stranded DNA. The surface of the substrate was then modified with the complementary DNA using an inkjet printer. Finally, DNA-immobilized cells were attached onto the substrate through DNA hybridization. The use of the inkjet printer enabled us to draw the DNA pattern accurately on the substrate with a resolution of a few hundred micrometers. DNA-immobilized cells could be attached precisely along the DNA pattern on the substrate. In addition, various kinds of cells could be attached simultaneously by using various sequences of DNA. Our technique is promising for analysis of cell-cell interactions and differentiation induction in stem cell research. Copyright © 2011 Elsevier Ltd. All rights reserved.
Patterns of bird functional diversity on land-bridge island fragments.
Ding, Zhifeng; Feeley, Kenneth J; Wang, Yanping; Pakeman, Robin J; Ding, Ping
2013-07-01
The loss of species diversity due to habitat fragmentation has been extensively studied. In contrast, the impacts of habitat fragmentation on functional diversity remains relatively poorly understood. We conducted bird functional diversity studies on a set of 41 recently isolated land-bridge islands in the Thousand Island Lake, China. We analysed differences in bird species richness and a recently developed suite of complementary functional diversity indices (FRic, volume of functional space occupied; FEve, evenness of abundance distribution in the functional trait space; FDiv, divergence in the distribution of abundance in the trait volume) across different gradients (island area and isolation). We found no correlations between FRic and FEve or FEve and FDiv, but negative correlations between FRic and FDiv. As predicted, island area accounted for most of the variation in bird species richness, whereas isolation explained most of the variation in species evenness (decreasing species evenness with increasing isolation). Functional diversity appears to be more strongly influenced by habitat filtering as opposed to limiting similarity. More specifically, across all islands, both FRic and FEve were significantly lower than expected for randomly assembled communities, but FDiv showed no clear patterns. FRic increased with island area, FEve decreased with island area and FDiv showed no clear patterns. Our finding that FEve decreases with island area at TIL may indicate low functional stability on such islands, and as such large islands and habitat patches may deserve extra attention and/or protection. These results help to demonstrate the importance of considering the effects of fragmentation on functional diversity in habitat management and reserve design plans. © 2013 The Authors. Journal of Animal Ecology © 2013 British Ecological Society.
Mapping of 34 minisatellite loci resolved by two-dimensional DNA typing
DEFF Research Database (Denmark)
Børglum, Anders; Nyegaard, Mette; Kvistgaard, AB
1997-01-01
Two-dimensional (2-D) DNA typing is based on electrophoretic separation of genomic DNA fragments in two dimensions according to independent criteria (size and base-pair sequence), followed by hybridization analysis using multilocus probes. The technique allows simultaneous visualization of several...... could be deduced, showing no evidence of clustering. In the analysis of spot patterns, use was made of a computerized image analysis system specifically designed for 2-D DNA typing. Since experimental variations between different separation patterns were automatically corrected for with this program......, rapid and reliable scorings could be obtained. The results presented demonstrate the availability of reliable genetic information throughout the 2-D separation pattern. Adding the use of semiautomated computerized pattern analysis, this study further substantiates the applicability of 2-D DNA typing...
Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie
2017-05-11
Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.
Fragmented patterns of flood change across the United States
Archfield, Stacey A.; Hirsch, Robert M.; Viglione, A.; Blöschl, G.
2016-01-01
Trends in the peak magnitude, frequency, duration, and volume of frequent floods (floods occurring at an average of two events per year relative to a base period) across the United States show large changes; however, few trends are found to be statistically significant. The multidimensional behavior of flood change across the United States can be described by four distinct groups, with streamgages experiencing (1) minimal change, (2) increasing frequency, (3) decreasing frequency, or (4) increases in all flood properties. Yet group membership shows only weak geographic cohesion. Lack of geographic cohesion is further demonstrated by weak correlations between the temporal patterns of flood change and large-scale climate indices. These findings reveal a complex, fragmented pattern of flood change that, therefore, clouds the ability to make meaningful generalizations about flood change across the United States.
Directory of Open Access Journals (Sweden)
Raquel Xavier
2011-11-01
Full Text Available Evidence for a general lack of genetic differentiation of intertidal invertebrate assemblages in the North Atlantic, based on mtDNA sequence variation, has been interpreted as resulting from recent colonization following the Last Glacial Maximum. In the present study, the phylogeographic patterns of one nuclear and one mtDNA gene fragments of two isopods, Stenosoma lancifer (Miers, 1881 and Stenosoma acuminatum Leach, 1814, from the northeast Atlantic were investigated. These organisms have direct development, which makes them poor dispersers, and are therefore expected to maintain signatures of past historical events in their genomes. Lack of genetic structure, significant deviations from neutrality and star-like haplotype networks have been observed for both mtDNA and nuclear markers of S. lancifer, as well as for the mtDNA of S. acuminatum. No sequence variation was observed for the nuclear gene fragment of S. acuminatum. These results suggest a scenario of recent colonization and demographic expansion and/or high population connectivity driven by ocean currents and sporadic long-distance dispersal through rafting.
Directory of Open Access Journals (Sweden)
Soumya Gupta
Full Text Available Cellular differentiation programs are accompanied by large-scale changes in nuclear organization and gene expression. In this context, accompanying transitions in chromatin assembly that facilitates changes in gene expression and cell behavior in a developmental system are poorly understood. Here, we address this gap and map structural changes in chromatin organization during murine T-cell development, to describe an unusual heterogeneity in chromatin organization and associated functional correlates in T-cell lineage. Confocal imaging of DNA assembly in cells isolated from bone marrow, thymus and spleen reveal the emergence of heterogeneous patterns in DNA organization in mature T-cells following their exit from the thymus. The central DNA pattern dominated in immature precursor cells in the thymus whereas both central and peripheral DNA patterns were observed in naïve and memory cells in circulation. Naïve T-cells with central DNA patterns exhibited higher mechanical pliability in response to compressive loads in vitro and transmigration assays in vivo, and demonstrated accelerated expression of activation-induced marker CD69. T-cell activation was characterized by marked redistribution of DNA assembly to a central DNA pattern and increased nuclear size. Notably, heterogeneity in DNA patterns recovered in cells induced into quiescence in culture, suggesting an internal regulatory mechanism for chromatin reorganization. Taken together, our results uncover an important component of plasticity in nuclear organization, reflected in chromatin assembly, during T-cell development, differentiation and transmigration.
Prakash, Celine; Haeseler, Arndt Von
2017-03-01
RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.
FragIt: a tool to prepare input files for fragment based quantum chemical calculations.
Directory of Open Access Journals (Sweden)
Casper Steinmann
Full Text Available Near linear scaling fragment based quantum chemical calculations are becoming increasingly popular for treating large systems with high accuracy and is an active field of research. However, it remains difficult to set up these calculations without expert knowledge. To facilitate the use of such methods, software tools need to be available to support these methods and help to set up reasonable input files which will lower the barrier of entry for usage by non-experts. Previous tools relies on specific annotations in structure files for automatic and successful fragmentation such as residues in PDB files. We present a general fragmentation methodology and accompanying tools called FragIt to help setup these calculations. FragIt uses the SMARTS language to locate chemically appropriate fragments in large structures and is applicable to fragmentation of any molecular system given suitable SMARTS patterns. We present SMARTS patterns of fragmentation for proteins, DNA and polysaccharides, specifically for D-galactopyranose for use in cyclodextrins. FragIt is used to prepare input files for the Fragment Molecular Orbital method in the GAMESS program package, but can be extended to other computational methods easily.
Fractal assembly of micrometre-scale DNA origami arrays with arbitrary patterns
Tikhomirov, Grigory; Petersen, Philip; Qian, Lulu
2017-12-01
Self-assembled DNA nanostructures enable nanometre-precise patterning that can be used to create programmable molecular machines and arrays of functional materials. DNA origami is particularly versatile in this context because each DNA strand in the origami nanostructure occupies a unique position and can serve as a uniquely addressable pixel. However, the scale of such structures has been limited to about 0.05 square micrometres, hindering applications that demand a larger layout and integration with more conventional patterning methods. Hierarchical multistage assembly of simple sets of tiles can in principle overcome this limitation, but so far has not been sufficiently robust to enable successful implementation of larger structures using DNA origami tiles. Here we show that by using simple local assembly rules that are modified and applied recursively throughout a hierarchical, multistage assembly process, a small and constant set of unique DNA strands can be used to create DNA origami arrays of increasing size and with arbitrary patterns. We illustrate this method, which we term ‘fractal assembly’, by producing DNA origami arrays with sizes of up to 0.5 square micrometres and with up to 8,704 pixels, allowing us to render images such as the Mona Lisa and a rooster. We find that self-assembly of the tiles into arrays is unaffected by changes in surface patterns on the tiles, and that the yield of the fractal assembly process corresponds to about 0.95m - 1 for arrays containing m tiles. When used in conjunction with a software tool that we developed that converts an arbitrary pattern into DNA sequences and experimental protocols, our assembly method is readily accessible and will facilitate the construction of sophisticated materials and devices with sizes similar to that of a bacterium using DNA nanostructures.
Huh, Y J; Ahn, D I; Kim, S J
1995-08-01
To establish the usefulness of DNA fingerprinting for the epidemiology of Mycobacterium tuberculosis isolated from Korean tuberculosis patients. Comparison of restriction fragment length polymorphism (RFLP) patterns produced by southern hybridization of PvuII-digested chromosomal DNA. IS6110-associated banding patterns of 41 isolates varied considerably, containing 1-13 copies. The RFLP pattern of the epidemiologically related M. tuberculosis isolates was identical in 8 of 10 groups of close contact patients. No noticeable differences in RFLP were observed between drug-sensitive and drug-resistant isolates. IS1081-containing restriction fragment analysis of 52 isolates showed 6 different banding patterns, and the C type was found dominant in Korea. Identification of G type M. tuberculosis, which has a 8.0 kb IS1081-containing PvuII fragment, is unusual because it has been observed only in M. bovis BCG so far. IS6110 was a very useful tool for tracing the transmission route of tuberculosis; IS1081 was also useful for subdividing M. tuberculosis into several groups.
DEFF Research Database (Denmark)
Andersen, Jeppe D; Pereira, Vania; Pietroni, Carlotta
2014-01-01
The simultaneous sequencing of samples from multiple individuals increases the efficiency of next-generation sequencing (NGS) while also reducing costs. Here we describe a novel and simple approach for sequencing DNA from multiple individuals per barcode. Our strategy relies on the endonuclease...... digestion of PCR amplicons prior to library preparation, creating a specific fragment pattern for each individual that can be resolved after sequencing. By using both barcodes and restriction fragment patterns, we demonstrate the ability to sequence the human melanocortin 1 receptor (MC1R) genes from 72...... individuals using only 24 barcoded libraries....
Global-Scale Patterns of Forest Fragmentation
Directory of Open Access Journals (Sweden)
Kurt Riitters
2000-12-01
Full Text Available We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 x 9 pixels, "small" scale to 59,049 km 2 (243 x 243 pixels, "large" scale were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe-Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types and Europe-Asia (four types, in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland. The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf.
Global-scale patterns of forest fragmentation
Riitters, K.; Wickham, J.; O'Neill, R.; Jones, B.; Smith, E.
2000-01-01
We report an analysis of forest fragmentation based on 1-km resolution land-cover maps for the globe. Measurements in analysis windows from 81 km 2 (9 ?? 9 pixels, "small" scale) to 59,049 km 2 (243 ?? 243 pixels, "large" scale) were used to characterize the fragmentation around each forested pixel. We identified six categories of fragmentation (interior, perforated, edge, transitional, patch, and undetermined) from the amount of forest and its occurrence as adjacent forest pixels. Interior forest exists only at relatively small scales; at larger scales, forests are dominated by edge and patch conditions. At the smallest scale, there were significant differences in fragmentation among continents; within continents, there were significant differences among individual forest types. Tropical rain forest fragmentation was most severe in North America and least severe in Europe - Asia. Forest types with a high percentage of perforated conditions were mainly in North America (five types) and Europe - Asia (four types), in both temperate and subtropical regions. Transitional and patch conditions were most common in 11 forest types, of which only a few would be considered as "naturally patchy" (e.g., dry woodland). The five forest types with the highest percentage of interior conditions were in North America; in decreasing order, they were cool rain forest, coniferous, conifer boreal, cool mixed, and cool broadleaf. Copyright ?? 2000 by The Resilience Alliance.
Crystal structure of an Okazaki fragment at 2-A resolution
Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.
1992-01-01
In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.
Patterning protein complexes on DNA nanostructures using a GFP nanobody.
Sommese, R F; Hariadi, R F; Kim, K; Liu, M; Tyska, M J; Sivaramakrishnan, S
2016-11-01
DNA nanostructures have become an important and powerful tool for studying protein function over the last 5 years. One of the challenges, though, has been the development of universal methods for patterning protein complexes on DNA nanostructures. Herein, we present a new approach for labeling DNA nanostructures by functionalizing them with a GFP nanobody. We demonstrate the ability to precisely control protein attachment via our nanobody linker using two enzymatic model systems, namely adenylyl cyclase activity and myosin motility. Finally, we test the power of this attachment method by patterning unpurified, endogenously expressed Arp2/3 protein complex from cell lysate. By bridging DNA nanostructures with a fluorescent protein ubiquitous throughout cell and developmental biology and protein biochemistry, this approach significantly streamlines the application of DNA nanostructures as a programmable scaffold in biological studies. © 2016 The Protein Society.
Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles
2016-01-01
DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
Directory of Open Access Journals (Sweden)
Sara Sadeghi
2016-01-01
Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
DEFF Research Database (Denmark)
Fugger, L; Morling, N; Ryder, L P
1989-01-01
The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...
Model for how type I restriction enzymes select cleavage sites in DNA
International Nuclear Information System (INIS)
Studier, F.W.; Bandyopadhyay, P.K.
1988-01-01
Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected
Harris, Christopher; Stace, Anthony J
2018-03-15
A series of experiments have been undertaken on the fragmentation of multiply charged ammonia clusters, (NH 3 ) n z+ , where z ≤ 8 and n ≤ 850, to establish Rayleigh instability limits, whereby clusters at certain critical sizes become unstable due to Coulomb repulsion between the resident charges. Experimental results on size-selected clusters are found to be in excellent agreement with theoretical predictions of Rayleigh instability limits at all values of the charge. Electrostatic theory has been used to help identify fragmentation patterns on the assumption that the clusters separate into two dielectric spheres, and the predicted Coulomb repulsion energies used to establish pathways and the sizes of cluster fragments. The results show that fragmentation is very asymmetric in terms of both the numbers of molecules involved and the amount of charge each fragment accommodates. For clusters carrying a charge ≤+4, the results show that fragmentation proceeds via the loss of small, singly charged clusters. When clusters carry a charge of +5 or more, the experimental observations suggest a marked switch in behavior. Although the laboratory measurements equate to fragmentation via the loss of a large dication cluster, electrostatic theory supports an interpretation that involves the sequential loss of two smaller, singly charged clusters possibly accompanied by the extensive evaporation of neutral molecules. It is suggested that this change in fragmentation pattern is driven by the channelling of Coulomb repulsion energy into intermolecular modes within these larger clusters. Overall, the results appear to support the ion evaporation model that is frequently used to interpret electrospray experiments.
Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M
2015-02-01
In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.
International Nuclear Information System (INIS)
Smith, A.C.; Harmon, J.M.
1987-01-01
The structural organization of the steroid-binding protein of the IM-9 cell glucocorticoid receptor was investigated by using one- and two-dimensional gel electrophoresis of proteolytic receptor fragments. One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of receptor fragments isolated after trypsin digestion of immunopurified [ 3 H]dexamethasone 21-mesylate ([ 3 H]DM-) labeled receptor revealed the presence of a stable 26.5-kilodalton (kDa) steroid-containing non-DNA-binding fragment, derived from a larger, less stable, 29-kDa fragment. The 26.5-kDa tryptic fragment appeared to be completely contained within a 41-kDa, steroid-containing, DNA-binding species isolated after chymotrypsin digestion of the intact protein. Two-dimensional electrophoretic analysis of the [ 3 H]DM-labeled tryptic fragments resolved two 26.5-kDa and two 29-kDa components. This was the same number of isoforms seen in the intact protein, indicating that the charge heterogeneity of the steroid-binding protein is the result of modification within the steroid-containing, non-DNA-binding, 26.5-kDa tryptic fragment. Two-dimensional analysis of the 41-kDa [ 3 H]DM-labeled chymotryptic species revealed a pattern of isoforms more complex than that seen either in the intact protein or in the steroid-containing tryptic fragments. These results suggest that the 41-kDa [ 3 H]DM-labeled species resolved by one-dimensional SDS-PAGE after chymotrypsin digestion may be composed of several distinct proteolytic fragments
International Nuclear Information System (INIS)
Vejko, N.N.; Spitkovskij, D.M.
2000-01-01
The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru
Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa
2014-04-01
Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.
Guevara, María Ángeles; de María, Nuria; Sáez-Laguna, Enrique; Vélez, María Dolores; Cervera, María Teresa; Cabezas, José Antonio
2017-01-01
Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is the methylation-sensitive amplified polymorphism technique (MSAP) which is a modification of amplified fragment length polymorphism (AFLP). It has been used to study methylation of anonymous CCGG sequences in different fungi, plants, and animal species. The main variation of this technique resides on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent-cutter restriction enzyme. For each sample, MSAP analysis is performed using both EcoRI/HpaII- and EcoRI/MspI-digested samples. A comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) methylation-insensitive polymorphisms that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples and (2) methylation-sensitive polymorphisms which are associated with the amplified fragments that differ in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses the modifications that can be applied to adjust the technology to different species of interest.
cDNA structure, genomic organization and expression patterns of ...
African Journals Online (AJOL)
Visfatin was a newly identified adipocytokine, which was involved in various physiologic and pathologic processes of organisms. The cDNA structure, genomic organization and expression patterns of silver Prussian carp visfatin were described in this report. The silver Prussian carp visfatin cDNA cloned from the liver was ...
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.
2000-01-01
DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.
Directory of Open Access Journals (Sweden)
Yuming Lu
Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.
Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F
2017-09-01
In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.
Scar-less multi-part DNA assembly design automation
Hillson, Nathan J.
2016-06-07
The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.
Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.
Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar
2018-06-05
The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.
Santangelo, G M; Tornow, J
1997-12-01
As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.
Vattimo, A V; Burroni, L; Bertelli, P; Vella, A; Volterrani, D
1998-01-01
Pulmonary lymphangitic carcinomatosis (PLC) is an unusual presentation of diffuse infiltrative lung disease. In this report we present two cases secondary to breast cancer; the diagnosis was made by means of transbronchial lung biopsy or postmortem examination. The goal of this study was to analyze the scintigraphic pattern of pulmonary perfusion performed with technetium-99m macroaggregated albumin (99mTc-MAA) in the hope of achieving improved recognition of PLC and its subsequent diagnosis. Upon admission, both patients underwent routine clinical exams followed by chest X-rays. The second patient also underwent CT examination, and both were ultimately examined using pulmonary perfusion scintigraphy with 99mTc-MAA. In the various exams performed, the most reliable and easily identified diagnostic finding turned out to be a characteristic 'fragmented' lung pattern revealed with the perfusion lung scan. Unfortunately, in both cases the patients' conditions rapidly worsened and death occurred shortly following scintigraphy. We were able to conclude that the recognition of the mentioned fragmented scintigraphic lung pattern may be useful in suspected PLC, whereas the nonspecific clinical presentation of this pathology makes diagnosis extremely difficult, with the most significant results being achieved through a comparison of scintigraphic and high resolution CT data.
Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás
2018-01-01
Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.
Groner, B; Hynes, N E
1980-01-01
The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257
Amplified-fragment length polymorphism fingerprinting of Mycoplasma species
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Jensen, J.S.
1999-01-01
Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...
Llorens, Tanya M; Ayre, David J; Whelan, Robert J
2018-04-01
Many plant species have pollination and seed dispersal systems and evolutionary histories that have produced strong genetic structuring. These genetic patterns may be consistent with expectations following recent anthropogenic fragmentation, making it difficult to detect fragmentation effects if no prefragmentation genetic data are available. We used microsatellite markers to investigate whether severe habitat fragmentation may have affected the structure and diversity of populations of the endangered Australian bird-pollinated shrub Grevillea caleyi R.Br., by comparing current patterns of genetic structure and diversity with those of the closely related G. longifolia R.Br. that has a similar life history but has not experienced anthropogenic fragmentation. Grevillea caleyi and G. longifolia showed similar and substantial population subdivision at all spatial levels (global F' ST = 0.615 and 0.454; S p = 0.039 and 0.066), marked isolation by distance and large heterozygous deficiencies. These characteristics suggest long-term effects of inbreeding in self-compatible species that have poor seed dispersal, limited connectivity via pollen flow and undergo population bottlenecks because of periodic fires. Highly structured allele size distributions, most notably in G. caleyi, imply historical processes of drift and mutation were important in isolated subpopulations. Genetic diversity did not vary with population size but was lower in more isolated populations for both species. Through this comparison, we reject the hypothesis that anthropogenic fragmentation has impacted substantially on the genetic composition or structure of G. caleyi populations. Our results suggest that highly self-compatible species with limited dispersal may be relatively resilient to the genetic changes predicted to follow habitat fragmentation. © 2018 John Wiley & Sons Ltd.
Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently
Yu, Chuanhe; Gan, Haiyun
2017-01-01
ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
Petit, R.J.; Csaikl, U.M.; Bordács, S.; Burg, K.; Coart, E.; Cottrell, J.; Dam, van B.C.; Deans, J.D.; Dumolin-LapOgue, S.; Fineschi, S.; Finkeldey, R.; Gillies, A.; Glaz, I.; Goicoechea, P.G.; Jensen, J.S.; König, A.O.; Lowe, A.J.; Madsen, S.F.; Mátyás, G.; Munro, R.C.; Olalde, M.; Pemonge, M.H.; Popescu, F.; Slade, D.; Tabbener, H.; Taurchini, D.; Vries, de S.G.M.; Ziegenhagen, B.; Kremer, A.
2002-01-01
A consortium of 16 laboratories have studied chloroplast DNA (cpDNA) variation in European white oaks. A common strategy for molecular screening, based on restriction analysis of four PCR-amplified cpDNA fragments, was used to allow comparison among the different laboratories. A total of 2613 oak
Structural insight into maintenance methylation by mouse DNA methyltransferase 1 (Dnmt1)
Takeshita, Kohei; Suetake, Isao; Yamashita, Eiki; Suga, Michihiro; Narita, Hirotaka; Nakagawa, Atsushi; Tajima, Shoji
2011-01-01
Methylation of cytosine in DNA plays a crucial role in development through inheritable gene silencing. The DNA methyltransferase Dnmt1 is responsible for the propagation of methylation patterns to the next generation via its preferential methylation of hemimethylated CpG sites in the genome; however, how Dnmt1 maintains methylation patterns is not fully understood. Here we report the crystal structure of the large fragment (291–1620) of mouse Dnmt1 and its complexes with cofactor S-adenosyl-L-methionine and its product S-adenosyl-L-homocystein. Notably, in the absence of DNA, the N-terminal domain responsible for targeting Dnmt1 to replication foci is inserted into the DNA-binding pocket, indicating that this domain must be removed for methylation to occur. Upon binding of S-adenosyl-L-methionine, the catalytic cysteine residue undergoes a conformation transition to a catalytically competent position. For the recognition of hemimethylated DNA, Dnmt1 is expected to utilize a target recognition domain that overhangs the putative DNA-binding pocket. Taking into considerations the recent report of a shorter fragment structure of Dnmt1 that the CXXC motif positions itself in the catalytic pocket and prevents aberrant de novo methylation, we propose that maintenance methylation is a multistep process accompanied by structural changes. PMID:21518897
Directory of Open Access Journals (Sweden)
MA Ghatee
2013-06-01
Full Text Available Background: Leishmania tropica is a genetically divergent species. Amplification of entire internal transcribed spacer (ITS region of L. tropica isolates obtained from Bam district, one of the well known focus of anthroponotic cutaneous leishmaniasis ACL( in Iran, revealed a double-band pattern in agarose gel electrophoresis. This study explains how this pattern occurs.Methods: Twenty seven L. tropica smear preparations were collected from Bam district, south east Iran, and eight L. major and one L. infantum smear preparations were gathered from Shiraz, south west Iran. Furthermore one L. major and one L. infantum cultured standard strains were tested using entire ITS-PCR to survey their electrophoretic pattern. The ITS sequences of L. tropica, L. major, and L. infantum already deposited in GenBank were analyzed. Analysis of GenBank sequences of L. tropica revealed two groups of sequences based on length size, one group having a 100 bp gap. Therefore, a new reverse primer namely LITS-MG was designed to exclude this gap in PCR products.Results: Whole ITS fragment amplification resulted in a double-band pattern in all L. tropica cases, while a sharp single band was observed for L. infantum and L. major isolates. This result was corresponding to the result obtained from in silico analysis of GenBank sequences. Use of LITS-MG primer was expectedly resulted in a single band including ITS1, 5.8s and partial ITS2 product for L. tropica which is appropriate for following molecular studies such as sequencing or restriction analysis.Conclusion: Sequences analysis of GenBank L. tropica sequences and following practical laboratory tests revealed at least two alleles in L. tropica which were confirmed in Bam isolates. This especial double-band pattern is because of a 100 bp fragment difference within ITS-rDNA alleles
Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.
2012-01-01
Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444
Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M
2006-05-01
The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic
International Nuclear Information System (INIS)
Schmid, D.S.; Tite, J.P.; Ruddle, N.H.
1986-01-01
A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery
Hill, Jane K; Gray, Michael A; Khen, Chey Vun; Benedick, Suzan; Tawatao, Noel; Hamer, Keith C
2011-11-27
Large areas of tropical forest now exist as remnants scattered across agricultural landscapes, and so understanding the impacts of forest fragmentation is important for biodiversity conservation. We examined species richness and nestedness among tropical forest remnants in birds (meta-analysis of published studies) and insects (field data for fruit-feeding Lepidoptera (butterflies and moths) and ants). Species-area relationships were evident in all four taxa, and avian and insect assemblages in remnants typically were nested subsets of those in larger areas. Avian carnivores and nectarivores and predatory ants were more nested than other guilds, implying that the sequential loss of species was more predictable in these groups, and that fragmentation alters the trophic organization of communities. For butterflies, the ordering of fragments to achieve maximum nestedness was by fragment area, suggesting that differences among fragments were driven mainly by extinction. In contrast for moths, maximum nestedness was achieved by ordering species by wing length; species with longer wings (implying better dispersal) were more likely to occur at all sites, including low diversity sites, suggesting that differences among fragments were driven more strongly by colonization. Although all four taxa exhibited high levels of nestedness, patterns of species turnover were also idiosyncratic, and thus even species-poor sites contributed to landscape-scale biodiversity, particularly for insects.
International Nuclear Information System (INIS)
Theodorakis, C.W.; Shugart, L.R.
1993-01-01
In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
DEFF Research Database (Denmark)
Mutenda, Kudzai E; Matthiesen, Rune; Roepstorff, Peter
2007-01-01
Oligogalacturonides of different degrees of polymerization (DP) and methyl esterification (DE) were structurally analyzed by nanoESI quadrupole ion-trap mass spectrometry. The fragmentation patterns of the oligogalacturonides were compared using the program 'Virtual Expert Mass Spectrometrist...... with free carboxylic acid groups underwent higher water loss compared to fully methyl-esterified oligogalacturonides under the same fragmentation conditions. Cross-ring cleavage, in which fragmentation occurs across the ring system of the galacturonate residue and signified by unique mass losses...... water loss than methyl-esterified ones will be postulated. In addition, the VEMS program was extended to automatically interpret and assign the fragment ions peaks generated in this study....
Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E
2015-08-18
The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect
High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.
Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie
2015-06-17
High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima
2015-09-01
To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.
International Nuclear Information System (INIS)
McNally, L.; Shaler, R.C.; Baird, M.; Balazs, I.; De Forest, P.; Kobilinsky, L.
1989-01-01
This study was designed to analyze the effects of common environmental insults on the ability to obtain deoxyribonucleic acid (DNA) restriction fragment-length polymorphisms (RFLP) patterns from laboratory prepared specimens. The environmental conditions studied include the exposure of dried bloodstains to varying amounts of relative humidity (0, 33, 67, and 98%), heat (37 degree C), and ultraviolet light for periods of up to five days. In addition, the effect of drying over a four-day period in whole blood collected with and without ethylenediaminetetraacetate (EDTA) was examined. The results of the study showed that, under the conditions studied, the integrity of DNA is not altered such that false RFLP patterns are obtained. The only effect observed was that the overall RFLP pattern becomes weaker, but individual RFLP fragments are neither created nor destroyed
An efficient method for DNA extraction from Cladosporioid fungi.
Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M
2010-11-23
We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.
T-DNA integration patterns in transgenic maize lines mediated by ...
African Journals Online (AJOL)
These results demonstrate that cleavage occurs not only during the T-DNA borders but also inside or outside the borders. The border sequences and some inside sequences can be deleted, and filler sequences can be inserted. Illegitimate recombination is a major pattern of T-DNA integration, while some hot spots and ...
Fragman: an R package for fragment analysis.
Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan
2016-04-21
Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.
Genotypic characterization of Rickettsiae by DNA probes generated from Rickettsia Prowazekii DNA
International Nuclear Information System (INIS)
Demkin, V.V.; Rydkina, E.B.; Likhoded, L.Ya.; Ignatovich, V.F.; Genig, V.A.; Balayeva, N.M.
1994-01-01
Southern blot analysis of HindIII-cleaved rickettsial DNA was used for genotypic characterization of the typhus group (TG) species (R. prowazekii, R. typhi, R. canada) and a few species were of the spotted fever group (SFG)rickettsiae (R. sibirica, R. conorii, R. akari). Four different DNA probes were employed. PBH11 and PBH13 probes were morphospecific HindIII fragment of R prowazekii DNA. MW218 probe contained the gene for 51 K antigen and MW264 probe contained the citrate synthase gene of R. prowazekii. All the probes hybridized with the tested TG and SFG rickettsial DNAs, forming from 1 to 5 bands, but they did not with R. tsutsudamushi or C. burnetii DNAs. All the probes demonstrated specific hybridization pattern with TG species and R. akari. PBH11. PBH13 and MW264 probes clearly distinguished R. sibirica and R. conorii from the other tested rickettsiae, but not from each other. However, these two species differed slightly with MW218 probe. Several strains of each species were analyzed in this way and except for strains of R. conorii identical intra-species pattern were obtained. These data lead us to consider the obtained hybridization patterns as criteria for genotypic identification. (author)
Analysis of DNA methylation in various swine tissues.
Directory of Open Access Journals (Sweden)
Chun Yang
Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.
C. Selva Kumar
2011-01-01
Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...
Directory of Open Access Journals (Sweden)
De Marzo Angelo M
2011-06-01
Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.
Jenkins, J A; Draugelis-Dale, R O; Pinkney, A E; Iwanowicz, L R; Blazer, V S
2015-03-15
Declining harvests of yellow perch, Perca flavescens, in urbanized watersheds of Chesapeake Bay have prompted investigations of their reproductive fitness. The purpose of this study was to establish a flow cytometric technique for DNA analysis of fixed samples sent from the field to provide reliable gamete quality measurements. Similar to the sperm chromatin structure assay, measures were made on the susceptibility of nuclear DNA to acid-induced denaturation, but used fixed rather than live or thawed cells. Nuclei were best exposed to the acid treatment for 1 minute at 37 °C followed by the addition of cold (4 °C) propidium iodide staining solution before flow cytometry. The rationale for protocol development is presented graphically through cytograms. Field results collected in 2008 and 2009 revealed DNA fragmentation up to 14.5%. In 2008, DNA fragmentation from the more urbanized watersheds was significantly greater than from reference sites (P = 0.026) and in 2009, higher percentages of haploid testicular cells were noted from the less urbanized watersheds (P = 0.032) indicating better reproductive condition at sites with less urbanization. For both years, total and progressive live sperm motilities by computer-assisted sperm motion analysis ranged from 19.1% to 76.5%, being significantly higher at the less urbanized sites (P < 0.05). This flow cytometric method takes advantage of the propensity of fragmented DNA to be denatured under standard conditions, or 1 minute at 37 °C with 10% buffered formalin-fixed cells. The study of fixed sperm makes possible the restrospective investigation of germplasm fragmentation, spermatogenic ploidy patterns, and chromatin compaction levels from samples translocated over distance and time. The protocol provides an approach that can be modified for other species across taxa. Published by Elsevier Inc.
Influence of LET on repair of DNA damages in Deinococcus radiodurans
Energy Technology Data Exchange (ETDEWEB)
Kobayashi, Y; Tanaka, A; Kikuchi, M; Shimizu, T; Watanabe, H [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Cao, J P; Taucher-Scholz, G
1997-03-01
Inactivation caused by heavy ions was studied in dry cells of radioresistant bacterium Deinococcus radiodurans. All survival curves were characterized by a large shoulder of the curves. No final slopes of the exponential part of survival curves for heavy ion irradiation were steeper than that for 2.0 MeV electron irradiation. The plots of RBE versus LET showed no obvious peaks, suggesting that this bacterium can repair not only DNA double strand breaks (DSBs) but also clustered damage in DNA which may be induced by heavy ions. The genomic DNA of D. radiodurans was cleaved into large fragments with restriction enzyme Not I after post-irradiation incubation and the fragments were separated using pulsed-field gel electrophoresis (PFGE). DSBs induction and rejoining process were analyzed by detection of the reappearance of ladder pattern of DNA fragments. The required repair time after heavy ions irradiation was longer than the repair time for electrons at the same dose of irradiation, however, the rate of repair enzyme induction was almost similar to each other between electrons and heavy ions, suggesting that the same repair system is likely to be used after both low and high LET irradiations. (author)
Fragmentation of chromatin with 125I radioactive disintegrations
International Nuclear Information System (INIS)
Turner, G.N.; Nobis, P.; Dewey, W.C.
1976-01-01
The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated
Energy Technology Data Exchange (ETDEWEB)
Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu
2016-09-02
Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.
International Nuclear Information System (INIS)
Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan
2016-01-01
Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.
Design Pattern Mining Using Distributed Learning Automata and DNA Sequence Alignment
Esmaeilpour, Mansour; Naderifar, Vahideh; Shukur, Zarina
2014-01-01
Context Over the last decade, design patterns have been used extensively to generate reusable solutions to frequently encountered problems in software engineering and object oriented programming. A design pattern is a repeatable software design solution that provides a template for solving various instances of a general problem. Objective This paper describes a new method for pattern mining, isolating design patterns and relationship between them; and a related tool, DLA-DNA for all implemented pattern and all projects used for evaluation. DLA-DNA achieves acceptable precision and recall instead of other evaluated tools based on distributed learning automata (DLA) and deoxyribonucleic acid (DNA) sequences alignment. Method The proposed method mines structural design patterns in the object oriented source code and extracts the strong and weak relationships between them, enabling analyzers and programmers to determine the dependency rate of each object, component, and other section of the code for parameter passing and modular programming. The proposed model can detect design patterns better that available other tools those are Pinot, PTIDEJ and DPJF; and the strengths of their relationships. Results The result demonstrate that whenever the source code is build standard and non-standard, based on the design patterns, then the result of the proposed method is near to DPJF and better that Pinot and PTIDEJ. The proposed model is tested on the several source codes and is compared with other related models and available tools those the results show the precision and recall of the proposed method, averagely 20% and 9.6% are more than Pinot, 27% and 31% are more than PTIDEJ and 3.3% and 2% are more than DPJF respectively. Conclusion The primary idea of the proposed method is organized in two following steps: the first step, elemental design patterns are identified, while at the second step, is composed to recognize actual design patterns. PMID:25243670
Design pattern mining using distributed learning automata and DNA sequence alignment.
Directory of Open Access Journals (Sweden)
Mansour Esmaeilpour
Full Text Available CONTEXT: Over the last decade, design patterns have been used extensively to generate reusable solutions to frequently encountered problems in software engineering and object oriented programming. A design pattern is a repeatable software design solution that provides a template for solving various instances of a general problem. OBJECTIVE: This paper describes a new method for pattern mining, isolating design patterns and relationship between them; and a related tool, DLA-DNA for all implemented pattern and all projects used for evaluation. DLA-DNA achieves acceptable precision and recall instead of other evaluated tools based on distributed learning automata (DLA and deoxyribonucleic acid (DNA sequences alignment. METHOD: The proposed method mines structural design patterns in the object oriented source code and extracts the strong and weak relationships between them, enabling analyzers and programmers to determine the dependency rate of each object, component, and other section of the code for parameter passing and modular programming. The proposed model can detect design patterns better that available other tools those are Pinot, PTIDEJ and DPJF; and the strengths of their relationships. RESULTS: The result demonstrate that whenever the source code is build standard and non-standard, based on the design patterns, then the result of the proposed method is near to DPJF and better that Pinot and PTIDEJ. The proposed model is tested on the several source codes and is compared with other related models and available tools those the results show the precision and recall of the proposed method, averagely 20% and 9.6% are more than Pinot, 27% and 31% are more than PTIDEJ and 3.3% and 2% are more than DPJF respectively. CONCLUSION: The primary idea of the proposed method is organized in two following steps: the first step, elemental design patterns are identified, while at the second step, is composed to recognize actual design patterns.
Design pattern mining using distributed learning automata and DNA sequence alignment.
Esmaeilpour, Mansour; Naderifar, Vahideh; Shukur, Zarina
2014-01-01
Over the last decade, design patterns have been used extensively to generate reusable solutions to frequently encountered problems in software engineering and object oriented programming. A design pattern is a repeatable software design solution that provides a template for solving various instances of a general problem. This paper describes a new method for pattern mining, isolating design patterns and relationship between them; and a related tool, DLA-DNA for all implemented pattern and all projects used for evaluation. DLA-DNA achieves acceptable precision and recall instead of other evaluated tools based on distributed learning automata (DLA) and deoxyribonucleic acid (DNA) sequences alignment. The proposed method mines structural design patterns in the object oriented source code and extracts the strong and weak relationships between them, enabling analyzers and programmers to determine the dependency rate of each object, component, and other section of the code for parameter passing and modular programming. The proposed model can detect design patterns better that available other tools those are Pinot, PTIDEJ and DPJF; and the strengths of their relationships. The result demonstrate that whenever the source code is build standard and non-standard, based on the design patterns, then the result of the proposed method is near to DPJF and better that Pinot and PTIDEJ. The proposed model is tested on the several source codes and is compared with other related models and available tools those the results show the precision and recall of the proposed method, averagely 20% and 9.6% are more than Pinot, 27% and 31% are more than PTIDEJ and 3.3% and 2% are more than DPJF respectively. The primary idea of the proposed method is organized in two following steps: the first step, elemental design patterns are identified, while at the second step, is composed to recognize actual design patterns.
Directory of Open Access Journals (Sweden)
Md. Rezaul Karim
2012-03-01
Full Text Available Mining interesting patterns from DNA sequences is one of the most challenging tasks in bioinformatics and computational biology. Maximal contiguous frequent patterns are preferable for expressing the function and structure of DNA sequences and hence can capture the common data characteristics among related sequences. Biologists are interested in finding frequent orderly arrangements of motifs that are responsible for similar expression of a group of genes. In order to reduce mining time and complexity, however, most existing sequence mining algorithms either focus on finding short DNA sequences or require explicit specification of sequence lengths in advance. The challenge is to find longer sequences without specifying sequence lengths in advance. In this paper, we propose an efficient approach to mining maximal contiguous frequent patterns from large DNA sequence datasets. The experimental results show that our proposed approach is memory-efficient and mines maximal contiguous frequent patterns within a reasonable time.
Polymer fragmentation in extensional flow
Energy Technology Data Exchange (ETDEWEB)
Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech
2001-06-01
In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.
Directory of Open Access Journals (Sweden)
Yuqian Luo
2016-11-01
Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.
Directory of Open Access Journals (Sweden)
Judith Pöppe
2010-04-01
Full Text Available DNA barcoding is a promising tool to facilitate a rapid and unambiguous identification of sponge species. Demosponges of the order Dictyoceratida are particularly challenging to identify, but are of ecological as well as biochemical importance.Here we apply DNA barcoding with the standard CO1-barcoding marker on selected Indo-Pacific specimens of two genera, Ircinia and Psammocinia of the family Irciniidae. We show that the CO1 marker identifies several species new to science, reveals separate radiation patterns of deep-sea Ircinia sponges and indicates dispersal patterns of Psammocinia species. However, some species cannot be unambiguously barcoded by solely this marker due to low evolutionary rates.We support previous suggestions for a combination of the standard CO1 fragment with an additional fragment for sponge DNA barcoding.
Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines
International Nuclear Information System (INIS)
Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran
2006-01-01
Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)
Restriction fragment length polymorphism of the major histocompatibility complex of the dog.
Sarmiento, U M; Storb, R F
1988-01-01
Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.
Energy Technology Data Exchange (ETDEWEB)
Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others
1994-09-15
In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.
Energy Technology Data Exchange (ETDEWEB)
Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)
2012-06-01
Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.
Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).
Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J
2014-01-01
DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic
Directory of Open Access Journals (Sweden)
D. Vaamonde
2014-12-01
Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Ahrens, Peter
2002-01-01
, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...
Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.
Bowden, G; Johnson, J; Schachtele, C
1993-08-01
Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.
Synchronization of DNA array replication kinetics
Manturov, Alexey O.; Grigoryev, Anton V.
2016-04-01
In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.
Benítez-Malvido, Julieta; Dáttilo, Wesley; Martínez-Falcón, Ana Paola; Durán-Barrón, César; Valenzuela, Jorge; López, Sara; Lombera, Rafael
2016-01-01
Tropical rain forest fragmentation affects biotic interactions in distinct ways. Little is known, however, about how fragmentation affects animal trophic guilds and their patterns of interactions with host plants. In this study, we analyzed changes in biotic interactions in forest fragments by using a multitrophic approach. For this, we classified arthropods associated with Heliconia aurantiaca herbs into broad trophic guilds (omnivores, herbivores and predators) and assessed the topological structure of intrapopulation plant-arthropod networks in fragments and continuous forests. Habitat type influenced arthropod species abundance, diversity and composition with greater abundance in fragments but greater diversity in continuous forest. According to trophic guilds, coleopteran herbivores were more abundant in continuous forest and overall omnivores in fragments. Continuous forest showed a greater diversity of interactions than fragments. Only in fragments, however, did the arthropod community associated with H aurantiaca show a nested structure, suggesting novel and/or opportunistic host-arthropod associations. Plants, omnivores and predators contributed more to nestedness than herbivores. Therefore, Heliconia-arthropod network properties do not appear to be maintained in fragments mainly caused by the decrease of herbivores. Our study contributes to the understanding of the impact of fragmentation on the structure and dynamics of multitrophic arthropod communities associated with a particular plant species of the highly biodiverse tropical forests. Nevertheless, further replication of study sites is needed to strengthen the conclusion that forest fragmentation negatively affects arthropod assemblages.
Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin
2017-04-15
Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.
ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping
DEFF Research Database (Denmark)
Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir
2008-01-01
A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...
DNA methylation patterns in cord blood DNA and body size in childhood.
Directory of Open Access Journals (Sweden)
Caroline L Relton
Full Text Available Epigenetic markings acquired in early life may have phenotypic consequences later in development through their role in transcriptional regulation with relevance to the developmental origins of diseases including obesity. The goal of this study was to investigate whether DNA methylation levels at birth are associated with body size later in childhood.A study design involving two birth cohorts was used to conduct transcription profiling followed by DNA methylation analysis in peripheral blood. Gene expression analysis was undertaken in 24 individuals whose biological samples and clinical data were collected at a mean ± standard deviation (SD age of 12.35 (0.95 years, the upper and lower tertiles of body mass index (BMI were compared with a mean (SD BMI difference of 9.86 (2.37 kg/m(2. This generated a panel of differentially expressed genes for DNA methylation analysis which was then undertaken in cord blood DNA in 178 individuals with body composition data prospectively collected at a mean (SD age of 9.83 (0.23 years. Twenty-nine differentially expressed genes (>1.2-fold and p<10(-4 were analysed to determine DNA methylation levels at 1-3 sites per gene. Five genes were unmethylated and DNA methylation in the remaining 24 genes was analysed using linear regression with bootstrapping. Methylation in 9 of the 24 (37.5% genes studied was associated with at least one index of body composition (BMI, fat mass, lean mass, height at age 9 years, although only one of these associations remained after correction for multiple testing (ALPL with height, p(Corrected = 0.017.DNA methylation patterns in cord blood show some association with altered gene expression, body size and composition in childhood. The observed relationship is correlative and despite suggestion of a mechanistic epigenetic link between in utero life and later phenotype, further investigation is required to establish causality.
Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process
International Nuclear Information System (INIS)
Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet
2014-01-01
Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process
Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process
Energy Technology Data Exchange (ETDEWEB)
Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr
2014-02-07
Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.
Role of minor groove width and hydration pattern on amsacrine interaction with DNA.
Directory of Open Access Journals (Sweden)
Deepak K Jangir
Full Text Available Amsacrine is an anilinoacridine derivative anticancer drug, used to treat a wide variety of malignancies. In cells, amsacrine poisons topoisomerase 2 by stabilizing DNA-drug-enzyme ternary complex. Presence of amsacrine increases the steady-state concentration of these ternary complexes which in turn hampers DNA replication and results in subsequent cell death. Due to reversible binding and rapid slip-out of amsacrine from DNA duplex, structural data is not available on amsacrine-DNA complexes. In the present work, we designed five oligonucleotide duplexes, differing in their minor groove widths and hydration pattern, and examined their binding with amsacrine using attenuated total reflection Fourier transform infrared (ATR-FTIR spectroscopy. Complexes of amsacrine with calf thymus DNA were also evaluated for a comparison. Our results demonstrate for the first time that amsacrine is not a simple intercalator; rather mixed type of DNA binding (intercalation and minor groove takes place between amsacrine and DNA. Further, this binding is highly sensitive towards the geometries and hydration patterns of different minor grooves present in the DNA. This study shows that ligand binding to DNA could be very sensitive to DNA base composition and DNA groove structures. Results demonstrated here could have implication for understanding cytotoxic mechanism of aminoacridine based anticancer drugs and provide directions to modify these drugs for better efficacy and few side-effects.
Treulen, F; Uribe, P; Boguen, R; Villegas, J V
2016-02-01
Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this
Institute of Scientific and Technical Information of China (English)
范惠玲; 白生文; 李华清; 孙万仓
2016-01-01
Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系,也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官,并分离与自交亲和性有关的 cDNA 片段,以芸芥的一对近等基因系,自交亲和系(SC)与自交不亲和系(SI)为试材,利用差异显示 RT-PCR
DNA damage and genetic methylation changes caused by Cd in Arabidopsis thaliana seedlings.
Li, Zhaoling; Liu, Zhihong; Chen, Ruijuan; Li, Xiaojun; Tai, Peidong; Gong, Zongqiang; Jia, Chunyun; Liu, Wan
2015-09-01
Amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MASP) techniques are sensitive to deoxyribonucleic acid (DNA) damage and genetic methylation, respectively. Using these 2 techniques, Arabidopsis thaliana cultured with 0 mg/L (control), 0.5 mg/L, 1.5 mg/L, and 5.0 mg/L Cd(2+) for 16 d was used to analyze the DNA damage and methylation changes as a result of cadmium (Cd). The DNA was amplified by 14 AFLP primer pairs and 13 MSAP primer combinations. In the AFLP experiment, 62 polymorphic sites were found in the patterns of 11 primer combinations and a total of 1116 fragments were obtained in these patterns. There were no polymorphic bands in the remaining 3 pairs. The proportions of polymorphic sites in the 0.5-mg/L Cd(2+) and 5.0-mg/L Cd(2+) treatments were significantly different. Seven polymorphic fragments were then separated and successfully sequenced, yielding 6 nucleobase substitutions and 1 nucleobase deletion. Similarly, in the MSAP experiment, the MSAP% and number of demethylated-type bands were unchanged after Cd treatment, but the number of methylated-type bands was increased significantly in the 5.0-mg/L Cd(2+) treatment group, a finding that may be associated with the AFLP results. The polymorphic bands were also sequenced and the functions of their homologous genes were determined. The DNA damage and methylation changes may be the primary cause of certain pathology changes as a result of Cd uptake in plants. © 2015 SETAC.
DEFF Research Database (Denmark)
Stronati, A; Manicardi, G C; Cecati, M
2006-01-01
Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
Nakata, A; Yoshimura, A; Kuro-o, M; Obara, Y
2005-01-01
The karyological relationship and organization of highly repetitive DNA sequences in Japanese shrew-moles were studied by zoo-blot hybridization and fluorescence in situ hybridization (FISH). When the genomic DNA of the eastern race of Urotrichus talpoides was digested with PstI, three fragments of highly repetitive DNA sequences, approximately 0.7, 0.9, and 1.4 kb in length, were observed as distinct bands. The results of FISH in the eastern race of U. talpoides using these three fragments separately as probes showed that the 0.7-kb PstI fragment was distributed in the centromeric regions of most chromosomes, and that the 0.9- and 1.4-kb fragments were predominantly located in the C-heterochromatin region of chromosome 13p. Although the western race of U. talpoides also had three PstI fragments, 0.9- and 1.4-kb PstI fragments were more ambiguous than those of the eastern race. The PstI- digested genomic DNA in Dymecodonpilirostris produced only a faint 0.9-kb band, and its signal patterns obtained by zoo-blot hybridization were clearly different from those of U. talpoides. The 0.7-kb fragment of U. talpoides hybridized strongly with the 0.9-kb fragment of D. pilirostris. In a FISH analysis, the 0.9-kb fragment of D. pilirostris hybridized with highly repetitive DNA in the centromeric regions of most chromosomes from both D. pilirostris and U. talpoides. Zoo-blot hybridization and FISH analyses suggest that the 0.9- and 1.4-kb PstI fragments were generated specifically in the genome of U. talpoides after the common ancestor differentiated into two extant shrew-mole species. A difference in the length of the centromeric elements between U. talpoides and D. pilirostris might be observed due to certain modifications of the repeating unit.
Benítez-Malvido, Julieta; Dáttilo, Wesley; Martínez-Falcón, Ana Paola; Durán-Barrón, César; Valenzuela, Jorge; López, Sara; Lombera, Rafael
2016-01-01
Tropical rain forest fragmentation affects biotic interactions in distinct ways. Little is known, however, about how fragmentation affects animal trophic guilds and their patterns of interactions with host plants. In this study, we analyzed changes in biotic interactions in forest fragments by using a multitrophic approach. For this, we classified arthropods associated with Heliconia aurantiaca herbs into broad trophic guilds (omnivores, herbivores and predators) and assessed the topological structure of intrapopulation plant-arthropod networks in fragments and continuous forests. Habitat type influenced arthropod species abundance, diversity and composition with greater abundance in fragments but greater diversity in continuous forest. According to trophic guilds, coleopteran herbivores were more abundant in continuous forest and overall omnivores in fragments. Continuous forest showed a greater diversity of interactions than fragments. Only in fragments, however, did the arthropod community associated with H aurantiaca show a nested structure, suggesting novel and/or opportunistic host-arthropod associations. Plants, omnivores and predators contributed more to nestedness than herbivores. Therefore, Heliconia-arthropod network properties do not appear to be maintained in fragments mainly caused by the decrease of herbivores. Our study contributes to the understanding of the impact of fragmentation on the structure and dynamics of multitrophic arthropod communities associated with a particular plant species of the highly biodiverse tropical forests. Nevertheless, further replication of study sites is needed to strengthen the conclusion that forest fragmentation negatively affects arthropod assemblages. PMID:26731271
Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe
2005-03-01
Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.
Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn
2014-01-01
The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.
International Nuclear Information System (INIS)
Negraes, Priscilla D; Favaro, Francine P; Camargo, João Lauro V; Oliveira, Maria Luiza CS; Goldberg, José; Rainho, Cláudia A; Salvadori, Daisy MF
2008-01-01
Epigenetic alterations are a hallmark of human cancer. In this study, we aimed to investigate whether aberrant DNA methylation of cancer-associated genes is related to urinary bladder cancer recurrence. A set of 4 genes, including CDH1 (E-cadherin), SFN (stratifin), RARB (retinoic acid receptor, beta) and RASSF1A (Ras association (RalGDS/AF-6) domain family 1), had their methylation patterns evaluated by MSP (Methylation-Specific Polymerase Chain Reaction) analysis in 49 fresh urinary bladder carcinoma tissues (including 14 cases paired with adjacent normal bladder epithelium, 3 squamous cell carcinomas and 2 adenocarcinomas) and 24 cell sediment samples from bladder washings of patients classified as cancer-free by cytological analysis (control group). A third set of samples included 39 archived tumor fragments and 23 matched washouts from 20 urinary bladder cancer patients in post-surgical monitoring. After genomic DNA isolation and sodium bisulfite modification, methylation patterns were determined and correlated with standard clinic-histopathological parameters. CDH1 and SFN genes were methylated at high frequencies in bladder cancer as well as in paired normal adjacent tissue and exfoliated cells from cancer-free patients. Although no statistically significant differences were found between RARB and RASSF1A methylation and the clinical and histopathological parameters in bladder cancer, a sensitivity of 95% and a specificity of 71% were observed for RARB methylation (Fisher's Exact test (p < 0.0001; OR = 48.89) and, 58% and 17% (p < 0.05; OR = 0.29) for RASSF1A gene, respectively, in relation to the control group. Indistinct DNA hypermethylation of CDH1 and SFN genes between tumoral and normal urinary bladder samples suggests that these epigenetic features are not suitable biomarkers for urinary bladder cancer. However, RARB and RASSF1A gene methylation appears to be an initial event in urinary bladder carcinogenesis and should be considered as defining a
Directory of Open Access Journals (Sweden)
Goldberg José
2008-08-01
Full Text Available Abstract Background Epigenetic alterations are a hallmark of human cancer. In this study, we aimed to investigate whether aberrant DNA methylation of cancer-associated genes is related to urinary bladder cancer recurrence. Methods A set of 4 genes, including CDH1 (E-cadherin, SFN (stratifin, RARB (retinoic acid receptor, beta and RASSF1A (Ras association (RalGDS/AF-6 domain family 1, had their methylation patterns evaluated by MSP (Methylation-Specific Polymerase Chain Reaction analysis in 49 fresh urinary bladder carcinoma tissues (including 14 cases paired with adjacent normal bladder epithelium, 3 squamous cell carcinomas and 2 adenocarcinomas and 24 cell sediment samples from bladder washings of patients classified as cancer-free by cytological analysis (control group. A third set of samples included 39 archived tumor fragments and 23 matched washouts from 20 urinary bladder cancer patients in post-surgical monitoring. After genomic DNA isolation and sodium bisulfite modification, methylation patterns were determined and correlated with standard clinic-histopathological parameters. Results CDH1 and SFN genes were methylated at high frequencies in bladder cancer as well as in paired normal adjacent tissue and exfoliated cells from cancer-free patients. Although no statistically significant differences were found between RARB and RASSF1A methylation and the clinical and histopathological parameters in bladder cancer, a sensitivity of 95% and a specificity of 71% were observed for RARB methylation (Fisher's Exact test (p RASSF1A gene, respectively, in relation to the control group. Conclusion Indistinct DNA hypermethylation of CDH1 and SFN genes between tumoral and normal urinary bladder samples suggests that these epigenetic features are not suitable biomarkers for urinary bladder cancer. However, RARB and RASSF1A gene methylation appears to be an initial event in urinary bladder carcinogenesis and should be considered as defining a panel of
Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels
1988-01-01
Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....
Electronic transport in methylated fragments of DNA
Energy Technology Data Exchange (ETDEWEB)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
International Nuclear Information System (INIS)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.
2015-01-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics
Helicobacter pylori Infection Causes Characteristic DNA Damage Patterns in Human Cells
Directory of Open Access Journals (Sweden)
Max Koeppel
2015-06-01
Full Text Available Infection with the human pathogen Helicobacter pylori (H. pylori is a major risk factor for gastric cancer. Since the bacterium exerts multiple genotoxic effects, we examined the circumstances of DNA damage accumulation and identified regions within the host genome with high susceptibility to H. pylori-induced damage. Infection impaired several DNA repair factors, the extent of which depends on a functional cagPAI. This leads to accumulation of a unique DNA damage pattern, preferentially in transcribed regions and proximal to telomeres, in both gastric cell lines and primary gastric epithelial cells. The observed pattern correlates with focal amplifications in adenocarcinomas of the stomach and partly overlaps with known cancer genes. We thus demonstrate an impact of a bacterial infection directed toward specific host genomic regions and describe underlying characteristics that make such regions more likely to acquire heritable changes during infection, which could contribute to cellular transformation.
Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a
Directory of Open Access Journals (Sweden)
Rachel Deplus
2014-08-01
Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.
International Nuclear Information System (INIS)
Loebrich, M.; Ikpeme, S.; Kiefer, J.
1994-01-01
DNA samples prepared from human SP 3 cells, which had not been exposed to various doses of X-ray, were treated with NotI restriction endonuclease before being run in a contour-clamped homogeneous electrophoresis system. The restriction enzyme cuts the DNA at defined positions delivering DNA sizes which can be resolved by pulsed-field gel electrophoresis (PFGE). In order to investigate only one of the DNA fragments, a human lactoferrin cDNA, pHL-41, was hybridized to the DNA separated by PFGE. As a result, only the DNA fragment which contains the hybridized gene was detected resulting in a one-band pattern. The decrease of this band was found to be exponential with increasing radiation dose. From the slope, a double-strand break induction rate of (6.3±0.7) x 10 -3 /Mbp/Gy was deduced for 80 kV X-rays. (Author)
Azimuthal Anisotropies in Nuclear Fragmentation
International Nuclear Information System (INIS)
Dabrowska, A.; Szarska, M.; Trzupek, A.; Wolter, W.; Wosiek, B.
2002-01-01
The directed and elliptic flow of fragments emitted from the excited projectile nuclei has been observed for 158 AGeV Pb collisions with the lead and plastic targets. For comparison the flow analysis has been performed for 10.6 AGeV Au collisions with the emulsion target. The strong directed flow of heaviest fragments is found. Light fragments exhibit directed flow opposite to that of heavy fragments. The elliptic flow for all multiply charged fragments is positive and increases with the charge of the fragment. The observed flow patterns in the fragmentation of the projectile nucleus are practically independent of the mass of the target nucleus and the collision energy. Emission of fragments in nuclear multifragmentation shows similar, although weaker, flow effects. (author)
International Nuclear Information System (INIS)
Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut
2011-01-01
Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.
Epigenetic Patterns of PTSD: DNA Methylation In Serum of OIF/OEF Servicemembers
2011-01-01
also have no data on other relevant exposures which are known to affect DNA methylation , such as dietary factors ( folate , vitamin B12 intake), (54, 55...ANSI Std. Z39.18 W81XWH-08-2-0053 31 MAR 2008 - 31 DEC 2010Final01-01-2011 Epigenetic Patterns of PTSD: DNA Methylation in Serum of OIF/OEF...distribution unlimited PTSD, epigenetics, DNA methylation , cytokines, serum, pre-deployment, post-deployment Abstract on next page. 38 jrusiecki@usuhs.mil
International Nuclear Information System (INIS)
Low, F.C.; Atan, S.; Jaafar, H.
1998-01-01
Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of
Directory of Open Access Journals (Sweden)
Aurélie Jory
2012-10-01
Full Text Available Over 6,000 fragments from the genome of Drosophila melanogaster were analyzed for their ability to drive expression of GAL4 reporter genes in the third-instar larval imaginal discs. About 1,200 reporter genes drove expression in the eye, antenna, leg, wing, haltere, or genital imaginal discs. The patterns ranged from large regions to individual cells. About 75% of the active fragments drove expression in multiple discs; 20% were expressed in ventral, but not dorsal, discs (legs, genital, and antenna, whereas ∼23% were expressed in dorsal but not ventral discs (wing, haltere, and eye. Several patterns, for example, within the leg chordotonal organ, appeared a surprisingly large number of times. Unbiased searches for DNA sequence motifs suggest candidate transcription factors that may regulate enhancers with shared activities. Together, these expression patterns provide a valuable resource to the community and offer a broad overview of how transcriptional regulatory information is distributed in the Drosophila genome.
RAPD analysis of alfalfa DNA mutation via N+ implantation
International Nuclear Information System (INIS)
Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang
2003-01-01
Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing
2007-05-02
An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.
Identification of salivary Lactobacillus rhamnosus species by DNA profiling and a specific probe.
Richard, B; Groisillier, A; Badet, C; Dorignac, G; Lonvaud-Funel, A
2001-03-01
The Lactobacillus genus has been shown to be associated with the dental carious process, but little is known about the species related to the decay, although Lactobacillus rhamnosus is suspected to be the most implicated species. Conventional identification methods based on biochemical criteria lead to ambiguous results, since the Lactobacillus species found in saliva are phenotypically close. To clarify the role of this genus in the evolution of carious disease, this work aimed to find a rapid and reliable method for identifying the L. rhamnosus species. Methods based on hybridization with DNA probes and DNA amplification by PCR were used. The dominant salivary Lactobacillus species (reference strains from the ATCC) were selected for this purpose as well as some wild strains isolated from children's saliva. DNA profiling using semirandom polymorphic DNA amplification (semi-RAPD) generated specific patterns for L. rhamnosus ATCC 7469. The profiles of all L. rhamnosus strains tested were similar and could be grouped; these strains shared four common fragments. Wild strains first identified with classic methods shared common patterns with the L. rhamnosus species and could be reclassified. One fragment of the profile was purified, cloned, used as a probe and found to be specific to the L. rhamnosus species. These results may help to localize this species within its ecological niche and to elucidate the progression of the carious process.
Directory of Open Access Journals (Sweden)
A. Yu. Popova
2015-01-01
Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm.
How to determine local stretching and tension in a flow-stretched DNA molecule
DEFF Research Database (Denmark)
Pedersen, Jonas Nyvold; Marie, Rodolphe; Kristensen, Anders
2016-01-01
We determine the nonuniform stretching of and tension in amega base pairs-long fragment of deoxyribonucleic acid (DNA) that is flow stretched in a nanofluidic chip. We use no markers, do not know the contour length of the DNA, and do not have the full DNA molecule inside our field of view. Instead......, we analyze the transverse thermal motion of the DNA. Tension at the center of the DNA adds up to 16 pN, giving almost fully stretched DNA. This method was devised for optical mapping of DNA, specifically, DNA denaturation patterns. It may be useful also for other studies, e.g., DNA......-protein interactions, specifically, their tension dependence. Generally, wherever long strands of DNA—e.g., native DNA extracted from human cells or bacteria—must be stretched with ease for inspection, this method applies....
Fragmentation patterns of jets in pPb collisions in CMS
AUTHOR|(CDS)2089542
2016-01-01
The nuclear parton distribution function and flavor composition of hard scattering processes can be accurately studied using the jet fragmentation functions. Recent measurements of the pPb nuclear modification factor ($R_{pPb}$), with diverging values for inclusive jets and charged hadrons, have raised question on jet fragmentation properties in pPb collisions. These spectra measurements are performed with pp reference at 5.02 TeV constructed by interpolation or extrapolation from different $\\sqrt{s}$, and on steeply falling power-law spectra. As the jet fragmentation function is only evolving logarithmically with $\\sqrt{s}$, this further underscores the importance of a direct measurement. Together with the CMS results in pPb inclusive jets and charge hadron $R_{pPb}$, we introduce the new CMS measurement of fragmentation function in pPb collisions, where within our uncertainties, jets in pPb is found to have identical fragmentation property vs. pp jets. We will further discuss the consistency and tension amo...
Application of DNA fingerprints for cell-line individualization.
Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J
1990-01-01
DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...
Regular Nanoscale Protein Patterns via Directed Adsorption through Self-Assembled DNA Origami Masks.
Ramakrishnan, Saminathan; Subramaniam, Sivaraman; Stewart, A Francis; Grundmeier, Guido; Keller, Adrian
2016-11-16
DNA origami has become a widely used method for synthesizing well-defined nanostructures with promising applications in various areas of nanotechnology, biophysics, and medicine. Recently, the possibility to transfer the shape of single DNA origami nanostructures into different materials via molecular lithography approaches has received growing interest due to the great structural control provided by the DNA origami technique. Here, we use ordered monolayers of DNA origami nanostructures with internal cavities on mica surfaces as molecular lithography masks for the fabrication of regular protein patterns over large surface areas. Exposure of the masked sample surface to negatively charged proteins results in the directed adsorption of the proteins onto the exposed surface areas in the holes of the mask. By controlling the buffer and adsorption conditions, the protein coverage of the exposed areas can be varied from single proteins to densely packed monolayers. To demonstrate the versatility of this approach, regular nanopatterns of four different proteins are fabricated: the single-strand annealing proteins Redβ and Sak, the iron-storage protein ferritin, and the blood protein bovine serum albumin (BSA). We furthermore demonstrate the desorption of the DNA origami mask after directed protein adsorption, which may enable the fabrication of hierarchical patterns composed of different protein species. Because selectivity in adsorption is achieved by electrostatic interactions between the proteins and the exposed surface areas, this approach may enable also the large-scale patterning of other charged molecular species or even nanoparticles.
Variation in DNA Methylation Patterns is More Common among Maize Inbreds than among Tissues
Directory of Open Access Journals (Sweden)
Steven R. Eichten
2013-07-01
Full Text Available Chromatin modifications, such as DNA methylation, can provide heritable, epigenetic regulation of gene expression in the absence of genetic changes. A role for DNA methylation in meiotically stable marking of repetitive elements and other sequences has been demonstrated in plants. Methylation of DNA is also proposed to play a role in development through providing a mitotic memory of gene expression states established during cellular differentiation. We sought to clarify the relative levels of DNA methylation variation among different genotypes and tissues in maize ( L.. We have assessed genomewide DNA methylation patterns in leaf, immature tassel, embryo, and endosperm tissues of two inbred maize lines: B73 and Mo17. There are hundreds of regions of differential methylation present between the two genotypes. In general, the same regions exhibit differential methylation between B73 and Mo17 in each of the tissues that were surveyed. In contrast, there are few examples of tissue-specific DNA methylation variation. Only a subset of regions with tissue-specific variation in DNA methylation show similar patterns in both genotypes of maize and even fewer are associated with altered gene expression levels among the tissues. Our data indicates a limited impact of DNA methylation on developmental gene regulation within maize.
Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C
1998-10-01
The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.
Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A
2012-08-01
In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.
International Nuclear Information System (INIS)
Ananiev, E.; Abdulova, G.; Grozdanov, P.; Karagyozov, L.
2003-01-01
High molecular mass genomic DNA was isolated from excised marrow cotyledons (Cucurbita pepo L. zucchini) treated with 6-benzyladenine (BA) of methyl ester of jasmonic acid (MeJA) for 24 h in darkness. DNA purified from contaminating polysaccharides with Celite column was completely digested with the restriction enzyme Eco RI and the changes in the methylation pattern of the intergenic spacer (IGS) of r RNA genes were studied after subsequent digestion with the couple of restriction enzymes-isoschizomers MSP I and Hpa II by the method of 'indirect end labelling'. As rDNA units probe a cloned 32 P-labelled Eco RI 2.1 kb fragment spanning in the most part of 18S r RNA gene from flax rDNA was used. Results showed heavy methylation of the rRNA genes. As judged from the almost total lack of digestion with HPA II, there were no methylation free regions in repeated rDNA units or little if any were observed. A hypo methylated Hps II site was detected near the promoter region in some of the repeats. Digestion with Msp I affected nearly 50% of the repeating units. The Msp digestion fragments of the 6.2 kb Eco RI fragment of r DNA were few in number and large in size (0.5 - 2.5 kb). This suggested that in addition with -CpG- sequences, methylation in -CpNpG- might not be random. Methylation pattern in IGS was not changed upon treatment of the cotyledons in vivo with BA and MeJA. Thus, previously observed hormone-mediated effects on the eactivity of rRNA gene expression were not accompanied by any significant changes of the methylation pattern in IGS. (authors)
Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki
Directory of Open Access Journals (Sweden)
Silvia W. Lestari
2015-12-01
Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on
Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine
International Nuclear Information System (INIS)
Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.
1982-01-01
The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af
Extraction of ultrashort DNA molecules from herbarium specimens.
Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A
2017-02-01
DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.
International Nuclear Information System (INIS)
Capranico, G.; Kohn, K.W.; Pommier, Y.; Zunino, F.
1990-01-01
Topoisomerase II mediated double-strand breaks produced by anthracycline analogues were studied in SV40 DNA. The compounds included doxorubicin, daunorubicin, two doxorubicin stereoisomers (4'-epimer and β-anomer), and five chromophore-modified derivatives, with a wide range of cytotoxic activity and DNA binding affinity. Cleavage of 32 P-end-labeled DNA fragments was visualized by autoradiography of agarose and polyacrylamide gels. Structure-activity relationships indicated that alterations in the chromophore structure greatly affected drug action on topoisomerase II. In particular, removal of substituents on position 4 of the D ring resulted in more active inducers of cleavage with lower DNA binding affinity. The stereochemistry between the sugar and the chromophore was also essential for activity. All the active anthracyclines induced a single region of prominent cleavage in the entire SV40 DNA, which resulted from a cluster of sites between nucleotides 4237 and 4294. DNA cleavage intensity patterns exhibited differences among analogues and were also dependent upon drug concentration. Intensity at a given site dependent on both stimulatory and suppressive effects depending upon drug concentration and DNA sequence. A good correlation was found between cytotoxicity and intensity of topoisomerase II mediated DNA breakage
Directory of Open Access Journals (Sweden)
José Gregorio Martínez
Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.
Yi, Young; Chun, Dong-Il; Won, Sung Hun; Park, Suyeon; Lee, Sanghyeon; Cho, Jaeho
2018-02-13
The posterior malleolar fragment (PMF) of an ankle fracture can have various shapes depending on the injury mechanism. The purpose of this study was to evaluate the morphological characteristics of the PMF according to the ankle fracture pattern described in the Lauge-Hansen classification by using computed tomography (CT) images. We retrospectively analyzed CT data of 107 patients (107 ankles) who underwent surgery for trimalleolar fracture from January 2012 to December 2014. The patients were divided into two groups: 76 ankles in the supination-external rotation (SER) stage IV group and 31 ankles in the pronation-external rotation (PER) stage IV group. The PMF type of the two groups was assessed using the Haraguchi and Jan Bartonicek classification. The cross angle (α), fragment length ratio (FLR), fragment area ratio (FAR), sagittal angle (θ), and fragment height (FH) were measured to assess the morphological characteristics of the PMF. The PMF in the SER group mainly had a posterolateral shape, whereas that in the PER group mainly had a posteromedial two-part shape or a large posterolateral triangular shape (P = 0.02). The average cross angle was not significantly different between the two groups (SER group = 19.4°, PER group = 17.6°). The mean FLR and FH were significantly larger in the PER group than in the SER group (P = 0.024, P = 0.006). The mean fragment sagittal angle in the PER group was significantly smaller than that in the SER group (P = 0.017). With regard to the articular involvement, volume, and vertical nature, the SER-type fracture tends to have a smaller fragment due to the rotational force, whereas the PER-type fracture tends to have a larger fragment due to the combination of rotational and axial forces.
Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T
2007-08-01
The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.
AFEAP cloning: a precise and efficient method for large DNA sequence assembly.
Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin
2017-11-14
Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.
Visualization of DNA in highly processed botanical materials.
Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary
2018-04-15
DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.
Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José
2016-12-01
The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.
Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao
2004-01-01
RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.
International Nuclear Information System (INIS)
Kruminya, A.R.; Kroshkina, V.G.; Yurov, Yu.B.; Aleksandrov, I.A.; Mitkevich, S.P.; Gindilis, V.M.
1988-01-01
The chromosomal distribution of the cloned PHS05 fragment of human alphoid DNA was studied by in situ hybridization in 38 individuals. It was shown that this DNA fraction is primarily localized in the pericentric regions of practically all chromosomes of the set. Significant interchromosomal differences and a weakly expressed interindividual polymorphism were discovered in the copying ability of this class of repeating DNA sequences; associations were not found between the results of hybridization and the pattern of Q-polymorphism
Chromatin immunoprecipitation to analyze DNA binding sites of HMGA2.
Directory of Open Access Journals (Sweden)
Nina Winter
Full Text Available BACKGROUND: HMGA2 is an architectonic transcription factor abundantly expressed during embryonic and fetal development and it is associated with the progression of malignant tumors. The protein harbours three basically charged DNA binding domains and an acidic protein binding C-terminal domain. DNA binding induces changes of DNA conformation and hence results in global overall change of gene expression patterns. Recently, using a PCR-based SELEX (Systematic Evolution of Ligands by Exponential Enrichment procedure two consensus sequences for HMGA2 binding have been identified. METHODOLOGY/PRINCIPAL FINDINGS: In this investigation chromatin immunoprecipitation (ChIP experiments and bioinformatic methods were used to analyze if these binding sequences can be verified on chromatin of living cells as well. CONCLUSION: After quantification of HMGA2 protein in different cell lines the colon cancer derived cell line HCT116 was chosen for further ChIP experiments because of its 3.4-fold higher HMGA2 protein level. 49 DNA fragments were obtained by ChIP. These fragments containing HMGA2 binding sites have been analyzed for their AT-content, location in the human genome and similarities to sequences generated by a SELEX study. The sequences show a significantly higher AT-content than the average of the human genome. The artificially generated SELEX sequences and short BLAST alignments (11 and 12 bp of the ChIP fragments from living cells show similarities in their organization. The flanking regions are AT-rich, whereas a lower conservation is present in the center of the sequences.
Bone fragments a body can make
Energy Technology Data Exchange (ETDEWEB)
Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))
1991-05-01
Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.
Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease
International Nuclear Information System (INIS)
Hentosh, P.; Henner, W.D.; Reynolds, R.J.
1985-01-01
DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation
Directory of Open Access Journals (Sweden)
Erwan Quéméré
Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the
Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.
1991-01-01
Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from
Sub-THz spectroscopic characterization of vibrational modes in artificially designed DNA monocrystal
International Nuclear Information System (INIS)
Sizov, Igor; Rahman, Masudur; Gelmont, Boris; Norton, Michael L.; Globus, Tatiana
2013-01-01
Highlights: • Sub-THz spectroscopy is used to characterize artificially designed DNA monocrystal. • Results are obtained using a novel near field, RT, frequency domain spectrometer. • Narrow resonances of 0.1 cm −1 width in absorption spectra of crystal are observed. • Signature measured between 310 and 490 GHz is reproducible and well resolved. • Absorption pattern is explained in part by simulation results from dsDNA fragment. - Abstract: Sub-terahertz (sub-THz) vibrational spectroscopy is a new spectroscopic branch for characterizing biological macromolecules. In this work, highly resolved sub-THz resonance spectroscopy is used for characterizing engineered molecular structures, an artificially designed DNA monocrystal, built from a short DNA sequence. Using a recently developed frequency domain spectroscopic instrument operating at room temperature with high spectral and spatial resolution, we demonstrated very intense and specific spectral lines from a DNA crystal in general agreement with a computational molecular dynamics (MD) simulation of a short double stranded DNA fragment. The spectroscopic signature measured in the frequency range between 310 and 490 GHz is rich in well resolved and reproducible spectral features thus demonstrating the capability of THz resonance spectroscopy to be used for characterizing custom macromolecules and structures designed and implemented via nanotechnology for a wide variety of application domains. Analysis of MD simulation indicates that intense and narrow vibrational modes with atomic movements perpendicular (transverse) and parallel (longitudinal) to the long DNA axis coexist in dsDNA, with much higher contribution from longitudinal vibrations
International Nuclear Information System (INIS)
Ermolaeva, N.V.; Vodolazskaya, N.A.
1978-01-01
It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation
Bacterial DNA in water and dialysate: detection and significance for patient outcomes.
Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K
2009-01-01
The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.
Christensen, Doug
2013-01-01
Understanding how DNA banding patterns in a gel can aid in the conviction or exoneration of suspects and be utilized for positive identification of biological fathers in paternity cases can be intimidating. In reality, the logistics and technology used in such cases are rather straightforward. This exercise is designed for use in high school…
PARP-1 cleavage fragments: signatures of cell-death proteases in neurodegeneration
Directory of Open Access Journals (Sweden)
Alexander Jonathan S
2010-12-01
Full Text Available Abstract The normal function of poly (ADP-ribose polymerase-1 (PARP-1 is the routine repair of DNA damage by adding poly (ADP ribose polymers in response to a variety of cellular stresses. Recently, it has become widely appreciated that PARP-1 also participates in diverse physiological and pathological functions from cell survival to several forms of cell death and has been implicated in gene transcription, immune responses, inflammation, learning, memory, synaptic functions, angiogenesis and aging. In the CNS, PARP inhibition attenuates injury in pathologies like cerebral ischemia, trauma and excitotoxicity demonstrating a central role of PARP-1 in these pathologies. PARP-1 is also a preferred substrate for several 'suicidal' proteases and the proteolytic action of suicidal proteases (caspases, calpains, cathepsins, granzymes and matrix metalloproteinases (MMPs on PARP-1 produces several specific proteolytic cleavage fragments with different molecular weights. These PARP-1 signature fragments are recognized biomarkers for specific patterns of protease activity in unique cell death programs. This review focuses on specific suicidal proteases active towards PARP-1 to generate signature PARP-1 fragments that can identify key proteases and particular forms of cell death involved in pathophysiology. The roles played by some of the PARP-1 fragments and their associated binding partners in the control of different forms of cell death are also discussed.
DNA based radiological dosimetry technology
International Nuclear Information System (INIS)
Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin
2008-01-01
Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)
Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.
Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François
2009-07-08
Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.
DNA polymerase beta participates in mitochondrial DNA repair
DEFF Research Database (Denmark)
Sykora, P; Kanno, S; Akbari, M
2017-01-01
We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...
Energy Technology Data Exchange (ETDEWEB)
Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.
2009-09-01
Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.
Telomere Restriction Fragment (TRF) Analysis.
Mender, Ilgen; Shay, Jerry W
2015-11-20
While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of
International Nuclear Information System (INIS)
Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.
1987-01-01
The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia
Energy Technology Data Exchange (ETDEWEB)
Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)
2015-04-28
Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.
[Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].
Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun
2015-08-01
To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.
Fragment emission from modestly excited nuclear systems
Energy Technology Data Exchange (ETDEWEB)
Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.
1996-07-08
Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).
Ishida, Yasuko; Gugala, Natalie A; Georgiadis, Nicholas J; Roca, Alfred L
2018-05-01
The past processes that have shaped geographic patterns of genetic diversity may be difficult to infer from current patterns. However, in species with sex differences in dispersal, differing phylogeographic patterns between mitochondrial (mt) and nuclear (nu) DNA may provide contrasting insights into past events. Forest elephants ( Loxodonta cyclotis ) were impacted by climate and habitat change during the Pleistocene, which likely shaped phylogeographic patterns in mitochondrial (mt) DNA that have persisted due to limited female dispersal. By contrast, the nuclear (nu) DNA phylogeography of forest elephants in Central Africa has not been determined. We therefore examined the population structure of Central African forest elephants by genotyping 94 individuals from six localities at 21 microsatellite loci. Between forest elephants in western and eastern Congolian forests, there was only modest genetic differentiation, a pattern highly discordant with that of mtDNA. Nuclear genetic patterns are consistent with isolation by distance. Alternatively, male-mediated gene flow may have reduced the previous regional differentiation in Central Africa suggested by mtDNA patterns, which likely reflect forest fragmentation during the Pleistocene. In species like elephants, male-mediated gene flow erases the nuclear genetic signatures of past climate and habitat changes, but these continue to persist as patterns in mtDNA because females do not disperse. Conservation implications of these results are discussed.
Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology
Directory of Open Access Journals (Sweden)
Nguyen-Hieu Tung
2012-09-01
Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.
Impacts of Landscape Context on Patterns of Wind Downfall Damage in a Fragmented Amazonian Landscape
Schwartz, N.; Uriarte, M.; DeFries, R. S.; Gutierrez-Velez, V. H.; Fernandes, K.; Pinedo-Vasquez, M.
2015-12-01
Wind is a major disturbance in the Amazon and has both short-term impacts and lasting legacies in tropical forests. Observed patterns of damage across landscapes result from differences in wind exposure and stand characteristics, such as tree stature, species traits, successional age, and fragmentation. Wind disturbance has important consequences for biomass dynamics in Amazonian forests, and understanding the spatial distribution and size of impacts is necessary to quantify the effects on carbon dynamics. In November 2013, a mesoscale convective system was observed over the study area in Ucayali, Peru, a highly human modified and fragmented forest landscape. We mapped downfall damage associated with the storm in order to ask: how does the severity of damage vary within forest patches, and across forest patches of different sizes and successional ages? We applied spectral mixture analysis to Landsat images from 2013 and 2014 to calculate the change in non-photosynthetic vegetation fraction after the storm, and combined it with C-band SAR data from the Sentinel-1 satellite to predict downfall damage measured in 30 field plots using random forest regression. We then applied this model to map damage in forests across the study area. Using a land cover classification developed in a previous study, we mapped secondary and mature forest, and compared the severity of damage in the two. We found that damage was on average higher in secondary forests, but patterns varied spatially. This study demonstrates the utility of using multiple sources of satellite data for mapping wind disturbance, and adds to our understanding of the sources of variation in wind-related damage. Ultimately, an improved ability to map wind impacts and a better understanding of their spatial patterns can contribute to better quantification of carbon dynamics in Amazonian landscapes.
Sequence analysis of mitochondrial DNA hypervariable region III of ...
African Journals Online (AJOL)
The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...
Amarger, V; Mercier, L
1995-01-01
We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.
Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika
2018-03-12
Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death
Wood, S; Starr, T V; Shukin, R J
1986-01-01
We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441
Energy Technology Data Exchange (ETDEWEB)
Christie, N.T. (Univ. of Tennessee, Oak Ridge); Skinner, D.M.
1979-02-01
Kinetic analysis of the reassociation of 420 nucleotide (NT) long fragments has shown that essentially all of the repetitive sequences of the DNA of the red crab Geryon quinquedens are highly repetitive. There are negligible amounts of low and intermediate repetitive DNAs. Though atypical of most eukaryotes, this pattern has been observed in al other brachyurans (true crabs) studied. The major repetitive component is subdivided into short runs of 300 NT and longer runs of greater than 1200 NT while the minor component has an average sequence length of 400 NT. Both components reassociate at rates commonly observed for satellite DNAs. Unique among eukaryotes the organization of the genome includes single copy DNA contiguous to short runs (300 NT) of both repetitive components. Although patent satellites are not present, subsets of the repetitive DNA have been isolated by either restriction endonuclease digestion or by centrifugation in Ag/sup +/ or Hg/sup 2 +//Cs/sub 2/SO/sub 4/ density gradients.
Homology of yeast photoreactivating gene fragment with human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1984-01-01
Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes
Stojković, Marijana Radić; Skugor, Marko; Dudek, Lukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo
2014-01-01
An investigation of the interactions of two novel and several known DBTAA-adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA-propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure-activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA.
Limestone fragmentation and attrition during fluidized bed oxyfiring
Energy Technology Data Exchange (ETDEWEB)
Fabrizio Scala; Piero Salatino [Istituto di Ricerche sulla Combustione - CNR, Napoli (Italy)
2010-04-15
Attrition/fragmentation of limestone under simulated fluidized bed oxyfiring conditions was investigated by means of an experimental protocol that had been previously developed for characterization of attrition/fragmentation of sorbents in air-blown atmospheric fluidized bed combustors. The protocol was based on the use of different and mutually complementary techniques. The extent and pattern of attrition by surface wear in the dense phase of a fluidized bed were assessed in experiments carried out with a bench scale fluidized bed combustor under simulated oxyfiring conditions. Sorbent samples generated during simulated oxyfiring tests were further characterized from the standpoint of fragmentation upon high velocity impact by means of a purposely designed particle impactor. Results showed that under calcination-hindered conditions attrition and fragmentation patterns are much different from those occurring under air-blown atmospheric combustion conditions. Noteworthy, attrition/fragmentation enhanced particle sulfation by continuously regenerating the exposed particle surface. 13 refs., 8 figs.
Staggering in the cleavage pattern of E. coli ABC-excinuclease
International Nuclear Information System (INIS)
Myles, G.M.; Van Houten, B.; Sancar, A.
1986-01-01
E. coli ABC excinuclease is a complex of three proteins encoded by the uvrA, uvrB, and uvrC genes. The enzyme repairs DNA mono and diadducts by the single strand cleavage of DNA eight phosphodiester bond 5' and four or five phosphodiester bonds 3' to a DNA lesion and facilitates the removal of the resulting twelve or thirteen nucleotide fragment. In this study, the authors have investigated the excision pattern for ultraviolet (UV) induced diadducts, i.e. cyclobutane pyrimidine dimers and pyrimidine-pyrimidone (6-4) photoproducts. Terminally (5' or 3') labeled DNA was irradiated with 254nm UV and treated with ABC excinuclease before and after photoreactivation of cyclobutane dimers by E. coli DNA photolyase. In this way, the authors were able to differentiate between the cleavage pattern of pyrimidine dimers and of (6-4) photoproducts. Their results show that certain TT cyclobutane dimers and rare TT (6-4) photoproducts are excised by cleavage seven and, less frequently, six phosphodiester bonds to the 5' side of the DNA lesion in addition to the primary cutting site at the eight 5' phosphodiester bond. The 3' cleavage sites are maintained at the fourth and fifth phosphodiester bonds for the these UV induced lesions. These data indicate that the cleavage pattern of the ABC excinuclease may be dependent upon both the type of DNA lesion as well as it surrounding nucleotide sequence. In addition, the authors analysis shows that (6-4) photoproducts are much better substrates for ABC excinuclease than are pyrimidine dimers
Directory of Open Access Journals (Sweden)
Olufunmilola Ibironke
2012-01-01
Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.
Conformational changes in DNA gyrase revealed by limited proteolysis
DEFF Research Database (Denmark)
Kampranis, S C; Maxwell, A
1998-01-01
We have used limited proteolysis to identify conformational changes in DNA gyrase. Gyrase exhibits a proteolytic fingerprint dominated by two fragments, one of approximately 62 kDa, deriving from the A protein, and another of approximately 25 kDa from the B protein. Quinolone binding to the enzyme......-DNA intermediate by calcium ions does not reveal any protection, suggesting that the quinolone-induced conformational change is different from an "open-gate" state of the enzyme. A quinolone-resistant mutant of gyrase fails to give the characteristic quinolone-associated proteolytic signature. The ATP...... does not prevent dimerization since incubation of the enzyme-DNA complex with both ADPNP and quinolones gives rise to a complex whose proteolytic pattern retains the characteristic signature of dimerization but has lost the quinolone-induced protection. As a result, the quinolone-gyrase complex can...
Investigation of DNA double strand breaks induced by α particle and 7Li ions
International Nuclear Information System (INIS)
Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong
2006-01-01
α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)
Fragmentation of atomic clusters: A theoretical study
International Nuclear Information System (INIS)
Lopez, M.J.; Jellinek, J.
1994-01-01
Collisionless fragmentation of nonrotating model n-atom metal clusters (n=12, 13, and 14) is studied using isoergic molecular-dynamics simulations. Minimum-energy paths for fragmentation are mapped out as functions of the distance between the centers of mass of the fragments. These paths provide information on the fragmentation energies for the different fragmentation channels. Fragmentation patterns (distributions of the fragmentation channel probabilities) and global and channel-specific fragmentation rate constants are computed and analyzed as functions of the internal energy and of the size of the clusters. The trends derived from the dynamics are compared with those obtained using the RRK and TST statistical approaches. The dynamics of the fragmentation process is analyzed in terms of characteristic quantities such as the distance between the centers of mass of the fragments, their relative translational energy, and their interaction energy, all considered as functions of time
Inostroza, Luis; Baur, Rolf; Csaplovics, Elmar
2013-01-30
South America is one of the most urbanized continents in the world, where almost 84% of the total population lives in cities, more urbanized than North America (82%) and Europe (73%). Spatial dynamics, their structure, main features, land consumption rates, spatial arrangement, fragmentation degrees and comparability, remain mostly unknown for most Latin American cities. Using satellite imagery the main parameters of sprawl are quantified for 10 Latin American cities over a period of 20 years by monitoring growth patterns and identifying spatial metrics to characterize urban development and sprawling features measured with GIS tools. This quantification contributes to a better understanding of urban form in Latin America. A pervasive spatial expansion has been observed, where most of the studied cities are expanding at fast rates with falling densities trend. Although important differences in the rates of land consumption and densities exist, there is an underlying fragmentation trend towards increasing sprawl. These trends of spatial discontinuity may eventually be intensified by further economic development. Urban Sprawl/Latin America/GIS metrics/spatial development. Copyright © 2012 Elsevier Ltd. All rights reserved.
Methods of introducing nucleic acids into cellular DNA
Energy Technology Data Exchange (ETDEWEB)
Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.
2017-06-27
A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.
DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA
DEFF Research Database (Denmark)
Christensen, H.; Angen, Øystein; Mutters, R.
2000-01-01
The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...
Cut-and-Paste of DNA Using an Artificial Restriction DNA Cutter
Directory of Open Access Journals (Sweden)
Makoto Komiyama
2013-02-01
Full Text Available DNA manipulations using a completely chemistry-based DNA cutter (ARCUT have been reviewed. This cutter, recently developed by the authors, is composed of Ce(IV/EDTA complex and two strands of pseudo-complementary peptide nucleic acid. The site-selective scission proceeds via hydrolysis of targeted phosphodiester linkages, so that the resultant scission fragments can be easily ligated with other fragments by using DNA ligase. Importantly, scission-site and site-specificity of the cutter are freely tuned in terms of the Watson–Crick rule. Thus, when one should like to manipulate DNA according to the need, he or she does not have to think about (1 whether appropriate “restriction enzyme sites” exist near the manipulation site and (2 whether the site-specificity of the restriction enzymes, if any, are sufficient to cut only the aimed position without chopping the DNA at non-targeted sites. Even the human genome can be manipulated, since ARCUT can cut the genome at only one predetermined site. Furthermore, the cutter is useful to promote homologous recombination in human cells, converting a site to desired sequence. The ARCUT-based DNA manipulation should be promising for versatile applications.
Heart Rate Fragmentation: A Symbolic Dynamical Approach
Directory of Open Access Journals (Sweden)
Madalena D. Costa
2017-11-01
Full Text Available Background: We recently introduced the concept of heart rate fragmentation along with a set of metrics for its quantification. The term was coined to refer to an increase in the percentage of changes in heart rate acceleration sign, a dynamical marker of a type of anomalous variability. The effort was motivated by the observation that fragmentation, which is consistent with the breakdown of the neuroautonomic-electrophysiologic control system of the sino-atrial node, could confound traditional short-term analysis of heart rate variability.Objective: The objectives of this study were to: (1 introduce a symbolic dynamical approach to the problem of quantifying heart rate fragmentation; (2 evaluate how the distribution of the different dynamical patterns (“words” varied with the participants' age in a group of healthy subjects and patients with coronary artery disease (CAD; and (3 quantify the differences in the fragmentation patterns between the two sample populations.Methods: The symbolic dynamical method employed here was based on a ternary map of the increment NN interval time series and on the analysis of the relative frequency of symbolic sequences (words with a pre-defined set of features. We analyzed annotated, open-access Holter databases of healthy subjects and patients with CAD, provided by the University of Rochester Telemetric and Holter ECG Warehouse (THEW.Results: The degree of fragmentation was significantly higher in older individuals than in their younger counterparts. However, the fragmentation patterns were different in the two sample populations. In healthy subjects, older age was significantly associated with a higher percentage of transitions from acceleration/deceleration to zero acceleration and vice versa (termed “soft” inflection points. In patients with CAD, older age was also significantly associated with higher percentages of frank reversals in heart rate acceleration (transitions from acceleration to
Jorgez, Carolina J; Bischoff, Farideh Z
2009-01-01
Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.
A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.
Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang
2005-12-01
The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.
Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika
2014-08-01
This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Asya S. Levina
2016-08-01
Full Text Available Background: The development of new antiviral drugs based on nucleic acids is under scrutiny. An important problem in this aspect is to find the most vulnerable conservative regions in the viral genome as targets for the action of these agents. Another challenge is the development of an efficient system for their delivery into cells. To solve this problem, we proposed a TiO2·PL–DNA nanocomposite consisting of titanium dioxide nanoparticles and polylysine (PL-containing oligonucleotides.Results: The TiO2·PL–DNA nanocomposites bearing the DNA fragments targeted to different conservative regions of (−RNA and (+RNA of segment 5 of influenza A virus (IAV were studied for their antiviral activity in MDCK cells infected with the H1N1, H5N1, and H3N2 virus subtypes. Within the negative strand of each of the studied strains, the efficiency of DNA fragments increased in the direction of its 3’-end. Thus, the DNA fragment aimed at the 3’-noncoding region of (−RNA was the most efficient and inhibited the reproduction of different IAV subtypes by 3–4 orders of magnitude. Although to a lesser extent, the DNA fragments targeted at the AUG region of (+RNA and the corresponding region of (−RNA were also active. For all studied viral subtypes, the nanocomposites bearing the DNA fragments targeted to (−RNA appeared to be more efficient than those containing fragments aimed at the corresponding (+RNA regions.Conclusion: The proposed TiO2·PL–DNA nanocomposites can be successfully used for highly efficient and site-specific inhibition of influenza A virus of different subtypes. Some patterns of localization of the most vulnerable regions in IAV segment 5 for the action of DNA-based drugs were found. The (−RNA strand of IAV segment 5 appeared to be more sensitive as compared to (+RNA.
Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.
Directory of Open Access Journals (Sweden)
Christine Couldrey
Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.
Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio
2010-03-31
The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra
2016-12-01
The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.
Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.
Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi
2017-01-01
Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.
Veiga, Puri; Rubal, Marcos; Cacabelos, Eva; Moreira, Juan; Sousa-Pinto, Isabel
2013-10-01
The crustose calcareous red macroalgae Lithophyllum byssoides (Lamarck) Foslie is a common ecosystem engineer along the Atlantic and Mediterranean coast of the Iberian Peninsula. This species is threatened by several anthropogenic impacts acting at different spatial scales, such as pollution or global warming. The aim of this study is to identify scales of spatial variation in the abundance and fragmentation patterns of L. byssoides along the Atlantic coast of the Iberian Peninsula. For this aim we used a hierarchical sampling design considering four spatial scales (from metres to 100s of kilometres). Results of the present study indicated no significant variability among regions investigated whereas significant variability was found at the scales of shore and site in spatial patterns of abundance and fragmentation of L. byssoides. Variance components were higher at the spatial scale of shore for abundance and fragmentation of L. byssoides with the only exception of percentage cover and thus, processes acting at the scale of 10s of kilometres seem to be more relevant in shaping the spatial variability both in abundance and fragmentation of L. byssoides. These results provided quantitative estimates of abundance and fragmentation of L. byssoides at the Atlantic coast of the Iberian Peninsula establishing the observational basis for future assessment, monitoring and experimental investigations to identify the processes and anthropogenic impacts affecting L. byssoides populations. Finally we have also identified percentage cover and patch density as the best variables for long-term monitoring programs aimed to detect future anthropogenic impacts on L. byssoides. Therefore, our results have important implications for conservation and management of this valuable ecosystem engineer along the Atlantic coast of the Iberian Peninsula.
Schiffer, Michele; Kennington, W J; Hoffmann, A A; Blacket, M J
2007-04-01
Although fragmented rainforest environments represent hotspots for invertebrate biodiversity, few genetic studies have been conducted on rainforest invertebrates. Thus, it is not known if invertebrate species in rainforests are highly genetically fragmented, with the potential for populations to show divergent selection responses, or if there are low levels of gene flow sufficient to maintain genetic homogeneity among fragmented populations. Here we use microsatellite markers and DNA sequences from the mitochondrial ND5 locus to investigate genetic differences among Drosophila birchii populations from tropical rainforests in Queensland, Australia. As found in a previous study, mitochondrial DNA diversity was low with no evidence for population differentiation among rainforest fragments. The pattern of mitochondrial haplotype variation was consistent with D. birchii having undergone substantial past population growth. Levels of nuclear genetic variation were high in all populations while F(ST) values were very low, even for flies from geographically isolated areas of rainforest. No significant differentiation was observed between populations on either side of the Burdekin Gap (a long-term dry corridor), although there was evidence for higher gene diversity in low-latitude populations. Spatial autocorrelation coefficients were low and did not differ significantly from random, except for one locus which revealed a clinal-like pattern. Comparisons of microsatellite differentiation contrasted with previously established clinal patterns in quantitative traits in D. birchii, and indicate that the patterns in quantitative traits are likely to be due to selection. These results suggest moderate gene flow in D. birchii over large distances. Limited population structure in this species appears to be due to recent range expansions or cycles of local extinctions followed by recolonizations/expansions. Nevertheless, patterns of local adaptation have developed in D. birchii that
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Patterns of exchange of forensic DNA data in the European Union through the Pr?m system
Santos, Filipe; Machado, Helena
2017-01-01
Article in press This paper presents a study of the 5-year operation (2011–2015) of the transnational exchange of forensic DNA data between Member States of the European Union (EU) for the purpose of combating cross-border crime and terrorism within the so-called Prüm system. This first systematisation of the full official statistical dataset provides an overall assessment of the match figures and patterns of operation of the Prüm system for DNA exchange. These figures and patterns are ana...
Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples
Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel
2017-01-01
Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837
Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita
2014-01-01
Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA. PMID:25246976
The Y4-RNA fragment, a potential diagnostic marker, exists in saliva
Directory of Open Access Journals (Sweden)
Tatsuya Ishikawa
2017-06-01
Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon
On some surprising statistical properties of a DNA fingerprinting technique called AFLP
Gort, G.
2010-01-01
AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary
Efficient representation of DNA data for pattern recognition using failure factor oracles
Cleophas, Loek; Kourie, Derrick G.; Watson, Bruce W.
2013-01-01
In indexing of and pattern matching on DNA sequences, representing all factors of a sequence is important. One efficient, compact representation is the factor oracle (FO). At the same time, any classical deterministic finite automata (DFA) can be transformed to a so-called failure one (FDFA), which
Srinivasan, Krishnamoorthy; Sharma, Shyam S
2011-11-20
Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.
Multiple tag labeling method for DNA sequencing
Mathies, R.A.; Huang, X.C.; Quesada, M.A.
1995-07-25
A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.
Effect of Cisplatin on the Flexibility of Linear DNA
International Nuclear Information System (INIS)
Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye
2011-01-01
With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)
International Nuclear Information System (INIS)
Eisen, L.P.; Reichman, M.E.; Thompson, E.B.; Gametchu, B.; Harrison, R.W.; Eisen, H.J.
1985-01-01
The region of the glucocorticoid receptor that reacted with a monoclonal antibody (BUGR-1) was identified. In order to identify the immunoreactive region, the rat liver glucocorticoid receptor was subjected to limited proteolysis; immunoreactive fragments were identified by Western blotting. The monoclonal antibody reacted with both the undigested Mr approximately 97,000 receptor subunit and a Mr approximately 45,000 fragment containing the steroid-binding and DNA-binding domains. Digestion by trypsin also produced two steroid-binding fragments of Mr approximately 27,000 and 31,000 which did not react with the antibody and an immunoreactive Mr approximately 16,000 fragment. This Mr approximately 16,000 fragment was shown to bind to DNA-cellulose, indicating that it contained a DNA-binding domain of the receptor. The undigested receptor must have steroid associated with it to undergo activation to a DNA-binding form. However, the Mr approximately 16,000 immunoreactive fragment binds to DNA-cellulose even if it is obtained by digestion of the steroid-free holoreceptor which does not itself bind to DNA
International Nuclear Information System (INIS)
Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen
2008-01-01
Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins
Patterns of DNA barcode variation in Canadian marine molluscs.
Layton, Kara K S; Martel, André L; Hebert, Paul D N
2014-01-01
Molluscs are the most diverse marine phylum and this high diversity has resulted in considerable taxonomic problems. Because the number of species in Canadian oceans remains uncertain, there is a need to incorporate molecular methods into species identifications. A 648 base pair segment of the cytochrome c oxidase subunit I gene has proven useful for the identification and discovery of species in many animal lineages. While the utility of DNA barcoding in molluscs has been demonstrated in other studies, this is the first effort to construct a DNA barcode registry for marine molluscs across such a large geographic area. This study examines patterns of DNA barcode variation in 227 species of Canadian marine molluscs. Intraspecific sequence divergences ranged from 0-26.4% and a barcode gap existed for most taxa. Eleven cases of relatively deep (>2%) intraspecific divergence were detected, suggesting the possible presence of overlooked species. Structural variation was detected in COI with indels found in 37 species, mostly bivalves. Some indels were present in divergent lineages, primarily in the region of the first external loop, suggesting certain areas are hotspots for change. Lastly, mean GC content varied substantially among orders (24.5%-46.5%), and showed a significant positive correlation with nearest neighbour distances. DNA barcoding is an effective tool for the identification of Canadian marine molluscs and for revealing possible cases of overlooked species. Some species with deep intraspecific divergence showed a biogeographic partition between lineages on the Atlantic, Arctic and Pacific coasts, suggesting the role of Pleistocene glaciations in the subdivision of their populations. Indels were prevalent in the barcode region of the COI gene in bivalves and gastropods. This study highlights the efficacy of DNA barcoding for providing insights into sequence variation across a broad taxonomic group on a large geographic scale.
Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries
Energy Technology Data Exchange (ETDEWEB)
Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)
2014-06-01
The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.
DNA polymorphism in the living fossil Ginkgo biloba from the eastern United States.
Kuddus, Ruhul H; Kuddus, Nayema N; Dvorchik, Igor
2002-02-01
Random amplified polymorphic DNA (RAPD) analysis is a valuable tool in studying inter- and intra-specific genetic variations, patterns of gene expression, and for the identification of specific genes using nearly isogenic variants. Here we used RAPD analysis to study the genetic variation in Ginkgo biloba grown in the eastern United States. Our results support the evidence that Southern blot hybridization of RAPD using probes made from cloned DNA fragments allows a more accurate analysis of the RAPD pattern than dye-stained gels or Southern blot hybridization of RAPD blots using probes made from purified PCR products. Using these techniques, we observed a high degree of relatedness among plants grown in certain localities although significant genetic variation may exist in the species, and could be a possible explanation for the observed variations in the efficacy of medications derived from G. biloba extract.
DNA hybridization sensing for cytogenetic analysis
DEFF Research Database (Denmark)
Kwasny, Dorota; Dapra, Johannes; Brøgger, Anna Line
2013-01-01
are rearrangements between two chromosome arms that results in two derivative chromosomes having a mixed DNA sequence. The current detection method is a Fluorescent In situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the DNA sequences of two chromosomes involved...... in the translocation (Kwasny et al., 2012). We have developed a new double hybridization assay that allows for sorting of the DNA chromosomal fragments into separate compartment, moreover allowing for detection of the translocation. To detect the translocation it is necessary to determine that the two DNA sequences...... forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The first example of the translocation detection was presented on lab-on-a-disc using fluorescently labeled DNA fragments, representing the derivative chromosome (Brøgger et al., 2012). To allow...
Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels
1988-01-01
Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....
Asimes, AnnaDorothea; Torcaso, Audrey; Pinceti, Elena; Kim, Chun K; Zeleznik-Le, Nancy J; Pak, Toni R
2017-05-01
Teenage binge drinking is a major health concern in the United States, with 21% of teenagers reporting binge-pattern drinking behavior in the previous 30 days. Recently, our lab showed that alcohol-naïve offspring of rats exposed to alcohol during adolescence exhibited altered gene expression profiles in the hypothalamus, a brain region involved in stress regulation. We employed Enhanced Reduced Representation Bisulfite Sequencing as an unbiased approach to test the hypothesis that parental exposure to binge-pattern alcohol during adolescence alters DNA methylation profiles in their alcohol-naïve offspring. Wistar rats were administered a repeated binge-ethanol exposure paradigm during early (postnatal day (PND) 37-44) and late (PND 67-74) adolescent development. Animals were mated 24 h after the last ethanol dose and subsequent offspring were produced. Analysis of male PND7 offspring revealed that offspring of alcohol-exposed parents exhibited differential DNA methylation patterns in the hypothalamus. The differentially methylated cytosines (DMCs) were distinct between offspring depending on which parent was exposed to ethanol. Moreover, novel DMCs were observed when both parents were exposed to ethanol and many DMCs from single parent ethanol exposure were not recapitulated with dual parent exposure. We also measured mRNA expression of several differentially methylated genes and some, but not all, showed correlative changes in expression. Importantly, methylation was not a direct predictor of expression levels, underscoring the complexity of transcriptional regulation. Overall, we demonstrate that adolescent binge ethanol exposure causes altered genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve offspring. Copyright © 2016 Elsevier Inc. All rights reserved.
Mechanics of fragmentation of crocodile skin and other thin films
Qin, Zhao; Pugno, Nicola M.; Buehler, Markus J.
2014-01-01
Fragmentation of thin layers of materials is mediated by a network of cracks on its surface. It is commonly seen in dehydrated paintings or asphalt pavements and even in graphene or other two-dimensional materials, but is also observed in the characteristic polygonal pattern on a crocodile's head. Here, we build a simple mechanical model of a thin film and investigate the generation and development of fragmentation patterns as the material is exposed to various modes of deformation. We find that the characteristic size of fragmentation, defined by the mean diameter of polygons, is strictly governed by mechanical properties of the film material. Our result demonstrates that skin fragmentation on the head of crocodiles is dominated by that it features a small ratio between the fracture energy and Young's modulus, and the patterns agree well with experimental observations. Understanding this mechanics-driven process could be applied to improve the lifetime and reliability of thin film coatings by mimicking crocodile skin. PMID:24862190
Mechanics of fragmentation of crocodile skin and other thin films
Qin, Zhao; Pugno, Nicola M.; Buehler, Markus J.
2014-05-01
Fragmentation of thin layers of materials is mediated by a network of cracks on its surface. It is commonly seen in dehydrated paintings or asphalt pavements and even in graphene or other two-dimensional materials, but is also observed in the characteristic polygonal pattern on a crocodile's head. Here, we build a simple mechanical model of a thin film and investigate the generation and development of fragmentation patterns as the material is exposed to various modes of deformation. We find that the characteristic size of fragmentation, defined by the mean diameter of polygons, is strictly governed by mechanical properties of the film material. Our result demonstrates that skin fragmentation on the head of crocodiles is dominated by that it features a small ratio between the fracture energy and Young's modulus, and the patterns agree well with experimental observations. Understanding this mechanics-driven process could be applied to improve the lifetime and reliability of thin film coatings by mimicking crocodile skin.
Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.
Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko
2016-01-01
The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for
Gene prediction in metagenomic fragments: A large scale machine learning approach
Directory of Open Access Journals (Sweden)
Morgenstern Burkhard
2008-04-01
Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene
Vandergast, A.G.; Bohonak, A.J.; Weissman, D.B.; Fisher, R.N.
2007-01-01
Habitat loss and fragmentation due to urbanization are the most pervasive threats to biodiversity in southern California. Loss of habitat and fragmentation can lower migration rates and genetic connectivity among remaining populations of native species, reducing genetic variability and increasing extinction risk. However, it may be difficult to separate the effects of recent anthropogenic fragmentation from the genetic signature of prehistoric fragmentation due to previous natural geological and climatic changes. To address these challenges, we examined the phylogenetic and population genetic structure of a flightless insect endemic to cismontane southern California, Stenopelmatus 'mahogani' (Orthoptera: Stenopelmatidae). Analyses of mitochondrial DNA sequence data suggest that diversification across southern California began during the Pleistocene, with most haplotypes currently restricted to a single population. Patterns of genetic divergence correlate with contemporary urbanization, even after correcting for (geographical information system) GIS-based reconstructions of fragmentation during the Pleistocene. Theoretical simulations confirm that contemporary patterns of genetic structure could be produced by recent urban fragmentation using biologically reasonable assumptions about model parameters. Diversity within populations was positively correlated with current fragment size, but not prehistoric fragment size, suggesting that the effects of increased drift following anthropogenic fragmentation are already being seen. Loss of genetic connectivity and diversity can hinder a population's ability to adapt to ecological perturbations commonly associated with urbanization, such as habitat degradation, climatic changes and introduced species. Consequently, our results underscore the importance of preserving and restoring landscape connectivity for long-term persistence of low vagility native species. Journal compilation ?? 2006 Blackwell Publishing Ltd.
DNA Sequences of RAPD Fragments in the Egyptian cotton ...
African Journals Online (AJOL)
Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...
DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line
Directory of Open Access Journals (Sweden)
Saeed Samarghandian
2013-01-01
Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 0.07 and 6.4 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.
Molecular markers. Amplified fragment length polymorphism
Directory of Open Access Journals (Sweden)
Pržulj Novo
2005-01-01
Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.
Trapping and breaking of in vivo nicked DNA during pulsed-field gel electrophoresis
Khan, Sharik R.; Kuzminov, Andrei
2013-01-01
Pulsed field gel electrophoresis (PFGE) offers a high-resolution approach to quantify chromosomal fragmentation in bacteria, measured as percent of chromosomal DNA entering the gel. The degree of separation in PFG depends upon the size of DNA, as well as various conditions of electrophoresis, such as electric field strength (FS), time of electrophoresis, switch time and buffer composition. Here we describe a new parameter, the structural integrity of the sample DNA itself, that influences its migration through PFGs. We show that sub-chromosomal fragments containing both spontaneous and DNA damage-induced nicks are prone to breakage during PFGE. Such breakage at single strand interruptions results in artefactual decrease in molecular weight of linear DNA making accurate determination of the number of double strand breaks difficult. While breakage of nicked sub-chromosomal fragments is FS-independent, some high molecular weight sub-chromosomal fragments are also trapped within wells under the standard PFGE conditions. This trapping can be minimized by lowering the field strength and increasing the time of electrophoresis. We discuss how breakage of nicked DNA may be mechanistically linked to trapping. Our results suggest how to optimize conditions for PFGE when quantifying chromosomal fragmentation induced by DNA damage. PMID:23770235
Parodi, S; Balbi, C; Abelmoschi, M L; Pala, M; Russo, P; Santi, L
1983-12-01
Alkaline elution is a well-known method for detecting DNA damage. Recently we have developed a viscosimetric method that is even more sensitive than alkaline elution. Here we report that the two methods, although apparently both revealing alkaline DNA fragmentation, can give dramatically different results for a significant series of compounds. We suspect that alkaline elution might reveal not only DNA fragmentation but also the extent of disentanglement of chromatin structure, whereas this DNA disentanglement rate, when evaluated viscosimetrically , is more strictly correlated with the initiation of DNA unwinding.
Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.
Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D
2004-11-01
Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.
Directory of Open Access Journals (Sweden)
Hossein ALAEI
2013-01-01
Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.
Molecular mechanisms of DNA photodamage
International Nuclear Information System (INIS)
Starrs, S.M.
2000-05-01
Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA) n and (GA) n , and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a dimeric
Heritable alteration of DNA methylation induced by whole-chromosome aneuploidy in wheat.
Gao, Lihong; Diarso, Moussa; Zhang, Ai; Zhang, Huakun; Dong, Yuzhu; Liu, Lixia; Lv, Zhenling; Liu, Bao
2016-01-01
Aneuploidy causes changes in gene expression and phenotypes in all organisms studied. A previous study in the model plant Arabidopsis thaliana showed that aneuploidy-generated phenotypic changes can be inherited to euploid progenies and implicated an epigenetic underpinning of the heritable variations. Based on an analysis by amplified fragment length polymorphism and methylation-sensitive amplified fragment length polymorphism markers, we found that although genetic changes at the nucleotide sequence level were negligible, extensive changes in cytosine DNA methylation patterns occurred in all studied homeologous group 1 whole-chromosome aneuploid lines of common wheat (Triticum aestivum), with monosomic 1A showing the greatest amount of methylation changes. The changed methylation patterns were inherited by euploid progenies derived from the aneuploid parents. The aneuploidy-induced DNA methylation alterations and their heritability were verified at selected loci by bisulfite sequencing. Our data have provided empirical evidence supporting earlier suggestions that heritability of aneuploidy-generated, but aneuploidy-independent, phenotypic variations may have an epigenetic basis. That at least one type of aneuploidy - monosomic 1A - was able to cause significant epigenetic divergence of the aneuploid plants and their euploid progenies also lends support to recent suggestions that aneuploidy may have played an important and protracted role in polyploid genome evolution. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Directory of Open Access Journals (Sweden)
Leterrier Christine
2010-07-01
Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.
Discovering approximate-associated sequence patterns for protein-DNA interactions
Chan, Tak Ming
2010-12-30
Motivation: The bindings between transcription factors (TFs) and transcription factor binding sites (TFBSs) are fundamental protein-DNA interactions in transcriptional regulation. Extensive efforts have been made to better understand the protein-DNA interactions. Recent mining on exact TF-TFBS-associated sequence patterns (rules) has shown great potentials and achieved very promising results. However, exact rules cannot handle variations in real data, resulting in limited informative rules. In this article, we generalize the exact rules to approximate ones for both TFs and TFBSs, which are essential for biological variations. Results: A progressive approach is proposed to address the approximation to alleviate the computational requirements. Firstly, similar TFBSs are grouped from the available TF-TFBS data (TRANSFAC database). Secondly, approximate and highly conserved binding cores are discovered from TF sequences corresponding to each TFBS group. A customized algorithm is developed for the specific objective. We discover the approximate TF-TFBS rules by associating the grouped TFBS consensuses and TF cores. The rules discovered are evaluated by matching (verifying with) the actual protein-DNA binding pairs from Protein Data Bank (PDB) 3D structures. The approximate results exhibit many more verified rules and up to 300% better verification ratios than the exact ones. The customized algorithm achieves over 73% better verification ratios than traditional methods. Approximate rules (64-79%) are shown statistically significant. Detailed variation analysis and conservation verification on NCBI records demonstrate that the approximate rules reveal both the flexible and specific protein-DNA interactions accurately. The approximate TF-TFBS rules discovered show great generalized capability of exploring more informative binding rules. © The Author 2010. Published by Oxford University Press. All rights reserved.
DNA strand breakage by 125I-decay in oligoDNA
International Nuclear Information System (INIS)
Lobachevsky, P.; Martin, R.F.
1996-01-01
Full text: A double-stranded oligodeoxynucleotide containing 125 I-dC in a defined location, with 5'- or 3'- 32 P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125 I decay. Samples of the 32 P-end-labelled and 125 I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32 P-end-labelled DNA fragments produced by 125 I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125 I decay event produces at least one break in the 125 I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125 I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125 I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125 I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125 I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25 I-decay, and may provide new mechanistic insights
Directory of Open Access Journals (Sweden)
Diane I Schroeder
2015-08-01
Full Text Available Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs and highly methylated domains (HMDs with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo.
Alteration of gene conversion patterns in Sordaria fimicola by supplementation with DNA bases.
Kitani, Y; Olive, L S
1970-08-01
Supplementation with DNA bases in crosses of Sordaria fimicola heterozygous for spore color markers (g(1), h(2)) within the gray-spore (g) locus has been found to cause significant alterations in patterns of gene conversion at the two mutant sites. Each base had its own characteristic effect in altering the conversion pattern, and responses of the two mutant sites to the four bases were different in several ways. Also, the responses of the two involved chromatids of the meiotic bivalent were different.
The Genomic Pattern of tDNA Operon Expression in E. coli.
Directory of Open Access Journals (Sweden)
2005-06-01
Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.
The Effect of Metabolic and Bariatric Surgery on DNA Methylation Patterns.
Morcillo, Sonsoles; Macías-González, Manuel; Tinahones, Francisco J
2017-08-30
Metabolic and bariatric surgery (MBS) is considered to be the most effective treatment for obesity. Not only due to the significant weight reduction but also because of the many health benefits associated with it. In the last 5 years, several studies have suggested that epigenetic modifications could be involved in the mechanisms underlying the response to bariatric surgery. In this review, we will compile the different studies (2012-2017) concerning the effect of this surgical procedure on DNA methylation patterns (the most studied epigenetic marker) and its association with metabolic improvement. This is an emerging area, and currently, there are not many studies in the literature. The aim is to show what has been done so far and what the future direction in this emerging area might be. Recent findings have shown how metabolic and bariatric surgery modifies the DNA methylation profile of the specific genes associated with the pathophysiology of the disease. The studies were performed in morbidly obese subjects, mainly in women, with the aim of reducing weight and improving the obesity-associated comorbidities. DNA methylation has been measured both in specific tissue and in peripheral blood samples. In general, studies about site-specific DNA methylation have shown a change in the methylation profile after surgery, whereas the studies analyzing global DNA methylation are not so conclusive. Summing up, metabolic and bariatric surgery can modify the DNA methylation profile of different genes and contributes to the metabolic health benefits that are often seen after metabolic and bariatric surgery. Although there are still many issues to be resolved, the capacity to revert the DNA methylation profile of specific sites opens a window for searching for target markers to treat obesity-related comorbidities.
Carbon ion induced DNA double-strand breaks in melanophore B16
International Nuclear Information System (INIS)
Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu
1997-01-01
DNA double-strand breaks (DSBs) in melanophore B 16 induced by plateau and extended Bragg peak of 75 MeV/u 12 C 6+ ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B 16 . Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau ∝85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)
Memory effects in nuclear fragmentation?
International Nuclear Information System (INIS)
Colonna, M.; Di Toro, M.; Guarnera, A.
1994-01-01
A general procedure to identify instability regions which lead to multifragmentation events is presented. The dominant mode at the instability point is determined from the knowledge of the mean properties (density and temperature) of the system at that point. For spinodal instabilities the dependence of fragment structures on the dynamical conditions is studied changing the beam energy and the considered equation of state. An important competition between two dynamical effects, expansion of the system and growth of fluctuations, is revealed. It is shown that in heavy-ion central collisions at medium energies memory effects of the configuration formed at the instability time could be observed in the final fragmentation pattern. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. ((orig.))
Isolation and characterization of the human uracil DNA glycosylase gene
International Nuclear Information System (INIS)
Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.
1989-01-01
A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene
Application of DNA fingerprints for cell-line individualization.
Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J
1990-09-01
DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.
Improved production and function of llama heavy chain antibody fragments by molecular evolution
Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.
2000-01-01
The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In
Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex
Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa
2016-01-01
Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051
Construction of recombinant DNA clone for bovine viral diarrhea virus
International Nuclear Information System (INIS)
Yeo, S.G.; Cho, H.J.; Masri, S.A.
1992-01-01
Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment
Size distribution of DNA molecules recovered from non-denaturing filter elution
International Nuclear Information System (INIS)
Bloecher, D.; Iliakis, G.
1991-01-01
DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)
Amplification of a transcriptionally active DNA sequence in the human brain
International Nuclear Information System (INIS)
Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.
1986-01-01
The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days
Sha, A H; Lin, X H; Huang, J B; Zhang, D P
2005-07-01
DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. The rice cultivar Wase Aikoku 3 becomes resistant to the blight pathogen Xanthomonas oryzae pv. oryzae at the adult stage. Using methylation-sensitive amplified polymorphism (MSAP) analysis, we compared the patterns of cytosine methylation in seedlings and adult plants of the rice cultivar Wase Aikoku 3 that had been inoculated with the pathogen Xanthomonas oryzae pv. oryzae, subjected to mock inoculation or left untreated. In all, 2000 DNA fragments, each representing a recognition site cleaved by either or both of two isoschizomers, were amplified using 60 pairs of selective primers. A total of 380 sites were found to be methylated. Of these, 45 showed differential cytosine methylation among the seedlings and adult plants subjected to different treatments, and overall levels of methylation were higher in adult plants than in seedlings. All polymorphic fragments were sequenced, and six showed homology to genes that code for products of known function. Northern analysis of three fragments indicated that their expression varied with methylation pattern, with hypermethylation being correlated with repression of transcription, as expected. The results suggest that significant differences in cytosine methylation exist between seedlings and adult plants, and that hypermethylation or hypomethylation of specific genes may be involved in the development of adult plant resistance (APR) in rice plants.
Hydrogen bond disruption in DNA base pairs from (14)C transmutation.
Sassi, Michel; Carter, Damien J; Uberuaga, Blas P; Stanek, Christopher R; Mancera, Ricardo L; Marks, Nigel A
2014-09-04
Recent ab initio molecular dynamics simulations have shown that radioactive carbon does not normally fragment DNA bases when it decays. Motivated by this finding, density functional theory and Bader analysis have been used to quantify the effect of C → N transmutation on hydrogen bonding in DNA base pairs. We find that (14)C decay has the potential to significantly alter hydrogen bonds in a variety of ways including direct proton shuttling (thymine and cytosine), thermally activated proton shuttling (guanine), and hydrogen bond breaking (cytosine). Transmutation substantially modifies both the absolute and relative strengths of the hydrogen bonding pattern, and in two instances (adenine and cytosine), the density at the critical point indicates development of mild covalent character. Since hydrogen bonding is an important component of Watson-Crick pairing, these (14)C-induced modifications, while infrequent, may trigger errors in DNA transcription and replication.
Blood extracellular DNA after irradiation
International Nuclear Information System (INIS)
Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.
1993-01-01
It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action
Directory of Open Access Journals (Sweden)
Takashi Kubota
2015-08-01
Full Text Available The sliding clamp PCNA is a crucial component of the DNA replication machinery. Timely PCNA loading and unloading are central for genome integrity and must be strictly coordinated with other DNA processing steps during replication. Here, we show that the S. cerevisiae Elg1 replication factor C-like complex (Elg1-RLC unloads PCNA genome-wide following Okazaki fragment ligation. In the absence of Elg1, PCNA is retained on chromosomes in the wake of replication forks, rather than at specific sites. Degradation of the Okazaki fragment ligase Cdc9 leads to PCNA accumulation on chromatin, similar to the accumulation caused by lack of Elg1. We demonstrate that Okazaki fragment ligation is the critical prerequisite for PCNA unloading, since Chlorella virus DNA ligase can substitute for Cdc9 in yeast and simultaneously promotes PCNA unloading. Our results suggest that Elg1-RLC acts as a general PCNA unloader and is dependent upon DNA ligation during chromosome replication.
Anguiano, Michael P.; Diffendorfer, James E.
2015-01-01
We investigated the spatial ecology of the California Kingsnake (Lampropeltis californiae) in unfragmented and fragmented habitat with varying patch sizes and degrees of exposure to urban edges. We radiotracked 34 Kingsnakes for up to 3 yr across four site types: interior areas of unfragmented ecological reserves, the urbanized edge of these reserves, large habitat fragments, and small habitat fragments. There was no relationship between California Kingsnake movements and the degree of exposure to urban edges and fragmentation. Home range size and movement patterns of Kingsnakes on edges and fragments resembled those in unfragmented sites. Average home-range size on each site type was smaller than the smallest fragment in which snakes were tracked. The persistence of California Kingsnakes in fragmented landscapes may be related directly to their small spatial movement patterns, home-range overlap, and ability to use urban edge habitat.
International Nuclear Information System (INIS)
Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.
1989-01-01
Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes
The 18F-FDG uptake in non small cell lung carcinoma correlates with the DNA-grading of malignancy
International Nuclear Information System (INIS)
Wu Jinchang
2002-01-01
In order to evaluate correlation of glucose metabolism and DNA ploidity of tumors, the uptake of 18 F-Deoxyglucose (FDG) by PET prior to surgery and the DNA content and DNA-grading of malignancy (DNA-MG) of Schiff-stained nuclei obtained from fresh tumor fragments by means of image cytometry were studied, and thereafter the correlation between standardized uptake value (SUV) and (DNA-MG) was analysed in forty-nine patients with histologically proven non-small cell lung carcinoma (NSCLC). As a result of the DNA histograms of these 49 patients, 46(93.88%) were aneuploidy and only 3(6.12%) were tetraploid. A linear correlation of the SUV versus the (DNA-MG) (r=0.336, p=0.024) was found, demonstrating that 18 F-FDG PET as a non-invasive metabolic imaging technique, may also provide information correlated to malignant DNA patterns which may be valuable in malignant differentiation and prognostic prediction
Directory of Open Access Journals (Sweden)
Eveson J Paige
2006-08-01
Full Text Available Abstract Background Poorly preserved biological tissues have become an important source of DNA for a wide range of zoological studies. Measuring the quality of DNA obtained from these samples is often desired; however, there are no widely used techniques available for quantifying damage in highly degraded DNA samples. We present a general method that can be used to determine the frequency of polymerase blocking DNA damage in specific gene-regions in such samples. The approach uses quantitative PCR to measure the amount of DNA present at several fragment sizes within a sample. According to a model of random degradation the amount of available template will decline exponentially with increasing fragment size in damaged samples, and the frequency of DNA damage (λ can be estimated by determining the rate of decline. Results The method is illustrated through the analysis of DNA extracted from sea lion faecal samples. Faeces contain a complex mixture of DNA from several sources and different components are expected to be differentially degraded. We estimated the frequency of DNA damage in both predator and prey DNA within individual faecal samples. The distribution of fragment lengths for each target fit well with the assumption of a random degradation process and, in keeping with our expectations, the estimated frequency of damage was always less in predator DNA than in prey DNA within the same sample (mean λpredator = 0.0106 per nucleotide; mean λprey = 0.0176 per nucleotide. This study is the first to explicitly define the amount of template damage in any DNA extracted from faeces and the first to quantify the amount of predator and prey DNA present within individual faecal samples. Conclusion We present an approach for characterizing mixed, highly degraded PCR templates such as those often encountered in ecological studies using non-invasive samples as a source of DNA, wildlife forensics investigations and ancient DNA research. This method will
International Nuclear Information System (INIS)
Chambers, C.; Dutta, S.K.
1983-01-01
High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with 32 P-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid
Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena
2015-01-01
Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and
Novel pattern of post-γ ray de novo DNA synthesis in a radioresistant human strain
International Nuclear Information System (INIS)
Mirzayans, R.; Gentner, N.E.; Paterson, M.C.
1985-01-01
Enhanced resistance to radiation cytotoxicity in a fibroblast strain from an afflicted member of a Li-Fraumeni syndrome family may be largely ascribable to a change in the pattern of DNA replicative synthesis following γ ray exposure. That is, the extent of the initial radiogenic inhibition of replicative synthesis and the time interval before its subsequent recovery were both found to be greater in radioresistant (RR) compared to normal cells. In addition, the post-recovery replication rates in the RR cells were both higher and longer lasting than those in the control cells. A similar differential pattern was also seen following treatment with 4NQO, another DNA-damaging agent to which this RR strain displays enhanced resistance. Moreover, several conventional DNA repair assays indicated that the RR cells repair radiogenic damage at normal rates. The authors therefore suggest that the increased inhibition and prolonged lag in resumption of replicative synthesis seen in the RR strain upon exposure to certain genotoxic agents may enhance cellular recovery by ''buying additional time'' for processing of potentially lethal lesions
Dna fingerprinting - review paper
Blundell, Renald
2006-01-01
Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis
DEFF Research Database (Denmark)
Morling, N; Friis, J; Fugger, L
1991-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...
International Nuclear Information System (INIS)
Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.
1988-01-01
The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site
Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo
2014-01-01
Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity...
Restriction endonuclease analysis of chloroplast DNA in interspecies somatic Hybrids of Petunia.
Kumar, A; Cocking, E C; Bovenberg, W A; Kool, A J
1982-12-01
Restriction endonuclease cleavage pattern analysis of chloroplast DNA (cpDNA) of three different interspecific somatic hybrid plants revealed that the cytoplasms of the hybrids contained only cpDNA of P. parodii. The somatic hybrid plants analysed were those between P. parodii (wild type) + P. hybrida (wild type); P. parodii (wild type)+P. inflata (cytoplasmic albino mutant); P. parodii (wild type) + P. parviflora (nuclear albino mutant). The presence of only P. parodii chloroplasts in the somatic hybrid of P. parodii + P. inflata is possibly due to the stringent selection used for somatic hybrid production. However, in the case of the two other somatic hybrids P. parodii + P. hybrida and P. parodii + P. parviflora it was not possible to determine whether the presence of only P. parodii chloroplasts in these somatic hybrid plants was due to the nature of the selection schemes used or simply occurred by chance. The relevance of such somatic hybrid material for the study of genomic-cytoplasmic interaction is discussed, as well as the use of restriction endonuclease fragment patterns for the analysis of taxonomic and evolutionary inter-relationships in the genus Petunia.
Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M
1994-11-01
Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.
Genome-wide patterns of nucleotide polymorphism in domesticated rice
DEFF Research Database (Denmark)
Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D
2007-01-01
Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...
Rapid transfer of DNA from agarose gels to nylon membranes.
Reed, K C; Mann, D A
1985-01-01
The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...
Wang, Dan; Zhao, Jieyu; Bai, Yan; Ao, You; Guo, Changhong
2017-08-10
Gametocidal (Gc) chromosomes can ensure their preferential transmission by killing the gametes without themselves through causing chromosome breakage and therefore have been exploited as an effective tool for genetic breeding. However, to date very little is known about the molecular mechanism of Gc action. In this study, we used methylation-sensitive amplified polymorphism (MSAP) technique to assess the extent and pattern of cytosine methylation alterations at the whole genome level between two lines of wheat Gc addition line and their common wheat parent. The results indicated that the overall levels of cytosine methylation of two studied Gc addition lines (CS-3C and CS-3C3C, 48.68% and 48.65%, respectively) were significantly increased when compared to common wheat CS (41.31%) and no matter fully methylated or hemimethylated rates enhanced in Gc addition lines. A set of 30 isolated fragments that showed different DNA methylation or demethylation patterns between the three lines were sequenced and the results indicated that 8 fragments showed significant homology to known sequences, of which three were homologous to MITE transposon (Miniature inverted-repeat transposable elements), LTR-retrotransposon WIS-1p and retrotransposon Gypsy , respectively. Overall, our results showed that DNA methylation could play a role in the Gc action.
Directory of Open Access Journals (Sweden)
Dan Wang
2017-08-01
Full Text Available Gametocidal (Gc chromosomes can ensure their preferential transmission by killing the gametes without themselves through causing chromosome breakage and therefore have been exploited as an effective tool for genetic breeding. However, to date very little is known about the molecular mechanism of Gc action. In this study, we used methylation-sensitive amplified polymorphism (MSAP technique to assess the extent and pattern of cytosine methylation alterations at the whole genome level between two lines of wheat Gc addition line and their common wheat parent. The results indicated that the overall levels of cytosine methylation of two studied Gc addition lines (CS–3C and CS–3C3C, 48.68% and 48.65%, respectively were significantly increased when compared to common wheat CS (41.31% and no matter fully methylated or hemimethylated rates enhanced in Gc addition lines. A set of 30 isolated fragments that showed different DNA methylation or demethylation patterns between the three lines were sequenced and the results indicated that 8 fragments showed significant homology to known sequences, of which three were homologous to MITE transposon (Miniature inverted–repeat transposable elements, LTR-retrotransposon WIS-1p and retrotransposon Gypsy, respectively. Overall, our results showed that DNA methylation could play a role in the Gc action.
Biological activity of SV40 DNA
International Nuclear Information System (INIS)
Abrahams, P.J.
1978-01-01
This thesis deals with a study on the biological activity of SV40 DNA. The transforming activity of SV40 DNA and DNA fragments is investigated in order to define as precisely as possible the area of the viral genome that is involved in the transformation. The infectivity of SV40 DNA is used to study the defective repair mechanisms of radiation damages of human xeroderma pigmentosum cells. (C.F.)
DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.
Elmroth, Kecke; Stenerlöw, Bo
2005-04-01
The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.
Natural transformation of bacteria by fragmented, damaged and ancient DNA
DEFF Research Database (Denmark)
Overballe-Petersen, Søren
with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...
Carbon ion induced DNA double-strand breaks in melanophore B{sub 16}
Energy Technology Data Exchange (ETDEWEB)
Zengquan, Wei; Guangming, Zhou; Jufang, Wang; Jing, He; Qiang, Li; Wenjian, Li; Hongmei, Xie; Xichen, Cai; Huang, Tao; Bingrong, Dang; Guangwu, Han [Chinese Academy of Sciences, Lanzhou (China). Inst. of Modern Physics; Qingxiang, Gao [Lanzhou Univ. (China)
1997-09-01
DNA double-strand breaks (DSBs) in melanophore B{sub 16} induced by plateau and extended Bragg peak of 75 MeV/u {sup 12}C{sup 6+} ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B{sub 16}. Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau {proportional_to}85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)
Case, Cheryl; Kandola, Kami; Chui, Linda; Li, Vincent; Nix, Nancy; Johnson, Rhonda
2013-01-01
Tuberculosis (TB) is an important public health problem in the Northwest Territories (NWT), particularly among Canadian Aboriginal people. To analyse the transmission patterns of tuberculosis among the population living in the NWT, a territorial jurisdiction located within Northern Canada. This population-based retrospective study examined the DNA fingerprints of all laboratory confirmed cases of TB in the NWT, Canada, between 1990 and 2009. An isolate of each lab-confirmed case had genotyping done using IS6110 Restriction Fragment Length Polymorphism. DNA patterns were assigned to each DNA fingerprint, and indistinguishable fingerprints patterns were assigned a cluster. Social network analysis (SNA) was used to examine direct linkages among cases determined through conventional contact tracing (CCT), their DNA fingerprint and home community. Of the 225 lab-confirmed cases identified, the study was limited to 195 subjects due to DNA fingerprinting data availability. The mean age of the cases was 43.8 years (±22.6) and 120 (61.5%) males. The Dene (First Nations) encompassed 120 of the cases (87.7%), 8 cases (4.1%) were Inuit, 2 cases (1.0%) were Metis, 7 cases (3.6%) were Immigrants and 1 case had unknown ethnicity. One hundred and eighty six (95.4%) subjects were clustered, resulting in 8 clusters. Trend analysis showed significant relationships between with risk factors for unemployment (p=0.020), geographic location (p≤0.001) and homelessness (p≤0.001). Other significant risk factors included excessive alcohol consumption, prior infection with Mycobacterium tuberculosis and prior contact with a case of TB. This study demonstrates how DNA fingerprinting and SNA can be additional epidemiological tools, along with CCT method, to determine transmission patterns of TB.
How to open the treasure chest? Optimising DNA extraction from herbarium specimens.
Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T
2012-01-01
Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.
Hair Dye–DNA Interaction: Plausible Cause of Mutation
Directory of Open Access Journals (Sweden)
Swati Maiti
2015-09-01
Full Text Available Hair dye is one of the most popular cosmetic products which are used more widely and frequently to improve an individual’s appearance. Although the genotoxic effects of dye ingredients are widely reported, hair dye in its usable form is not reported extensively. In this contribution, we report the possible mode of interaction of hair dye with DNA which leads to genotoxicity. The effect of dye DNA interaction was studied on the most popular and globally used hair dye with Calf Thymus DNA and plasmid DNA. This interaction of dye DNA was studied by spectroscopic analyses and gel electrophoresis. The result had shown positive interaction of dye with DNA. Gel electrophoresis study confirms the binding of dye with DNA which results in linearization and fragmentation of the plasmid DNA. Dye–DNA interaction causes fragmentation and oxidation of DNA in absence of any catalyst, implies high toxicity of commercial hair dyes. Thus, it can be deduced from the present studies that hair dye in its usable form may lead to its penetration through skin affecting genomic DNA possesses genotoxic property and can be treated as one of the most common mutagen.
Use of RAPD and PCR double amplification in the study of ancient DNA
Directory of Open Access Journals (Sweden)
F. Balzano
2011-01-01
Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.
Ou, Xiufang; Zhang, Yunhong; Xu, Chunming; Lin, Xiuyun; Zang, Qi; Zhuang, Tingting; Jiang, Lili; von Wettstein, Diter; Liu, Bao
2012-01-01
DNA methylation is sensitive and responsive to stressful environmental conditions. Nonetheless, the extent to which condition-induced somatic methylation modifications can impose transgenerational effects remains to be fully understood. Even less is known about the biological relevance of the induced epigenetic changes for potentially altered well-being of the organismal progenies regarding adaptation to the specific condition their progenitors experienced. We analyzed DNA methylation pattern by gel-blotting at genomic loci representing transposable elements and protein-coding genes in leaf-tissue of heavy metal-treated rice (Oryza sativa) plants (S0), and its three successive organismal generations. We assessed expression of putative genes involved in establishing and/or maintaining DNA methylation patterns by reverse transcription (RT)-PCR. We measured growth of the stressed plants and their unstressed progenies vs. the control plants. We found (1) relative to control, DNA methylation patterns were modified in leaf-tissue of the immediately treated plants, and the modifications were exclusively confined to CHG hypomethylation; (2) the CHG-demethylated states were heritable via both maternal and paternal germline, albeit often accompanying further hypomethylation; (3) altered expression of genes encoding for DNA methyltransferases, DNA glycosylase and SWI/SNF chromatin remodeling factor (DDM1) were induced by the stress; (4) progenies of the stressed plants exhibited enhanced tolerance to the same stress their progenitor experienced, and this transgenerational inheritance of the effect of condition accompanying heritability of modified methylation patterns. Our findings suggest that stressful environmental condition can produce transgenerational epigenetic modifications. Progenies of stressed plants may develop enhanced adaptability to the condition, and this acquired trait is inheritable and accord with transmission of the epigenetic modifications. We suggest
Accurate phylogenetic classification of DNA fragments based onsequence composition
Energy Technology Data Exchange (ETDEWEB)
McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore
2006-05-01
Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.
Comparison of Suitability of the Most Common Ancient DNA Quantification Methods.
Brzobohatá, Kristýna; Drozdová, Eva; Smutný, Jiří; Zeman, Tomáš; Beňuš, Radoslav
2017-04-01
Ancient DNA (aDNA) extracted from historical bones is damaged and fragmented into short segments, present in low quantity, and usually copurified with microbial DNA. A wide range of DNA quantification methods are available. The aim of this study was to compare the five most common DNA quantification methods for aDNA. Quantification methods were tested on DNA extracted from skeletal material originating from an early medieval burial site. The tested methods included ultraviolet (UV) absorbance, real-time quantitative polymerase chain reaction (qPCR) based on SYBR ® green detection, real-time qPCR based on a forensic kit, quantification via fluorescent dyes bonded to DNA, and fragmentary analysis. Differences between groups were tested using a paired t-test. Methods that measure total DNA present in the sample (NanoDrop ™ UV spectrophotometer and Qubit ® fluorometer) showed the highest concentrations. Methods based on real-time qPCR underestimated the quantity of aDNA. The most accurate method of aDNA quantification was fragmentary analysis, which also allows DNA quantification of the desired length and is not affected by PCR inhibitors. Methods based on the quantification of the total amount of DNA in samples are unsuitable for ancient samples as they overestimate the amount of DNA presumably due to the presence of microbial DNA. Real-time qPCR methods give undervalued results due to DNA damage and the presence of PCR inhibitors. DNA quantification methods based on fragment analysis show not only the quantity of DNA but also fragment length.
DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...
African Journals Online (AJOL)
We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...
Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA
Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen
2010-01-01
This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…
Participation of ATM in cellular response to DNA damage induced by ionizing radiation
International Nuclear Information System (INIS)
Meng Xiangbing; Song Yi; Mao Jianping; Gong Bo; Dong Yan; Liu Bin; Sun Zhixian
2000-01-01
Objective: To clone ATM full length cDNA and cDNA fragments containing some functional domains and to identify proteins that interact with ATM and mediate DNA damage signal transduction in cellular response to DNA damage. Methods: ATM cDNA was amplified from MarthomTM-Ready cDNA kit of human leukocytes by LD-PCR. ATM-interacting proteins were screened by yeast two hybrid system. Results: ATM full-length cDNA and cDNA fragments containing PI3K kinase domain, leucine zipper and proline rich region were amplified from human cDNAs. Several candidate clones that interacted with ATM PI3K domain were identified. Conclusion: ATM mediates DNA damage signal transduction by interacting with many proteins
Energy Technology Data Exchange (ETDEWEB)
Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)
2005-10-01
This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.
Strong and nonlinear effects of fragmentation on ecosystem service provision at multiple scales
Mitchell, Matthew G. E.; Bennett, Elena M.; Gonzalez, Andrew
2015-09-01
Human actions, such as converting natural land cover to agricultural or urban land, result in the loss and fragmentation of natural habitat, with important consequences for the provision of ecosystem services. Such habitat loss is especially important for services that are supplied by fragments of natural land cover and that depend on flows of organisms, matter, or people across the landscape to produce benefits, such as pollination, pest regulation, recreation and cultural services. However, our quantitative knowledge about precisely how different patterns of landscape fragmentation might affect the provision of these types of services is limited. We used a simple, spatially explicit model to evaluate the potential impact of natural land cover loss and fragmentation on the provision of hypothetical ecosystem services. Based on current literature, we assumed that fragments of natural land cover provide ecosystem services to the area surrounding them in a distance-dependent manner such that ecosystem service flow depended on proximity to fragments. We modeled seven different patterns of natural land cover loss across landscapes that varied in the overall level of landscape fragmentation. Our model predicts that natural land cover loss will have strong and unimodal effects on ecosystem service provision, with clear thresholds indicating rapid loss of service provision beyond critical levels of natural land cover loss. It also predicts the presence of a tradeoff between maximizing ecosystem service provision and conserving natural land cover, and a mismatch between ecosystem service provision at landscape versus finer spatial scales. Importantly, the pattern of landscape fragmentation mitigated or intensified these tradeoffs and mismatches. Our model suggests that managing patterns of natural land cover loss and fragmentation could help influence the provision of multiple ecosystem services and manage tradeoffs and synergies between services across different human
∆DNMT3B4-del Contributes to Aberrant DNA Methylation Patterns in Lung Tumorigenesis
Directory of Open Access Journals (Sweden)
Mark Z. Ma
2015-10-01
Full Text Available Aberrant DNA methylation is a hallmark of cancer but mechanisms contributing to the abnormality remain elusive. We have previously shown that ∆DNMT3B is the predominantly expressed form of DNMT3B. In this study, we found that most of the lung cancer cell lines tested predominantly expressed DNMT3B isoforms without exons 21, 22 or both 21 and 22 (a region corresponding to the enzymatic domain of DNMT3B termed DNMT3B/∆DNMT3B-del. In normal bronchial epithelial cells, DNMT3B/ΔDNMT3B and DNMT3B/∆DNMT3B-del displayed equal levels of expression. In contrast, in patients with non-small cell lung cancer NSCLC, 111 (93% of the 119 tumors predominantly expressed DNMT3B/ΔDNMT3B-del, including 47 (39% tumors with no detectable DNMT3B/∆DNMT3B. Using a transgenic mouse model, we further demonstrated the biological impact of ∆DNMT3B4-del, the ∆DNMT3B-del isoform most abundantly expressed in NSCLC, in global DNA methylation patterns and lung tumorigenesis. Expression of ∆DNMT3B4-del in the mouse lungs resulted in an increased global DNA hypomethylation, focal DNA hypermethylation, epithelial hyperplastia and tumor formation when challenged with a tobacco carcinogen. Our results demonstrate ∆DNMT3B4-del as a critical factor in developing aberrant DNA methylation patterns during lung tumorigenesis and suggest that ∆DNMT3B4-del may be a target for lung cancer prevention.
Energy Technology Data Exchange (ETDEWEB)
Benlliure, J
1995-03-01
The study of moments of fragments charge distributions produced in heavy ions collisions can give us evidence of a critical behavior of nuclear matter which could explain the multifragmentation pattern. From an experimental point of view, in order to perform this capabilities of the INDRA detector has made it possible to identify all these particles and to reconstruct the initial projectile-like fragment coming from binary collisions in the reaction Xe+Sn at 50 MeV/A. We have selected events where the initial projectile-like fragments keep their entire charge in a large range of excitation energy. The study of these fragment`s characteristics show clearly a change in the deexcitation pattern. The evolution of moments of the fragment charge distributions has been reproduced within a percolation model, in this sense we can interpreter this change in the deexcitation pattern as a function of the initial projectile-like fragment`s size shows the existence of finite-size effects. However, the signature of a phase transition remains independent on the projectile-like fragment`s size. (author). 74 refs., 58 figs., 9 tabs.
Bhardwaj, Jyoti; Mahajan, Monika; Yadav, Sudesh Kumar
2013-08-01
DNA methylation is known as an epigenetic modification that affects gene expression in plants. Variation in CpG methylation behavior was studied in two natural horse gram (Macrotyloma uniflorum [Lam.] Verdc.) genotypes, HPKC2 (drought-sensitive) and HPK4 (drought-tolerant). The methylation pattern in both genotypes was studied through methylation-sensitive amplified polymorphism. The results revealed that methylation was higher in HPKC2 (10.1%) than in HPK4 (8.6%). Sequencing demonstrated sequence homology with the DRE binding factor (cbf1), the POZ/BTB protein, and the Ty1-copia retrotransposon among some of the polymorphic fragments showing alteration in methylation behavior. Differences in DNA methylation patterns could explain the differential drought tolerance and the epigenetic signature of these two horse gram genotypes.
A Mimicking-of-DNA-Methylation-Patterns Pipeline for Overcoming the Restriction Barrier of Bacteria
Zhang, Guoqiang; Wang, Wenzhao; Deng, Aihua; Sun, Zhaopeng; Zhang, Yun; Liang, Yong; Che, Yongsheng; Wen, Tingyi
2012-01-01
Genetic transformation of bacteria harboring multiple Restriction-Modification (R-M) systems is often difficult using conventional methods. Here, we describe a mimicking-of-DNA-methylation-patterns (MoDMP) pipeline to address this problem in three difficult-to-transform bacterial strains. Twenty-four putative DNA methyltransferases (MTases) from these difficult-to-transform strains were cloned and expressed in an Escherichia coli strain lacking all of the known R-M systems and orphan MTases. Thirteen of these MTases exhibited DNA modification activity in Southwestern dot blot or Liquid Chromatography–Mass Spectrometry (LC–MS) assays. The active MTase genes were assembled into three operons using the Saccharomyces cerevisiae DNA assembler and were co-expressed in the E. coli strain lacking known R-M systems and orphan MTases. Thereafter, results from the dot blot and restriction enzyme digestion assays indicated that the DNA methylation patterns of the difficult-to-transform strains are mimicked in these E. coli hosts. The transformation of the Gram-positive Bacillus amyloliquefaciens TA208 and B. cereus ATCC 10987 strains with the shuttle plasmids prepared from MoDMP hosts showed increased efficiencies (up to four orders of magnitude) compared to those using the plasmids prepared from the E. coli strain lacking known R-M systems and orphan MTases or its parental strain. Additionally, the gene coding for uracil phosphoribosyltransferase (upp) was directly inactivated using non-replicative plasmids prepared from the MoDMP host in B. amyloliquefaciens TA208. Moreover, the Gram-negative chemoautotrophic Nitrobacter hamburgensis strain X14 was transformed and expressed Green Fluorescent Protein (GFP). Finally, the sequence specificities of active MTases were identified by restriction enzyme digestion, making the MoDMP system potentially useful for other strains. The effectiveness of the MoDMP pipeline in different bacterial groups suggests a universal potential
Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase
International Nuclear Information System (INIS)
Heller, E.P.; Goldthwait, D.A.
1983-01-01
Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair
Synthesis, Characterization and DNA Cleavage of Copper(II ...
African Journals Online (AJOL)
Keywords: DNA shearing, Copper(II) complex, Dithiothreitol, Attenuated total reflectance-Fourier transform .... confirm the fragmentation of DNA by the newly .... sperm. Biochem Biophys Acta 1986; 884: 124-134. 7. Cornell NW, Crivaro KE.
International Nuclear Information System (INIS)
Jacob, R.J.
1984-01-01
Human embryonic lung cells were pre-equilibrated with phosphonoacetate and 32 P orthophosphate label, then infected with phosphonoacetate-sensitive herpes simplex virus (HSV) type 1. Analyses of viral DNA produced in these cells showed the following. i) Viral DNA was synthesized in infected cells exposed to 100 μg of the drug per ml of medium but not in cells exposed to four-fold higher concentrations of the drug. ii) At 300 μg/ml a region of the DNA between 0.58 and 0.69 map units became transiently labeled, but the restriction endonuclease fragment containing these sequences migrated more slowly than the corresponding fragment from virion DNA. iii) Viral DNA extracted from infected cells 1.5 hours post drug withdrawal (300 μg/ml) was preferentially labeled in 2 regions of the genome mapping between 0.17 and 0.23 and 0.58-0.69 map units. This finding is in agreement with a report of Friedman et al. suggesting that HSV DNA contains two different sites if initiation. In addition a 4.8 x 10 6 molecular weight fragment was also preferentially labeled. This fragment could represent a smaller, aberrantly migrating fragment from the 0.17-0.27 map unit region of the DNA. iv) Viral DNA extracted from infected cells at longer intervals after drug withdrawal showed an increasing gradient of radioactivity progressively labeling the genome. These results are consistent with the hypothesis that viral DNA has at least two sites of initiation of DNA synthesis and that both sites are within the L component of the DNA. Alternatively, the results could be interpreted as two sites of localized synthesis (repair) that are detected at high concentrations of phosphonoacetate and immediately following reversal of inhibition of DNA synthesis. The results do not exclude the possibility that secondary sites in both L and S are utilized late in infection or in untreated cells. (Author)
Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J
2007-01-01
JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.
Molecular mechanisms of DNA photodamage
Energy Technology Data Exchange (ETDEWEB)
Starrs, S.M
2000-05-01
Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA){sub n} and (GA){sub n}, and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a
DEFF Research Database (Denmark)
Christensen, Laurids Siig
1988-01-01
Eleven European isolates of Suid herpesvirus type 1 (SHV-1) were compared by restriction fragment pattern analyses and Southern blot hybridization using different genomic probes. The presence of strain discriminative 4 major genome types and several subtypes as well as the molecular distinctions...
Directory of Open Access Journals (Sweden)
Zhou Sun
2012-05-01
Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned
Interactions of tetracationic porphyrins with DNA and their effects on DNA cleavage
Lebedeva, Natalya Sh.; Yurina, Elena S.; Gubarev, Yury A.; Syrbu, Sergey A.
2018-06-01
The interaction of tetracationic porphyrins with DNA was studied using UV-Vis absorption, fluorescence spectroscopy and viscometry, and the particle sizes were determined. Аs cationic porphyrins, two isomer porphyrins, 3,3‧,3″,3‴-(5,10,15,20-Porphyrintetrayl)tetrakis(1-methylpyridinium) (TMPyP3) and 4,4‧,4″,4‴-(5,10,15,20-Porphyrintetrayl)tetrakis(1-methylpyridinium) (TMPyP4), were studied. They differ in the position of NCH3+ group in phenyl ring of the porphyrins and hence, in degree of freedom of rotation of the phenyl rings about the central macrocycle. It was found that intercalated complexes are formed at DNA/porphyrin molar ratios (R) of 2.2 and 3.9 for TMPyP3 и TMPyP4, respectively. Decreasing R up to 0.4 and 0.8 for TMPyP3 и TMPyP4, respectively, leads mainly to formation of outside complexes due to π-π stacking between the porphyrin chromophores interacting electrostatically with phosphate framework of DNA. Each type of the obtained complexes was characterized using Scatchard approach. It was ascertained that the affinity of TMPyP4 to DNA is stronger than TMPyP3, meanwhile the wedge effect of the latter is higher. The differences between the porphyrin isomers become more evident at irradiation of their complexes with DNA. It was established that irradiation of the intercalated complexes results in DNA fragmentation. In the case of TMPyP4, DNA fragments of different size are formed. The irradiation of the outside DNA/porphyrin complexes leads to cleavage of DNA (TMPyP3 and TMPyP4) and partial destruction of the complex due to photolysis of the porphyrin (TMPyP3).
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
Directory of Open Access Journals (Sweden)
EMJ. Costa
Full Text Available The Parque Estadual do Prosa (PEP, in Campo Grande, MS, is an urban fragment of savanna (cerrado and tall savanna woodland (cerradão, with an area of 1,335 km², where the population density of brown-nosed coatis is 33.71 individuals/km². Our results suggest that seasonality at the PEP causes changes in the availability of resources for coatis, altering their home range areas, their dispersion patterns and their daily behaviour. And our observations regarding male-band associations, agonistic interactions between bands and their daily behaviour emphasize the plasticity of coati social structure, and its potential for future comparative studies.
Directory of Open Access Journals (Sweden)
Gusti Ngurah Permana
2016-11-01
The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.
Dynamics and instabilities in nuclear fragmentation
International Nuclear Information System (INIS)
Colonna, M.; Guarnera, A.; Di Toro, M.; Latora, V.; Smerzi, A.; Catania Univ.
1993-01-01
A general procedure to identify instability regions which lead to multifragmentation events is presented. The method covers all possible sources of dynamical instabilities. Informations on the instability point, like the time when the nuclear system enters the critical region, the most unstable modes and the time constant of the exponential growing of the relative variances, are deduced without any numerical bias. Important memory effects in the fragmentation pattern are revealed. Some hints towards a fully dynamical picture of fragmentation processes are finally suggested. (author) 7 refs., 3 figs
LINKAGE ANALYSIS BY 2-DIMENSIONAL DNA TYPING
MEERMAN, GJT; MULLAART, E; VANDERMEULEN, MA; DENDAAS, JHG; MOROLLI, B; UITTERLINDEN, AG; VIJG, J
1993-01-01
In two-dimensional (2-D) DNA typing, genomic DNA fragments are separated, first according to size by electrophoresis in a neutral polyacrylamide gel and second according to sequence by denaturing gradient gel electrophoresis, followed by hybridization analysis using micro- and minisatellite core
Linkage analysis by two-dimensional DNA typing
te Meerman, G J; Mullaart, E; Meulen ,van der Martin; den Daas, J H; Morolli, B; Uitterlinden, A G; Vijg, J
1993-01-01
In two-dimensional (2-D) DNA typing, genomic DNA fragments are separated, first according to size by electrophoresis in a neutral polyacrylamide gel and second according to sequence by denaturing gradient gel electrophoresis, followed by hybridization analysis using micro- and minisatellite core
Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T
2018-05-30
We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.
Chromatin Constrains the Initiation and Elongation of DNA Replication.
Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk
2017-01-05
Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.
Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency
Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.
2009-01-01
Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on
Inácio, Vera; Barros, Pedro M; Costa, Augusta; Roussado, Cristóvão; Gonçalves, Elsa; Costa, Rita; Graça, José; Oliveira, M Margarida; Morais-Cecílio, Leonor
2017-01-01
DNA methylation is thought to influence Quercus suber cork quality, which is the main constraint for its economic valorisation. However, a deep knowledge of the cytosine methylation patterns disclosing the epigenetic variability of trees with different cork quality types is totally missing. This study investigates the hypothesis that variations in DNA methylation contribute to differences in cork cellular characteristics directly related to original or traumatic phellogen activity. We used MSAPs (Methylation Sensitive Amplified Polymorphism) to assess DNA methylation patterns of cork and leaf tissues of Q. suber adult trees growing in three cork oak stands. The relationship between the detected polymorphisms and the diversity of cork quality traits was explored by a marker-trait analysis focusing on the most relevant quality characteristics. Populations differed widely in cork quality, but only slightly in degree of epigenetic differentiation. Four MSAP markers (1.3% of the total) were significantly associated with the most noteworthy quality traits: wood inclusions (nails) and porosity. This evidence supports the potential role of cytosine methylation in the modulation of differential phellogen activity either involved in localized cell death or in pore production, resulting in different cork qualities. Although, the underlying basis of the methylation polymorphism of loci affecting cork quality traits remain unclear, the disclosure of markers statistically associated with cork quality strengthens the potential role of DNA methylation in the regulation of these traits, namely at the phellogen level.
Recurrence plot analysis of DNA sequences
Energy Technology Data Exchange (ETDEWEB)
Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn
2004-11-15
Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.
Break-up fragment topology in statistical multifragmentation models
International Nuclear Information System (INIS)
Raduta, Ad. R.
2009-01-01
Break-up fragmentation patterns together with kinetic and configurational energy fluctuations are investigated in the framework of a microcanonical model with fragment degrees of freedom over a broad excitation energy range. As long as fragment partitioning is approximately preserved, energy fluctuations are found to be rather insensitive to both the way in which the freeze-out volume is constrained and the trajectory followed by the system in the excitation-energy-freeze-out volume space. Due to hard-core repulsion, the freeze-out volume is found to be populated nonuniformly, its highly depleted core giving the source a bubble-like structure. The most probable localization of the largest fragments in the freeze-out volume may be inferred experimentally from their kinematic properties, largely dictated by Coulomb repulsion.
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
De Lena, M; Romero, A; Rabinovich, M; Leone, B; Vallejo, C; Machiavelli, M; Cuevas, M; Rodriguez, R; Lacava, J; Perez, J
1993-06-01
Sixty-nine patients with metastatic breast cancer (MBC) at initial diagnosis were analyzed to verify if metastatic pattern and clinical outcome are related to DNA ploidy determined by flow cytometry (FCM). Characteristics of 55 fully evaluable patients were as follows: median age: 61 years; postmenopausal: 75%; bone-only metastases (BM): 60%; extraosseous-only metastases (EM): 40%. Overall response rates (CR + PR) obtained with different chemotherapies and/or hormonal therapies were 58% and 68% for patients with BM and EM, respectively. Sixty percent of specimens resulted aneuploid, and the mean coefficient of variation of the complete series was 5.1%. In the whole group of patients DNA ploidy of primary tumor did not predict the metastatic pattern and had no influence upon response to treatment, duration of response, time to progression, and overall survival. When analyses were carried out according to metastatic pattern, those patients with BM showed similar results. However, within the group with EM, those with diploid tumors presented a significantly better survival (median 18 vs 13 months, p = .04). FCM-DNA analysis seems to identify a subgroup of patients with poor prognosis constituted by those who had aneuploid primary tumors and metastases to extraosseous sites.
International Nuclear Information System (INIS)
Pramanik, P.; Kanhouwa, N.; Kan, L.
1988-01-01
Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported
Improved DNA electrophoresis in conditions favoring polyborates and lewis acid complexation.
Directory of Open Access Journals (Sweden)
Hari Singhal
2010-06-01
Full Text Available Spatial compression among the longer DNA fragments occurs during DNA electrophoresis in agarose and non-agarose gels when using certain ions in the conductive buffer, impairing the range of fragment sizes resolved well in a single gel. Substitutions using various polyhydroxyl anions supported the underlying phenomenon as the complexation of Lewis acids to DNA. We saw significant improvements using conditions (lithium borate 10 mM cations, pH 6.5 favoring the formation of borate polyanions and having lower conductance and Joule heating, delayed electrolyte exhaustion, faster electrophoretic run-speed, and sharper separation of DNA bands from 100 bp to 12 kb in a single run.
Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1
International Nuclear Information System (INIS)
Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui
2011-01-01
Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)
Fragment approaches in structure-based drug discovery
International Nuclear Information System (INIS)
Hubbard, Roderick E.
2008-01-01
Fragment-based methods are successfully generating novel and selective drug-like inhibitors of protein targets, with a number of groups reporting compounds entering clinical trials. This paper summarizes the key features of the approach as one of the tools in structure-guided drug discovery. There has been considerable interest recently in what is known as 'fragment-based lead discovery'. The novel feature of the approach is to begin with small low-affinity compounds. The main advantage is that a larger potential chemical diversity can be sampled with fewer compounds, which is particularly important for new target classes. The approach relies on careful design of the fragment library, a method that can detect binding of the fragment to the protein target, determination of the structure of the fragment bound to the target, and the conventional use of structural information to guide compound optimization. In this article the methods are reviewed, and experiences in fragment-based discovery of lead series of compounds against kinases such as PDK1 and ATPases such as Hsp90 are discussed. The examples illustrate some of the key benefits and issues of the approach and also provide anecdotal examples of the patterns seen in selectivity and the binding mode of fragments across different protein targets
cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications.
Wani, Gowher A; Shah, Manzoor A; Reshi, Zafar A; Atangana, Alain R; Khasa, Damase P
2014-07-01
A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.
Necessity of purification during bacterial DNA extraction with environmental soils
Directory of Open Access Journals (Sweden)
Hyun Jeong Lim
2017-08-01
Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.
Development of biometric DNA ink for authentication security.
Hashiyada, Masaki
2004-10-01
Among the various types of biometric personal identification systems, DNA provides the most reliable personal identification. It is intrinsically digital and unchangeable while the person is alive, and even after his/her death. Increasing the number of DNA loci examined can enhance the power of discrimination. This report describes the development of DNA ink, which contains synthetic DNA mixed with printing inks. Single-stranded DNA fragments encoding a personalized set of short tandem repeats (STR) were synthesized. The sequence was defined as follows. First, a decimal DNA personal identification (DNA-ID) was established based on the number of STRs in the locus. Next, this DNA-ID was encrypted using a binary, 160-bit algorithm, using a hashing function to protect privacy. Since this function is irreversible, no one can recover the original information from the encrypted code. Finally, the bit series generated above is transformed into base sequences, and double-stranded DNA fragments are amplified by the polymerase chain reaction (PCR) to protect against physical attacks. Synthesized DNA was detected successfully after samples printed in DNA ink were subjected to several resistance tests used to assess the stability of printing inks. Endurance test results showed that this DNA ink would be suitable for practical use as a printing ink and was resistant to 40 hours of ultraviolet exposure, performance commensurate with that of photogravure ink. Copyright 2004 Tohoku University Medical Press
Genomic and gene variation in Mycoplasma hominis strains
DEFF Research Database (Denmark)
Christiansen, Gunna; Andersen, H; Birkelund, Svend
1987-01-01
DNAs from 14 strains of Mycoplasma hominis isolated from various habitats, including strain PG21, were analyzed for genomic heterogeneity. DNA-DNA filter hybridization values were from 51 to 91%. Restriction endonuclease digestion patterns, analyzed by agarose gel electrophoresis, revealed...... no identity or cluster formation between strains. Variation within M. hominis rRNA genes was analyzed by Southern hybridization of EcoRI-cleaved DNA hybridized with a cloned fragment of the rRNA gene from the mycoplasma strain PG50. Five of the M. hominis strains showed identical hybridization patterns....... These hybridization patterns were compared with those of 12 other mycoplasma species, which showed a much more complex band pattern. Cloned nonribosomal RNA gene fragments of M. hominis PG21 DNA were analyzed, and the fragments were used to demonstrate heterogeneity among the strains. A monoclonal antibody against...
Eukaryotic DNA Replication Fork.
Burgers, Peter M J; Kunkel, Thomas A
2017-06-20
This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.
Use of DNA markers in forest tree improvement research
D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall
1992-01-01
DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...
Directory of Open Access Journals (Sweden)
Dessie Salilew-Wondim
Full Text Available Early embryonic loss and altered gene expression in in vitro produced blastocysts are believed to be partly caused by aberrant DNA methylation. However, specific embryonic stage which is sensitive to in vitro culture conditions to alter the DNA methylation profile of the resulting blastocysts remained unclear. Therefore, the aim of this study was to investigate the stage specific effect of in vitro culture environment on the DNA methylation response of the resulting blastocysts. For this, embryos cultured in vitro until zygote (ZY, 4-cell (4C or 16-cell (16C were transferred to recipients and the blastocysts were recovery at day 7 of the estrous cycle. Another embryo group was cultured in vitro until blastocyst stage (IVP. Genome-wide DNA methylation profiles of ZY, 4C, 16C and IVP blastocyst groups were then determined with reference to blastocysts developed completely under in vivo condition (VO using EmbryoGENE DNA Methylation Array. To assess the contribution of methylation changes on gene expression patterns, the DNA methylation data was superimposed to the transcriptome profile data. The degree of DNA methylation dysregulation in the promoter and/or gene body regions of the resulting blastocysts was correlated with successive stages of development the embryos advanced under in vitro culture before transfer to the in vivo condition. Genomic enrichment analysis revealed that in 4C and 16C blastocyst groups, hypermethylated loci were outpacing the hypomethylated ones in intronic, exonic, promoter and proximal promoter regions, whereas the reverse was observed in ZY blastocyst group. However, in the IVP group, as much hypermethylated as hypomethylated probes were detected in gene body and promoter regions. In addition, gene ontology analysis indicated that differentially methylated regions were found to affected several biological functions including ATP binding in the ZY group, programmed cell death in the 4C, glycolysis in 16C and genetic
Copani, Agata; Hoozemans, Jeroen J. M.; Caraci, Filippo; Calafiore, Marco; van Haastert, Elise S.; Veerhuis, Robert; Rozemuller, Annemieke J. M.; Aronica, Eleonora; Sortino, Maria Angela; Nicoletti, Ferdinando
2006-01-01
Cultured neurons exposed to synthetic beta-amyloid (Abeta) fragments reenter the cell cycle and initiate a pathway of DNA replication that involves the repair enzyme DNA polymerase-beta (DNA pol-beta) before undergoing apoptotic death. In this study, by performing coimmunoprecipitation experiments
DNA polymorphism of HLA class II genes in systemic lupus erythematosus
DEFF Research Database (Denmark)
Cowland, J B; Andersen, V; Halberg, P
1994-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3......- and DRw6-associated 7.00 kb DRB TaqI DNA fragment was found in SLE patients compared to normal controls (83.3% vs 35.5%; RR = 9.1, p 1*0501-associated 4.56 kb DQA TaqI fragment and the DRB3*01/03-associated 9.79 kb TaqI fragment were also found to be significantly...... increased in SLE patients (70.8% vs 29.7%; RR = 5.8, p 1%; RR = 4.3, p
DNA fingerprinting of pearls to determine their origins.
Directory of Open Access Journals (Sweden)
Joana B Meyer
Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.
Directory of Open Access Journals (Sweden)
Itai Gat
Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.
Bugno-Poniewierska, Monika; Solek, Przemysław; Wronski, Mariusz; Potocki, Leszek; Jezewska-Witkowska, Grażyna; Wnuk, Maciej
2014-12-01
The molecular structure of B chromosomes (Bs) is relatively well studied. Previous research demonstrates that Bs of various species usually contain two types of repetitive DNA sequences, satellite DNA and ribosomal DNA, but Bs also contain genes encoding histone proteins and many others. However, many questions remain regarding the origin and function of these chromosomes. Here, we focused on the comparative cytogenetic characteristics of the red fox and Chinese raccoon dog B chromosomes with particular attention to the distribution of repetitive DNA sequences and their methylation status. We confirmed that the small Bs of the red fox show a typical fluorescent telomeric distal signal, whereas medium-sized Bs of the Chinese raccoon dog were characterized by clusters of telomeric sequences along their length. We also found different DNA methylation patterns for the B chromosomes of both species. Therefore, we concluded that DNA methylation may maintain the transcriptional inactivation of DNA sequences localized to B chromosomes and may prevent genetic unbalancing and several negative phenotypic effects. © 2014 The Authors.
Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction
International Nuclear Information System (INIS)
Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang
2002-01-01
The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor
Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction
Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang
2002-12-01
The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.
Patterns of exchange of forensic DNA data in the European Union through the Prüm system.
Santos, Filipe; Machado, Helena
2017-07-01
This paper presents a study of the 5-year operation (2011-2015) of the transnational exchange of forensic DNA data between Member States of the European Union (EU) for the purpose of combating cross-border crime and terrorism within the so-called Prüm system. This first systematisation of the full official statistical dataset provides an overall assessment of the match figures and patterns of operation of the Prüm system for DNA exchange. These figures and patterns are analysed in terms of the differentiated contributions by participating EU Member States. The data suggest a trend for West and Central European countries to concentrate the majority of Prüm matches, while DNA databases of Eastern European countries tend to contribute with profiles of people that match stains in other countries. In view of the necessary transparency and accountability of the Prüm system, more extensive and informative statistics would be an important contribution to the assessment of its functioning and societal benefits. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet
2004-01-01
The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component of oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication
Cui, Xiaoyan; Sun, Can; Zhao, Pei; Wang, Yanyan; Guo, Yanchun; Zhao, Yufen; Cao, Shuxia
2018-04-01
The fragmentation pathways of pentacoordinated phenoxyspirophosphoranes were investigated in the positive mode by electrospray ionization multistage mass spectrometry. The results demonstrate that the sodium adducts of the title compounds undergo two competitive fragmentation pathways, and the fragmentation patterns are heavily dependent on the various substituent patterns at the phenolic group. An electron-withdrawing substituent at the ortho-position always results in the removal of a corresponding phenol analogue, while cleavage by spiroring opening becomes the predominant fragmentation pathway if an electron-donating substituent is at the phenolic group. The substituent effects on the competitive fragmentation pathways were further elucidated by theoretical calculations, single crystal structure analysis, and high-resolution mass spectrometry. The results contribute to the understanding of the gas-phase fragmentation reactions and the structure identification of spirophosphorane analogues by electrospray ionization multistage mass spectrometry. Copyright © 2018 John Wiley & Sons, Ltd.
RAD51 interconnects between DNA replication, DNA repair and immunity.
Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame
2017-05-05
RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
Ali, M. S.; Latif, Z.
2016-01-01
Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Directory of Open Access Journals (Sweden)
José Gregorio Martínez
2012-09-01
Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M
1996-05-16
A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.
Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad
2017-09-01
Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed
Directory of Open Access Journals (Sweden)
Athma A Pai
2011-02-01
Full Text Available The modification of DNA by methylation is an important epigenetic mechanism that affects the spatial and temporal regulation of gene expression. Methylation patterns have been described in many contexts within and across a range of species. However, the extent to which changes in methylation might underlie inter-species differences in gene regulation, in particular between humans and other primates, has not yet been studied. To this end, we studied DNA methylation patterns in livers, hearts, and kidneys from multiple humans and chimpanzees, using tissue samples for which genome-wide gene expression data were also available. Using the multi-species gene expression and methylation data for 7,723 genes, we were able to study the role of promoter DNA methylation in the evolution of gene regulation across tissues and species. We found that inter-tissue methylation patterns are often conserved between humans and chimpanzees. However, we also found a large number of gene expression differences between species that might be explained, at least in part, by corresponding differences in methylation levels. In particular, we estimate that, in the tissues we studied, inter-species differences in promoter methylation might underlie as much as 12%-18% of differences in gene expression levels between humans and chimpanzees.
Metagenome Fragment Classification Using -Mer Frequency Profiles
Directory of Open Access Journals (Sweden)
Gail Rosen
2008-01-01
Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.
Directory of Open Access Journals (Sweden)
James C Carolan
Full Text Available Cryptic diversity within bumblebees (Bombus has the potential to undermine crucial conservation efforts designed to reverse the observed decline in many bumblebee species worldwide. Central to such efforts is the ability to correctly recognise and diagnose species. The B. lucorum complex (Bombus lucorum, B. cryptarum and B. magnus comprises one of the most abundant and important group of wild plant and crop pollinators in northern Europe. Although the workers of these species are notoriously difficult to diagnose morphologically, it has been claimed that queens are readily diagnosable from morphological characters. Here we assess the value of colour-pattern characters in species identification of DNA-barcoded queens from the B. lucorum complex. Three distinct molecular operational taxonomic units were identified each representing one species. However, no uniquely diagnostic colour-pattern character state was found for any of these three molecular units and most colour-pattern characters showed continuous variation among the units. All characters previously deemed to be unique and diagnostic for one species were displayed by specimens molecularly identified as a different species. These results presented here raise questions on the reliability of species determinations in previous studies and highlights the benefits of implementing DNA barcoding prior to ecological, taxonomic and conservation studies of these important key pollinators.
DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids
Directory of Open Access Journals (Sweden)
Emad A. Ahmed
2015-12-01
Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.
Fragmentation of forest, grassland, and shrubland
Kurt H. Riitters
2013-01-01
As humans introduce competing land uses into natural landscapes, the public concerns regarding landcover patterns are expressed through headline issues such as urban sprawl, forest fragmentation, water quality, and wilderness preservation. The spatial arrangement of an environment affects all human perceptions and ecological processes within that environment, but this...
Evaluation of irradiation in foods using DNA comet assay
International Nuclear Information System (INIS)
Khawar, Affaf; Bhatti, Ijaz Ahmad; Khan, Q.M.; Ali, T.; Khan, A.I.; Asi, M.R.
2011-01-01
Comet assay is a rapid, inexpensive and sensitive biological technique to detect DNA damage in food stuffs by irradiation. In this study the Comet assay is applied on foods of plant and animal origins. Samples were irradiated by using 60 Co gamma-radiation source. The applied doses were 2, 6 and 10 kGy for food of plant origin and 0.5, 1 and 2 kGy for meat items. The un-irradiated and irradiated samples were clearly differentiated on the basis of DNA fragmentation. During the electrophoresis study, it was found that in un-irradiated cells DNA remained intact and appeared as Comets without tail whereas in irradiated cells Comets with tails were visible due to stretching of fragmented DNA. Moreover, it was also revealed that the DNA tail length was dose dependent. Dry food stuffs (seeds) showed good results as compared to moist foods (meat, fruits and vegetables) due to the absence of background damage. (author)
Mechanisms Affecting Population Density in Fragmented Habitat
Directory of Open Access Journals (Sweden)
Lutz Tischendorf
2005-06-01
Full Text Available We conducted a factorial simulation experiment to analyze the relative importance of movement pattern, boundary-crossing probability, and mortality in habitat and matrix on population density, and its dependency on habitat fragmentation, as well as inter-patch distance. We also examined how the initial response of a species to a fragmentation event may affect our observations of population density in post-fragmentation experiments. We found that the boundary-crossing probability from habitat to matrix, which partly determines the emigration rate, is the most important determinant for population density within habitat patches. The probability of crossing a boundary from matrix to habitat had a weaker, but positive, effect on population density. Movement behavior in habitat had a stronger effect on population density than movement behavior in matrix. Habitat fragmentation and inter-patch distance may have a positive or negative effect on population density. The direction of both effects depends on two factors. First, when the boundary-crossing probability from habitat to matrix is high, population density may decline with increasing habitat fragmentation. Conversely, for species with a high matrix-to-habitat boundary-crossing probability, population density may increase with increasing habitat fragmentation. Second, the initial distribution of individuals across the landscape: we found that habitat fragmentation and inter-patch distance were positively correlated with population density when individuals were distributed across matrix and habitat at the beginning of our simulation experiments. The direction of these relationships changed to negative when individuals were initially distributed across habitat only. Our findings imply that the speed of the initial response of organisms to habitat fragmentation events may determine the direction of observed relationships between habitat fragmentation and population density. The time scale of post-fragmentation
Note: Primer Amysat 001; Fragment size is 211bp
Indian Academy of Sciences (India)
Renuka
Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.
Isolation of a sex-linked DNA sequence in cranes.
Duan, W; Fuerst, P A
2001-01-01
A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.
Differential expression analysis of genic male sterility by cDNA-AFLP in maize
International Nuclear Information System (INIS)
Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju
2009-01-01
The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)
Martin, Christiana; Cho, Young-Eun; Kim, Hyungsuk; Yun, Sijung; Kanefsky, Rebekah; Lee, Hyunhwa; Mysliwiec, Vincent; Cashion, Ann; Gill, Jessica
2018-05-01
Military personnel experience posttraumatic stress disorder (PTSD), which is associated with differential DNA methylation across the whole genome. However, the relationship between these DNA methylation patterns and clinically relevant increases in PTSD severity is not yet clearly understood. The purpose of this study was to identify differences in DNA methylation associated with PTSD symptoms and investigate DNA methylation changes related to increases in the severity of PTSD in military personnel. In this pilot study, a cross-sectional comparison was made between military personnel with PTSD (n = 8) and combat-matched controls without PTSD (n = 6). Symptom measures were obtained, and genome-wide DNA methylation was measured using methylated DNA immunoprecipitation (MeDIP-seq) from whole blood samples at baseline and 3 months later. A longitudinal comparison measured DNA methylation changes in military personnel with clinically relevant increases in PTSD symptoms between time points (PTSD onset) and compared methylation patterns to controls with no clinical changes in PTSD. In military personnel with elevated PTSD symptoms 3 months following baseline, 119 genes exhibited reduced methylation and 8 genes exhibited increased methylation. Genes with reduced methylation in the PTSD-onset group relate to the canonical pathways of netrin signaling, Wnt/Ca + pathway, and axonal guidance signaling. These gene pathways relate to neurological disorders, and the current findings suggest that these epigenetic changes potentially relate to PTSD symptomology. This study provides some novel insights into the role of epigenetic changes in PTSD symptoms and the progression of PTSD symptoms in military personnel.
Kostetskiĭ, P V; Dobrova, I E
1988-04-01
An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.
Rathore, Mangal S; Jha, Bhavanath
2016-03-01
The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.
Automation of a single-DNA molecule stretching device
DEFF Research Database (Denmark)
Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels
2015-01-01
We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...