Luciferase assay to study the activity of a cloned promoter DNA fragment.
Solberg, Nina; Krauss, Stefan
2013-01-01
Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.
Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L
2018-04-12
Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.
DNA fragmentation in spermatozoa
DEFF Research Database (Denmark)
Rex, A S; Aagaard, J.; Fedder, J
2017-01-01
Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...
International Nuclear Information System (INIS)
Evenson, Donald P.; Wixon, Regina
2005-01-01
Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated
Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.
Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh
2016-04-01
Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.
International Nuclear Information System (INIS)
Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert
1987-01-01
The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)
Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage
Directory of Open Access Journals (Sweden)
Carol Coughlan
2015-01-01
Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.
Fragmentation of sperm DNA using the TUNEL method.
Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R
2014-11-01
To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.
Quantification of DNA fragmentation in processed foods using real-time PCR.
Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi
2017-07-01
DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J
2013-09-01
Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.
Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.
Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M
2018-02-01
To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.
A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food
International Nuclear Information System (INIS)
Jones, J.L.; Bulford, B.B.
1990-07-01
The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)
Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes
2005-10-01
1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as
Evaluation of irradiation in foods using DNA comet assay
International Nuclear Information System (INIS)
Khawar, Affaf; Bhatti, Ijaz Ahmad; Khan, Q.M.; Ali, T.; Khan, A.I.; Asi, M.R.
2011-01-01
Comet assay is a rapid, inexpensive and sensitive biological technique to detect DNA damage in food stuffs by irradiation. In this study the Comet assay is applied on foods of plant and animal origins. Samples were irradiated by using 60 Co gamma-radiation source. The applied doses were 2, 6 and 10 kGy for food of plant origin and 0.5, 1 and 2 kGy for meat items. The un-irradiated and irradiated samples were clearly differentiated on the basis of DNA fragmentation. During the electrophoresis study, it was found that in un-irradiated cells DNA remained intact and appeared as Comets without tail whereas in irradiated cells Comets with tails were visible due to stretching of fragmented DNA. Moreover, it was also revealed that the DNA tail length was dose dependent. Dry food stuffs (seeds) showed good results as compared to moist foods (meat, fruits and vegetables) due to the absence of background damage. (author)
Directory of Open Access Journals (Sweden)
Gosalvez Jaime
2009-04-01
Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.
Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.
De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C
2015-03-01
Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.
Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana
2013-04-01
An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .
DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.
García-Vilchis, David; Aranda-Anzaldo, Armando
2017-12-01
Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment
Directory of Open Access Journals (Sweden)
Manesh Kumar Panner Selvam
2018-03-01
Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay
FragIdent--automatic identification and characterisation of cDNA-fragments.
Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin
2009-03-02
Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
Fragment Length of Circulating Tumor DNA.
Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay
2016-07-01
Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.
No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus
DEFF Research Database (Denmark)
Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens
2013-01-01
It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....
Irradiation detection of food by DNA Comet Assay
International Nuclear Information System (INIS)
Khan, A.A.; Delincee, H.
1999-01-01
Microgel electrophoresis of single cells or nuclei (DNA Comet Assay) has been investigated to detect irradiation treatment of more than 50 food commodities e.g. meats, seafood, cereals, pulses, nuts, fruits and vegetables, and spices. The foodstuffs have been exposed to radiation doses covering the range of potential commercial irradiation for inactivation of pathogenic and spoilage micro-organisms, for insect disinfestation and for shelf-life extension. The Comet Assay is based on detection of DNA fragments presumptive to irradiation. For most of the food items investigated, the assay can be applied successfully for irradiation detection by working out different conditions of the assay. However, with some of the foods difficulties arose due to - lack of discrimination between the irradiated and unirradiated food samples due to the presence of the same kinds of comets in both cases and the total absence of the typical intact cells in unirradiated samples. - Sufficient DNA material was not available from some of the foods. - Insufficient lysis of the cell walls in case of some plant foods. In conclusion, the DNA Comet Assay can help to detect the irradiation treatment of several varieties of foods using low-cost equipment in a short time of analysis. (orig.)
Fraser, L; Strzezek, J
2007-07-15
In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in
FragIdent – Automatic identification and characterisation of cDNA-fragments
Directory of Open Access Journals (Sweden)
Goehler Heike
2009-03-01
Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.
SOLANKY, DIPESH; HAYDEL, SHELLEY E.
2012-01-01
This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101
Boyko, Alex; Kovalchuk, Igor
2010-01-01
Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.
Application of the DNA comet assay for detection of irradiated meat
International Nuclear Information System (INIS)
Kruszewski, M.; Iwanenko, T.; Wojewodzka, M.; Malec-Czechowska, K.; Dancewicz, A. M.; Szot, Z.
1998-01-01
Radiation induces damage to the DNA. This damage (fragmentation) can be assessed in the irradiated food using Single Cell Gel Electrophoresis (SCGE), known as DNA comet assay. Fragmentation of DNA may also be caused by improper storage of meat and repeated freezing and thawing. This makes identification of irradiated meat by this assay not reliable enough. In order to know the scale of the processes imitating radiation effects in DNA of the comets, their shape and lengths were examined in both irradiated and unirradiated fresh meat (D = 1.5 or 3.0 kGy) stored at 4 o C or frozen (-21 o ) up to 5 months. Comets formed upon SCGE were stained with DAPI or silver and examined in fluorescent or light microscope. They were divided arbitrarily into 4 classes. Comets of IV class were found quite often in fresh meat stored at 4 o C. In meat samples that were irradiated and stored frozen, comets of class I, II and III were observed. The negative comet test is univocal. Positive comet test, however, needs confirmation. The meat should be subjected to further analysis with other validated methods. (author)
A Qualitative and Quantitative Assay to Study DNA/Drug Interaction ...
African Journals Online (AJOL)
Purpose: To explore the use of restriction inhibition assay (RIA) to study the binding specificity of some anticancer drugs. Methods: A 448 bp DNA fragment derived from pBCKS+ plasmid (harboring the polylinker region with multiple restriction endonuclease sites) was used as a template for sequence selective inhibition of ...
Fragmentation in DNA double-strand breaks
International Nuclear Information System (INIS)
Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie
2005-01-01
DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)
Supramolecular gel electrophoresis of large DNA fragments.
Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi
2017-10-01
Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure
International Nuclear Information System (INIS)
Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo
2010-01-01
Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.
DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure
Energy Technology Data Exchange (ETDEWEB)
Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)
2010-01-05
Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.
Comet assay optimization for assessment of DNA damage due to radiation exposure
International Nuclear Information System (INIS)
Dwi Ramadhani; Devita Tetriana; Viria Agesti Suvifan
2016-01-01
Comet assay can be used to measure the deoxyribonucleic acid (DNA) damage level caused by ionizing radiation exposure in peripheral blood lymphocytes. The principle of the comet assay is based on the amount of denatured DNA fragments that migrated out of the cell nucleus during electrophoresis. There are several aspects that must be concerned when doing the comet assay. For example the agarose concentration, duration of alkaline incubation, electrophoresis conditions (time, temperature, and voltage gradient), and the measurement parameters that used in analyze the comet. Percentage of DNA in the comet tail (% tail DNA) is strongly recommended as a parameter when analyze the comet because it can be converted to lesions per 106 base pairs (bp) using calibration curve that show relationship between the dose of ionizing radiation and % tail DNA. To obtain an accurate result, the calibration curve must be made and comet should be analyzing using image processing analysis software since it can be increase the precision and reduce the subjectivity of the measurement process. (author)
Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods
Directory of Open Access Journals (Sweden)
Sedlackova Tatiana
2013-02-01
Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.
The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.
2015-01-01
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667
Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P
2013-10-01
Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The
DNA fragments assembly based on nicking enzyme system.
Directory of Open Access Journals (Sweden)
Rui-Yan Wang
Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.
Linkage map of the fragments of herpesvirus papio DNA.
Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H
1981-01-01
Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015
The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.
Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F
2015-05-15
During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Complementary DNA-amplified fragment length polymorphism ...
African Journals Online (AJOL)
Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.
High efficiency hydrodynamic DNA fragmentation in a bubbling system
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling
2017-01-01
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling
High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.
Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling
2017-01-18
DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.
Directory of Open Access Journals (Sweden)
Agustín García-Peiró
2014-01-01
Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
Assessment of gamma ray-induced DNA damage in Lasioderma serricorne using the comet assay
International Nuclear Information System (INIS)
Kameya, Hiromi; Miyanoshita, Akihiro; Imamura, Taro; Todoriki, Setsuko
2012-01-01
We attempted a DNA comet assay under alkaline conditions to verify the irradiation treatment of pests. Lasioderma serricorne (Fabricius) were chosen as test insects and irradiated with gamma rays from a 60 Co source at 1 kGy. We conducted the comet assay immediately after irradiation and over time for 7 day. Severe DNA fragmentation in L. serricorne cells was observed just after irradiation and the damage was repaired during the post-irradiation period in a time-dependent manner. The parameters of the comet image analysis were calculated, and the degree of DNA damage and repair were evaluated. Values for the Ratio (a percentage determined by fluorescence in the damaged area to overall luminance, including intact DNA and the damaged area of a comet image) of individual cells showed that no cells in the irradiated group were included in the Ratio<0.1 category, the lowest grade. This finding was observed consistently throughout the 7-day post-irradiation period. We suggest that the Ratio values of individual cells can be used as an index of irradiation history and conclude that the DNA comet assay under alkaline conditions, combined with comet image analysis, can be used to identify irradiation history. - Highlights: ► We investigated the DNA comet assay to verify the irradiation of pests. ► Ratio and Tail Moment were higher in irradiated groups than in the control group. ► The DNA comet assay can be used to identify irradiation history.
Agarose gel electrophoresis for the separation of DNA fragments.
Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon
2012-04-20
Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate
International Nuclear Information System (INIS)
Bonicel, A.
1977-01-01
A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
The DNA 'comet assay' as a rapid screening technique to control irradiated food
International Nuclear Information System (INIS)
Cerda, H.; Delincee, H.; Haine, H.; Rupp, H.
1997-01-01
The exposure of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests, and to extend shelf-life, thereby contributing to a safer and more plentiful food supply. To ensure free consumer choice, irradiated food will be labelled as such, and to enforce labelling, analytical methods to detect the irradiation treatment in the food product itself are desirable. In particular, there is a need for simple and rapid screening methods for the control of irradiated food. The DNA comet assay offers great potential as a rapid tool to detect whether a wide variety of foodstuffs have been radiation processed. In order to simplify the test, the agarose single-layer set-up has been chosen, using a neutral protocol. Interlaboratory blind trials have been successfully carried out with a number of food products, both of animal and plant origin. This paper presents an overview of the hitherto obtained results and in addition the results of an intercomparison test with seeds, dried fruits and spices are described. In this intercomparison, an identification rate of 95% was achieved. Thus, using this novel technique, an effective screening of radiation-induced DNA fragmentation is obtained. Since other food treatments also may cause DNA fragmentation, samples with fragmented DNA suspected to have been irradiated should be analyzed by other validated methods for irradiated food, if such treatments which damage DNA cannot be excluded
Bacterial natural transformation by highly fragmented and damaged DNA
DEFF Research Database (Denmark)
Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre
2013-01-01
for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...
Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan
2013-01-01
A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926
Directory of Open Access Journals (Sweden)
Yuming Lu
Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.
Development of fluorescent methods for DNA methyltransferase assay
Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang
2017-03-01
DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
International Nuclear Information System (INIS)
Jackson, Christopher B.; Gallati, Sabina; Schaller, André
2012-01-01
Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two
qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy
Energy Technology Data Exchange (ETDEWEB)
Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)
2012-07-06
Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in
Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I
2016-01-01
Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.
Amplification of deoxyribonucleic acid (DNA) fragment using two ...
African Journals Online (AJOL)
user
2011-04-11
Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...
DEFF Research Database (Denmark)
Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.
1995-01-01
Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...
Ding, Wei; Bishop, Michelle E; Lyn-Cook, Lascelles E; Davis, Kelly J; Manjanatha, Mugimane G
2016-05-04
Unrepaired DNA damage can lead to genetic instability, which in turn may enhance cancer development. Therefore, identifying potential DNA damaging agents is important for protecting public health. The in vivo alkaline comet assay, which detects DNA damage as strand breaks, is especially relevant for assessing the genotoxic hazards of xenobiotics, as its responses reflect the in vivo absorption, tissue distribution, metabolism and excretion (ADME) of chemicals, as well as DNA repair process. Compared to other in vivo DNA damage assays, the assay is rapid, sensitive, visual and inexpensive, and, by converting oxidative DNA damage into strand breaks using specific repair enzymes, the assay can measure oxidative DNA damage in an efficient and relatively artifact-free manner. Measurement of DNA damage with the comet assay can be performed using both acute and subchronic toxicology study designs, and by integrating the comet assay with other toxicological assessments, the assay addresses animal welfare requirements by making maximum use of animal resources. Another major advantage of the assays is that they only require a small amount of cells, and the cells do not have to be derived from proliferating cell populations. The assays also can be performed with a variety of human samples obtained from clinically or occupationally exposed individuals.
International Nuclear Information System (INIS)
Kosaka, T.; Kuwabara, M.; Koide, F.
1992-01-01
Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking
Synthesis and NMR of {sup 15}N-labeled DNA fragments
Energy Technology Data Exchange (ETDEWEB)
Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)
1994-12-01
DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.
Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.
Pegels, N; González, I; Fernández, S; García, T; Martín, R
2012-01-01
A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.
A fluorescence sedimentation assay for dsDNA antibodies
DEFF Research Database (Denmark)
Duus, K; Draborg, A H; Güven, E
2017-01-01
The Farr assay is a radioimmunoassay (RIA) for dsDNA antibodies, based on antibody precipitation using ammonium sulphate and quantification using radio-labelled dsDNA. The RIA-Farr assay offers outstanding clinical specificity and sensitivity for systemic lupus erythematosus (SLE) compared to other...... on precipitation with polyethylene glycol (PEG) and fluorescence of EvaGreen intercalated in dsDNA as detection principle. As dsDNA antibodies are quantified using fluorescence, the disadvantages of working with radioactivity are eliminated. The Fluoro-Farr assay was developed and validated, and the diagnostic...
Directory of Open Access Journals (Sweden)
Leclerc Xavier
2009-04-01
Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.
Evaluating In Vitro DNA Damage Using Comet Assay.
Lu, Yanxin; Liu, Yang; Yang, Chunzhang
2017-10-11
DNA damage is a common phenomenon for each cell during its lifespan, and is defined as an alteration of the chemical structure of genomic DNA. Cancer therapies, such as radio- and chemotherapy, introduce enormous amount of additional DNA damage, leading to cell cycle arrest and apoptosis to limit cancer progression. Quantitative assessment of DNA damage during experimental cancer therapy is a key step to justify the effectiveness of a genotoxic agent. In this study, we focus on a single cell electrophoresis assay, also known as the comet assay, which can quantify single and double-strand DNA breaks in vitro. The comet assay is a DNA damage quantification method that is efficient and easy to perform, and has low time/budget demands and high reproducibility. Here, we highlight the utility of the comet assay for a preclinical study by evaluating the genotoxic effect of olaparib/temozolomide combination therapy to U251 glioma cells.
Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis
International Nuclear Information System (INIS)
Lau How Mooi
1998-01-01
Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured
Cheng, Xin; Ivessa, Andreas S
2012-10-01
Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.
A nuclear DNA-based species determination and DNA quantification assay for common poultry species.
Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S
2014-12-01
DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.
Real-time Tracking of DNA Fragment Separation by Smartphone.
Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori
2017-06-01
Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.
Directory of Open Access Journals (Sweden)
Barbara Dariš
2018-02-01
Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.
Energy Technology Data Exchange (ETDEWEB)
Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))
1994-08-01
The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.
Detection of irradiation treatment of foods using DNA 'comet assay'
International Nuclear Information System (INIS)
Khan, Hasan M.; Delincee, Henry
1998-01-01
Microgel electrophoresis of single cells (DNA comet assay) has been investigated to detect irradiation treatment of some food samples. These samples of fresh and frozen rainbow trout, red lentil, gram and sliced almonds were irradiated to 1 or 2 kGy using 10 MeV electron beam from a linear accelerator. Rainbow trout samples yielded good results with samples irradiated to 1 or 2 kGy showing fragmentation of DNA and, therefore, longer comets with no intact cells. Unirradiated samples showed shorter comets with a significant number of intact cells. For rainbow trout stored in a freezer for 11 days the irradiated samples can still be discerned by electrophoresis from unirradiated samples, however, the unirradiated trouts also showed some longer comets besides some intact cells. Radiation treatment of red lentils can also be detected by this method, i.e. no intact cells in 1 or 2 kGy irradiated samples and shorter comets and some intact cells in unirradiated samples. However, the results for gram and sliced almond samples were not satisfactory since some intact DNA cells were observed in irradiated samples as well. Probably, incomplete lysis has led to these deviating results
Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples
Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel
2017-01-01
Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837
Santangelo, G M; Tornow, J
1997-12-01
As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.
Alkaline Comet Assay for Assessing DNA Damage in Individual Cells.
Pu, Xinzhu; Wang, Zemin; Klaunig, James E
2015-08-06
Single-cell gel electrophoresis, commonly called a comet assay, is a simple and sensitive method for assessing DNA damage at the single-cell level. It is an important technique in genetic toxicological studies. The comet assay performed under alkaline conditions (pH >13) is considered the optimal version for identifying agents with genotoxic activity. The alkaline comet assay is capable of detecting DNA double-strand breaks, single-strand breaks, alkali-labile sites, DNA-DNA/DNA-protein cross-linking, and incomplete excision repair sites. The inclusion of digestion of lesion-specific DNA repair enzymes in the procedure allows the detection of various DNA base alterations, such as oxidative base damage. This unit describes alkaline comet assay procedures for assessing DNA strand breaks and oxidative base alterations. These methods can be applied in a variety of cells from in vitro and in vivo experiments, as well as human studies. Copyright © 2015 John Wiley & Sons, Inc.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
Energy Technology Data Exchange (ETDEWEB)
Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)
2000-06-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
International Nuclear Information System (INIS)
Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.
2000-01-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America
Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.
Warwicker, J; Ollis, D; Richards, F M; Steitz, T A
1985-12-05
The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.
Directory of Open Access Journals (Sweden)
S. Yu. Borovets
2017-01-01
Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level
Identification of radiation treatment of foods using novel technique of 'DNA comet assay'
International Nuclear Information System (INIS)
Khan, A.A.; Khan, H.M.; Wasim, M.A.
2005-01-01
Treatment of food using ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for the detection foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study samples of fresh and frozen beef has investigated for the detection of irradiation treatment. The samples were subjected to radiation doses of 0,4.5 and 7 KGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into agarose gel on microscope slides, lysed and eletrophoressed at a voltage of 2V/cm for 2 minutes. The fragmented DNA as a irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiation samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in from of round or conical intact cells for unirradiated samples or in from of comets for irradiated samples. It is therefore concluded that DNA comet Assay offers a potential to screen unirradiated and irradiated meat samples. (author)
Detection of radiation treatment of meat by novel techniques of DNA comet assay
International Nuclear Information System (INIS)
Khan, A.A.; Khan, H.M.
2002-01-01
Treatment of food to ionizing radiation is being progressively used in many countries to inactivate food pathogens, to eradicate pests and to extend shelf life; thereby contributing to safer and more plentiful food supply. Food control agencies throughout the world need some reliable, simple and rapid methods for detection of irradiated foods to ensure free choice of consumer and to enforce labeling. The DNA comet assay offers great potential as a rapid tool to screen irradiated and unirradiated samples of several kinds of foods. In the present study, frozen beef has been investigated for detection of irradiation treatment. The samples were subjected to radiation doses of 0,4,5 and 7.0 kGy and were stored in freezer before analysis. The cells were extracted into cold PBS solutions, embedded into the agarose gel on microscope slides, lysed and electrophoressed at a voltage of 2v/cm for 2 min. The fragmented DNA as a result of irradiation treatment was stretched in the gel producing the dose dependent comets. These comets were visible using a simple transmission microscope after silver staining. The controlled and irradiated samples of meat were clearly distinguishable on the basis of the stained patterns of DNA in form of round or conical intact cells for unirradiated samples or in form of comets for irradiated samples. It is therefore, concluded that 'DNA Comet Assay' offers a potential to screen unirradiated and irradiated meat samples. (author)
Electrokinetically-controlled RNA-DNA hybridization assay for foodborne pathogens
International Nuclear Information System (INIS)
Weng, X.; Jiang, H.; Li, D.
2012-01-01
We have developed a microfluidic chip for use in an RNA-DNA hybridization assay for foodborne pathogens. Automatic sequential reagent dispensing and washing was realized with a programmable DC voltage sequencer. Signal detection was achieved with a miniaturized optical detection module. Salmonella and Listeria monocytogenes bacteria in different concentrations were quantitatively determined by this RNA-DNA hybridization assay in the microfluidic chip. The detection limit for the Salmonella and Listeria monocytogenes bacteria is 10 3 to 10 4 CFU mL -1 . The method excels by a significant reduction in the consumption of sample and reagent, and a short assay time. This automatic-operating microfluidic RNA-DNA hybridization assay is promising for on-site pathogen detection. (author)
Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.
2015-07-01
Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.
Cortés-Gutiérrez, Elva I.; López-Fernández, Carmen; Fernández, José Luis; Dávila-Rodríguez, Martha I.; Johnston, Stephen D.; Gosálvez, Jaime
2014-01-01
Key Concepts The two-dimensional Two-Tailed Comet assay (TT-comet) protocol is a valuable technique to differentiate between single-stranded (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell.Protein lysis inherent with the TT-comet protocol accounts for differences in sperm protamine composition at a species-specific level to produce reliable visualization of sperm DNA damage.Alkaline treatment may break the sugar–phosphate backbone in abasic sites or at sites with deoxyribose damage, transforming these lesions into DNA breaks that are also converted into ssDNA. These lesions are known as Alkali Labile Sites “ALSs.”DBD–FISH permits the in situ visualization of DNA breaks, abasic sites or alkaline-sensitive DNA regions.The alkaline comet single assay reveals that all mammalian species display constitutive ALS related with the requirement of the sperm to undergo transient changes in DNA structure linked with chromatin packing.Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome.The TT is a valuable tool for identifying SSBs or DSBs in sperm cells with DNA fragmentation and can be therefore used for the purposes of fertility assessment. Sperm DNA damage is associated with fertilization failure, impaired pre-and post- embryo implantation and poor pregnancy outcome. A series of methodologies to assess DNA damage in spermatozoa have been developed but most are unable to differentiate between single-stranded DNA breaks (SSBs) and double-stranded DNA breaks (DSBs) on the same sperm cell. The two-dimensional Two-Tailed Comet assay (TT-comet) protocol highlighted in this review overcomes this limitation and emphasizes the importance in accounting for the difference in sperm protamine composition at a species-specific level for the appropriate preparation of the assay. The TT-comet is a modification of the original comet assay that uses a two dimensional electrophoresis to
DEFF Research Database (Denmark)
Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E
1995-01-01
Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...
International Nuclear Information System (INIS)
Zielinsky, A.; Hirsh, J.; Straumanis, G.; Carter, C.J.; Gent, M.; Sackett, D.L.; Hull, R.; Kelton, J.G.; Powers, P.; Turpie, A.G.
1982-01-01
We have evaluated the fibrinogen/fibrin fragment E antigen assay as a diagnostic test in patients with clinically suspected venous thrombosis by comparing the results of this assay with venography in 272 patients. The result of the fragment E antigen assay was elevated in 79 of 80 patients with positive venograms for recent venous thrombosis (sensitivity 99%) and within the normal range in 161 of 192 patients with normal venograms (specificity 84%). The fragment E assay was also evaluated in 130 medical and surgical controls without evidence of venous thrombosis by leg scanning and the test was found to be relatively nonspecific. However, in the patient group under study, a correct clinical diagnosis of no thrombosis, based on a normal fragment E result, was made in 161 of 162 cases (negative predictive value of 99%). Therefore, a normal test result effectively excludes a diagnosis of venous thrombosis in clinically symptomatic patients. The assay, as currently performed, is technically demanding and takes 24 hr to complete. Therefore, it will have to be simplified before it can be applied to clinical practice
International Nuclear Information System (INIS)
Zielinsky, A.; Hirsh, J.; Straumanis, G.; Carter, C.J.; Gent, M.; Sackett, D.L.; Hull, R.; Kelton, J.G.; Powers, P.
1982-01-01
We have evaluated the fibrinogen/fibrin fragment E antigen assay as a diagnostic test in patients with clinically suspected venous thrombosis by comparing the results of this assay with venography in 272 patients. The result of the fragment E antigen assay was elevated in 79 of 80 patients with positive venograms for recent venous thrombosis (sensitivity 99%) and within the normal range in 161 of 192 patients with normal venograms (specificity 84%). The fragment E assay was also evaluated in 130 medical and surgical controls without evidence of venous thrombosis by leg scanning and the test was found to be relatively nonspecific. However, in the patient group under study, a correct clinical diagnosis of no thrombosis, based on a normal fragment E result, was made in 161 of 162 cases (negative predictive value 99%). Therefore, a normal test result effectively excludes a diagnosis of venous thrombosis in clinically symptomatic patients. The assay, as currently performed, is technically demanding and takes 24 hr to complete. Therefore, it will have to be simplified before it can be applied to clinical practice
Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao
2005-01-01
AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039
Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis
van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland
2006-01-01
We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893
Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.
Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime
2006-12-01
The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.
Enzyme-linked electrochemical DNA ligation assay using magnetic beads.
Stejskalová, Eva; Horáková, Petra; Vacek, Jan; Bowater, Richard P; Fojta, Miroslav
2014-07-01
DNA ligases are essential enzymes in all cells and have been proposed as targets for novel antibiotics. Efficient DNA ligase activity assays are thus required for applications in biomedical research. Here we present an enzyme-linked electrochemical assay based on two terminally tagged probes forming a nicked junction upon hybridization with a template DNA. Nicked DNA bearing a 5' biotin tag is immobilized on the surface of streptavidin-coated magnetic beads, and ligated product is detected via a 3' digoxigenin tag recognized by monoclonal antibody-alkaline phosphatase conjugate. Enzymatic conversion of napht-1-yl phosphate to napht-1-ol enables sensitive detection of the voltammetric signal on a pyrolytic graphite electrode. The technique was tested under optimal conditions and various situations limiting or precluding the ligation reaction (such as DNA substrates lacking 5'-phosphate or containing a base mismatch at the nick junction, or application of incompatible cofactor), and utilized for the analysis of the nick-joining activity of a range of recombinant Escherichia coli DNA ligase constructs. The novel technique provides a fast, versatile, specific, and sensitive electrochemical assay of DNA ligase activity.
A versatile non-radioactive assay for DNA methyltransferase activity and DNA binding
Frauer, Carina; Leonhardt, Heinrich
2009-01-01
We present a simple, non-radioactive assay for DNA methyltransferase activity and DNA binding. As most proteins are studied as GFP fusions in living cells, we used a GFP binding nanobody coupled to agarose beads (GFP nanotrap) for rapid one-step purification. Immobilized GFP fusion proteins were subsequently incubated with different fluorescently labeled DNA substrates. The absolute amounts and molar ratios of GFP fusion proteins and bound DNA substrates were determined by fluorescence spectroscopy. In addition to specific DNA binding of GFP fusion proteins, the enzymatic activity of DNA methyltransferases can also be determined by using suicide DNA substrates. These substrates contain the mechanism-based inhibitor 5-aza-dC and lead to irreversible covalent complex formation. We obtained covalent complexes with mammalian DNA methyltransferase 1 (Dnmt1), which were resistant to competition with non-labeled canonical DNA substrates, allowing differentiation between methyltransferase activity and DNA binding. By comparison, the Dnmt1C1229W catalytic site mutant showed DNA-binding activity, but no irreversible covalent complex formation. With this assay, we could also confirm the preference of Dnmt1 for hemimethylated CpG sequences. The rapid optical read-out in a multi-well format and the possibility to test several different substrates in direct competition allow rapid characterization of sequence-specific binding and enzymatic activity. PMID:19129216
High performance of a new PCR-based urine assay for HPV-DNA detection and genotyping.
Tanzi, Elisabetta; Bianchi, Silvia; Fasolo, Maria Michela; Frati, Elena R; Mazza, Francesca; Martinelli, Marianna; Colzani, Daniela; Beretta, Rosangela; Zappa, Alessandra; Orlando, Giovanna
2013-01-01
Human papillomavirus (HPV) testing has been proposed as a means of replacing or supporting conventional cervical screening (Pap test). However, both methods require the collection of cervical samples. Urine sample is easier and more acceptable to collect and could be helpful in facilitating cervical cancer screening. The aim of this study was to evaluate the sensitivity and specificity of urine testing compared to conventional cervical smear testing using a PCR-based method with a new, designed specifically primer set. Paired cervical and first voided urine samples collected from 107 women infected with HIV were subjected to HPV-DNA detection and genotyping using a PCR-based assay and a restriction fragment length polymorphism method. Sensitivity, specificity, Positive Predictive Value (PPV), and Negative Predictive Value (NPV) were calculated using the McNemar's test for differences. Concordance between tests was assessed using the Cohen's unweighted Kappa (k). HPV DNA was detected in 64.5% (95% CI: 55.1-73.1%) of both cytobrush and urine samples. High concordance rates of HPV-DNA detection (k = 0.96; 95% CI: 0.90-1.0) and of high risk-clade and low-risk genotyping in paired samples (k = 0.80; 95% CI: 0.67-0.92 and k = 0.74; 95% CI: 0.60-0.88, respectively) were observed. HPV-DNA detection in urine versus cervix testing revealed a sensitivity of 98.6% (95% CI: 93.1-99.9%) and a specificity of 97.4% (95% CI: 87.7-99.9%), with a very high NPV (97.4%; 95% CI: 87.7-99.9%). The PCR-based assay utilized in this study proved highly sensitive and specific for HPV-DNA detection and genotyping in urine samples. These data suggest that a urine-based assay would be a suitable and effective tool for epidemiological surveillance and, most of all, screening programs. Copyright © 2012 Wiley Periodicals, Inc.
(PCR) for direct cloning of blunt-end DNA fragments
African Journals Online (AJOL)
Administrator
2011-09-19
Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).
Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.
1996-01-01
We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes
Detection of irradiation treatment of foods using DNA 'comet assay'
Energy Technology Data Exchange (ETDEWEB)
Khan, Hasan M.; Delincee, Henry
1998-06-01
Microgel electrophoresis of single cells (DNA comet assay) has been investigated to detect irradiation treatment of some food samples. These samples of fresh and frozen rainbow trout, red lentil, gram and sliced almonds were irradiated to 1 or 2 kGy using 10 MeV electron beam from a linear accelerator. Rainbow trout samples yielded good results with samples irradiated to 1 or 2 kGy showing fragmentation of DNA and, therefore, longer comets with no intact cells. Unirradiated samples showed shorter comets with a significant number of intact cells. For rainbow trout stored in a freezer for 11 days the irradiated samples can still be discerned by electrophoresis from unirradiated samples, however, the unirradiated trouts also showed some longer comets besides some intact cells. Radiation treatment of red lentils can also be detected by this method, i.e. no intact cells in 1 or 2 kGy irradiated samples and shorter comets and some intact cells in unirradiated samples. However, the results for gram and sliced almond samples were not satisfactory since some intact DNA cells were observed in irradiated samples as well. Probably, incomplete lysis has led to these deviating results.
Chen, Dan; Pan, Shiyang; Xie, Erfu; Gao, Li; Xu, Huaguo; Xia, Wenying; Xu, Ting; Huang, Peijun
2017-01-01
Circulating levels of cell-free DNA increase in many pathologic conditions. However, notable discrepancies in the quantitative analysis of cell-free DNA from a large number of laboratories have become a considerable pitfall, hampering its clinical application. We designed a novel recombinant DNA fragment that could be applied as an internal standard in a newly developed and validated duplex real-time PCR assay for the quantitative analysis of total cell-free plasma DNA, which was tested in 5,442 healthy adults and 200 trauma patients. Compared with two traditional methods, this novel assay showed a lower detection limit of 0.1 ng/mL, lower intra- and inter-assay CVs, and higher accuracy in the recovery test. The median plasma DNA concentration of healthy males (20.3 ng/mL, n=3,092) was significantly higher than that of healthy females (16.1 ng/mL, n=2,350) (Mann-Whitney two-sample rank sum test, PDNA concentration were 0-45.8 ng/mL and 0-52.5 ng/mL for healthy females and males, respectively. The plasma DNA concentrations of the majority of trauma patients (96%) were higher than the upper normal cutoff values and were closely related to the corresponding injury severity scores (R²=0.916, PDNA, showing promising application in clinical diagnosis.
Grigaravicius, Paulius; Rapp, Alexander; Greulich, Karl Otto
2009-03-01
In DNA repair research, DNA damage is induced by different agents, depending on the technical facilities of the investigating researchers. A quantitative comparison of different investigations is therefore often difficult. By using a modified variant of the neutral comet assay, where the histone H1 is detected by immunofluorescence [immunofluorescent comet assay (IFCA)], we achieve previously unprecedented resolution in the detection of fragmented chromatin and show that trillions of ultraviolet A photons (of a few eV), billions of bleomycin (BLM) molecules and thousands of gamma quanta (of 662 keV) generate, in first order, similar damage in the chromatin of HeLa cells. A somewhat more detailed inspection shows that the damage caused by 20 Gy ionizing radiation and by a single laser pulse of 10 microJ are comparable, while the damage caused by 12 microg/ml BLM depends highly on the individual cell. Taken together, this work provides a detailed view of DNA fragmentation induced by different treatments and allows comparing them to some extent, especially with respect to the neutral comet assay.
International Nuclear Information System (INIS)
Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.
1990-01-01
A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map
International Nuclear Information System (INIS)
Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge
2006-01-01
Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments
A multiplex branched DNA assay for parallel quantitative gene expression profiling.
Flagella, Michael; Bui, Son; Zheng, Zhi; Nguyen, Cung Tuong; Zhang, Aiguo; Pastor, Larry; Ma, Yunqing; Yang, Wen; Crawford, Kimberly L; McMaster, Gary K; Witney, Frank; Luo, Yuling
2006-05-01
We describe a novel method to quantitatively measure messenger RNA (mRNA) expression of multiple genes directly from crude cell lysates and tissue homogenates without the need for RNA purification or target amplification. The multiplex branched DNA (bDNA) assay adapts the bDNA technology to the Luminex fluorescent bead-based platform through the use of cooperative hybridization, which ensures an exceptionally high degree of assay specificity. Using in vitro transcribed RNA as reference standards, we demonstrated that the assay is highly specific, with cross-reactivity less than 0.2%. We also determined that the assay detection sensitivity is 25,000 RNA transcripts with intra- and interplate coefficients of variance of less than 10% and less than 15%, respectively. Using three 10-gene panels designed to measure proinflammatory and apoptosis responses, we demonstrated sensitive and specific multiplex gene expression profiling directly from cell lysates. The gene expression change data demonstrate a high correlation coefficient (R(2)=0.94) compared with measurements obtained using the single-plex bDNA assay. Thus, the multiplex bDNA assay provides a powerful means to quantify the gene expression profile of a defined set of target genes in large sample populations.
International Nuclear Information System (INIS)
Todoroki, Setsuko; Hayashi, Toru
2002-01-01
Cherry fruits were irradiated with gamma-rays at doses up to 200Gy (effective dose for disinfestation of codling moth), and DNA strand break in seed embryos was investigated by using alkaline comet assay. Immediately after irradiation (≥100Gy), DNA from embryos produced comets with a long and wide tail due to fragmentation. In control cells, DNA relaxed and produced comet with very short tail (with few strand break). After 72h storage, DNA from fruits irradiated at 200 Gy showed comets with little tail and tail moment of comets was same as un-irradiated control. These results indicate that the strand breaks of DNA caused by irradiation in fresh seed embryo are repaired during storage. On the contrary, the ability of germination lost by irradiation did not restored, a dose of 100Gy and more retarded shoot elongation. In cherries irradiated at 100Gy, the shooting percentage was less than 50% at 4th day after incubation. Germination test (Half embryo test) can be discriminate between irradiated and un-irradiated cherries. (author)
Ionization and fragmentation of DNA-RNA bases: a density functional theory study
International Nuclear Information System (INIS)
Sadr-Arani, Leila
2014-01-01
Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)
A novel SERRS sandwich-hybridization assay to detect specific DNA target.
Directory of Open Access Journals (Sweden)
Cécile Feuillie
Full Text Available In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR. In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics.
International Nuclear Information System (INIS)
Araujo, Michel Mozeika
2008-01-01
Marketing of minimally processed vegetables (MPV) are gaining impetus due to its convenience, freshness and apparent healthy. However, minimal processing does not reduce pathogenic microorganisms to safe levels. Food irradiation is used to extend the shelf life and inactivation of food-borne pathogens, Its combination with minimal processing could improve the safety and quality of MPV. Two different food irradiation detection methods, a biological, the DEFT/APC, and another biochemical, the DNA Comet Assay were applied to MPV in order to test its applicability to detect irradiation treatment. DEFT/APC is a microbiological screening method based on the use of the direct epi fluorescent filter technique (DEFT) and the aerobic plate count (APC). DNA Comet Assay detects DNA damage due to ionizing radiation. Samples of lettuce, chard, watercress, dandelion, kale, chicory, spinach, cabbage from retail market were irradiated O.5 kGy and 1.0 kGy using a 60 Co facility. Irradiation treatment guaranteed at least 2 log cycle reduction for aerobic and psychotropic microorganisms. In general, with increasing radiation doses, DEFT counts remained similar independent of irradiation processing while APC counts decreased gradually. The difference of the two counts gradually increased with dose increment in all samples. It could be suggested that a DEFT/APC difference over 2.0 log would be a criteria to judge if a MPV was treated by irradiation. DNA Comet Assay allowed distinguishing non-irradiated samples from irradiated ones, which showed different types of comets owing to DNA fragmentation. Both DEFT/APC method and DNA Comet Assay would be satisfactorily used as a screening method for indicating irradiation processing. (author)
New Application of the Comet Assay
Cortés-Gutiérrez, Elva I.; Dávila-Rodríguez, Martha I.; Fernández, José Luís; López-Fernández, Carmen; Gosálbez, Altea; Gosálvez, Jaime
2011-01-01
The comet assay is a well-established, simple, versatile, visual, rapid, and sensitive tool used extensively to assess DNA damage and DNA repair quantitatively and qualitatively in single cells. The comet assay is most frequently used to analyze white blood cells or lymphocytes in human biomonitoring studies, although other cell types have been examined, including buccal, nasal, epithelial, and placental cells and even spermatozoa. This study was conducted to design a protocol that can be used to generate comets in subnuclear units, such as chromosomes. The new technique is based on the chromosome isolation protocols currently used for whole chromosome mounting in electron microscopy, coupled to the alkaline variant of the comet assay, to detect DNA damage. The results show that migrant DNA fragments can be visualized in whole nuclei and isolated chromosomes and that they exhibit patterns of DNA migration that depend on the level of DNA damage produced. This protocol has great potential for the highly reproducible study of DNA damage and repair in specific chromosomal domains. PMID:21540337
Directory of Open Access Journals (Sweden)
Adriana Díaz
2009-01-01
Full Text Available The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1 to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2 to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3 to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29% of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins.
Enzyme-linked immunosorbent assays for Z-DNA.
Thomas, M J; Strobl, J S
1988-01-01
Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e....
DNA comet assay as a rapid detection method of irradiated bovine meat by electron beam
International Nuclear Information System (INIS)
Marin-Huachaca, Nelida Simona; Villavicencio, Anna Lucia C.H.
2001-01-01
Full text: Introduction: The presence in food of pathogenic microorganisms, such as Salmonella species, Escherichia coli 0157:H7, Listeria Monocytogenes or Yersinia enterolitica, is a problem of growing concern to public health authorities all over the world. Thus, irradiation of certain prepackaged meat products such as ground beef, minced meat, and hamburgers may help in controlling meatborne pathogens and parasites. Pathogenic microorganisms and parasites in meat products, which are commonly consumed raw, are of particular importance, Up to now, only electron-beam accelerators and gamma-ray cells have been used for commercial applications. At the international conference on 'The Acceptance, Control of, and Trade in Irradiated Food', it was recommended that governments should encourage research into detection methods (Anon, 1989), Already five international standards are available to food control agencies. A number of physical, chemical, and biological techniques of detection of irradiated foods have been discussed in the literature. A rapid and inexpensive screening test employing DNA Comet Assay to identify radiation treatment of food has been described by Cerda et al. (1997). This method is restricted to foods that have not been subjected to heat or other treatments, which also induce DNA fragmentation. Advantages are its simplicity, low cost and speed of measurement. This method was proposed to the European Committee for Standardization (CEN) as a screening protocol (presumptive) and not as a proof (definitive). The DNA comet assay have been yielded good results with chicken, pork, fish meat, exotic meat, hamburgers, fruits and cereals. In this work we studied a DNA fragmentation of bovine meat irradiated by electron beam. Experimental: Bovine meat was purchased in local shops in Sao Paulo. Irradiation was performed with electron beam of accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 3,5; 4,5, 5,5, and 7
Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay
Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.
2011-01-01
The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207
DNA Sequences of RAPD Fragments in the Egyptian cotton ...
African Journals Online (AJOL)
Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...
Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu
2014-12-15
A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Hammad, A.A.; Abo El Nour, S.A.; Ibrahim, H.M.; Osman, M.E.; Abo El- Nasr, A.
2014-01-01
In the present study the microgel electrophoresis of single cells (DNA Comet Assay), and changes in microflora load were applied to detect irradiation treatment of strawberries and fresh-deboned chicken produced in Egypt. Strawberry samples were irradiated at 1.0, 2.0, 3.0 and 4.0 kGy, stored at 4 degree C±1 and analyzed at 0 and 7 days post.-irradiation. Fresh- deboned chicken meat samples were exposed to 2.0, 3.0, 4.0 and 5.0 kGy, stored at 4 degree C±1 and analyzed at 0, 7, 14 and 21 days post-irradiation. After electrophoresis performance, the accridine orange stain slides were seen under fluorescent microscope and the DNA comets were evaluated by photographic and image analysis. Changes in microflora load of irradiated samples were also evaluated. In all irradiated samples, the DNA fragments stretched or migrated out of the cells towards the anode of the agrose gel and appeared as a “comets” with tail. Whereas, DNA comets of all non-irradiated samples were almost intact, round without tail or had very short tail. Values of DNA % in tails and the tail length increased with increasing irradiation dose and storage times. The DNA comet assay could successfully be used to detect radiation treatment of strawberry and deboned-chicken meat samples up to 7 and 21 days post-irradiation, respectively. The absence of gram-negative bacteria and enterobacteriaceae group as well as the very low count of fungi (mostly yeasts) might be considered another evidence of radiation treatment of strawberries and fresh-deboned chicken.
An assay system for factors involved in mammalian DNA replication
International Nuclear Information System (INIS)
Reinhard, P.; Maillart, P.; Schluchter, M.; Gautschi, J.R.; Schindler, R.
1979-01-01
An assay for cellular factors stimulating DNA synthesis by partially lysed CHO cells is presented. The assay is based on the observation that in highly lysed cells, DNA synthesis, as determined by [ 3 H]dTTP incorporation, was only 2-5% of that in gently lysed cells, and that this low level of DNA synthesis could be increased by a factor of approx. 50 by the addition of CHO cell extract (i.e. supernatant of a cell homogenate subjected to high-speed centrifugation.) (Auth.)
DEFF Research Database (Denmark)
Møller, Peter; Möller, Lennart; Godschalk, Roger W L
2010-01-01
The alkaline single cell gel electrophoresis (comet) assay has become a widely used method for the detection of DNA damage and repair in cells and tissues. Still, it has been difficult to compare results from different investigators because of differences in assay conditions and because the data...... are reported in different units. The European Comet Assay Validation Group (ECVAG) was established for the purpose of validation of the comet assay with respect to measures of DNA damage formation and its repair. The results from this inter-laboratory validation trail showed a large variation in measured level...... reliability for the measurement of DNA damage by the comet assay but there is still a need for further validation to reduce both assay and inter-laboratory variation....
Boufana, Belgees; Umhang, Gérald; Qiu, Jiamin; Chen, Xingwang; Lahmar, Samia; Boué, Franck; Jenkins, David; Craig, Philip
2013-01-01
To investigate echinococcosis in co-endemic regions, three polymerase chain reaction (PCR) assays based on the amplification of a fragment within the NADH dehydrogenase subunit 1 (ND1) mitochondrial gene were optimized for the detection of Echinococcus shiquicus, Echinococcus granulosus G1, and Echinococcus multilocularis DNA derived from parasite tissue or canid fecal samples. Specificity using parasite tissue-derived DNA was found to be 100% except for E. shiquicus primers that faintly detected E. equinus DNA. Sensitivity of the three assays for DNA detection was between 2 and 10 pg. Ethanol precipitation of negative PCR fecal samples was used to eliminate false negatives and served to increase sensitivity as exemplified by an increase in detection from 0% to 89% of E. shiquicus coproDNA using necropsy-positive fox samples. PMID:23438764
A simple colorimetric assay for detection of amplified Mycobacterium leprae DNA
van der Vliet, G. M.; de Wit, M. Y.; Klatser, P. R.
1993-01-01
A colorimetric assay for the detection of PCR-products is described. The assay is based on amplification of DNA in the presence of digoxigenin-dUTP. After immobilization of the PCR products to a microtitre plate, amplified DNA could be detected colorimetrically. The sensitivity of this colorimetric
Electrochemical DNA sandwich assay with a lipase label for attomole detection of DNA
DEFF Research Database (Denmark)
Ferapontova, Elena; Hansen, Majken Nørgaard; Saunders, Aaron Marc
2010-01-01
A fast and sensitive electrochemical lipase-based sandwich hybridization assay for detection of attomole levels of DNA has been developed. A combination of magnetic beads, used for pre-concentration and bioseparation of the analyte with a lipase catalyst label allowed detection of DNA with a limi...
Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles
Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin
2010-01-01
Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be
International Nuclear Information System (INIS)
D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.
1988-01-01
cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
International Nuclear Information System (INIS)
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.
2014-01-01
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
Energy Technology Data Exchange (ETDEWEB)
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert [Department of Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States); Gagnon, David [Institut de Recherches Cliniques de Montreal (IRCM), 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7 (Canada); Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Quebec (Canada); Gjoerup, Ole [Molecular Oncology Research Institute, Tufts Medical Center, Boston, MA 02111 (United States); Archambault, Jacques [Institut de Recherches Cliniques de Montreal (IRCM), 110 Pine Avenue West, Montreal, Quebec, Canada H2W 1R7 (Canada); Department of Biochemistry and Molecular Medicine, Université de Montréal, Montréal, Quebec (Canada); Bullock, Peter A., E-mail: Peter.Bullock@tufts.edu [Department of Developmental, Molecular and Chemical Biology, Tufts University School of Medicine, Boston, MA 02111 (United States)
2014-11-15
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. - Highlights: • Development of a high-throughput screening assay for JCV DNA replication using C33A cells. • Evidence that T-ag fails to accumulate in the nuclei of established glioma cell lines. • Evidence that NF-1 directly promotes JCV DNA replication in C33A cells. • Proof-of-concept that the HTS assay can be used to identify pharmacological inhibitor of JCV DNA replication.
Raman, Natarajan; Selvaganapathy, Muthusamy; Radhakrishnan, Srinivasan
2014-06-01
The 4-aminoantipyrine derivatives (sbnd NO2, sbnd OCH3) and their mixed-ligand complexes with amino acids have been synthesized and investigated for their binding with CT DNA using UV-visible spectroscopy, cyclic voltammetry, and viscosity measurements under physiological conditions of pH (stomach 4.7; blood 7.4). The results from all techniques i.e. binding constant (Kb), and free energy change (ΔG) were in good agreement and inferred spontaneous compound-DNA complexes formation via intercalation. Among all the compounds 1 and 4 showed comparatively greater binding at pH 7.4 as evident from its greater Kb values. All the complexes exhibit oxidative cleavage of supercoiled (SC) pBR322 plasmid DNA in the presence of H2O2 as an activator. It is remarkable that at 25 μM concentration 1 and 4 completely degrade SC DNA into undetectable minor fragments and thus they act as efficient chemical nucleases. Among the new complexes, complexes 1 and 4 have highest potential against all the microorganisms tested. The results of the above biological experiments also reveal that the choice of different metal ions has little influence on the DNA binding, DNA cleavage and antimicrobial assay.
Marsh, A G; Gauthier, J D; Vasta, G R
1995-08-01
A 3.2-kb fragment of Perkinsus marinus DNA was cloned and sequenced. A noncoding domain was identified and targeted for the development of a semiquantitative polymerase chain reaction (PCR) assay for the presence of P. marinus in eastern oyster tissues. The assay involves extracting total DNA from oyster hemolymph and using 1 microgram of that DNA as template in a stringent PCR amplification with oligonucleotide primers that are specific for the P. marinus 3.2-kb fragment. With this assay, we can detect 10 pg of total P. marinus DNA per 1 microgram of oyster hemocyte DNA with ethidium bromide (EtBr) staining of agarose gels, 100 fg total P. marinus DNA with Southern blot autoradiography, and 10 fg of total P. marinus DNA with dot-blot hybridizations. We have used the sensitivity of the PCR assay to develop a method for estimating the level of P. marinus DNA in oyster hemolymph and have successfully applied this technique to gill tissues. Our semiquantitative assay uses a dilution series to essentially titrate the point at which a P. marinus DNA target is no longer amplified in a sample. We refer to this technique as "dilution endpoint" PCR. Using hemocytes obtained by withdrawing a 1-ml sample of hemolymph, this assay provides a nondestructive methodology for rapidly screening large numbers of adult oysters for the presence and quantification of P. marinus infection levels. This technique is applicable to other tissues (gills) and could potentially be applied to DNA extracts of whole larvae or spat.
Directory of Open Access Journals (Sweden)
Katy E Klymus
Full Text Available Describing and monitoring biodiversity comprise integral parts of ecosystem management. Recent research coupling metabarcoding and environmental DNA (eDNA demonstrate that these methods can serve as important tools for surveying biodiversity, while significantly decreasing the time, expense and resources spent on traditional survey methods. The literature emphasizes the importance of genetic marker development, as the markers dictate the applicability, sensitivity and resolution ability of an eDNA assay. The present study developed two metabarcoding eDNA assays using the mtDNA 16S RNA gene with Illumina MiSeq platform to detect invertebrate fauna in the Laurentian Great Lakes and surrounding waterways, with a focus for use on invasive bivalve and gastropod species monitoring. We employed careful primer design and in vitro testing with mock communities to assess ability of the markers to amplify and sequence targeted species DNA, while retaining rank abundance information. In our mock communities, read abundances reflected the initial input abundance, with regressions having significant slopes (p<0.05 and high coefficients of determination (R2 for all comparisons. Tests on field environmental samples revealed similar ability of our markers to measure relative abundance. Due to the limited reference sequence data available for these invertebrate species, care must be taken when analyzing results and identifying sequence reads to species level. These markers extend eDNA metabarcoding research for molluscs and appear relevant to other invertebrate taxa, such as rotifers and bryozoans. Furthermore, the sphaeriid mussel assay is group-specific, exclusively amplifying bivalves in the Sphaeridae family and providing species-level identification. Our assays provide useful tools for managers and conservation scientists, facilitating early detection of invasive species as well as improving resolution of mollusc diversity.
Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima
2015-09-01
To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.
Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments
International Nuclear Information System (INIS)
Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.
1979-01-01
Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)
Qurollo, Barbara A; Archer, Nikole R; Schreeg, Megan E; Marr, Henry S; Birkenheuer, Adam J; Haney, Kaitlin N; Thomas, Brittany S; Breitschwerdt, Edward B
2017-03-07
Babesiosis is a protozoal, tick transmitted disease found worldwide in humans, wildlife and domesticated animals. Commonly used approaches to diagnose babesiosis include microscopic examination of peripheral blood smears, detection of circulating antibodies and PCR. To screen and differentiate canine Babesia infections many PCR assays amplify the 18S rRNA gene. These sequences contain hypervariable regions flanked by highly conserved regions allowing for amplification of a broad-range of Babesia spp. However, differences in the 18S rRNA gene sequence of distantly related clades can make it difficult to design assays that will amplify all Babesia species while excluding the amplification of other eukaryotes. By targeting Babesia mitochondrial genome (mtDNA), we designed a novel three primer qPCR with greater sensitivity and broader screening capabilities to diagnose and differentiate Babesia spp. Using 13 Babesia mtDNA sequences, a region spanning two large subunit rRNA gene fragments (lsu5-lsu4) was aligned to design three primers for use in a qPCR assay (LSU qPCR) capable of amplifying a wide range of Babesia spp. Plasmid clones were generated and used as standards to determine efficiency, linear dynamic range and analytical sensitivity. Animals naturally infected with vector-borne pathogens were tested retrospectively and prospectively to determine relative clinical sensitivity and specificity by comparing the LSU qPCR to an established 18S rDNA qPCR. The LSU qPCR efficiencies ranged between 92 and 100% with the limit of detection at five copies/reaction. The assay did not amplify mammalian host or other vector-borne pathogen gDNA except Cytauxzoon felis (a feline protozoal pathogen). The LSU qPCR assay amplified 12 different Babesia. sp. and C. felis from 31/31 (100%) archived samples, whereas the 18S qPCR amplified only 26/31 (83.9%). By prospective analysis, 19/394 diagnostic accessions (4.8%) were LSU qPCR positive, compared to 11/394 (2.8%) 18S rDNA q
Serafini, R; Varner, D D; Bissett, W; Blanchard, T L; Teague, S R; Love, C C
2015-09-15
Unilateral orchiectomy (UO) may interfere with thermoregulation of the remaining testis caused by inflammation surrounding the incision site, thus altering normal spermatogenesis and consequently sperm quality. Two measures of sperm DNA quality (neutral comet assay and the sperm chromatin structure assay [SCSA]) were compared before UO (0 days) and at 14, 30, and 60 days after UO to determine whether sperm DNA changed after a mild testis stress (i.e., UO). The percent DNA in the comet tail was higher at 14 and 60 days compared to 0 days (P comet tail measures (i.e., length, moment, migration) were higher at all time periods after UO compared to 0 days (P comet assay and the SCSA, which was not identified using traditional measures of sperm quality. Copyright © 2015 Elsevier Inc. All rights reserved.
Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko
2013-01-01
A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.
Polymerase chain reaction assay for the detection of Bacillus cereus group cells
DEFF Research Database (Denmark)
Hansen, Bjarne Munk; Leser, Thomas D.; Hendriksen, Niels Bohse
2001-01-01
of the B. cereus group in food and in the environment. Using 16S rDNA as target, a PCR assay for the detection of B. cereus group cells has been developed. Primers specific for the 16S rDNA of the B. cereus group bacteria were selected and used in combination with consensus primers for 165 rDNA as internal...... PCR procedure control. The PCR procedure was optimized with respect to annealing temperature. When DNA from the B. cereus group bacteria was present, the PCR assay yielded a B. cereus specific fragment, while when non-B. cereus prokaryotic DNA was present, the consensus 165 rDNA primers directed...
Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet
2018-03-23
To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.
Energy Technology Data Exchange (ETDEWEB)
Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor
2001-09-15
We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.
Holley, W. R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the
International Nuclear Information System (INIS)
Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.
1986-01-01
The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides
Energy Technology Data Exchange (ETDEWEB)
Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)
2012-06-01
Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.
Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias
2013-09-24
Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.
Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A
2012-08-01
In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.
2015-01-01
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. PMID:25155200
DNA Damage among Wood Workers Assessed with the Comet Assay
Bruschweiler, Evin Danisman; Wild, Pascal; Huynh, Cong Khanh; Savova-Bianchi, Dessislava; Danuser, Brigitta; Hopf, Nancy B.
2016-01-01
Exposure to wood dust, a human carcinogen, is common in wood-related industries, and millions of workers are occupationally exposed to wood dust worldwide. The comet assay is a rapid, simple, and sensitive method for determining DNA damage. The objective of this study was to investigate the DNA damage associated with occupational exposure to wood dust using the comet assay (peripheral blood samples) among nonsmoking wood workers (n = 31, furniture and construction workers) and controls (n = 19). DNA damage was greater in the group exposed to composite wood products compared to the group exposed to natural woods and controls (P < 0.001). No difference in DNA damage was observed between workers exposed to natural woods and controls (P = 0.13). Duration of exposure and current dust concentrations had no effect on DNA damage. In future studies, workers’ exposures should include cumulative dust concentrations and exposures originating from the binders used in composite wood products. PMID:27398027
DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.
Elmroth, Kecke; Stenerlöw, Bo
2005-04-01
The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.
Extraction, amplification and detection of DNA in microfluidic chip-based assays
Wu, Jinbo
2013-12-20
This review covers three aspects of PCR-based microfluidic chip assays: sample preparation, target amplification, and product detection. We also discuss the challenges related to the miniaturization and integration of each assay and make a comparison between conventional and microfluidic schemes. In order to accomplish these essential assays without human intervention between individual steps, the micro-components for fluid manipulation become critical. We therefore summarize and discuss components such as microvalves (for fluid regulation), pumps (for fluid driving) and mixers (for blending fluids). By combining the above assays and microcomponents, DNA testing of multi-step bio-reactions in microfluidic chips may be achieved with minimal external control. The combination of assay schemes with the use of micro-components also leads to rapid methods for DNA testing via multi-step bioreactions. Contains 259 references.
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA
International Nuclear Information System (INIS)
Yakura, Kimitaka; Tanifuji, Shigeyuki.
1983-01-01
EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)
Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.
Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F
1976-09-01
Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.
Birla, Bhagyashree S; Chou, Hui-Hsien
2015-01-01
Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Directory of Open Access Journals (Sweden)
Bhagyashree S Birla
Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Wehrmann, A; Eggeling, L; Sahm, H
1994-12-01
In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.
Nature of defects produced on thymine fragment by gamma irradiation of DNA
International Nuclear Information System (INIS)
Teoule, R.; Bonicel, A.
1975-01-01
A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions
ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH
CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of
Homology of yeast photoreactivating gene fragment with human genomic digests
International Nuclear Information System (INIS)
Meechan, P.J.; Milam, K.M.; Cleaver, J.E.
1984-01-01
Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes
Evaluation of assays for quantification of DNA in canine plasma as an indirect marker of NETosis.
Smith, Stephanie A; Lawson, Corinne M; McMichael, Maureen A; Jung, Katrina; O'Brien, Mauria; Achiel, Ron
2017-06-01
Neutrophil extracellular traps (NET), consisting of a filamentous DNA/chromatin-histone scaffold originating from neutrophils are part of the innate immune response, may be released under a variety of inflammatory conditions and are associated with an increased risk for thrombosis. The purpose of this study was to evaluate a SYTOX green fluorescence assay and a histone-DNA complex (hisDNA) ELISA for quantification of NET-related DNA in canine plasma. The influence of variations in blood sample handling on assay results was tested. Accuracy of the SYTOX green fluorescence and the hisDNA ELISA was evaluated with dilutional linearity using serial dilutions. Interference was assessed by addition of purified bilirubin or hemoglobin. Precision was determined by calculating the intra- and inter-assay CV. Preanalytic sample handling did not influence DNA measurements by either assay. Citrate and EDTA plasma samples were equivalent. For the DNA fluorescence assay, dilutional linearity was poor due to autofluorescence, which was corrected by addition of canine plasma to the diluent. The presence of bilirubin and hemoglobin also increased autofluorescence, and resulted in falsely low concentrations of DNA. On the hisDNA ELISA, pigmentemia had no effect. Both assays as modified in this study are suitable for measuring DNA in canine EDTA or citrate plasma. However, performance of the fluorescence assay was impacted by pigmentemia, and it was less sensitive than the ELISA in detecting the presence of nucleosome material in the plasma. © 2017 American Society for Veterinary Clinical Pathology.
Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms
Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.
1987-01-01
DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers
An ECVAG trial on assessment of oxidative damage to DNA measured by the comet assay
DEFF Research Database (Denmark)
Johansson, Clara; Møller, Peter; Forchhammer, Lykke
2010-01-01
The increasing use of single cell gel electrophoresis (the comet assay) highlights its popularity as a method for detecting DNA damage, including the use of enzymes for assessment of oxidatively damaged DNA. However, comparison of DNA damage levels between laboratories can be difficult due...... to differences in assay protocols (e.g. lysis conditions, enzyme treatment, the duration of the alkaline treatment and electrophoresis) and in the end points used for reporting results (e.g. %DNA in tail, arbitrary units, tail moment and tail length). One way to facilitate comparisons is to convert primary comet...... assay end points to number of lesions/10(6) bp by calibration with ionizing radiation. The aim of this study was to investigate the inter-laboratory variation in assessment of oxidatively damaged DNA by the comet assay in terms of oxidized purines converted to strand breaks with formamidopyrimidine DNA...
Wang, Dan; Xie, Jiangbi; Zhu, Xiaocui; Li, Jinqiu; Zhao, Dongqin; Zhao, Meiping
2014-05-15
In this work, we demonstrate a novel estrogenic receptor fragment-based homogeneous fluorescent assay which enables rapid and sensitive detection of 17β-estradiol (E2) and other highly potent estrogens. A modified human estrogenic receptor fragment (N-His × 6-hER270-595-C-Strep tag II) has been constructed that contains amino acids 270-595 of wild-type human estrogenic receptor α (hER270-595) and two specific tags (6 × His and Strep tag II) fused to the N and C terminus, respectively. The designed receptor protein fragment could be easily produced by prokaryotic expression with high yield and high purity. The obtained protein exhibits high binding affinity to E2 and the two tags greatly facilitate the application of the recombinant protein. Taking advantage of the unique spectroscopic properties of coumestrol (CS), a fluorescent phytoestrogen, a CS/hER270-595-based fluorescent assay has been developed which can sensitively respond to E2 within 1.0 min with a linear working range from 0.1 to 20 ng/mL and a limit of detection of 0.1 ng/mL. The assay was successfully applied for rapid detection of E2 in the culture medium of rat hippocampal neurons. The method also holds great potential for high-throughput monitoring the variation of estrogen levels in complex biological fluids, which is crucial for investigation of the molecular basis of various estrogen-involved processes. Copyright © 2013 Elsevier B.V. All rights reserved.
Utilization of DNA comet assay and half embryo test to identify irradiated lentil
International Nuclear Information System (INIS)
Romanelli, Maria Fernanda; Villavicencio, Anna Lucia C.H.
2001-01-01
Full text: Legumes make an important contribution to human nutrition on a worldwide basis. Insect infestation cause extensive damage to stored grains. Over the last few decades some countries adopted food irradiation as a safe food process. Radiation's processing on foods improves hygienic quality and extends their shelf life. The use of radiation treatment to reduce the microbial population and thereby extend the shelf life in legumes has been reported in many papers. Irradiation has been shown to be an effective pest control method for these commodities and a good alternative to prohibited methyl bromide. Radiation disinfestation can facilitate trade in foods that often harbor insect pests of quarantine importance. Although the wholesomeness of irradiated food is no longer a question there is a need for irradiation control in the international trade of foods, in order to enhance the consumer confidence in the regulation. As a screening methods to identify irradiated lentils, processed by e-beam as a food treatment to disinfestation, the DNA Comet Assay and Half Embryo tests were performed. The methodologies used in this work are based upon biological changes that occur in Brazilian lentils. The samples were irradiated in an electron beam accelerator facility of Radiation Dynamics Inc., USA (E=1,5 MeV, l=25 mA). The irradiation doses were 0,7; 1,4 and 3,0 kGy at dry conditions. The thickness of samples was less than 0,5 cm. A sensitive technique to detect DNA fragmentation is the microgel electrophoresis of single cells or nuclei, also called 'comet assay'. Since the large molecule of DNA is an easy target for ionizing radiation, changes in DNA offer potential as a detection method. It is restricted to foods that have not been subjected to heat or other treatments, which also cause DNA fragmentation. Lentil samples were crushed with a mortar and pestle and was transferred to 3ml ice-cold PBS. This suspension was stirred for 5 minutes and filtered. 100μl cell
DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line
Directory of Open Access Journals (Sweden)
Saeed Samarghandian
2013-01-01
Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 0.07 and 6.4 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.
Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua
2012-03-01
The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.
Aigrain, Louise; Gu, Yong; Quail, Michael A
2016-06-13
The emergence of next-generation sequencing (NGS) technologies in the past decade has allowed the democratization of DNA sequencing both in terms of price per sequenced bases and ease to produce DNA libraries. When it comes to preparing DNA sequencing libraries for Illumina, the current market leader, a plethora of kits are available and it can be difficult for the users to determine which kit is the most appropriate and efficient for their applications; the main concerns being not only cost but also minimal bias, yield and time efficiency. We compared 9 commercially available library preparation kits in a systematic manner using the same DNA sample by probing the amount of DNA remaining after each protocol steps using a new droplet digital PCR (ddPCR) assay. This method allows the precise quantification of fragments bearing either adaptors or P5/P7 sequences on both ends just after ligation or PCR enrichment. We also investigated the potential influence of DNA input and DNA fragment size on the final library preparation efficiency. The overall library preparations efficiencies of the libraries show important variations between the different kits with the ones combining several steps into a single one exhibiting some final yields 4 to 7 times higher than the other kits. Detailed ddPCR data also reveal that the adaptor ligation yield itself varies by more than a factor of 10 between kits, certain ligation efficiencies being so low that it could impair the original library complexity and impoverish the sequencing results. When a PCR enrichment step is necessary, lower adaptor-ligated DNA inputs leads to greater amplification yields, hiding the latent disparity between kits. We describe a ddPCR assay that allows us to probe the efficiency of the most critical step in the library preparation, ligation, and to draw conclusion on which kits is more likely to preserve the sample heterogeneity and reduce the need of amplification.
Directory of Open Access Journals (Sweden)
Beiyu Liu
2009-09-01
Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.
DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing
Directory of Open Access Journals (Sweden)
Jackson Stuart
2010-04-01
Full Text Available Abstract Background DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. Results We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. Conclusion The described assay outputs absolute copy number, outputs an error estimate (p-value, and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads.
DNA Comet Assay. A simple screening technique for identification of some irradiated foods
International Nuclear Information System (INIS)
Khan, A.A.; Khan, H.M.
2008-01-01
DNA Comet Assay method was carried out to detect irradiation treatment of some foods like meat, spices, beans and lentils. The fresh meat of cow and duck were irradiated up to radiation doses of 3 kGy, the spices (cardamoms and cumin black) were irradiated to radiation doses of 5, 10, 15 and 20 kGy while the beans (black beans and white beans) and lentils (red and green lentils) were irradiated to 0.5 and 1 kGy. All the foods were then analyzed for radiation treatment using simple microgel electrophoresis of single cells or nuclei (DNA Comet Assay). Sedimentation, lysis and staining times were adjusted to get optimized conditions for correct and easy analysis of each food. Using these optimized conditions, it was found out that radiation damaged DNA showed comets in case of irradiated food samples, whereas in non-treated food samples, round or conical spots of stained DNA were visible. Shape, length and intensity of these comets were also radiation dose dependent. Screening of unirradiated and irradiated samples by Comet Assay was successful in the case of all the foods under consideration under the optimized conditions of assay. Therefore, for different kinds of irradiated foods studied in the present study, the DNA Comet Assay can be used as a rapid, simple and inexpensive screening test. (author)
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Hašplová, Katarína; Hudecová, Alexandra; Magdolénová, Zuzana; Bjøras, Magnar; Gálová, Eliška; Miadoková, Eva; Dušinská, Mária
2012-01-05
3-methyladenine DNA glycosylase (AlkD) belongs to a new family of DNA glycosylases; it initiates repair of cytotoxic and promutagenic alkylated bases (its main substrates being 3-methyladenine and 7-methylguanine). The modification of the comet assay (single cell gel electrophoresis) using AlkD enzyme thus allows assessment of specific DNA alkylation lesions. The resulting baseless sugars are alkali-labile, and under the conditions of the alkaline comet assay they appear as DNA strand breaks. The alkylating agent methyl methanesulfonate (MMS) was used to induce alkylation lesions and to optimize conditions for the modified comet assay method with AlkD on human lymphoblastoid (TK6) cells. We also studied cellular and in vitro DNA repair of alkylated bases in DNA in TK6 cells after treatment with MMS. Results from cellular repair indicate that 50% of DNA alkylation is repaired in the first 60 min. The in vitro repair assay shows that while AlkD recognises most alkylation lesions after 60 min, a cell extract from TK6 cells recognises most of the MMS-induced DNA adducts already in the first 15 min of incubation, with maximum detection of lesions after 60 min' incubation. Additionally, we tested the in vitro repair capacity of human lymphocyte extracts from 5 individuals and found them to be able to incise DNA alkylations in the same range as AlkD. The modification of the comet assay with AlkD can be useful for in vitro and in vivo genotoxicity studies to detect alkylation damage and repair and also for human biomonitoring and molecular epidemiology studies. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W
1991-01-01
Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.
A force-based, parallel assay for the quantification of protein-DNA interactions.
Limmer, Katja; Pippig, Diana A; Aschenbrenner, Daniela; Gaub, Hermann E
2014-01-01
Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA), parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.
A force-based, parallel assay for the quantification of protein-DNA interactions.
Directory of Open Access Journals (Sweden)
Katja Limmer
Full Text Available Analysis of transcription factor binding to DNA sequences is of utmost importance to understand the intricate regulatory mechanisms that underlie gene expression. Several techniques exist that quantify DNA-protein affinity, but they are either very time-consuming or suffer from possible misinterpretation due to complicated algorithms or approximations like many high-throughput techniques. We present a more direct method to quantify DNA-protein interaction in a force-based assay. In contrast to single-molecule force spectroscopy, our technique, the Molecular Force Assay (MFA, parallelizes force measurements so that it can test one or multiple proteins against several DNA sequences in a single experiment. The interaction strength is quantified by comparison to the well-defined rupture stability of different DNA duplexes. As a proof-of-principle, we measured the interaction of the zinc finger construct Zif268/NRE against six different DNA constructs. We could show the specificity of our approach and quantify the strength of the protein-DNA interaction.
The comet assay: assessment of in vitro and in vivo DNA damage.
Bajpayee, Mahima; Kumar, Ashutosh; Dhawan, Alok
2013-01-01
Rapid industrialization and pursuance of a better life have led to an increase in the amount of chemicals in the environment, which are deleterious to human health. Pesticides, automobile exhausts, and new chemical entities all add to air pollution and have an adverse effect on all living organisms including humans. Sensitive test systems are thus required for accurate hazard identification and risk assessment. The Comet assay has been used widely as a simple, rapid, and sensitive tool for assessment of DNA damage in single cells from both in vitro and in vivo sources as well as in humans. Already, the in vivo comet assay has gained importance as the preferred test for assessing DNA damage in animals for some international regulatory guidelines. The advantages of the in vivo comet assay are its ability to detect DNA damage in any tissue, despite having non-proliferating cells, and its sensitivity to detect genotoxicity. The recommendations from the international workshops held for the comet assay have resulted in establishment of guidelines. The in vitro comet assay conducted in cultured cells and cell lines can be used for screening large number of compounds and at very low concentrations. The in vitro assay has also been automated to provide a high-throughput screening method for new chemical entities, as well as environmental samples. This chapter details the in vitro comet assay using the 96-well plate and in vivo comet assay in multiple organs of the mouse.
The electrophoretic mobility shift assay (EMSA)
sprotocols
2015-01-01
The electrophoretic mobility shift assay (EMSA), also known as “gel shift assay”, is used to examine the binding parameters and relative affinities of protein and DNA interactions. We produced recombinant CCA1 protein and tested its binding affinity for the promoter fragments that contain CBS (AAAAATCT) or evening element (EE, AAAATATCT) (1) using a modified procedure adopted from published protocols (2,3).
Leopol'd, A V; Baklaushev, V P; Korchagina, A A; Shein, S A; Grinenko, N F; Pavlov, K A; Ryabukhin, I A; Chekhonin, V P
2012-04-01
cDNA encoding VEGF and Ig-like extracellular domains 2-4 of VEGFR-1 (sFlt-1(2-4)) were cloned into prokaryotic expression vectors pET32a and pQE60. Recombinant proteins were purified (metal affinity chromatography) and renatured. Chemiluminescent study for the interaction of recombinant VEGF and sFlt-1(2-4) showed that biotinylated VEGF specifically binds to the polystyrene-immobilized receptor extracellular fragment. Biotinylated recombinant sFlt-1 interacts with immobilized VEGF. Analysis of the interaction of immobilized recombinant VEGFR-1 and VEGF with C6 glioma cells labeled with CFDA-SE (vital fluorescent dye) showed that recombinant VEGFR-1 also binds to native membrane-associated VEGF. Recombinant VEGF was shown to bind to specific receptors expressed on the surface of C6 glioma cells. Functional activity of these proteins was confirmed by ligand-receptor assay for VEGF and VEGFR-1 (sFlt-1) and quantitative chemiluminescent detection.
Zhao, Jian; Li, Hongli; Zhai, Qingfeng; Qiu, Yugang; Niu, Yong; Dai, Yufei; Zheng, Yuxin; Duan, Huawei
2014-03-01
The aim of this study was to investigate the use of the lesion-specific endonucleases-modified comet assay for analysis of DNA oxidation in cell lines. DNA breaks and oxidative damage were evaluated by normal alkaline and formamidopyrimidine-DNA-glycosylase (FPG) modified comet assays. Cytotoxicity were assessed by MTT method. The human bronchial epithelial cell (16HBE) were treated with benzo (a) pyrene (B(a)P), methyl methanesulfonate (MMS), colchicine (COL) and vincristine (VCR) respectively, and the dose is 20 µmol/L, 25 mg/ml, 5 mg/L and 0.5 mg/L for 24 h, respectively. Oxidative damage was also detected by levels of reactive oxygen species in treated cells. Four genotoxicants give higher cytotoxicity and no significant changes on parameters of comet assay treated by enzyme buffer. Cell survival rate were (59.69 ± 2.60) %, (54.33 ± 2.81) %, (53.11 ± 4.00) %, (51.43 ± 3.92) % in four groups, respectively. There was the direct DNA damage induced by test genotoxicants presented by tail length, Olive tail moment (TM) and tail DNA (%) in the comet assay. The presence of FPG in the assays increased DNA migration in treated groups when compared to those without it, and the difference was statistically significant which indicated that the clastogen and aneugen could induce oxidative damage in DNA strand. In the three parameters, the Olive TM was changed most obviously after genotoxicants treatment. In the contrast group, the Olive TM of B(a) P,MMS, COL,VCR in the contrast groups were 22.99 ± 17.33, 31.65 ± 18.86, 19.86 ± 9.56 and 17.02 ± 9.39, respectively, after dealing with the FPG, the Olive TM were 34.50 ± 17.29, 43.80 ± 10.06, 33.10 ± 12.38, 28.60 ± 10.53, increased by 58.94%, 38.48%, 66.86% and 68.21%, respectively (t value was 3.91, 3.89, 6.66 and 3.87, respectively, and all P comet assay appears more specific for detecting oxidative DNA damage induced by genotoxicants exposure, and the application of comet assay will be expanded. The endonuclease
Identification of irradiated pepper with comet assay
International Nuclear Information System (INIS)
Prieto Miranda, Enrique Fco.; Moreno Alvarez, Damaris L.; Carro Palacio, Sandra; Iglesia Enriquez, Isora
2007-01-01
The treatment of foods with ionizing radiations is a technological process utilized in order to increase the hygienic quality and the storage time of the foods. Several methods of detection of irradiated foods have been recommended. The comet assay of DNA is one fast and economical technique for the qualitative identification of irradiated foods. The objective of the present paper was to identify with the comet assay technique the modifications of the DNA molecule of irradiated pepper storage at environment and refrigeration temperatures and different post-irradiation times for different absorbed dose values, (0.1, 0.3 and 0.5 kGy). It was demonstrated that for the high absorbed dose values was observed a greater break into fragments of the DNA molecule, which shows the application of this technique for the identification of irradiated foods. (author)
International Nuclear Information System (INIS)
Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut
2011-01-01
Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.
DNA hybridization sensing for cytogenetic analysis
DEFF Research Database (Denmark)
Kwasny, Dorota; Dapra, Johannes; Brøgger, Anna Line
2013-01-01
are rearrangements between two chromosome arms that results in two derivative chromosomes having a mixed DNA sequence. The current detection method is a Fluorescent In situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the DNA sequences of two chromosomes involved...... in the translocation (Kwasny et al., 2012). We have developed a new double hybridization assay that allows for sorting of the DNA chromosomal fragments into separate compartment, moreover allowing for detection of the translocation. To detect the translocation it is necessary to determine that the two DNA sequences...... forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The first example of the translocation detection was presented on lab-on-a-disc using fluorescently labeled DNA fragments, representing the derivative chromosome (Brøgger et al., 2012). To allow...
A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS
One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...
Measuring oxidative damage to DNA and its repair with the comet assay.
Collins, Andrew R
2014-02-01
Single cell gel electrophoresis, or the comet assay, was devised as a sensitive method for detecting DNA strand breaks, at the level of individual cells. A simple modification, incorporating a digestion of DNA with a lesion-specific endonuclease, makes it possible to measure oxidised bases. With the inclusion of formamidopyrimidine DNA glycosylase to recognise oxidised purines, or Nth (endonuclease III) to detect oxidised pyrimidines, the comet assay has been used extensively in human biomonitoring to monitor oxidative stress, usually in peripheral blood mononuclear cells. There is evidence to suggest that the enzymic approach is more accurate than chromatographic methods, when applied to low background levels of base oxidation. However, there are potential problems of over-estimation (because the enzymes are not completely specific) or under-estimation (failure to detect lesions that are close together). Attempts have been made to improve the inter-laboratory reproducibility of the comet assay. In addition to measuring DNA damage, the assay can be used to monitor the cellular or in vitro repair of strand breaks or oxidised bases. It also has applications in assessing the antioxidant status of cells. In its various forms, the comet assay is now an invaluable tool in human biomonitoring and genotoxicity testing. This article is part of a Special Issue entitled Current methods to study reactive oxygen species - pros and cons and biophysics of membrane proteins. Guest Editor: Christine Winterbourn. Copyright © 2013 Elsevier B.V. All rights reserved.
A non-isotopic assay uses bromouridine and RNA synthesis to detect DNA damage responses.
Hasegawa, Mayu; Iwai, Shigenori; Kuraoka, Isao
2010-06-17
Individuals with inherited xeroderma pigmentosum (XP) disorder and Cockayne syndrome (CS) are deficient in nucleotide excision repair and experience hypersensitivity to sunlight. Although there are several diagnostic assays for these disorders, the recovery of RNA synthesis (RRS) assay that can discriminate between XP cells and CS cells is very laborious. Here, we report on a novel non-radioisotope RRS assay that uses bromouridine (a uridine analog) as an alternative to (3)H-uridine. This assay can easily detect RNA polymerase I transcription in nucleoli and RNA polymerase II transcription in nuclei. The non-RI RSS assay also can rapidly detect normal RRS activity in HeLa cells. Thus, this assay is useful as a novel and easy technique for CS diagnosis. Because RRS is thought to be related to transcription-coupled DNA repair, which is triggered by the blockage of transcriptional machinery by DNA lesions, this assay may be of use for analysis of DNA repair, transcription, and/or genetic toxicity. Copyright 2010 Elsevier B.V. All rights reserved.
An eDNA Assay to Monitor a Globally Invasive Fish Species from Flowing Freshwater.
Adrian-Kalchhauser, Irene; Burkhardt-Holm, Patricia
2016-01-01
Ponto-Caspian gobies are a flock of five invasive fish species that have colonized freshwaters and brackish waters in Europe and North America. One of them, the round goby Neogobius melanostomus, figures among the 100 worst invaders in Europe. Current methods to detect the presence of Ponto-Caspian gobies involve catching or sighting the fish. These approaches are labor intense and not very sensitive. Consequently, populations are usually detected only when they have reached high densities and when management or containment efforts are futile. To improve monitoring, we developed an assay based on the detection of DNA traces (environmental DNA, or eDNA) of Ponto-Caspian gobies in river water. The assay specifically detects invasive goby DNA and does not react to any native fish species. We apply the assay to environmental samples and demonstrate that parameters such as sampling depth, sampling location, extraction protocol, PCR protocol and PCR inhibition greatly impact detection. We further successfully outline the invasion front of Ponto-Caspian gobies in a large river, the High Rhine in Switzerland, and thus demonstrate the applicability of the assay to lotic environments. The eDNA assay requires less time, equipment, manpower, skills, and financial resources than the conventional monitoring methods such as electrofishing, angling or diving. Samples can be taken by untrained individuals, and the assay can be performed by any molecular biologist on a conventional PCR machine. Therefore, this assay enables environment managers to map invaded areas independently of fishermen's' reports and fish community monitorings.
Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M
1986-09-01
The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.
International Nuclear Information System (INIS)
Hahn, P.J.; Giddings, L.; Lane, M.J.
1989-01-01
Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes
[Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].
Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D
2011-01-01
The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
International Nuclear Information System (INIS)
Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie
2012-01-01
Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins
Energy Technology Data Exchange (ETDEWEB)
Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)
2012-04-20
Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.
Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation
International Nuclear Information System (INIS)
Wei Kang; Liu Xueying; Zhu Xuefen
1984-01-01
The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)
Micropatterned comet assay enables high throughput and sensitive DNA damage quantification.
Ge, Jing; Chow, Danielle N; Fessler, Jessica L; Weingeist, David M; Wood, David K; Engelward, Bevin P
2015-01-01
The single cell gel electrophoresis assay, also known as the comet assay, is a versatile method for measuring many classes of DNA damage, including base damage, abasic sites, single strand breaks and double strand breaks. However, limited throughput and difficulties with reproducibility have limited its utility, particularly for clinical and epidemiological studies. To address these limitations, we created a microarray comet assay. The use of a micrometer scale array of cells increases the number of analysable comets per square centimetre and enables automated imaging and analysis. In addition, the platform is compatible with standard 24- and 96-well plate formats. Here, we have assessed the consistency and sensitivity of the microarray comet assay. We showed that the linear detection range for H2O2-induced DNA damage in human lymphoblastoid cells is between 30 and 100 μM, and that within this range, inter-sample coefficient of variance was between 5 and 10%. Importantly, only 20 comets were required to detect a statistically significant induction of DNA damage for doses within the linear range. We also evaluated sample-to-sample and experiment-to-experiment variation and found that for both conditions, the coefficient of variation was lower than what has been reported for the traditional comet assay. Finally, we also show that the assay can be performed using a 4× objective (rather than the standard 10× objective for the traditional assay). This adjustment combined with the microarray format makes it possible to capture more than 50 analysable comets in a single image, which can then be automatically analysed using in-house software. Overall, throughput is increased more than 100-fold compared to the traditional assay. Together, the results presented here demonstrate key advances in comet assay technology that improve the throughput, sensitivity, and robustness, thus enabling larger scale clinical and epidemiological studies. © The Author 2014. Published by
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
How to evaluate PCR assays for the detection of low-level DNA
DEFF Research Database (Denmark)
Banch-Clausen, Frederik; Urhammer, Emil; Rieneck, Klaus
2015-01-01
distribution describing parameters for singleplex real-time PCR-based detection of low-level DNA. The model was tested against experimental data of diluted cell-free foetal DNA. Also, the model was compared with a simplified formula to enable easy predictions. The model predicted outcomes that were...... not significantly different from experimental data generated by testing of cell-free foetal DNA. Also, the simplified formula was applicable for fast and accurate assay evaluation. In conclusion, the model can be applied for evaluation of sensitivity of real-time PCR-based detection of low-level DNA, and may also......High sensitivity of PCR-based detection of very low copy number DNA targets is crucial. Much focus has been on design of PCR primers and optimization of the amplification conditions. Very important are also the criteria used for determining the outcome of a PCR assay, e.g. how many replicates...
International Nuclear Information System (INIS)
Zhu Shoupeng; Xiao Dong; Han Xiaofeng
1997-01-01
The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis
Evaluation of the Branched-Chain DNA Assay for Measurement of RNA in Formalin-Fixed Tissues
Knudsen, Beatrice S.; Allen, April N.; McLerran, Dale F.; Vessella, Robert L.; Karademos, Jonathan; Davies, Joan E.; Maqsodi, Botoul; McMaster, Gary K.; Kristal, Alan R.
2008-01-01
We evaluated the branched-chain DNA (bDNA) assay QuantiGene Reagent System to measure RNA in formalin-fixed, paraffin-embedded (FFPE) tissues. The QuantiGene Reagent System does not require RNA isolation, avoids enzymatic preamplification, and has a simple workflow. Five selected genes were measured by bDNA assay; quantitative polymerase chain reaction (qPCR) was used as a reference method. Mixed-effect statistical models were used to partition the overall variance into components attributable to xenograft, sample, and assay. For FFPE tissues, the coefficients of reliability were significantly higher for the bDNA assay (93–100%) than for qPCR (82.4–95%). Correlations between qPCRFROZEN, the gold standard, and bDNAFFPE ranged from 0.60 to 0.94, similar to those from qPCRFROZEN and qPCRFFPE. Additionally, the sensitivity of the bDNA assay in tissue homogenates was 10-fold higher than in purified RNA. In 9- to 13-year-old blocks with poor RNA quality, the bDNA assay allowed the correct identification of the overexpression of known cancer genes. In conclusion, the QuantiGene Reagent System is considerably more reliable, reproducible, and sensitive than qPCR, providing an alternative method for the measurement of gene expression in FFPE tissues. It also appears to be well suited for the clinical analysis of FFPE tissues with diagnostic or prognostic gene expression biomarker panels for use in patient treatment and management. PMID:18276773
Improved sensitivity of circulating tumor DNA measurement using short PCR amplicons
DEFF Research Database (Denmark)
Andersen, Rikke Fredslund; Spindler, Karen-Lise Garm; Brandslund, Ivan
2015-01-01
, however, presents a number of challenges that require attention. The amount of DNA is low and highly fragmented and analyses need to be optimized accordingly. KRAS ARMS-qPCR assays with amplicon lengths of 120 and 85 base pairs, respectively, were compared using positive control material (PCR fragments...
Using a medium-throughput comet assay to evaluate the global DNA methylation status of single cells
Lewies, Angélique; Van Dyk, Etresia; Wentzel, Johannes F.; Pretorius, Pieter J.
2014-01-01
The comet assay is a simple and cost effective technique, commonly used to analyze and quantify DNA damage in individual cells. The versatility of the comet assay allows introduction of various modifications to the basic technique. The difference in the methylation sensitivity of the isoschizomeric restriction enzymes HpaII and MspI are used to demonstrate the ability of the comet assay to measure the global DNA methylation level of individual cells when using cell cultures. In the experiments described here, a medium-throughput comet assay and methylation sensitive comet assay are combined to produce a methylation sensitive medium-throughput comet assay to measure changes in the global DNA methylation pattern in individual cells under various growth conditions. PMID:25071840
Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas
1996-01-01
For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.
Directory of Open Access Journals (Sweden)
Jiabing Ji
Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.
International Nuclear Information System (INIS)
Ciereszko, Andrzej; Wolfe, Tobie D.; Dabrowski, Konrad
2005-01-01
In this study we sought to demonstrate that Comet assay can be applied to sea lamprey sperm DNA fragmentation and used to describe the relationship between sperm DNA damage and sperm fertilizing ability. We show that the assay can be used reliably and accurately, and unlike in the case of mammals, there is no need for additional steps related to improvement of efficacy of lysis and DNA decondensation. This agrees with the presence of histone proteins in lamprey sperm. An increase in DNA fragmentation was noted during short-term storage of milt on ice (0-4 days). We demonstrated genotoxic effects of UV radiation and oxidative stress (exposure to hydrogen peroxide) and found that oxidative damage to sperm DNA was likely repaired after fertilization in the embryo. Repairing capacity of the oocyte toward sperm DNA lesions caused by UV was restricted. Toxic effect of p,p-bis-(1-aziridinyl)-N-methylphosphinothioic acid (p,p-bis(1-aziridinyl)-N-methylphosphinothioic amide), a sea lamprey chemosterilant, could not be linked to DNA fragmentation in the in vitro tests. Its genotoxicity in vivo may possibly be associated with other mechanisms of DNA degradation (oxidation or DNA-protein and DNA-DNA cross-linking). In conclusion, this study demonstrates that Comet assay can be successfully applied to monitor effects of environmental disturbances and imposed injuries in sea lamprey spermatozoa and possibly other species of ancient fish with acrosomal sperm
Energy Technology Data Exchange (ETDEWEB)
Ciereszko, Andrzej [School of Natural Resources, Ohio State University, 210 Kottman Hall, 2021 Coffey Rd., Columbus, OH 434210 (United States); Semen Biology Group, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, 10-747 Olsztyn (Poland); Wolfe, Tobie D. [School of Natural Resources, Ohio State University, 210 Kottman Hall, 2021 Coffey Rd., Columbus, OH 434210 (United States); Dabrowski, Konrad [School of Natural Resources, Ohio State University, 210 Kottman Hall, 2021 Coffey Rd., Columbus, OH 434210 (United States)]. E-mail: dabrowski.1@osu.edu
2005-06-15
In this study we sought to demonstrate that Comet assay can be applied to sea lamprey sperm DNA fragmentation and used to describe the relationship between sperm DNA damage and sperm fertilizing ability. We show that the assay can be used reliably and accurately, and unlike in the case of mammals, there is no need for additional steps related to improvement of efficacy of lysis and DNA decondensation. This agrees with the presence of histone proteins in lamprey sperm. An increase in DNA fragmentation was noted during short-term storage of milt on ice (0-4 days). We demonstrated genotoxic effects of UV radiation and oxidative stress (exposure to hydrogen peroxide) and found that oxidative damage to sperm DNA was likely repaired after fertilization in the embryo. Repairing capacity of the oocyte toward sperm DNA lesions caused by UV was restricted. Toxic effect of p,p-bis-(1-aziridinyl)-N-methylphosphinothioic acid (p,p-bis(1-aziridinyl)-N-methylphosphinothioic amide), a sea lamprey chemosterilant, could not be linked to DNA fragmentation in the in vitro tests. Its genotoxicity in vivo may possibly be associated with other mechanisms of DNA degradation (oxidation or DNA-protein and DNA-DNA cross-linking). In conclusion, this study demonstrates that Comet assay can be successfully applied to monitor effects of environmental disturbances and imposed injuries in sea lamprey spermatozoa and possibly other species of ancient fish with acrosomal sperm.
Hybrid male sterility is caused by mitochondrial DNA deletion.
Hayashida, Kenji; Kohno, Shigeru
2009-07-01
Although it is known that the hybrid male mouse is sterile just like any other animal's heterogametic sex, the reason why only the male germ cells are impaired has yet to be discovered. TdT-mediated dUTP nick end labeling assay using a confocal fluorescence microscope and DNA fragmentation assay of hybrid testis indicated destruction of the mitochondrial DNA (mtDNA) rather than the nuclear DNA. Previously we reported that maternal mtDNA inheritance is through selective sperm mtDNA elimination based on the sperm factor and two egg factors, and expression of these three factors was recognized in the hybrid testis. It was thereby assumed that mtDNA destruction caused by the expression of maternal mtDNA inheritance system in male germ cells is implicated in the hybrid male sterility of mice.
Diot, Alan; Hinks-Roberts, Alex; Lodge, Tiffany; Liao, Chunyan; Dombi, Eszter; Morten, Karl; Brady, Stefen; Fratter, Carl; Carver, Janet; Muir, Rebecca; Davis, Ryan; Green, Charlotte J; Johnston, Iain; Hilton-Jones, David; Sue, Carolyn; Mortiboys, Heather; Poulton, Joanna
2015-10-01
Mitophagy is a cellular mechanism for the recycling of mitochondrial fragments. This process is able to improve mitochondrial DNA (mtDNA) quality in heteroplasmic mtDNA disease, in which mutant mtDNA co-exists with normal mtDNA. In disorders where the load of mutant mtDNA determines disease severity it is likely to be an important determinant of disease progression. Measuring mitophagy is technically demanding. We used pharmacological modulators of autophagy to validate two techniques for quantifying mitophagy. First we used the IN Cell 1000 analyzer to quantify mitochondrial co-localisation with LC3-II positive autophagosomes. Unlike conventional fluorescence and electron microscopy, this high-throughput system is sufficiently sensitive to detect transient low frequency autophagosomes. Secondly, because mitophagy preferentially removes pathogenic heteroplasmic mtDNA mutants, we developed a heteroplasmy assay based on loss of m.3243A>G mtDNA, during culture conditions requiring oxidative metabolism ("energetic stress"). The effects of the pharmacological modulators on these two measures were consistent, confirming that the high throughput imaging output (autophagosomes co-localising with mitochondria) reflects mitochondrial quality control. To further validate these methods, we performed a more detailed study using metformin, the most commonly prescribed antidiabetic drug that is still sometimes used in Maternally Inherited Diabetes and Deafness (MIDD). This confirmed our initial findings and revealed that metformin inhibits mitophagy at clinically relevant concentrations, suggesting that it may have novel therapeutic uses. Copyright © 2015. Published by Elsevier Ltd.
Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.
Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi
2017-08-12
Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.
Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum
2018-04-01
ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.
Treulen, F; Uribe, P; Boguen, R; Villegas, J V
2016-02-01
Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
DNA Strand Breaks in Mitotic Germ Cells of Caenorhabditis elegans Evaluated by Comet Assay
Park, Sojin; Choi, Seoyun; Ahn, Byungchan
2016-01-01
DNA damage responses are important for the maintenance of genome stability and the survival of organisms. Such responses are activated in the presence of DNA damage and lead to cell cycle arrest, apoptosis, and DNA repair. In Caenorhabditis elegans, double-strand breaks induced by DNA damaging agents have been detected indirectly by antibodies against DSB recognizing proteins. In this study we used a comet assay to detect DNA strand breaks and to measure the elimination of DNA strand breaks in mitotic germline nuclei of C. elegans. We found that C. elegans brc-1 mutants were more sensitive to ionizing radiation and camptothecin than the N2 wild-type strain and repaired DNA strand breaks less efficiently than N2. This study is the first demonstration of direct measurement of DNA strand breaks in mitotic germline nuclei of C. elegans. This newly developed assay can be applied to detect DNA strand breaks in different C. elegans mutants that are sensitive to DNA damaging agents. PMID:26903030
Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.
Liu, Chao; Chang, Le; Jia, Tingting; Guo, Fei; Zhang, Lu; Ji, Huimin; Zhao, Junpeng; Wang, Lunan
2017-05-12
Quantification Hepatitis B virus (HBV) DNA plays a critical role in the management of chronic HBV infections. However, HBV is a DNA virus with high levels of genetic variation, and drug-resistant mutations have emerged with the use of antiviral drugs. If a mutation caused a sequence mismatched in the primer or probe of a commercial DNA quantification kit, this would lead to an underestimation of the viral load of the sample. The aim of this study was to determine whether commercial kits, which use only one pair of primers and a single probe, accurately quantify the HBV DNA levels and to develop an improved duplex real-time PCR assay. We developed a new duplex real-time PCR assay that used two pairs of primers and two probes based on the conserved S and C regions of the HBV genome. We performed HBV DNA quantitative detection of HBV samples and compared the results of our duplex real-time PCR assays with the COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. The target region of the discordant sample was amplified, sequenced, and validated using plasmid. The results of the duplex real-time PCR were in good accordance with the commercial COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. We showed that two samples from Chinese HBV infections underestimated viral loads when quantified by the Roche kit because of a mismatch between the viral sequence and the reverse primer of the Roche kit. The HBV DNA levels of six samples were undervalued by duplex real-time PCR assays of the C region because of mutations in the primer of C region. We developed a new duplex real-time PCR assay, and the results of this assay were similar to the results of commercial kits. The HBV DNA level could be undervalued when using the COBAS TaqMan HBV Test version 2 for Chinese HBV infections owing to a mismatch with the primer/probe. A duplex real-time PCR assay based on the S and C regions could solve this problem to some extent.
International Nuclear Information System (INIS)
Regan, J.D.; Dunn, W.C.
1979-01-01
The bromodeoxyuridine photolysis assay of DNA damage in human cells permits an estimate of both the number of repaired regions in the DNA and the size of the average repaired region - the patch size. The antineoplastic agent arabinofuranosyl cytosine (ara-C) can also be employed to assay the magnitude of repair since this agent appears to block rejoining of single-strand incisions made in the DNA during the initial step of repair. Thus, the number of incisions can be accumulated. The ara-C effect is dependent on the presence of hydroxyurea. Both assays can be employed for the study of physical or chemical DNA damages. Results comparing these assays are presented
Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments
International Nuclear Information System (INIS)
Sage, E.; Moustacchi, E.
1987-01-01
The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA
Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi
2008-12-15
The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.
Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na
2014-11-11
Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.
Enzyme-linked immunosorbent assays for Z-DNA.
Thomas, M J; Strobl, J S
1988-10-01
Dot blot and transblot enzyme-linked immunosorbent assays (e.l.i.s.a.) are described which provide sensitive non-radioactive methods for screening Z-DNA-specific antisera and for detecting Z-DNA in polydeoxyribonucleotides and supercoiled plasmids. In the alkaline phosphatase dot blot e.l.i.s.a., Z-DNA, Br-poly(dG-dC).poly(dG-dC), or B-DNA, poly(dG-dC).poly(dG-dC), poly(dA-dT).poly(dA-dT), Br-poly(dI-dC).poly(dI-dC), or salmon sperm DNA were spotted onto nitrocellulose discs and baked. The e.l.i.s.a. was conducted in 48-well culture dishes at 37 degrees C using a rabbit polyclonal antiserum developed against Br-poly(dG-dC).poly(dG-dC), an alkaline phosphatase-conjugated second antibody, and p-nitrophenol as the substrate. Under conditions where antibody concentrations were not limiting, alkaline phosphatase activity was linear for 2 h. Dot blot e.l.i.s.a. conditions are described which allow quantification of Z-DNA [Br-poly(dG-dC).poly(dG-dC)] within the range 5-250 ng. Dot blot and transblot horseradish peroxidase e.l.i.s.a. are described that detect Z-DNA within supercoiled plasmid DNAs immobilized on diazophenylthioether (DPT) paper. In the transblot e.l.i.s.a., plasmid pUC8 derivatives containing 16, 24, or 32 residues of Z-DNA were electrophoresed in agarose gels and electrophoretically transferred to DPT paper. Z-DNA-antibody complexes were detected by the horseradish peroxidase-catalysed conversion of 4-chloro-1-naphthol to a coloured product that was covalently bound to the DPT paper. Z-DNA antibody reactivity was specific for supercoiled Z-DNA containing plasmids after removal of the antibodies cross-reactive with B-DNA by absorption onto native DNA-cellulose. The transblot e.l.i.s.a. was sensitive enough to detect 16 base pairs of alternating G-C residues in 100 ng of pUC8 DNA.
PORSCHA: a novel homogeneous assay for detection of DNA/RNA
Kidwell, David A.
1995-05-01
A novel assay, Pi Overlapping Ring Systems Contained in a Homogeneous Assay (PORSCHA), has been developed which relies upon the change in fluorescent spectral properties that pyrene and its derivatives show as a function of their proximity. When two pyrene rings are sufficiently close such that their pi-systems can overlap during the excited lifetime, an excimer emission centered at 480 nm is observed. When the pi-systems are too far apart for overlap, only monomer emission is observed at 378 nm and 396 nm. Only Angstrom changes in distances are necessary to switch from excimer to monomer emission. Due to its many degrees of freedom, single-stranded DNA adopts a random-coil conformation in solution. When labeled with two pyrene fluorophores and upon binding to its complimentary strand, the excimer intensity changes because the pyrenes may be either closer together or farther apart, corresponding to the reduced degrees of freedom of the double helix. Because the probe does not disturb the system and no separation steps are necessary before detecting the DNA binding, completely reversible, in situ, detection of DNA is possible.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay
Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.
Majid, Farjana; Jahan, Munira; Lutful Moben, Ahmed; Tabassum, Shahina
2014-01-01
Both real-time-polymerase chain reaction (PCR) and hybrid capture 2 (HC2) assay can detect and quantify hepatitis B virus (HBV) DNA. However, real-time-PCR can detect a wide range of HBV DNA, while HC2 assay could not detect lower levels of viremia. The present study was designed to detect and quantify HBV DNA by real-time-PCR and HC2 assay and compare the quantitative data of these two assays. A cross-sectional study was conducted in between July 2010 and June 2011. A total of 66 serologically diagnosed chronic hepatitis B (CHB) patients were selected for the study. Real-time-PCR and HC2 assay was done to detect HBV DNA. Data were analyzed by statistical Package for the social sciences (SPSS). Among 66 serologically diagnosed chronic hepatitis B patients 40 (60.61%) patients had detectable and 26 (39.39%) had undetectable HBV DNA by HC2 assay. Concordant results were obtained for 40 (60.61%) out of these 66 patients by real-time-PCR and HC2 assay with mean viral load of 7.06 ± 1.13 log 10 copies/ml and 6.95 ± 1.08 log 10 copies/ml, respectively. In the remaining 26 patients, HBV DNA was detectable by real-time-PCR in 20 patients (mean HBV DNA level was 3.67 ± 0.72 log 10 copies/ml. However, HBV DNA could not be detectable in six cases by the both assays. The study showed strong correlation (r = 0.915) between real-time-PCR and HC2 assay for the detection and quantification of HBV DNA. HC2 assay may be used as an alternative to real-time-PCR for CHB patients. How to cite this article: Majid F, Jahan M, Moben AL, Tabassum S. Comparison of Hybrid Capture 2 Assay with Real-time-PCR for Detection and Quantitation of Hepatitis B Virus DNA. Euroasian J Hepato-Gastroenterol 2014;4(1):31-35.
Directory of Open Access Journals (Sweden)
Jorge A. Bertolotto
2016-06-01
Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Bertolotto, Jorge A.; Umazano, Juan P.
2016-06-01
In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.
Hammond, Emma L.; Sayer, David; Nolan, David; Walker, Ulrich A.; Ronde, Anthony de; Montaner, Julio S. G.; Cote, Helene C. F.; Gahan, Michelle E.; Cherry, Catherine L.; Wesselingh, Steven L.; Reiss, Peter; Mallal, Simon
2003-01-01
Background: A number of international research groups have developed DNA quantitation assays in order to investigate the role of mitochondrial DNA depletion in anti-retroviral therapy-induced toxicities. Objectives: A collaborative study was undertaken to evaluate intra-assay precision and between
DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser
de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson
2015-03-01
Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.
Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V
2016-06-20
Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.
The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation
Directory of Open Access Journals (Sweden)
George Anifandis
2018-05-01
Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.
Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge
2017-12-01
In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.
Aoki, Kimiko; Tanaka, Hiroyuki; Kawahara, Takashi
2018-07-01
The standard method for personal identification and verification of urine samples in doping control is short tandem repeat (STR) analysis using nuclear DNA (nDNA). The DNA concentration of urine is very low and decreases under most conditions used for sample storage; therefore, the amount of DNA from cryopreserved urine samples may be insufficient for STR analysis. We aimed to establish a multiplexed assay for urine mitochondrial DNA typing containing only trace amounts of DNA, particularly for Japanese populations. A multiplexed suspension-array assay using oligo-tagged microspheres (Luminex MagPlex-TAG) was developed to measure C-stretch length in hypervariable region 1 (HV1) and 2 (HV2), five single nucleotide polymorphisms (SNPs), and one polymorphic indel. Based on these SNPs and the indel, the Japanese population can be classified into five major haplogroups (D4, B, M7a, A, D5). The assay was applied to DNA samples from urine cryopreserved for 1 - 1.5 years (n = 63) and fresh blood (n = 150). The assay with blood DNA enabled Japanese subjects to be categorized into 62 types, exhibiting a discriminatory power of 0.960. The detection limit for cryopreserved urine was 0.005 ng of nDNA. Profiling of blood and urine pairs revealed that 5 of 63 pairs showed different C-stretch patterns in HV1 or HV2. The assay described here yields valuable information in terms of the verification of urine sample sources employing only trace amounts of recovered DNA. However, blood cannot be used as a reference sample.
Effect of superoxide dismutase supplementation on sperm DNA fragmentation
Directory of Open Access Journals (Sweden)
Luciano Negri
2017-10-01
Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD
International Nuclear Information System (INIS)
Al-Gubory, Kais H.
2005-01-01
The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals
International Nuclear Information System (INIS)
Gokahmetoglu, S.; Deniz, E.
2007-01-01
To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)
DNA fingerprinting of pearls to determine their origins.
Directory of Open Access Journals (Sweden)
Joana B Meyer
Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.
Directory of Open Access Journals (Sweden)
Laura Carolina Valencia
2011-01-01
Full Text Available The aim of this study was to use the Comet assay to assess genetic damage in the direct-developing frog Eleutherodactylus johnstonei. A DNA diffusion assay was used to evaluate the effectiveness of alkaline, enzymatic and alkaline/enzymatic treatments for lysing E. johnstonei blood cells and to determine the amount of DNA strand breakage associated with apoptosis and necrosis. Cell sensitivity to the mutagens bleomycin (BLM and 4-nitroquinoline-1-oxide (4NQO was also assessed using the Comet assay, as was the assay reproducibility. Alkaline treatment did not lyse the cytoplasmic and nuclear membranes of E. johnstonei blood cells, whereas enzymatic digestion with proteinase K (40 !g/mL yielded naked nuclei. The contribution of apoptosis and necrosis (assessed by the DNA diffusion assay to DNA damage was estimated to range from 0% to 8%. BLM and 4NQO induced DNA damage in E. johnstonei blood cells at different concentrations and exposure times. Dose-effect curves with both mutagens were highly reproducible and showed consistently low coefficients of variation (CV < 10%. The results are discussed with regard to the potential use of the modified Comet assay for assessing the exposure of E. johnstonei to herbicides in ecotoxicological studies.
Valencia, Laura Carolina; García, Adriana; Ramírez-Pinilla, Martha Patricia; Fuentes, Jorge Luis
2011-10-01
The aim of this study was to use the Comet assay to assess genetic damage in the direct-developing frog Eleutherodactylus johnstonei. A DNA diffusion assay was used to evaluate the effectiveness of alkaline, enzymatic and alkaline/enzymatic treatments for lysing E. johnstonei blood cells and to determine the amount of DNA strand breakage associated with apoptosis and necrosis. Cell sensitivity to the mutagens bleomycin (BLM) and 4-nitro-quinoline-1-oxide (4NQO) was also assessed using the Comet assay, as was the assay reproducibility. Alkaline treatment did not lyse the cytoplasmic and nuclear membranes of E. johnstonei blood cells, whereas enzymatic digestion with proteinase K (40 μg/mL) yielded naked nuclei. The contribution of apoptosis and necrosis (assessed by the DNA diffusion assay) to DNA damage was estimated to range from 0% to 8%. BLM and 4NQO induced DNA damage in E. johnstonei blood cells at different concentrations and exposure times. Dose-effect curves with both mutagens were highly reproducible and showed consistently low coefficients of variation (CV ≤ 10%). The results are discussed with regard to the potential use of the modified Comet assay for assessing the exposure of E. johnstonei to herbicides in ecotoxicological studies.
In vitro Assays for Eukaryotic Leading/Lagging Strand DNA Replication.
Schauer, Grant; Finkelstein, Jeff; O'Donnell, Mike
2017-09-20
The eukaryotic replisome is a multiprotein complex that duplicates DNA. The replisome is sculpted to couple continuous leading strand synthesis with discontinuous lagging strand synthesis, primarily carried out by DNA polymerases ε and δ, respectively, along with helicases, polymerase α-primase, DNA sliding clamps, clamp loaders and many other proteins. We have previously established the mechanisms by which the polymerases ε and δ are targeted to their 'correct' strands, as well as quality control mechanisms that evict polymerases when they associate with an 'incorrect' strand. Here, we provide a practical guide to differentially assay leading and lagging strand replication in vitro using pure proteins.
A multiplex calibrated real-time PCR assay for quantitation of DNA of EBV-1 and 2.
Gatto, Francesca; Cassina, Giulia; Broccolo, Francesco; Morreale, Giuseppe; Lanino, Edoardo; Di Marco, Eddi; Vardas, Efthiya; Bernasconi, Daniela; Buttò, Stefano; Principi, Nicola; Esposito, Susanna; Scarlatti, Gabriella; Lusso, Paolo; Malnati, Mauro S
2011-12-01
Accurate and highly sensitive tests for the diagnosis of active Epstein-Barr virus (EBV) infection are essential for the clinical management of individuals infected with EBV. A calibrated quantitative real-time PCR assay for the measurement of EBV DNA of both EBV-1 and 2 subtypes was developed, combining the detection of the EBV DNA and a synthetic DNA calibrator in a multiplex PCR format. The assay displays a wide dynamic range and a high degree of accuracy even in the presence of 1μg of human genomic DNA. This assay measures with the same efficiency EBV DNA from strains prevalent in different geographic areas. The clinical sensitivity and specificity of the system were evaluated by testing 181 peripheral blood mononuclear cell (PBMCs) and plasma specimens obtained from 21 patients subjected to bone marrow transplantation, 70 HIV-seropositive subjects and 23 healthy controls. Patients affected by EBV-associated post-transplant lymphoprolipherative disorders had the highest frequency of EBV detection and the highest viral load. Persons infected with HIV had higher levels of EBV DNA load in PBMCs and a higher frequency of EBV plasma viremia compared to healthy controls. In conclusion, this new assay provides a reliable high-throughput method for the quantitation of EBV DNA in clinical samples. Copyright © 2011 Elsevier B.V. All rights reserved.
Identification of irradiated refrigerated pork with the DNA comet assay
Energy Technology Data Exchange (ETDEWEB)
Araujo, M.M. E-mail: villavic@net.ipen.br; Marin-Huachaca, N.S.; Mancini-Filho, J. E-mail: jmancini@usp.br; Delincee, H.; Villavicencio, A.L.C.H. E-mail: henry.delincee@bfe.uni-karlsruhe.de
2004-10-01
Food irradiation can contribute to a safer and more plentiful food supply by inactivating pathogens, eradicating pests and by extending shelf-life. Particularly in the case of pork meat, this process could be a useful way to inactivate harmful parasites such as Trichinella and Taenia solium. Ionizing radiation causes damage to the DNA of the cells (e.g. strand breaks), which can be used to detect irradiated food. Microelectrophoresis of single cells ('Comet Assay') is a simple and rapid test for DNA damage and can be used over a wide dose range and for a variety of products. Refrigerated pork meat was irradiated with a {sup 60}Co source, Gammacell 220 (A.E.C.L.) installed in IPEN (Sao Paulo, Brazil). The doses given were 0, 1.5, 3.0 and 4.5 kGy for refrigerated samples. Immediately after irradiation the samples were returned to the refrigerator (6 deg. C). Samples were kept in the refrigerator after irradiation. Pork meat was analyzed 1, 8 and 10 days after irradiation using the DNA 'Comet Assay'. This method showed to be an inexpensive and rapid technique for qualitative detection of irradiation treatment.
Identification of irradiated refrigerated pork with the DNA comet assay
Araújo, M. M.; Marin-Huachaca, N. S.; Mancini-Filho, J.; Delincée, H.; Villavicencio, A. L. C. H.
2004-09-01
Food irradiation can contribute to a safer and more plentiful food supply by inactivating pathogens, eradicating pests and by extending shelf-life. Particularly in the case of pork meat, this process could be a useful way to inactivate harmful parasites such as Trichinella and Taenia solium. Ionizing radiation causes damage to the DNA of the cells (e.g. strand breaks), which can be used to detect irradiated food. Microelectrophoresis of single cells (``Comet Assay'') is a simple and rapid test for DNA damage and can be used over a wide dose range and for a variety of products. Refrigerated pork meat was irradiated with a 60Co source, Gammacell 220 (A.E.C.L.) installed in IPEN (Sa~o Paulo, Brazil). The doses given were 0, 1.5, 3.0 and 4.5kGy for refrigerated samples. Immediately after irradiation the samples were returned to the refrigerator (6°C). Samples were kept in the refrigerator after irradiation. Pork meat was analyzed 1, 8 and 10 days after irradiation using the DNA ``Comet Assay''. This method showed to be an inexpensive and rapid technique for qualitative detection of irradiation treatment.
International Nuclear Information System (INIS)
Holley, W.R.; Chatterjee, A.
1996-01-01
We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs
International Nuclear Information System (INIS)
Hofbauer, Daniela
2010-01-01
Aim of this study was to differentiate DNA-double-strand-breaks from DNA-single-strand-breaks on a single cell level, using the comet assay after α- and γ-irradiation. Americium-241 was used as a alpha-irradiation-source, Caesium-137 was used for γ-irradiation. Because of technical problems with both the neutral and alkaline comet assay after irradiation of gastric cancer cells and human lymphocytes, no definite differentiation of DNA-damage was possible.
Direct quantification of fungal DNA from soil substrate using real-time PCR.
Filion, Martin; St-Arnaud, Marc; Jabaji-Hare, Suha H
2003-04-01
Detection and quantification of genomic DNA from two ecologically different fungi, the plant pathogen Fusarium solani f. sp. phaseoli and the arbuscular mycorrhizal fungus Glomus intraradices, was achieved from soil substrate. Specific primers targeting a 362-bp fragment from the SSU rRNA gene region of G. intraradices and a 562-bp fragment from the F. solani f. sp. phaseoli translation elongation factor 1 alpha gene were used in real-time polymerase chain reaction (PCR) assays conjugated with the fluorescent SYBR(R) Green I dye. Standard curves showed a linear relation (r(2)=0.999) between log values of fungal genomic DNA of each species and real-time PCR threshold cycles and were quantitative over 4-5 orders of magnitude. Real-time PCR assays were applied to in vitro-produced fungal structures and sterile and non-sterile soil substrate seeded with known propagule numbers of either fungi. Detection and genomic DNA quantification was obtained from the different treatments, while no amplicon was detected from non-seeded non-sterile soil samples, confirming the absence of cross-reactivity with the soil microflora DNA. A significant correlation (Pgenomic DNA of F. solani f. sp. phaseoli or G. intraradices detected and the number of fungal propagules present in seeded soil substrate. The DNA extraction protocol and real-time PCR quantification assay can be performed in less than 2 h and is adaptable to detect and quantify genomic DNA from other soilborne fungi.
Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena
2016-09-01
Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.
Richardson, Ruth E.; Suzuki, Yo
2015-01-01
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330
Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan
2009-02-01
To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.
Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu
2015-08-01
In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.
Comet assay in the detection of irradiated garlic
International Nuclear Information System (INIS)
Villavicencio, Anna Lucia C.H.; Marin-Huachaca, Nelida Simona; Romanelli, Maria Fernanda; Delincee, Henry
2002-01-01
The increased claim for fresh produce has forced a consensus between nations to pay more attention to the phytosanitary regulations. Inhibition of sprouting of bulbs and tubers by applying ionising radiation is authorised by the National Food Codes in Brazil. The availability of methods for detection of irradiated food will contribute to increase consumers' confidence. A quick and simple screening test to indicate whether a food product has been irradiated or not was utilised in this study. The DNA comet assay was applied to verify whether garlic imported from China had been irradiated or not. This test has already been adopted as a European Standard (EN 13784), for detection of irradiated food. Non-irradiated control samples of garlic and garlic treated with maleic hydrazide were compared with garlic samples irradiated in our department. The unirradiated samples exhibited only limited DNA migration. If samples were irradiated, an increased DNA fragmentation was observed which permitted the discrimination between non-irradiated and irradiated samples. Since the garlic samples from China showed only very limited DNA fragmentation, they were deemed non-irradiated. Thus, this simple screening test was shown to be successful for identification of an irradiation treatment. (author)
Comet Assay: A Method to Evaluate Genotoxicity of Nano-Drug Delivery System
Vandghanooni, Somayeh; Eskandani, Morteza
2011-01-01
Introduction Drug delivery systems could induce cellular toxicity as side effect of nanomaterials. The mechanism of toxicity usually involves DNA damage. The comet assay or single cell gel electrophoresis (SCGE) is a sensitive method for detecting strand damages in the DNA of a cell with applications in genotoxicity testing and molecular epidemiology as well as fundamental research in DNA damage and repair. Methods In the current study, we reviewed recent drug delivery researches related to SCGE. Results We found that one preference for choosing the assay is that comet images may result from apoptosis-mediated nuclear fragmentation. This method has been widely used over the last decade in several different areas. Overall cells, such as cultured cells are embedded in agarose on a microscope slide, lysed with detergent, and treated with high salt. Nucleoids are supercoiled DNA form. When the slide is faced to alkaline electrophoresis any breakages present in the DNA cause the supercoiling to relax locally and loops of DNA extend toward the anode as a ‘‘comet tail’’. Conclusion This article provides a relatively comprehensive review upon potentiality of the comet assay for assessment of DNA damage and accordingly it can be used as an informative platform in genotoxicity studies of drug delivery systems. PMID:23678412
Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.
1974-01-01
By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397
International Nuclear Information System (INIS)
Shaddock, J.G.; Heflich, R.H.; McMillan, D.C.; Hinson, J.A.; Casciano, D.A.
1989-01-01
A recent National Toxicology Program evaluation indicates that the rat hepatocyte/DNA repair assay has a high false-negative rate and that it is insensitive to some genotoxic hepatocarcinogens as well as other species and organ-specific carcinogens. In this study, the authors examined whether the sensitivity of the hepatocyte/DNA repair assay might be increased through animal pretreatment with various hepatic mixed-function oxidase inducers, i.e., Aroclor 1254, phenobarbital, and 3,3',4,4'-tetrachloroazobenzene (TCAB). The effects on unscheduled DNA synthesis (UDS), a measured of DNA damage and repair, were studied in cultures exposed to known and/or potential carcinogens that had been evaluated as negative or questionable or that produced conflicting results with hepatocytes isolated from uninduced animals. 4,4'-Oxydianiline, 1-nitropy-rene, and TCAB produced concentration-dependent increases in UDS in hepatocytes from rats pretreated with Aroclor 1254. 4,4'-Oxydianiline and TCAB also induced a dose-dependent increase in DNA repair in hepatocytes from rats pretreated with phenobarbital, whereas 1-nitropyrene was negative. These data indicate that the limited sensitivity to chemical carcinogens displayed by the hepatocyte/DNA repair assay may be increased by using hepatocytes isolated from animals exposed to hepatic mixed-function oxidase inducers
Energy Technology Data Exchange (ETDEWEB)
Shaddock, J.G.; Heflich, R.H.; McMillan, D.C.; Hinson, J.A.; Casciano, D.A. (National Center for Toxicological Research, Jefferson, AK (USA) Univ. of Arkansas for Medical Sciences, Little Rock (USA))
1989-01-01
A recent National Toxicology Program evaluation indicates that the rat hepatocyte/DNA repair assay has a high false-negative rate and that it is insensitive to some genotoxic hepatocarcinogens as well as other species and organ-specific carcinogens. In this study, the authors examined whether the sensitivity of the hepatocyte/DNA repair assay might be increased through animal pretreatment with various hepatic mixed-function oxidase inducers, i.e., Aroclor 1254, phenobarbital, and 3,3{prime},4,4{prime}-tetrachloroazobenzene (TCAB). The effects on unscheduled DNA synthesis (UDS), a measured of DNA damage and repair, were studied in cultures exposed to known and/or potential carcinogens that had been evaluated as negative or questionable or that produced conflicting results with hepatocytes isolated from uninduced animals. 4,4{prime}-Oxydianiline, 1-nitropy-rene, and TCAB produced concentration-dependent increases in UDS in hepatocytes from rats pretreated with Aroclor 1254. 4,4{prime}-Oxydianiline and TCAB also induced a dose-dependent increase in DNA repair in hepatocytes from rats pretreated with phenobarbital, whereas 1-nitropyrene was negative. These data indicate that the limited sensitivity to chemical carcinogens displayed by the hepatocyte/DNA repair assay may be increased by using hepatocytes isolated from animals exposed to hepatic mixed-function oxidase inducers.
Mapping of gene transcripts by nuclease protection assays and cDNA primer extension
International Nuclear Information System (INIS)
Calzone, F.J.; Britten, R.J.; Davidson, E.J.
1987-01-01
An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements
International Nuclear Information System (INIS)
Balart, Josep; Pueyo, Gemma; Llobet, Lara I de; Baro, Marta; Sole, Xavi; Marin, Susanna; Casanovas, Oriol; Mesia, Ricard; Capella, Gabriel
2011-01-01
Radiation-induced DNA double-strand break (DSB) repair can be tested by using pulsed-field gel electrophoresis (PFGE) in agarose-encapsulated cells. However, previous studies have reported that this assay is impaired by the spontaneous DNA breakage in this medium. We investigated the mechanisms of this fragmentation with the principal aim of eliminating it in order to improve the estimation of radiation-induced DNA repair. Samples from cancer cell cultures or xenografted tumours were encapsulated in agarose plugs. The cell plugs were then irradiated, incubated to allow them to repair, and evaluated by PFGE, caspase-3, and histone H2AX activation (γH2AX). In addition, apoptosis inhibition was evaluated through chemical caspase inhibitors. We confirmed that spontaneous DNA fragmentation was associated with the process of encapsulation, regardless of whether cells were irradiated or not. This DNA fragmentation was also correlated to apoptosis activation in a fraction of the cells encapsulated in agarose, while non-apoptotic cell fraction could rejoin DNA fragments as was measured by γH2AX decrease and PFGE data. We were able to eliminate interference of apoptosis by applying specific caspase inhibitors, and improve the estimation of DNA repair, and apoptosis itself. The estimation of radiation-induced DNA repair by PFGE may be improved by the use of apoptosis inhibitors. The ability to simultaneously determine DNA repair and apoptosis, which are involved in cell fate, provides new insights for using the PFGE methodology as functional assay
Directory of Open Access Journals (Sweden)
Cheuk-Chun Szeto
Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.
A Qualitative and Quantitative Assay to Study DNA/Drug Interaction ...
African Journals Online (AJOL)
Research Article. A Qualitative and Quantitative Assay to Study. DNA/Drug Interaction Based on Sequence Selective. Inhibition of Restriction Endonucleases. Syed A Hassan1*, Lata Chauhan2, Ritu Barthwal2 and Aparna Dixit3. 1 Faculty of Computing and Information Technology, King Abdul Aziz University, Rabigh-21911 ...
Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat
2018-01-01
The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.
Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.
Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D
2004-11-01
Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.
Energy Technology Data Exchange (ETDEWEB)
Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)
2005-10-01
This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.
International Nuclear Information System (INIS)
Mattos, Jose Carlos Pelielo de; Motta, Ellen Serri da; Oliveira, Marcia Betania Nunes de; Dantas, Flavio Jose da Silva; Araujo, Adriano Caldeira de
2008-01-01
Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl 2 ) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl 2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl 2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms. (author)
Energy Technology Data Exchange (ETDEWEB)
Mattos, Jose Carlos Pelielo de; Motta, Ellen Serri da; Oliveira, Marcia Betania Nunes de; Dantas, Flavio Jose da Silva; Araujo, Adriano Caldeira de [Universidade do Estado do Rio de Janeiro (UERJ), RJ (Brazil). Dept. de Biofisica e Biometria. Lab. de Radio e Fotobiologia]. E-mail: jcmattos@uerj.br
2008-12-15
Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl{sub 2}) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl{sub 2} in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl{sub 2} was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms. (author)
Wellenberg, G.J.; Verstraten, E.; Belak, S.; Verschuren, S.B.E.; Rijsewijk, F.A.M.; Peshev, R.; Oirschot, van J.T.
2001-01-01
A polymerase chain reaction (PCR) assay was developed to detect bovine herpesvirus 4 (BHV4) glycoprotein B (gB) DNA, and a nested-PCR assay was modified for the detection of BHV4 thymidine kinase (TK) DNA in bovine milk samples. To identify false-negative PCR results, internal control templates were
Wang, Yan; Xu, Chang; Du, Li Qing; Cao, Jia; Liu, Jian Xiang; Su, Xu; Zhao, Hui; Fan, Fei-Yue; Wang, Bing; Katsube, Takanori; Fan, Sai Jun; Liu, Qiang
2013-01-01
Dose- and time-response curves were combined to assess the potential of the comet assay in radiation biodosimetry. The neutral comet assay was used to detect DNA double-strand breaks in lymphocytes caused by γ-ray irradiation. A clear dose-response relationship with DNA double-strand breaks using the comet assay was found at different times after irradiation (p < 0.001). A time-response relationship was also found within 72 h after irradiation (p < 0.001). The curves for DNA double-strand breaks and DNA repair in vitro of human lymphocytes presented a nice model, and a smooth, three-dimensional plane model was obtained when the two curves were combined. PMID:24240807
Directory of Open Access Journals (Sweden)
Qiang Liu
2013-11-01
Full Text Available Dose- and time-response curves were combined to assess the potential of the comet assay in radiation biodosimetry. The neutral comet assay was used to detect DNA double-strand breaks in lymphocytes caused by γ-ray irradiation. A clear dose-response relationship with DNA double-strand breaks using the comet assay was found at different times after irradiation (p < 0.001. A time-response relationship was also found within 72 h after irradiation (p < 0.001. The curves for DNA double-strand breaks and DNA repair in vitro of human lymphocytes presented a nice model, and a smooth, three-dimensional plane model was obtained when the two curves were combined.
DNA-repair measurements by use of the modified comet assay
DEFF Research Database (Denmark)
Godschalk, Roger W L; Ersson, Clara; Riso, Patrizia
2013-01-01
The measurement of DNA-repair activity by extracts from cells or tissues by means of the single-cell gel electrophoresis (comet) assay has a high potential to become widely used in biomonitoring studies. We assessed the inter-laboratory variation in reported values of DNA-repair activity...... on substrate cells that had been incubated with Ro19-8022 plus light to generate oxidatively damaged DNA. Eight laboratories assessed the DNA-repair activity of three cell lines (i.e. one epithelial and two fibroblast cell lines), starting with cell pellets or with cell extracts provided by the coordinating...... laboratory. There was a large inter-laboratory variation, as evidenced by the range in the mean level of repair incisions between the laboratory with the lowest (0.002incisions/10(6)bp) and highest (0.988incisions/10(6)bp) incision activity. Nevertheless, six out of eight laboratories reported the same cell...
Cell-free assay measuring repair DNA synthesis in human fibroblasts
International Nuclear Information System (INIS)
Ciarrocchi, G.; Linn, S.
1978-01-01
Osmotic disruption of confluent cultured human fibroblasts that have been irradiated or exposed to chemical carcinogens allows the specific measurement of repair DNA synthesis using dTTP as a precursor. Fibroblasts similarly prepared from various xeroderma pigmentosum cell lines show the deficiencies of uv-induced DNA synthesis predicted from in vivo studies, while giving normal responses to methylmethanesulfonate. A pyrimidine-dimer-specific enzyme, T4 endonuclease V, stimulated the rate of uv-induced repair synthesis with normal and xeroderma pigmentosum cell lines. This system should prove useful for identifying agents that induce DNA repair, and cells that respond abnormally to such induction. It should also be applicable to an in vitro complementation assay with repair-defective cells and proteins obtained from repair-proficient cells. Finally, by using actively growing fibroblasts and thymidine in the system, DNA replication can be measured and studied in vitro
Localized irradiations, evaluation through 'Comet Assay'
International Nuclear Information System (INIS)
Di Giorgio, Marina; Taja, Maria R.; Nasazzi, Nora B.; Bustos, N.; Cavalieri, H.; Bolgiani, A.
2000-01-01
During the last 50 years various radiation accidents involving localized irradiations occurred, resulting mainly from improper handling of sealed sources of Cobalt 60, Cesium 137 or Iridium 192 at work placed for industrial gammagraphy and other radiation sources. Severe skin reaction may developed at the contact sites. Such inhomogeneous irradiations lead to a differential exposure of lymphocytes in lymphatic tissues or other organs that may recirculate into the peripheral blood producing a mixed irradiated and unirradiated population of lymphocytes. Applying the mathematical models 'Contaminated Poisson' of Dolphin and Qdr method of Sasaki, a mean dose in the irradiated body area and its size can be estimated from unstable chromosome aberration scoring. There are also different biophysical techniques that can give response in localized irradiations. Biological dosimetry is a necessary complement to physical and clinical dosimetries. Thus, there is increasing interest in the assessment of biological markers that permit the detection of radiation induced damage in the localized irradiations. The 'Comet Assay' (single cell gel electrophoresis) is a sensitive, rapid and relatively inexpensive method for measuring DNA damage in individual cells. Single cells are embedded in agarose on microscope slides, lysed to remove the majority of the proteins, electrophoresed, then stained with ethidium bromide in order to visualize the DNA. When visualized using a fluorescent microscope, DNA of undamaged cells appears as a spherical mass occupying the cavity formed by the lysed cell. Following radiation damage, the smaller the fragment size and the grater the number of fragments of DNA, the grater the percentage of DNA that it is able to migrate in an electric field, forming a comet image. The assay can be performed under alkaline conditions to examine DNA single strand breaks (SSBs), or in non denaturing (neutral) conditions to measure double strand breaks (DSBs) in individual
International Nuclear Information System (INIS)
Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich
1998-01-01
The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)
International Nuclear Information System (INIS)
Atchley, S.V.; Chen, D.J.C.; Strniste, G.F.; Walters, R.A.; Moyzis, R.K.
1984-01-01
We are developing a new recombinant DNA system for the detection and measurement of genetic change in humans caused by exposure to low level ionizing radiation. A unique feature of the method is the use of cloned repetitive DNA probes to assay human DNA for structural changes during or after irradiation. Repetitive sequences exist in different families. Collectively they constitute over 25% of the DNA in a human cell. Repeat families have between 10 and 500,000 members. We have constructed repetitive DNA sequence libraries using recombinant DNA techniques. From these libraries we have isolated and characterized individual repeats comprising 75 to 90% of the mass of human repetitive DNA. Repeats used in our assay system exist in tandem arrays in the genome. Perturbation of these sequences in a cell, followed by detection with a repeat probe, produces a new, multimeric ''ladder'' pattern on an autoradiogram. The repeat probe used in our initial study is complementary to 1% of human DNA. Therefore, the sensitivity of this method is several orders of magnitude better than existing assays. Preliminary evidence from human skin cells exposed to acute, low-dose x-ray treatments indicates that DNA is affected at a dose as low as 5R. The radiation doses used in this system are well within the range of doses received by astronauts during spaceflight missions. Due to its small material requirements, this technique could easily be adapted for use in space. 16 refs., 1 fig
LAMP assay for rapid diagnosis of cow DNA in goat milk and meat samples.
Deb, R; Sengar, G S; Singh, U; Kumar, S; Raja, T V; Alex, R; Alyethodi, R R; Prakash, B
2017-01-01
Animal species detection is one of the crucial steps for consumer's food analysis. In the present study we developed an in-house built loop-mediated isothermal amplification (LAMP) assay for rapid detection of adulterated cow DNA in goat milk/meat samples. The cow milk/tissue DNA in goat milk/meat samples were identified in the developed LAMP assay by either naked eye visualizing with SYBR Green I dyes or by detecting the typical ladder pattern on gel electrophoresis. This test can detect up to minimum 5% level of cow components admixed in goat milk/meat samples and can be completed within 1 h 40 min starting from DNA extraction from milk/meat samples and can be performed in a water bath. Developed LAMP methodology is simple; rapid and sensitive techniques that can detect adulterant like cow components in goat milk/meat are more accurate than other existing DNA based technologies.
Bille, Todd W; Cromartie, Carter; Farr, Matthew
2009-09-01
This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.
International Nuclear Information System (INIS)
Chu Liping; Liu Qiang; Wang Qin; Li Jin; Yue Jingyin; Mu Chuanjie; Fan Feiyue
2008-01-01
Objective: To explore the feasibility of determining radiosensitivity of human tumor cell lines in vitro using the assay of mtDNA 4977 bp deletion and comet assay. Methods: Three human tumor cell lines were selected in this study, HepG 2 , EC-9706 and MCF-7. The surviving fraction(SF), the ratio of mtDNA 4977 bp deletion and DNA damage were detected by MTY assay, nested PCR technique and comet assay, respectively. Results: The results of MTT assay showed that the radiosensitivity of HepG 2 and EC-9706 was higher than that of MCF-7. The ratio of mtDNA 4977 bp deletion of HepG 2 and EC-9706 was higher significantly than that of MCF-7 (P 2 and EC-9706 was higher than that of MCF-7. The difference of radiosensitivity among these three tumor cell lines was significant after 8 Gy γ-ray irradiation. Conclusions: Combination of many biological parameter is helpful to evaluate the radiosensitivity of tumor cells more accurately. (authors)
Energy Technology Data Exchange (ETDEWEB)
Lucarelli, Fausto; Marrazza, Giovanna; Palchetti, Ilaria; Cesaretti, S.; Mascini, Marco
2002-09-26
This paper describes a disposable indicator-free electrochemical DNA biosensor applied to the detection of apolipoprotein E (apoE) sequences in PCR samples. In the indicator-free assays, the duplex formation was detected by measuring the electrochemical signal of the guanine base of nucleic acids. The biosensor format involved the immobilisation of an inosine-modified (guanine-free) probe onto a screen-printed electrode (SPE) transducer and the detection of the duplex formation in connection with the square-wave voltammetric measurement of the oxidation peak of the guanine of the target sequence. The indicator-free scheme has been characterised using 23-mer oligonucleotides as model: parameters affecting the hybridisation assay such as probe immobilisation conditions, hybridisation time, use of hybridisation accelerators were examined and optimised. The analysis of PCR samples (244 bp DNA fragments, obtained by amplification of DNA extracted from human blood) required a further optimisation of the experimental procedure. In particular, a lower steric hyndrance of the probe modified surface was essential to allow an efficient hybridisation of the target DNA fragment. Negative controls have been performed using the PCR blank and amplicons unrelated to the immobilised probe. A 10 min hybridisation time allowed a full characterisation of each sample.
Effects of seven chemicals on DNA damage in the rat urinary bladder: a comet assay study.
Wada, Kunio; Yoshida, Toshinori; Takahashi, Naofumi; Matsumoto, Kyomu
2014-07-15
The in vivo comet assay has been used for the evaluation of DNA damage and repair in various tissues of rodents. However, it can give false-positive results due to non-specific DNA damage associated with cell death. In this study, we examined whether the in vivo comet assay can distinguish between genotoxic and non-genotoxic DNA damage in urinary bladder cells, by using the following seven chemicals related to urinary bladder carcinogenesis in rodents: N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN), glycidol, 2,2-bis(bromomethyl)-1,3-propanediol (BMP), 2-nitroanisole (2-NA), benzyl isothiocyanate (BITC), uracil, and melamine. BBN, glycidol, BMP, and 2-NA are known to be Ames test-positive and they are expected to produce DNA damage in the absence of cytotoxicity. BITC, uracil, and melamine are Ames test-negative with metabolic activation but have the potential to induce non-specific DNA damage due to cytotoxicity. The test chemicals were administered orally to male Sprague-Dawley rats (five per group) for each of two consecutive days. Urinary bladders were sampled 3h after the second administration and urothelial cells were analyzed by the comet assay and subjected to histopathological examination to evaluate cytotoxicity. In the urinary bladders of rats treated with BBN, glycidol, and BMP, DNA damage was detected. In contrast, 2-NA induced neither DNA damage nor cytotoxicity. The non-genotoxic chemicals (BITC, uracil, and melamine) did not induce DNA damage in the urinary bladders under conditions where some histopathological changes were observed. The results indicate that the comet assay could distinguish between genotoxic and non-genotoxic chemicals and that no false-positive responses were obtained. Copyright © 2014 Elsevier B.V. All rights reserved.
A powerful selection assay for mixture libraries of DNA alkylating agents.
Ham, Young-Wan; Boger, Dale L
2004-08-04
A simple and powerful selection assay that permits the separation (rpHPLC), quantitation (ELSD), and identification (ESI-MS) of thermally released adenine adducts derived from duocarmycin analogues is detailed that can establish the most effective DNA alkylating agents in synthetic combinatorial mixtures.
Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S
2005-01-01
Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.
Directory of Open Access Journals (Sweden)
Kotoka Masuyama
Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.
International Nuclear Information System (INIS)
Wlodek, D.; Olive, P.L.
1996-01-01
The of elution of DNA during non-denaturing filter elution (NFE) often correlates with cell sensitivity to radiation. The elution rate is influenced by two cellular factors: chromatin structure and the number of DNA-strand breaks (DSBs) produced in an intact cell by ionizing radiation. To determine which of the above factors is relevant to cell radiosensitivity, four assays were used to measure induction of DNA damage in three cell lines varying in radiosensitivity (V79, CHO, and L5178Y-R). Each of the assays, neutral filter elution (NFE), DNA precipitation, constant (CFGE) and pulsed field gel electrophoresis (PFGE) have different physical basis for DNA damage measurement and might be differently affected by chromatin structure. Three of the methods used to measure DNA double-strand breaks gave different results: NFE was dependent on cell type and location of DNA relative to the replication fork, gel electrophoresis was independent of cell type but was affected by proximity to the replication fork, and the precipitation assay was independent of both cell type and replication status. Pulsed field gel electrophoresis produced the same results and constant field gel electrophoresis for 3 cell lines examined. Only NFE showed differences in sensitivity which correlated with cell survival following irradiation. The results suggest that three is the same initial amount of DSBs in cells from all three lines and that the sensitivity to radiation is determined by some additional factors, probably chromatin structure. (author). 18 refs, 5 figs
Londoño-Velasco, Elizabeth; Martínez-Perafán, Fabián; Carvajal-Varona, Silvio; García-Vallejo, Felipe; Hoyos-Giraldo, Luz Stella
2016-05-01
Occupational exposure as a painter is associated with DNA damage and development of cancer. Comet assay has been widely adopted as a sensitive and quantitative tool for DNA damage assessment at the individual cell level in populations exposed to genotoxics. The aim of this study was to assess the application of the high-throughput comet assay, to determine the DNA damage in car spray painters. The study population included 52 car spray painters and 52 unexposed subjects. A significant increase in the %TDNA median (p 0.05). The results showed an increase in DNA breaks in car spray painters exposed to organic solvents and paints; furthermore, they demonstrated the application of high-throughput comet assay in an occupational exposure study to genotoxic agents.
DEFF Research Database (Denmark)
Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta
2012-01-01
Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...
Energy Technology Data Exchange (ETDEWEB)
Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)
2012-07-29
Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.
The CTD2 Center at Emory has developed a new NanoLuc®-based protein-fragment complementation assay (NanoPCA) which allows the detection of novel protein-protein interactions (PPI). NanoPCA allows the study of PPI dynamics with reversible interactions. Read the abstract. Experimental Approaches Read the detailed Experimetnal Approaches.
Directory of Open Access Journals (Sweden)
Michael Mahler
2017-01-01
Full Text Available Objective. We sought to evaluate different anti-double-stranded DNA assays for their performance characteristics in monitoring disease activity fluctuations in systemic lupus erythematosus (SLE. Methods. 36 active SLE patients were followed monthly. At each study visit (total n=371, blood was collected and disease activity was scored using the SELENA-SLEDAI (excluding anti-dsDNA or complement components and by a physician’s global assessment (PGA. Four anti-dsDNA tests were compared. Linear mixed-effects models with random intercept and fixed slopes were used to evaluate the relationship between the longitudinal fluctuations of disease activity and anti-dsDNA titers. Results. At enrollment, positivity for QUANTA Lite and high-avidity anti-dsDNA assay was both 64% and significantly lower than anti-dsDNA positivity by QUANTA Flash (83% and CLIFT (96%. Linear mixed-effects modeling indicated that the change in clinical SELENA-SLEDAI scores was associated with the titers of all anti-dsDNA with QUANTA Flash yielding the highest marginal R2 (0.15; p<0.01. QUANTA Flash was the only anti-dsDNA assay significantly associated with the change in PGA (marginal R2=0.05; p<0.01. Conclusion. These data indicate that anti-dsDNA antibodies determined by QUANTA Flash have a value in monitoring SLE disease activity.
Assay of repair enzyme activity by reactivation of ultraviolet-irradiated infective viral DNA
Energy Technology Data Exchange (ETDEWEB)
Oeda, K; Nakatsu, Y; Sekiguchi, M [Kyushu Univ., Fukuoka (Japan).Faculty of Science
1980-05-01
Treatment of OeX174 replicative form (RF) DNA, pre-exposed to ultraviolet light, with T4 endonuclease V led to a marked increase of infectivity of the RF when the activity was assayed on CaCl/sub 2/-treated cells of Escherichia coli strain defective in uvrA gene. The reaction was specific and the extent of the reactivation was proportional to the concentration of the enzyme. Based on this finding, we developed a procedure to assay endonuclease activities specific for ultraviolet-damaged DNA, that might be involved in the incision step of excision repair of pyrimidine dimers. To find conditions suitable for accurate and rapid assays, we examined conditions affecting transfection with OeX174 RF. The maximum transfection was achieved when more than 2 x 10/sup 8/ CaCl/sub 2/-treated cells, which had been prepared from bacteria harvested during the early or mid-logarithmic phase of growth in L broth, were incubated with the DNA at 0/sup 0/C for 20 min in 50 mM CaCl/sub 2/. Incubation of the cell-DNA mixture at 37/sup 0/C decreased the transfection efficiency to about 30% of the optimal level; thus, heat shock, a step regarded as necessary in the conventional CaCl/sub 2/ methods for transfection and transformation, was eliminated. The CaCl/sub 2/-treated cells remained viable and competent after storage at -20/sup 0/C in a solution containing 15% glycerol. By using the procedure thus established, repair endonuclease activities in crude extracts of T4-infected E. coli and of Micrococcus luteus were determined. The procedure should be of use in assaying and purifying repair enzymes of other organisms.
International Nuclear Information System (INIS)
Gajski, Goran; Garaj-Vrhovac, Vera; Orescanin, Visnja
2008-01-01
To investigate the genotoxic potential of atorvastatin on human lymphocytes in vitro standard comet assay was used in the evaluation of basal DNA damage and to investigate possible oxidative DNA damage produced by reactive oxygen species (ROS) Fpg-modified version of comet assay was also conducted. In addition to these techniques the new criteria for scoring micronucleus test were applied for more complete detection of baseline damage in binuclear lymphocytes exposed to atorvastatin 80 mg/day in different time periods by virtue of measuring the frequency of micronuclei, nucleoplasmic bridges and nuclear buds. All parameters obtained with the standard comet assay and Fpg-modified comet assay were significantly higher in the treated than in control lymphocytes. The Fpg-modified comet assay showed a significantly greater tail length, tail intensity, and tail moment in all treated lymphocytes than did the standard comet assay, which suggests that oxidative stress is likely to be responsible for DNA damage. DNA damage detected by the standard comet assay indicates that some other mechanism is also involved. In addition to the comet assay, a total number of micronuclei, nucleoplasmic bridges and nuclear buds were significantly higher in the exposed than in controlled lymphocytes. Regression analyses showed a positive correlation between the results obtained by the comet (Fpg-modified and standard) and micronucleus assay. Overall, the study demonstrated that atorvastatin in its highest dose is capable of producing damage on the level of DNA molecule and cell
Energy Technology Data Exchange (ETDEWEB)
Gajski, Goran [Institute for Medical Research and Occupational Health, Mutagenesis Unit, 10000 Zagreb (Croatia); Garaj-Vrhovac, Vera [Institute for Medical Research and Occupational Health, Mutagenesis Unit, 10000 Zagreb (Croatia); Orescanin, Visnja [Ruder Boskovic Institute, 10000 Zagreb (Croatia)
2008-08-15
To investigate the genotoxic potential of atorvastatin on human lymphocytes in vitro standard comet assay was used in the evaluation of basal DNA damage and to investigate possible oxidative DNA damage produced by reactive oxygen species (ROS) Fpg-modified version of comet assay was also conducted. In addition to these techniques the new criteria for scoring micronucleus test were applied for more complete detection of baseline damage in binuclear lymphocytes exposed to atorvastatin 80 mg/day in different time periods by virtue of measuring the frequency of micronuclei, nucleoplasmic bridges and nuclear buds. All parameters obtained with the standard comet assay and Fpg-modified comet assay were significantly higher in the treated than in control lymphocytes. The Fpg-modified comet assay showed a significantly greater tail length, tail intensity, and tail moment in all treated lymphocytes than did the standard comet assay, which suggests that oxidative stress is likely to be responsible for DNA damage. DNA damage detected by the standard comet assay indicates that some other mechanism is also involved. In addition to the comet assay, a total number of micronuclei, nucleoplasmic bridges and nuclear buds were significantly higher in the exposed than in controlled lymphocytes. Regression analyses showed a positive correlation between the results obtained by the comet (Fpg-modified and standard) and micronucleus assay. Overall, the study demonstrated that atorvastatin in its highest dose is capable of producing damage on the level of DNA molecule and cell.
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale
1994-01-01
A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....
Directory of Open Access Journals (Sweden)
Olga Makarova
Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.
Hutchins, Patrick; Sepulveda, Adam; Martin, Renee; Hopper, Lacey
2017-01-01
A probe-based quantitative real-time PCR assay was developed to detect Tetracapsuloides bryosalmonae, which causes proliferative kidney disease in salmonid fish, in kidney tissue and environmental DNA (eDNA) water samples. The limits of detection and quantification were 7 and 100 DNA copies for calibration standards and T. bryosalmonae was reliably detected down to 100 copies in tissue and eDNA samples. The assay presented here is a highly sensitive and quantitative tool for detecting T. bryosalmonae with potential applications for tissue diagnostics and environmental detection.
Application of the comet assay in studies of programmed cell death (PCD in plants
Directory of Open Access Journals (Sweden)
Maria Charzyńska
2014-01-01
Full Text Available Programmed cell death (PCD in plants is an intensively investigated process. One of the main characteristics of PCD in both animal and plant organisms is the non-random, internucleosomal fragmentation of nuclear DNA, usually analysed using total DNA gel electrophoresis or TUNEL method. In this paper we present application of the "comet assay" (Single Cell Gel Electrophoresis for detection of nDNA degradation in studies of PCD during plant life cycle. We analyzed three types of tissue: anther tapetum, endosperm and mesophyll which were prepared in different ways to obtain a suspension of viable cells (without cell walls. The comet assay gives a possibility of examination of the nDNA degradation in individual cell. This method is significant for studies of the plant tissue differentiation and senescence especially in the cases when it is not possible to isolate large number of cells at the same developmental stage.
Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan
2011-12-07
Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.
Energy Technology Data Exchange (ETDEWEB)
Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-01
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.
Detection of DNA damage in mussels and sea urchins exposed to crude oil using comet assay
International Nuclear Information System (INIS)
Taban, I.C.; Bechmann, R.K.; Torgrimsen, S.; Baussant, T.; Sanni, S.
2004-01-01
The single-cell microgel electrophoresis assay or the comet assay was used to evaluate DNA damage of dispersed crude oil on sea urchins (Strongylocentrotus droebachiensis) and mussels (Mytilus edulis L.). Sea urchins were exposed to 0.06 and 0.25 mg/L dispersed crude oil in a continuous flow system, while the mussels were exposed to 0.015, 0.06 and 0.25 mg/L dispersed crude oil. Sea urchin coelomocytes and mussel haemocytes were sampled after 4 and 5 weeks exposure, respectively. In the sea urchin coelomocytes, there was a significant concentration-related increase in the percentage of DNA in comet tail. In mussel haemocytes, there was a significantly higher percentage of DNA in comet tail for all treatments compared to the control. The responses were concentration-related up to 0.06 mg/L oil. The two highest exposure concentrations of mussels were not significantly different from each other. These results indicate that the comet assay can be used for biomonitoring of DNA damage in marine invertebrates following oil contamination. (author)
Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C
2001-01-01
Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.
Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.
Directory of Open Access Journals (Sweden)
Andrea Fuso
Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.
Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru
2017-01-01
Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096
Köhnemann, Stephan; Hohoff, Carsten; Pfeiffer, Heidi
2009-09-01
We had sequenced 329 Caucasian samples in Hypervariable Region 1 (HVR 1) and found that they belong to eleven different mitochondrial DNA (mtDNA) haplotypes. The sample set was further analysed by an mtDNA assay examining 32 single nucleotide polymorphisms (SNPs) for haplogroup discrimination. In a validation study on 160 samples of different origin it was shown that these SNPs were able to discriminate between the evolved superhaplogroups worldwide (L, M and N) and between the nine most common Caucasian haplogroups (H, I, J, K, T, U, V, W and X). The 32 mtDNA SNPs comprised 42 different SNP haplotypes instead of only eleven haplotypes after HVR 1 sequencing. The assay provided stable results in a range of 5ng genomic DNA down to virtually no genomic DNA per reaction. It was possible to detect samples of African, Asian and Eurasian ancestry, respectively. The 32 mtDNA SNP assay is a helpful adjunct to further distinguish between identical HVR 1 sequences of Caucasian origin. Our results suggest that haplogroup prediction using HVR 1 sequencing provides instable results. The use of coding region SNPs for haplogroup assignment is more suited than using HVR 1 haplotypes.
Assessment of DNA damage in blood lymphocytes of bakery workers by comet assay.
Kianmehr, Mojtaba; Hajavi, Jafar; Gazeri, Javad
2017-09-01
The comet assay is widely used in screening and identification of genotoxic effects of different substances on people in either their working or living environment. Exposure to fuel smoke leads to DNA damage and ultimately different types of cancer. Using a comet assay, the present study aimed to assess peripheral blood lymphocyte DNA damage in people working in bakeries using natural gas, kerosene, diesel, or firewood for fuel compared to those in the control group. The subjects of this study were 55 people in total who were divided into four experimental groups, each of which comprised of 11 members (based on the type of fuel used), and one control group comprised of 11 members. Using CometScore, the subjects' peripheral blood lymphocytes were examined for DNA damage. All bakers, that is, experimental subjects, showed significantly greater peripheral blood lymphocyte DNA damage compared to the individuals in the control group. There was greater peripheral blood lymphocyte DNA damage in bakers who had been using firewood for fuel compared to those using other types of fuel to such an extent that tail moments (µm) for firewood-burning bakers was 4.40 ± 1.98 versus 1.35 ± 0.84 for natural gas, 1.85 ± 1.33 for diesel, and 2.19 ± 2.20 for kerosene. The results indicated that burning firewood is the greatest inducer of peripheral blood lymphocytes DNA damage in bakers. Nonetheless, there was no significant difference in peripheral blood lymphocyte DNA damage among diesel and kerosene burning bakers.
Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra
2018-02-01
Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.
Increased DNA damage in blood cells of rat treated with lead as assessed by comet assay
Directory of Open Access Journals (Sweden)
Mohammad Arif
2008-06-01
Full Text Available A growing body of evidence suggests that oxidative stress is the key player in the pathogenesis of lead-induced toxicity. The present study investigated lead induced oxidative DNA damage, if any in rat blood cells by alkaline comet assay. Lead was administered intraperitoneally to rats at doses of 25, 50 and 100 mg/kg body weight for 5 days consecutively. Blood collected on day six from sacrificed lead-treated rats was used to assess the extent of DNA damage by comet assay which entailed measurement of comet length, olive tail moment, tail DNA (% and tail length. The results showed that treatment with lead significantly increased DNA damage in a dose-dependent manner. Therefore, our data suggests that lead treatment is associated with oxidative stress-induced DNA damage in rat blood cells which could be used as an early bio-marker of lead-toxicity.
Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T
2018-05-30
We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.
DEFF Research Database (Denmark)
Forchhammer, Lykke; Bräuner, Elvira Vaclavik; Folkmann, Janne Kjaersgaard
2008-01-01
The comet assay is popular for assessments of genotoxicity, but the comparison of results between studies is challenging because of differences in experimental procedures and reports of DNA damage in different units. We investigated the variation of DNA damage in mononuclear blood cells (MNBCs......) measured by the comet assay with focus on the variation related to alkaline unwinding and electrophoresis time, number of cells scored, as well as the putative benefits of transforming the primary end points to common units by the use of reference standards and calibration curves. Eight experienced......, our results indicate that inter-investigator difference in scoring is a strong determinant of DNA damage levels measured by the comet assay....
Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan
2012-04-20
In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.
Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie
2017-05-11
Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.
Development of a loop-mediated isothermal amplification assay for rapid detection of BK virus.
Bista, Bipin Raj; Ishwad, Chandra; Wadowsky, Robert M; Manna, Pradip; Randhawa, Parmjeet Singh; Gupta, Gaurav; Adhikari, Meena; Tyagi, Rakhi; Gasper, Gina; Vats, Abhay
2007-05-01
Loop-mediated isothermal amplification (LAMP) is a novel method for rapid amplification of DNA. Its advantages include rapidity and minimal equipment requirement. The LAMP assay was developed for BK virus (BKV), which is a leading cause of morbidity in renal transplant recipients. The characteristics of the assay, including its specificity and sensitivity, were evaluated. BKV LAMP was performed using various incubation times with a variety of specimens, including unprocessed urine and plasma samples. A ladder pattern on gel electrophoresis, typical of successful LAMP reactions, was observed specifically only for BKV and not for other viruses. The sensitivity of the assay with 1 h of incubation was 100 copies/tube of a cloned BKV fragment. Additionally, a positive reaction was visually ascertained by a simple color reaction using SYBR green dye. BKV LAMP was also successful for urine and plasma specimens without the need for DNA extraction. Due to its simplicity and specificity, the LAMP assay can potentially be developed for "point of care" screening of BKV.
Energy Technology Data Exchange (ETDEWEB)
Yamamoto, H.; Takigami, H.; Shimizu, Y.; Matsui, S. [Kyoto University, Kyoto (Japan). Faculty of Engineering
1998-05-22
Antimutagenic effect of humic substances has been reported by various investigators. In this research, the diminishing effect of DNA damaging toxicity by humic acid was evaluated for the influent and effluent of activated sludge tank receiving municipal wastewater and several DNA damaging chemicals (e.g., pyrene, 1-aminopyrene and benzo(a)pyrene) using Bacillus subtilis rec-assay. The diminishing effect was not apparent for influent but observed in the effluent. Among the DNA damaging chemicals, the DNA toxicity was effectively suppressed by humic acid for pyrene and benzo(a)pyrene. However, the effect was relatively smaller for 1-aminopyrene. 19 refs., 6 figs., 6 tabs.
Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein
2017-09-01
The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Lens-free imaging of magnetic particles in DNA assays.
Colle, Frederik; Vercruysse, Dries; Peeters, Sara; Liu, Chengxun; Stakenborg, Tim; Lagae, Liesbet; Del-Favero, Jurgen
2013-11-07
We present a novel opto-magnetic system for the fast and sensitive detection of nucleic acids. The system is based on a lens-free imaging approach resulting in a compact and cheap optical readout of surface hybridized DNA fragments. In our system magnetic particles are attracted towards the detection surface thereby completing the labeling step in less than 1 min. An optimized surface functionalization combined with magnetic manipulation was used to remove all nonspecifically bound magnetic particles from the detection surface. A lens-free image of the specifically bound magnetic particles on the detection surface was recorded by a CMOS imager. This recorded interference pattern was reconstructed in software, to represent the particle image at the focal distance, using little computational power. As a result we were able to detect DNA concentrations down to 10 pM with single particle sensitivity. The possibility of integrated sample preparation by manipulation of magnetic particles, combined with the cheap and highly compact lens-free detection makes our system an ideal candidate for point-of-care diagnostic applications.
Chevaliez, Stéphane; Dauvillier, Claude; Dubernet, Fabienne; Poveda, Jean-Dominique; Laperche, Syria; Hézode, Christophe; Pawlotsky, Jean-Michel
2017-04-01
Sensitive and accurate hepatitis B virus (HBV) DNA detection and quantification are essential to diagnose HBV infection, establish the prognosis of HBV-related liver disease, and guide the decision to treat and monitor the virological response to antiviral treatment and the emergence of resistance. Currently available HBV DNA platforms and assays are generally designed for batching multiple specimens within an individual run and require at least one full day of work to complete the analyses. The aim of this study was to evaluate the ability of the newly developed, fully automated, one-step Aptima HBV Quant assay to accurately detect and quantify HBV DNA in a large series of patients infected with different HBV genotypes. The limit of detection of the assay was estimated to be 4.5 IU/ml. The specificity of the assay was 100%. Intra-assay and interassay coefficients of variation ranged from 0.29% to 5.07% and 4.90% to 6.85%, respectively. HBV DNA levels from patients infected with HBV genotypes A to F measured with the Aptima HBV Quant assay strongly correlated with those measured by two commercial real-time PCR comparators (Cobas AmpliPrep/Cobas TaqMan HBV test, version 2.0, and Abbott RealTi m e HBV test). In conclusion, the Aptima HBV Quant assay is sensitive, specific, and reproducible and accurately quantifies HBV DNA in plasma samples from patients with chronic HBV infections of all genotypes, including patients on antiviral treatment with nucleoside or nucleotide analogues. The Aptima HBV Quant assay can thus confidently be used to detect and quantify HBV DNA in both clinical trials with new anti-HBV drugs and clinical practice. Copyright © 2017 American Society for Microbiology.
Neumann, Lars; Ritscher, Allegra; Müller, Gerhard; Hafenbradl, Doris
2009-08-01
For the detection of the precise and unambiguous binding of fragments to a specific binding site on the target protein, we have developed a novel reporter displacement binding assay technology. The application of this technology for the fragment screening as well as the fragment evolution process with a specific modelling based design strategy is demonstrated for inhibitors of the protein kinase p38alpha. In a fragment screening approach seed fragments were identified which were then used to build compounds from the deep-pocket towards the hinge binding area of the protein kinase p38alpha based on a modelling approach. BIRB796 was used as a blueprint for the alignment of the fragments. The fragment evolution of these deep-pocket binding fragments towards the fully optimized inhibitor BIRB796 included the modulation of the residence time as well as the affinity. The goal of our study was to evaluate the robustness and efficiency of our novel fragment screening technology at high fragment concentrations, compare the screening data with biochemical activity data and to demonstrate the evolution of the hit fragments with fast kinetics, into slow kinetic inhibitors in an in silico approach.
Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J
2007-01-01
JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.
Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P
2017-10-01
A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.
Reis, Gabriela Barreto Dos; Andrade-Vieira, Larissa Fonseca; Moraes, Isabella de Campos; César, Pedro Henrique Souza; Marcussi, Silvana; Davide, Lisete Chamma
2017-08-01
Comet assay is an efficient test to detect genotoxic compounds based on observation of DNA damage. The aim of this work was to compare the results obtained from the comet assay in two different type of cells extracted from the root tips from Lactuca sativa L. and human blood. For this, Spent Pot Liner (SPL), and its components (aluminum and fluoride) were applied as toxic agents. SPL is a solid waste generated in industry from the aluminum mining and processing with known toxicity. Three concentrations of all tested solutions were applied and the damages observed were compared to negative and positive controls. It was observed an increase in the frequency of DNA damage for human leukocytes and plant cells, in all treatments. On human leukocytes, SPL induced the highest percentage of damage, with an average of 87.68%. For root tips cells of L. sativa the highest percentage of damage was detected for aluminum (93.89%). Considering the arbitrary units (AU), the average of nuclei with high levels of DNA fragmentation was significant for both cells type evaluated. The tested cells demonstrated equal effectiveness for detection of the genotoxicity induced by the SPL and its chemical components, aluminum and fluoride. Further, using a unique method, the comet assay, we proved that cells from root tips of Lactuca sativa represent a reliable model to detect DNA damage induced by genotoxic pollutants is in agreement of those observed in human leukocytes as model. So far, plant cells may be suggested as important system to assess the toxicological risk of environmental agents. Copyright © 2017 Elsevier Inc. All rights reserved.
Evaluating Digital PCR for the Quantification of Human Genomic DNA: Accessible Amplifiable Targets.
Kline, Margaret C; Romsos, Erica L; Duewer, David L
2016-02-16
Polymerase chain reaction (PCR) multiplexed assays perform best when the input quantity of template DNA is controlled to within about a factor of √2. To help ensure that PCR assays yield consistent results over time and place, results from methods used to determine DNA quantity need to be metrologically traceable to a common reference. Many DNA quantitation systems can be accurately calibrated with solutions of DNA in aqueous buffer. Since they do not require external calibration, end-point limiting dilution technologies, collectively termed "digital PCR (dPCR)", have been proposed as suitable for value assigning such DNA calibrants. The performance characteristics of several commercially available dPCR systems have recently been documented using plasmid, viral, or fragmented genomic DNA; dPCR performance with more complex materials, such as human genomic DNA, has been less studied. With the goal of providing a human genomic reference material traceably certified for mass concentration, we are investigating the measurement characteristics of several dPCR systems. We here report results of measurements from multiple PCR assays, on four human genomic DNAs treated with four endonuclease restriction enzymes using both chamber and droplet dPCR platforms. We conclude that dPCR does not estimate the absolute number of PCR targets in a given volume but rather the number of accessible and amplifiable targets. While enzymatic restriction of human genomic DNA increases accessibility for some assays, in well-optimized PCR assays it can reduce the number of amplifiable targets and increase assay variability relative to uncut sample.
Development of laser-induced fluorescence detection to assay DNA damage
International Nuclear Information System (INIS)
Sharma, M.; Freund, H.G.
1991-01-01
A precolumn derivation method has been developed for high performance liquid chromatographic (HPLC) analysis of DNA damage using fluorescence detection. The modified nucleotide, having excised enzymatically from the exposed DNA, is enriched from the normal nucleotides and labeled with a fluorescent reagent. The labeling procedure involves phosphoramidation of the nucleotide with ethylenediamine (EDA) followed by conjugation of the free amino end of the phosphoramidate with 5-dimethylaminonaphthalene 1-sulfonyl chloride, commonly known as Dansyl chloride. The dansylated nucleotide can be analyzed with a sub-picomole limit of detection (LOD) by conventional HPLC using a conventional fluorescence detector. By combining microbore HPLC with laser-induced fluorescence (LIF) detection, the authors present the development of an analytical system that has sub-femtomole LOD for real-time analysis of the dansylated nucleotide. In this paper the application of the developed system in fluorescence postlabeling assay of a small alkyl-modified nucleotide (5-methyl CMP) in calf-thymus DNA is discussed
D'Amour, Pierre; Räkel, Agnès; Brossard, Jean-Hugues; Rousseau, Louise; Albert, Caroline; Cantor, Tom
2006-01-01
The quantitative evaluation of circulating PTH peaks revealed by PTH assays after HPLC separation constitutes the best way to study the behavior of PTH molecular forms, but it is also impractical. The objective of the study was to investigate the regulation of circulating PTH molecular forms by calcium through the use of PTH fragments/PTH (1-84) ratios derived from PTH assays with different specificities before and after HPLC separation of circulating PTH. CaCl2 and Na citrate were infused in eight volunteers. PTH was measured in serum and HPLC fractions at different calcium concentrations in PTH assays reacting with regions 1-2 (CA), 12-18 (T), and 65-69 (C) of the PTH structure. From hypo- to hypercalcemia, the C/CA ratio had the highest range (1.92 to 9.75; P < 0.001), and the C/T ratio had a higher range (1.69 to 6.11; P < 0.01) than the T/CA ratio (1.15 to 1.86). Human (h) PTH (1-84) represented 32.7 and 4.3% of circulating PTH in hypo- and hypercalcemic HPLC profiles, respectively. These numbers were 5 and 0.9% for amino-terminal (N)-PTH, an amino-terminal form of PTH distinct from hPTH (1-84), 7.3 and 6.8% for non-(1-84) PTH or large C-PTH fragments with a partially preserved N structure, and 54.9 and 88.1% for C-PTH fragments missing a N structure. The HPLC C-PTH fragments to hPTH (1-84) ratio had the most extensive range (1.67 to 20.58). Despite their quantitative differences, all ratios identified identical behavior of PTH fragments relative to PTH (1-84). PTH assay ratios are an adequate tool to investigate the modulation of PTH molecular forms, even if all PTH assays show some undesirable cross-reactivity with certain circulating forms of PTH.
Koppelman, M H G M; van Swieten, P; Cuijpers, H T M
2011-06-01
European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.
Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida
2010-11-01
The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.
Directory of Open Access Journals (Sweden)
Mayra Eduardoff
2017-09-01
Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS
Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya
Directory of Open Access Journals (Sweden)
Chi-Chu Tsai
2016-09-01
Full Text Available Papaya (Carica papaya L. is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique—based on DNA analysis—was developed for detecting male-hermaphrodite-specific markers to examine the papaya’s sex type. This method is based on the loop-mediated isothermal amplification (LAMP and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya’s sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source.
Directory of Open Access Journals (Sweden)
Kelly J. Henrickson
2009-10-01
Full Text Available Assays to simultaneously detect multiple potential agents of bioterrorism are limited. Two multiplex PCR and RT-PCR enzyme hybridization assays (mPCR-EHA, mRT-PCR-EHA were developed to simultaneously detect many of the CDC category “A” bioterrorism agents. The “Bio T” DNA assay was developed to detect: Variola major (VM, Bacillus anthracis (BA, Yersinia pestis (YP, Francisella tularensis (FT and Varicella zoster virus (VZV. The “Bio T” RNA assay (mRT-PCR-EHA was developed to detect: Ebola virus (Ebola, Lassa fever virus (Lassa, Rift Valley fever (RVF, Hantavirus Sin Nombre species (HSN and dengue virus (serotypes 1-4. Sensitivity and specificity of the 2 assays were tested by using genomic DNA, recombinant plasmid positive controls, RNA transcripts controls, surrogate (spiked clinical samples and common respiratory pathogens. The analytical sensitivity (limit of detection (LOD of the DNA asssay for genomic DNA was 1×100~1×102 copies/mL for BA, FT and YP. The LOD for VZV whole organism was 1×10-2 TCID50/mL. The LOD for recombinant controls ranged from 1×102~1×103copies/mL for BA, FT, YP and VM. The RNA assay demonstrated LOD for RNA transcript controls of 1×104~1×106 copies/mL without extraction and 1×105~1×106 copies/mL with extraction for Ebola, RVF, Lassa and HSN. The LOD for dengue whole organisms was ~1×10-4 dilution for dengue 1 and 2, 1×104 LD50/mL and 1×102 LD50/mL for dengue 3 and 4. The LOD without extraction for recombinant plasmid DNA controls was ~1×103 copies/mL (1.5 input copies/reaction for Ebola, RVF, Lassa and HSN. No cross-reactivity of primers and probes used in both assays was detected with common respiratory pathogens or between targeted analytes. Clinical sensitivity was estimated using 264 surrogate clinical samples tested with the BioT DNA assay and 549 samples tested with the BioT RNA assay. The clinical specificity is 99.6% and 99.8% for BioT DNA assay and BioT RNA assay, respectively. The
Bakshi, Hamid; Sam, Smitha; Rozati, Roya; Sultan, Phalisteen; Islam, Tajamul; Rathore, Babita; Lone, Zahoor; Sharma, Manik; Triphati, Jagrati; Saxena, Ramesh Chand
2010-01-01
Apoptosis, a widely important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus in different cancer types. The present study was designed to elucidate apoptosis induction by crocin, a main component of Crocus sativus in a human pancreatic cancer cell line (BxPC-3). Cell viability was measured by MTT assay, Hoechest33258 staining was used to detect the chromatin condensation characteristic of apoptosis, and DNA fragmentation was assessed by gel electrophoresis and cell cycle analysis by flow cytometry. Crocin induced apoptosis and G1-phase cell cycle arrest of BxPC-3 cells, while decreasing cell viability in a dose dependent and time dependent manner. Cells treated with 10μg/L crocin exhibited apoptotic morphology (brightly blue-fluorescent condensed nuclei on Hoechst 33258 staining) and reduction of volume. DNA analysis revealed typical ladders as early as 12 hours after treatment indicative of apoptosis. Our preclinical study demonstrated a pancreatic cancer cell line to be highly sensitive to crocin-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of crocin action are not yet clearly understood, it appears to have potential as a therapeutic agent.
Crystal structure of an Okazaki fragment at 2-A resolution
Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.
1992-01-01
In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.
Jenkins, J A; Draugelis-Dale, R O; Pinkney, A E; Iwanowicz, L R; Blazer, V S
2015-03-15
Declining harvests of yellow perch, Perca flavescens, in urbanized watersheds of Chesapeake Bay have prompted investigations of their reproductive fitness. The purpose of this study was to establish a flow cytometric technique for DNA analysis of fixed samples sent from the field to provide reliable gamete quality measurements. Similar to the sperm chromatin structure assay, measures were made on the susceptibility of nuclear DNA to acid-induced denaturation, but used fixed rather than live or thawed cells. Nuclei were best exposed to the acid treatment for 1 minute at 37 °C followed by the addition of cold (4 °C) propidium iodide staining solution before flow cytometry. The rationale for protocol development is presented graphically through cytograms. Field results collected in 2008 and 2009 revealed DNA fragmentation up to 14.5%. In 2008, DNA fragmentation from the more urbanized watersheds was significantly greater than from reference sites (P = 0.026) and in 2009, higher percentages of haploid testicular cells were noted from the less urbanized watersheds (P = 0.032) indicating better reproductive condition at sites with less urbanization. For both years, total and progressive live sperm motilities by computer-assisted sperm motion analysis ranged from 19.1% to 76.5%, being significantly higher at the less urbanized sites (P < 0.05). This flow cytometric method takes advantage of the propensity of fragmented DNA to be denatured under standard conditions, or 1 minute at 37 °C with 10% buffered formalin-fixed cells. The study of fixed sperm makes possible the restrospective investigation of germplasm fragmentation, spermatogenic ploidy patterns, and chromatin compaction levels from samples translocated over distance and time. The protocol provides an approach that can be modified for other species across taxa. Published by Elsevier Inc.
Yazdi, Soroush H; Giles, Kristen L; White, Ian M
2013-11-05
We demonstrate sensitive and multiplexed detection of DNA sequences through a surface enhanced resonance Raman spectroscopy (SERRS)-based competitive displacement assay in an integrated microsystem. The use of the competitive displacement scheme, in which the target DNA sequence displaces a Raman-labeled reporter sequence that has lower affinity for the immobilized probe, enables detection of unlabeled target DNA sequences with a simple single-step procedure. In our implementation, the displacement reaction occurs in a microporous packed column of silica beads prefunctionalized with probe-reporter pairs. The use of a functionalized packed-bead column in a microfluidic channel provides two major advantages: (i) immobilization surface chemistry can be performed as a batch process instead of on a chip-by-chip basis, and (ii) the microporous network eliminates the diffusion limitations of a typical biological assay, which increases the sensitivity. Packed silica beads are also leveraged to improve the SERRS detection of the Raman-labeled reporter. Following displacement, the reporter adsorbs onto aggregated silver nanoparticles in a microfluidic mixer; the nanoparticle-reporter conjugates are then trapped and concentrated in the silica bead matrix, which leads to a significant increase in plasmonic nanoparticles and adsorbed Raman reporters within the detection volume as compared to an open microfluidic channel. The experimental results reported here demonstrate detection down to 100 pM of the target DNA sequence, and the experiments are shown to be specific, repeatable, and quantitative. Furthermore, we illustrate the advantage of using SERRS by demonstrating multiplexed detection. The sensitivity of the assay, combined with the advantages of multiplexed detection and single-step operation with unlabeled target sequences makes this method attractive for practical applications. Importantly, while we illustrate DNA sequence detection, the SERRS-based competitive
Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles
2016-01-01
DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
Directory of Open Access Journals (Sweden)
Sara Sadeghi
2016-01-01
Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.
Energy Technology Data Exchange (ETDEWEB)
Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi
2002-11-30
As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.
Nakano, Miyo
2015-01-01
The thermophilic spore forming bacteria Geobacillus stearothermophilus is recognized as a major cause of spoilage in canned food. A quantitative real-time PCR assay was developed to specifically detect and quantify the species G. stearothermophilus in samples from canned food. The selected primer pairs amplified a 163-bp fragment of the 16S rRNA gene in a specific PCR assay with a detection limit of 12.5 fg of pure culture DNA, corresponding to DNA extracted from approximately 0.7 CFU/mL of G. stearothermophilus. Analysis showed that the bacterial species G. stearothermophilus was not detected in any canned food sample. Our approach presented here will be useful for tracking or quantifying species G. stearotethermophilus in canned food and ingredients.
Qian, Yong; Wang, Chunyan; Gao, Fenglei
2015-01-15
A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.
Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung
2015-01-01
Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60
International Nuclear Information System (INIS)
Gupta, R.C.; Gairola, C.G.
1990-01-01
An analysis of the tissue DNA adducts in rats by the sensitive (32)p-postlabeling assay showed one to eight detectable DNA adducts in lung, trachea, larynx, heart and bladder of the sham controls. Chronic exposure of animals to mainstream cigarette smoke showed a remarkable enhancement of most adducts in the lung and heart DNA. Since cigarette smoke contains several thousand chemicals and a few dozen of them are known or potential carcinogens, the difference between the DNA adducts of nasal and the other tissues may reflect the diversity of reactive constituents and their differential absorption in different tissues. In comparison to the lung DNA adducts, the adducts in nasal DNA were less hydrophobic. Identity of the predominant adducts was further investigated by comparison with several reference DNA adducts from 10 PAH and aromatic amines. Since some of these chemicals are present in cigarette smoke, the results suggest that these constituents of cigarette smoke may not be directly responsible for formation of DNA adducts in the lung and heart of the smoke-exposed animals
Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.
Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P
2017-06-01
Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.
Hossain, M A Motalib; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Hossain, S M Azad; Asing; Nizar, Nina Naquiah Ahmad; Uddin, Mohammad Nasir; Ali, Lokman; Asaduzzaman, Md; Akanda, Md Jahurul Haque
2017-06-01
Replacement of beef by buffalo and vice versa is frequent in global markets, but their authentication is challenging in processed foods due to the fragmentation of most biomarkers including DNA. The shortening of target sequences through use of two target sites might ameliorate assay reliability because it is highly unlikely that both targets will be lost during food processing. For the first time, we report a tetraplex polymerase chain reaction (PCR) assay targeting two different DNA regions in beef (106 and 120-bp) and buffalo (90 and 138-bp) mitochondrial genes to discriminate beef and buffalo in processed foods. All targets were stable under boiling, autoclaving and microwave cooking conditions. A survey in Malaysian markets revealed 71% beef curries contained buffalo but there was no buffalo in beef burgers. The assay detected down to 0.01ng DNA and 1% meat in admixed and burger products. Copyright © 2016 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Grazielle Cardoso da Graça
2012-08-01
Full Text Available In this study, PCR assays targeting different Leishmania heat-shock protein 70 gene (hsp70 regions, producing fragments ranging in size from 230-390 bp were developed and evaluated to determine their potential as a tool for the specific molecular diagnosis of cutaneous leishmaniasis (CL. A total of 70 Leishmania strains were analysed, including seven reference strains (RS and 63 previously typed strains. Analysis of the RS indicated a specific region of 234 bp in the hsp70 gene as a valid target that was highly sensitive for detection of Leishmania species DNA with capacity of distinguishing all analyzed species, after polymerase chain reaction-restriction fragment length polymorfism (PCR-RFLP. This PCR assay was compared with other PCR targets used for the molecular diagnosis of leishmaniasis: hsp70 (1400-bp region, internal transcribed spacer (ITS1 and glucose-6-phosphate dehydrogenase (G6pd. A good agreement among the methods was observed concerning the Leishmania species identification. Moreover, to evaluate the potential for molecular diagnosis, we compared the PCR targets hsp70-234 bp, ITS1, G6pd and mkDNA using a panel of 99 DNA samples from tissue fragments collected from patients with confirmed CL. Both PCR-hsp70-234 bp and PCR-ITS1 detected Leishmania DNA in more than 70% of the samples. However, using hsp70-234 bp PCR-RFLP, identification of all of the Leishmania species associated with CL in Brazil can be achieved employing a simpler and cheaper electrophoresis protocol.
K. J. Carim; J. C. S. Dysthe; Michael Young; Kevin McKelvey; Michael Schwartz
2016-01-01
The upper Missouri River basin in the northwestern US contains disjunct Arctic grayling (Thymallus arcticus) populations of conservation concern. To assist efforts aimed at understanding Artic grayling distribution, we developed a quantitative PCR assay to detect the presence of Arctic grayling DNA in environmental samples. The assay amplified low...
Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L
2012-05-01
In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.
DNA damage and repair assessed by comet assay in workers exposed to lead in a battery recycling.
Directory of Open Access Journals (Sweden)
Mahara Valverde
2015-05-01
In addition to these findings, DNA damage determined by comet assay was sensible to reflect lead exposure levels related to specific activities inside this factory. Human biomonitoring studies through comet assay could be robust when additional biomarkers are determined at time.
International Nuclear Information System (INIS)
Vejko, N.N.; Spitkovskij, D.M.
2000-01-01
The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru
Kothera, Linda; Byrd, Brian; Savage, Harry M
2017-11-07
Aedes aegypti (L.) and Ae. albopictus (Skuse) are important arbovirus vectors in the United States, and the recent emergence of Zika virus disease as a public health concern in the Americas has reinforced a need for tools to rapidly distinguish between these species in collections made by vector control agencies. We developed a duplex real-time PCR assay that detects both species and does not cross-amplify in any of the other seven Aedes species tested. The lower limit of detection for our assay is equivalent to ∼0.03 of a first-instar larva in a 60-µl sample (0.016 ng of DNA per real-time PCR reaction). The assay was sensitive and specific in mixtures of both species that reflected up to a 2,000-fold difference in DNA concentration. In addition, we developed a simple protocol to extract DNA from sonicated first-instar larvae, and used that DNA to test the assay. Because it uses real-time PCR, the assay saves time by not requiring a separate visualization step. This assay can reduce the time needed for vector control agencies to make species identifications, and thus inform decisions about surveillance and control. Published by Oxford University Press on behalf of Entomological Society of America 2017 This work is written by US Government employees and is in the public domain in the US.
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Porcine circovirus type 2 (PCV2 has emerged as one of the most important pathogens affecting swine production globally. Preclinical identification of PCV2 is very important for effective prophylaxis of PCV2-associated diseases. In this study, we developed an ultrasensitive nanoparticle DNA probe-based PCR assay (UNDP-PCR for PCV2 detection. Magnetic microparticles coated with PCV2 specific DNA probes were used to enrich PCV2 DNA from samples, then gold nanoparticles coated with PCV2 specific oligonucleotides were added to form a sandwich nucleic acid-complex. After the complex was formed, the oligonucleotides were released and characterized by PCR. This assay exhibited about 500-fold more sensitive than conventional PCR, with a detection limit of 2 copies of purified PCV2 genomic DNA and 10 viral copies of PCV2 in serum. The assay has a wide detection range for all of PCV2 genotypes with reliable reproducibility. No cross-reactivity was observed from the samples of other related viruses including porcine circovirus type 1, porcine parvovirus, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus and classical swine fever virus. The positive detection rate of PCV2 specific UNDP-PCR in 40 preclinical field samples was 27.5%, which appeared greater than that by conventional and real-time PCR and appeared application potency in evaluation of the viral loads levels of preclinical infection samples. The UNDP-PCR assay reported here can reliably rule out false negative results from antibody-based assays, provide a nucleic acid extraction free, specific, ultrasensitive, economic and rapid diagnosis method for preclinical PCV2 infection in field, which may help prevent large-scale outbreaks.
Development of a Loop-Mediated Isothermal Amplification Assay for Rapid Detection of BK Virus▿
Bista, Bipin Raj; Ishwad, Chandra; Wadowsky, Robert M.; Manna, Pradip; Randhawa, Parmjeet Singh; Gupta, Gaurav; Adhikari, Meena; Tyagi, Rakhi; Gasper, Gina; Vats, Abhay
2007-01-01
Loop-mediated isothermal amplification (LAMP) is a novel method for rapid amplification of DNA. Its advantages include rapidity and minimal equipment requirement. The LAMP assay was developed for BK virus (BKV), which is a leading cause of morbidity in renal transplant recipients. The characteristics of the assay, including its specificity and sensitivity, were evaluated. BKV LAMP was performed using various incubation times with a variety of specimens, including unprocessed urine and plasma samples. A ladder pattern on gel electrophoresis, typical of successful LAMP reactions, was observed specifically only for BKV and not for other viruses. The sensitivity of the assay with 1 h of incubation was 100 copies/tube of a cloned BKV fragment. Additionally, a positive reaction was visually ascertained by a simple color reaction using SYBR green dye. BKV LAMP was also successful for urine and plasma specimens without the need for DNA extraction. Due to its simplicity and specificity, the LAMP assay can potentially be developed for “point of care” screening of BKV. PMID:17314224
A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.
Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry
2008-11-01
A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.
Zhou, Feng; Noor, M Omair; Krull, Ulrich J
2014-03-04
A bioassay based on DNA hybridization on cellulose paper is a promising format for gene fragment detection that may be suited for in-field and rapid diagnostic applications. We demonstrate for the first time that luminescence resonance energy transfer (LRET) associated with upconverting phosphors (UCPs) can be used to develop a paper-based DNA hybridization assay with high sensitivity, selectivity and fast response. UCPs with strong green emission were synthesized and subsequently functionalized with streptavidin (UCP-strep). UCP-strep particles were immobilized on cellulose paper, and then biotinylated single-stranded oligonucleotide probes were conjugated onto the UCPs via streptavidin-biotin linkage. The UCPs served as donors that were LRET-paired with Cy3-labeled target DNA. Selective DNA hybridization enabled the proximity required for LRET-sensitized emission from Cy3, which was used as the detection signal. Hybridization was complete within 2 min, and the limit of detection of the method was 34 fmol, which is a significant improvement in comparison to an analogous fluorescence resonance energy transfer (FRET) assay based on quantum dots. The assay exhibited excellent resistance to nonspecific adsorption of noncomplementary short/long DNA and protein. The selectivity of the assay was further evaluated by one base pair mismatched (1BPM) DNA detection, where a maximum signal ratio of 3.1:1 was achieved between fully complementary and 1BPM samples. This work represents a preliminary but significant step for the development of paper-based UCP-LRET nucleic acid hybridization assays, which offer potential for lowering the limit of detection of luminescent hybridization assays due to the negligible background signal associated with optical excitation by near-infrared (NIR) light.
Multiplex PCR assay for the detection of five meat species forbidden in Islamic foods.
Ali, Md Eaqub; Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Rahman, Md Mahfujur; Amin, Md Al; Rashid, Nur Raifana Abd; Asing
2015-06-15
Food falsification has direct impact on public health, religious faith, fair-trades and wildlife. For the first time, here we described a multiplex polymerase chain reaction assay for the accurate identification of five meat species forbidden in Islamic foods in a single assay platform. Five pairs of species-specific primers were designed targeting mitochondrial ND5, ATPase 6, and cytochrome b genes to amplify 172, 163, 141, 129 and 108 bp DNA fragments from cat, dog, pig, monkey and rat meats, respectively. All PCR products were identified in gel-images and electrochromatograms obtained from Experion Bioanalyzer. Species-specificity checking against 15 important meat and fish and 5 plant species detected no cross-species amplification. Screening of target species in model and commercial meatballs reflected its application to detect target species in process foods. The assay was tested to detect 0.01-0.02 ng DNA under raw states and 1% suspected meats in meatball formulation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa
2014-04-01
Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.
Ganapathy, Sreelatha; Muraleedharan, Aparna; Sathidevi, Puthumangalathu Savithri; Chand, Parkash; Rajkumar, Ravi Philip
2016-09-01
DNA damage analysis plays an important role in determining the approaches for treatment and prevention of various diseases like cancer, schizophrenia and other heritable diseases. Comet assay is a sensitive and versatile method for DNA damage analysis. The main objective of this work is to implement a fully automated tool for the detection and quantification of DNA damage by analysing comet assay images. The comet assay image analysis consists of four stages: (1) classifier (2) comet segmentation (3) comet partitioning and (4) comet quantification. Main features of the proposed software are the design and development of four comet segmentation methods, and the automatic routing of the input comet assay image to the most suitable one among these methods depending on the type of the image (silver stained or fluorescent stained) as well as the level of DNA damage (heavily damaged or lightly/moderately damaged). A classifier stage, based on support vector machine (SVM) is designed and implemented at the front end, to categorise the input image into one of the above four groups to ensure proper routing. Comet segmentation is followed by comet partitioning which is implemented using a novel technique coined as modified fuzzy clustering. Comet parameters are calculated in the comet quantification stage and are saved in an excel file. Our dataset consists of 600 silver stained images obtained from 40 Schizophrenia patients with different levels of severity, admitted to a tertiary hospital in South India and 56 fluorescent stained images obtained from different internet sources. The performance of "CometQ", the proposed standalone application for automated analysis of comet assay images, is evaluated by a clinical expert and is also compared with that of a most recent and related software-OpenComet. CometQ gave 90.26% positive predictive value (PPV) and 93.34% sensitivity which are much higher than those of OpenComet, especially in the case of silver stained images. The
Lead-induced DNA damage in Vicia faba root cells: Potential involvement of oxidative stress
Pourrut, Bertrand; Jean, Séverine; Silvestre, Jérôme; Pinelli, Eric
2011-01-01
Genotoxic effects of lead (0–20 µM) were investigated in whole-plant roots of Vicia faba L., grown hydroponically under controlled conditions. Lead-induced DNA damage in V. faba roots was evaluated by use of the comet assay, which allowed the detection of DNA strand-breakage and with the V. faba micronucleus test, which revealed chromosome aberrations. The results clearly indicate that lead induced DNA fragmentation in a dose-dependant manner with a maximum effect at 10 µM. In addition, at th...
Energy Technology Data Exchange (ETDEWEB)
Araujo, Michel Mozeika
2008-07-01
Marketing of minimally processed vegetables (MPV) are gaining impetus due to its convenience, freshness and apparent healthy. However, minimal processing does not reduce pathogenic microorganisms to safe levels. Food irradiation is used to extend the shelf life and inactivation of food-borne pathogens, Its combination with minimal processing could improve the safety and quality of MPV. Two different food irradiation detection methods, a biological, the DEFT/APC, and another biochemical, the DNA Comet Assay were applied to MPV in order to test its applicability to detect irradiation treatment. DEFT/APC is a microbiological screening method based on the use of the direct epi fluorescent filter technique (DEFT) and the aerobic plate count (APC). DNA Comet Assay detects DNA damage due to ionizing radiation. Samples of lettuce, chard, watercress, dandelion, kale, chicory, spinach, cabbage from retail market were irradiated O.5 kGy and 1.0 kGy using a {sup 60} Co facility. Irradiation treatment guaranteed at least 2 log cycle reduction for aerobic and psychotropic microorganisms. In general, with increasing radiation doses, DEFT counts remained similar independent of irradiation processing while APC counts decreased gradually. The difference of the two counts gradually increased with dose increment in all samples. It could be suggested that a DEFT/APC difference over 2.0 log would be a criteria to judge if a MPV was treated by irradiation. DNA Comet Assay allowed distinguishing non-irradiated samples from irradiated ones, which showed different types of comets owing to DNA fragmentation. Both DEFT/APC method and DNA Comet Assay would be satisfactorily used as a screening method for indicating irradiation processing. (author)
Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.
2000-01-01
DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.
Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.
Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F
2017-09-01
In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.
Scar-less multi-part DNA assembly design automation
Hillson, Nathan J.
2016-06-07
The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.
Directory of Open Access Journals (Sweden)
Katrin Carow
2017-09-01
Full Text Available The development of cervical cancer is frequently accompanied by the integration of human papillomaviruses (HPV DNA into the host genome. Viral-cellular junction sequences, which arise in consequence, are highly tumor specific. By using these fragments as markers for tumor cell origin, we examined cervical cancer clonality in the context of intra-tumor heterogeneity. Moreover, we assessed the potential of these fragments as molecular tumor markers and analyzed their suitability for the detection of circulating tumor DNA in sera of cervical cancer patients. For intra-tumor heterogeneity analyses tumors of 8 patients with up to 5 integration sites per tumor were included. Tumor islands were micro-dissected from cryosections of several tissue blocks representing different regions of the tumor. Each micro-dissected tumor area served as template for a single junction-specific PCR. For the detection of circulating tumor-DNA (ctDNA junction-specific PCR-assays were applied to sera of 21 patients. Samples were collected preoperatively and during the course of disease. In 7 of 8 tumors the integration site(s were shown to be homogenously distributed throughout different tumor regions. Only one tumor displayed intra-tumor heterogeneity. In 5 of 21 analyzed preoperative serum samples we specifically detected junction fragments. Junction-based detection of ctDNA was significantly associated with reduced recurrence-free survival. Our study provides evidence that HPV-DNA integration is as an early step in cervical carcinogenesis. Clonality with respect to HPV integration opens new perspectives for the application of viral-cellular junction sites as molecular biomarkers in a clinical setting such as disease monitoring.
Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás
2018-01-01
Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.
Fundamental study of the radiation monitoring system based on evaluation of DNA lesions
International Nuclear Information System (INIS)
Shimizu, K.; Matuo, Y.; Izumi, Y.; Ikeda, T.
2011-01-01
The biological dosemeter that measures biological responses to ionising radiation is useful for radiation protection. This paper presents the development and characterisation of a gamma ray irradiation dosimetry system based on real-time PCR (polymerase chain reaction) methodology. Real-time PCR is used to amplify and simultaneously quantify a targeted DNA molecule. If there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment. The essential point of this assay is that DNA lesions caused by ionising radiation block DNA synthesis by DNA polymerase, resulting in a decrease in the amplification of a damaged DNA template compared with that of non-damaged DNA templates. (authors)
Fertilization capacity with rainbow trout DNA-damaged sperm and embryo developmental success.
Pérez-Cerezales, S; Martínez-Páramo, S; Beirão, J; Herráez, M P
2010-06-01
Mammalian spermatozoa undergo a strong selection process along the female tract to guarantee fertilization by good quality cells, but risks of fertilization with DNA-damaged spermatozoa have been reported. In contrast, most external fertilizers such as fish seem to have weaker selection procedures. This fact, together with their high prolificacy and external embryo development, indicates that fish could be useful for the study of the effects of sperm DNA damage on embryo development. We cryopreserved sperm from rainbow trout using egg yolk and low-density lipoprotein as additives to promote different rates of DNA damage. DNA fragmentation and oxidization were analyzed using comet assay with and without digestion with restriction enzymes, and fertilization trials were performed. Some embryo batches were treated with 3-aminobenzamide (3AB) to inhibit DNA repair by the poly (ADP-ribose) polymerase, which is an enzyme of the base excision repair pathway. Results showed that all the spermatozoa cryopreserved with egg yolk carried more than 10% fragmented DNA, maintaining fertilization rates of 61.1+/-2.3 but a high rate of abortions, especially during gastrulation, and only 14.5+/-4.4 hatching success. Furthermore, after 3AB treatment, hatching dropped to 3.2+/-2.2, showing that at least 10% DNA fragmentation was repaired. We conclude that trout sperm maintains its ability to fertilize in spite of having DNA damage, but that embryo survival is affected. Damage is partially repaired by the oocyte during the first cleavage. Important advantages of using rainbow trout for the study of processes related to DNA damage and repair during development have been reported.
International Nuclear Information System (INIS)
Di Giorgio, Marina; Taja, Maria R.; Bolgiani, A.; Bustos, N.; Cavalieri, H.
2002-01-01
Many accidental overexposures to ionizing radiation lead to an inhomogeneous irradiation of the body. Skin and mucous membranes resulted exposed to very high local radiation doses, which may be survivable because bone marrow is less severely exposed. Under these circumstances, the skin becomes an important organ in determining clinical prognosis, being dosimetric assessment a necessary requirement. There is increasing interest in the assessment of biological markers that permit the detection of radiation induced damage in the localized irradiations. The 'Comet Assay' (single cell gel electrophoresis) is a sensitive, rapid and relatively inexpensive method for measuring DNA damage in individual cells. Single cells are embedded in agarose on microscope slides, lysed to remove the majority of the proteins, electrophoreses, then stained with ethidium bromide in order to visualize the DNA. Following radiation damage, the smaller the fragment size and the grater the number of fragments of DNA, the grater the percentage of DNA that it is able to migrate in an electric field, forming a comet image. The assay can be performed under alkaline conditions to examine DNA single strand breaks (SSBs), or in non denaturing (neutral) conditions to measure double strand breaks (DSBs) in individual cells. In order to get information to be applied on the evaluation of skin biopsies without culture for an early assessment of irradiation consequences in locally irradiated individuals, we have evaluated the alkaline comet assay (for doses 5 Gy), neutral comet assay has been applied to keratinocytes from primary and secondary cultures and to a suspension of epidermal cells obtained from biopsies irradiated in vitro and afterwards processed to obtain the mentioned cellular suspension, in order to reproduce the closest condition to in vivo overexposure. Our results suggest that comet assay can be applied for the early assessment of gamma radiation induced damage in skin biopsies without
Comet assay evaluation of six chemicals of known genotoxic potential in rats.
Hobbs, Cheryl A; Recio, Leslie; Streicker, Michael; Boyle, Molly H; Tanaka, Jin; Shiga, Atsushi; Witt, Kristine L
2015-07-01
As a part of an international validation of the in vivo rat alkaline comet assay (comet assay) initiated by the Japanese Center for the Validation of Alternative Methods (JaCVAM) we examined six chemicals for potential to induce DNA damage: 2-acetylaminofluorene (2-AAF), N-nitrosodimethylamine (DMN), o-anisidine, 1,2-dimethylhydrazine dihydrochloride (1,2-DMH), sodium chloride, and sodium arsenite. DNA damage was evaluated in the liver and stomach of 7- to 9-week-old male Sprague Dawley rats. Of the five genotoxic carcinogens tested in our laboratory, DMN and 1,2-DMH were positive in the liver and negative in the stomach, 2-AAF and o-anisidine produced an equivocal result in liver and negative results in stomach, and sodium arsenite was negative in both liver and stomach. 1,2-DMH and DMN induced dose-related increases in hedgehogs in the same tissue (liver) that exhibited increased DNA migration. However, no cytotoxicity was indicated by the neutral diffusion assay (assessment of highly fragmented DNA) or histopathology in response to treatment with any of the tested chemicals. Therefore, the increased DNA damage resulting from exposure to DMN and 1,2-DMH was considered to represent a genotoxic response. Sodium chloride, a non-genotoxic non-carcinogen, was negative in both tissues as would be predicted. Although only two (1,2-DMH and DMN) out of five genotoxic carcinogens produced clearly positive results in the comet assay, the results obtained for o-anisidine and sodium arsenite in liver and stomach cells are consistent with the known mode of genotoxicity and tissue specificity exhibited by these carcinogens. In contrast, given the known genotoxic mode-of-action and target organ carcinogenicity of 2-AAF, it is unclear why this chemical failed to convincingly increase DNA migration in the liver. Thus, the results of the comet assay validation studies conducted in our laboratory were considered appropriate for five out of the six test chemicals. Copyright © 2015
Parodi, S; Pala, M; Russo, P; Balbi, C; Abelmoschi, M L; Taningher, M; Zunino, A; Ottaggio, L; de Ferrari, M; Carbone, A; Santi, L
1983-07-01
Nitrofurantoin was not positive as a carcinogen in long term assays. In vitro it was positive in some short term tests and negative in others. We have examined Nitrofurantoin for its capability of inducing DNA damage in vivo. With the alkaline elution technique, Nitrofurantoin appeared clearly positive in all the tissues examined (liver, kidney, lung, spleen and bone marrow). In the liver we also observed some cross-linking effect. In bone marrow cells Nitrofurantoin was also clearly positive in terms of sister chromatid exchanges (SCEs) induction. DNA damage in vivo was also examined with a viscosimetric method, more sensitive than alkaline elution. With this method the results were essentially negative, suggesting that the two methods detect different types of damage. In view of its positivity in many organs and in two short term tests in vivo, the carcinogenic potential of Nitrofurantoin should be reconsidered.
Ultrastructural and DNA damaging effects of lead nitrate in the liver.
Narayana, K; Al-Bader, Maie
2011-01-01
A ubiquitous environmental toxicant - lead is known to affect several organ systems. This study was designed to investigate the effects of lead nitrate exposure on liver structure and DNA fragmentation. Adult male Wistar rats were treated orally with lead nitrate at the dose levels of 0%, 0.5% and 1% for 60 days and sacrificed on the next day. The liver was processed for thick sections and evaluated after toludine blue staining and by electron microscopy after staining with uranyl acetate and lead citrate. The DNA damage was assessed by DNA fragmentation assay. The liver weight was not significantly affected in the experimental groups. Hepatocyte nuclei were not shrunk, instead lead was mitogenic to hepatocytes as indicated by an increase in the number of binucleated hepatocytes (Plead-treated groups, these changes were not significantly different from that in control as evaluated by optical density. In conclusion, lead induces necrotic changes with simultaneous mitogenic activity; however, it does not induce significant DNA damage in the liver. Copyright © 2009 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Emmanuelle eFiore
2015-08-01
Full Text Available Here, we report a new homogeneous DNA amplification-based aptamer assay for small analyte sensing. The aptamer of adenosine chosen as the model analyte was split into two fragments able to assemble in the presence of target. Primers were introduced at extremities of one fragment in order to generate the amplifiable DNA component. The amount of amplifiable fragment was quantifiable by Real-Time Polymerase Chain Reaction (RT-PCR amplification and directly reliable on adenosine concentration. This approach combines the very high separation efficiency and the homogeneous format (without immobilization of capillary electrophoresis and the sensitivity of real time PCR amplification. An ultrafast isolation of target-bound split aptamer (60 s was developed by designing a capillary electrophoresis input/ouput scheme. Such method was successfully applied to the determination of adenosine with a LOD of 1 µM.
Hou, Ting; Li, Wei; Zhang, Lianfang; Li, Feng
2015-08-21
Herein, a highly sensitive and versatile homogeneous electrochemical biosensing strategy is proposed, based on the split aptamer-incorporated DNA three-way junction and the exonuclease (Exo) III-assisted target recycling. The aptamer of adenosine triphosphate (ATP, chosen as the model analyte) is split into two fragments and embedded in single-stranded DNA1 and DNA2, respectively. ATP specifically binds with the split aptamers, bringing DNA1 and DNA2 close to each other, thus inducing the DNA three-way junction formation through the partial hybridization among DNA1, DNA2 and the methylene blue-labelled MB-DNA. Subsequently, MB-DNA is specifically digested by Exo III, releasing a MB-labelled mononucleotide, as well as a DNA1-ATP-DNA2 complex, which acts as the recycled target and hybridizes with another intact MB-DNA to initiate the subsequent cycling cleavage process. As a result, large amounts of MB-labelled mononucleotides are released, generating a significantly amplified electrochemical signal toward the ATP assay. To the best of our knowledge, it is the first example to successfully incorporate split aptamers into DNA three-way junctions and to be adopted in a homogeneous electrochemical assay. In addition to high sensitivity, this strategy also exhibits the advantages of simplicity and convenience, because it is carried out in a homogeneous solution, and sophisticated electrode modification processes are avoided. By simply changing the sequences of the split aptamer fragments, this versatile strategy can be easily adopted to assay a large spectrum of targets. Due to its advantages of high sensitivity, excellent selectivity, versatility and simple operation, the as-proposed approach has great potential to be applied in biochemical research and clinical practices.
Estrogen receptor accessory proteins augment receptor-DNA interaction and DNA bending.
Landel, C C; Potthoff, S J; Nardulli, A M; Kushner, P J; Greene, G L
1997-01-01
Increasing evidence suggests that accessory proteins play an important role in the ability of the estrogen receptor (ER) and other nuclear hormone receptors to modulate transcription when bound to cis-acting hormone response elements in target genes. We have previously shown that four proteins, hsp70, protein disulfide isomerase (PDI) and two unknown proteins (p48 and p45), copurify with ER that has been isolated by site-specific DNA chromatography (BERE) and influence the interaction of ER with DNA in vitro. To better define the nature of these effects, we used filter binding and electrophoretic mobility shift assays to study the ability of these proteins to alter the kinetics of ER-DNA interaction and to influence the ability of ER to bend DNA when bound to an estrogen response element (ERE). The results of both assays indicate that ERE-purified ER, with its four associated proteins (hsp70, PDI, p48, p45), has a greater ability to bind to the vitellogenin A2 ERE than ER purified by estradiol-Sepharose chromatography in the absence (ESeph) or presence (EATP) of ATP, in which p48, p45 (ESeph) and hsp70 (EATP) are removed. Surprisingly, the rates of association and dissociation of ER and ERE were essentially the same for all three mixtures, suggesting that one or more ER-associated proteins, especially p45 and p48, may be required for ER to attain maximum DNA binding activity. In addition, circular permutation and phasing analyses demonstrated that the same ER-associated proteins produced higher order ER-DNA complexes that significantly increased the magnitude of DNA distortion, but did not alter the direction of the ER-induced bend of ERE-containing DNA fragments, which was toward the major groove of the DNA helix. These results suggest that p45 and/or p48 and possibly hsp70, play an important role both in the specific DNA binding and bending activities of ER and thus contribute to the overall stimulation of transcription in target genes that contain cis
Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process
International Nuclear Information System (INIS)
Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet
2014-01-01
Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process
Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process
Energy Technology Data Exchange (ETDEWEB)
Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr
2014-02-07
Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.
Evaluation of oxidative DNA damage promoted by storage in sperm from sex-reversed rainbow trout.
Pérez-Cerezales, S; Martínez-Páramo, S; Cabrita, E; Martínez-Pastor, F; de Paz, P; Herráez, M P
2009-03-01
Short-term storage and cryopreservation of sperm are two common procedures in aquaculture, used for routine practices in artificial insemination reproduction and gene banking, respectively. Nevertheless, both procedures cause injuries affecting sperm motility, viability, cell structure and DNA stability, which diminish reproductive success. DNA modification is considered extremely important, especially when sperm storage is carried out with gene banking purposes. DNA damage caused by sperm storage is not well characterized and previous studies have reported simple and double strand breaks that have been attributed to oxidative events promoted by the generation of free radicals during storage. The objective of this study was to reveal DNA fragmentation and to explore the presence of oxidized bases that could be produced by oxidative events during short-term storage and cryopreservation in sex-reversed rainbow trout (Oncorhynchus mykiss) spermatozoa. Sperm from six males was analyzed separately. Different aliquots of the samples were stored 2h (fresh) or 5 days at 4 degrees C or were cryopreserved. Then spermatozoa were analyzed using the Comet assay, as well as combining this method with digestion with two endonucleases from Escherichia coli (Endonuclease III, that cut in oxidized cytosines, and FPG, cutting in oxidized guanosines). Both storage procedures yielded DNA fragmentation, but only short-term storage oxidative events were clearly detected, showing that oxidative processes affect guanosines rather than cytosines. Cryopreservation increases DNA fragmentation but the presence of oxidized bases was not noticed, suggesting that mechanisms other than oxidative stress could be involved in DNA fragmentation promoted by freezing.
Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.
2016-01-01
Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...
International Nuclear Information System (INIS)
Kurashige, Tomomi; Shimamura, Mika; Nagayama, Yuji
2016-01-01
The biological effect of ionizing radiation (IR) on genomic DNA is thought to be either direct or indirect; the latter is mediated by IR induction of free radicals and reactive oxygen species (ROS). This study was designed to evaluate the effect of N-acetyl-L-cysteine (NAC), a well-known ROS-scavenging antioxidant, on IR induction of genotoxicity, cytotoxicity and ROS production in mammalian cells, and aimed to clarify the conflicting data in previous publications. Although we clearly demonstrate the beneficial effect of NAC on IR-induced genotoxicity and cytotoxicity (determined using the micronucleus assay and cell viability/clonogenic assays), the data on NAC's effect on DNA double-strand break (DSB) formation were inconsistent in different assays. Specifically, mitigation of IR-induced DSBs by NAC was readily detected by the neutral comet assay, but not by the γH2AX or 53BP1 focus assays. NAC is a glutathione precursor and exerts its effect after conversion to glutathione, and presumably it has its own biological activity. Assuming that the focus assay reflects the biological responses to DSBs (detection and repair), while the comet assay reflects the physical status of genomic DNA, our results indicate that the comet assay could readily detect the antioxidant effect of NAC on DSB formation. However, NAC's biological effect might affect the detection of DSB repair by the focus assays. Our data illustrate that multiple parameters should be carefully used to analyze DNA damage when studying potential candidates for radioprotective compounds
Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay
Zhou, Huijuan; Wu, Baoyan
2008-12-01
The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.
Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.
2012-01-01
Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444
Jost, Petr; Svobodova, Hana; Stetina, Rudolf
2015-07-25
Sulfur mustard is a highly toxic chemical warfare agent with devastating impact on intoxicated tissues. DNA cross-links are probably the most toxic DNA lesions induced in the cell by sulfur mustard. The comet assay is a very sensitive method for measuring DNA damage. In the present study using the A-549 lung cell line, the comet assay protocol was optimized for indirect detection of DNA cross-links induced by sulfur mustard. The method is based on the additional treatment of the assayed cells containing cross-links with the chemical mutagen, styrene oxide. Alkali-labile adducts of styrene oxide cause DNA breaks leading to the formation of comets. A significant dose-dependent reduction of DNA migration of the comet's tail was found after exposing cells to sulfur mustard, indicative of the amount of sulfur mustard induced cross-links. The remarkable decrease of % tail DNA could be observed as early as 5min following exposure to sulfur mustard and the maximal effect was found after 30min, when DNA migration was reduced to the minimum. Sulfur mustard preincubated in culture medium without cells lost its ability to induce cross-links and had a half-life of about 15min. Pre-incubation longer than 30min does not lead to a significant increase in cross-links when applied to cells. However, the amount of cross-links is decreased during further incubation due to repair. The current modification of the comet assay provides a useful tool for detecting DNA cross-links induced by sulfur mustard and could be used for detection of other DNA cross-linking agents such as chemotherapeutic drugs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia
2015-01-01
Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.
International Nuclear Information System (INIS)
Schmid, D.S.; Tite, J.P.; Ruddle, N.H.
1986-01-01
A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery
Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J
2010-08-01
In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.
Rajab, N F; Yaakob, T A; Ong, B Y; Hamid, M; Ali, A M; Annuar, B O; Inayat-Hussain, S H
2004-05-01
Hydroxyapatite is the main component of the bone which is a potential biomaterial substance that can be applied in orthopaedics. In this study, the biocompatibility of this biomaterial was assessed using an in vitro technique. The cytotoxicity and genotoxicity effect of HA2 and HA3 against L929 fibroblast cell was evaluated using the MTT Assay and Alkaline Comet Assay respectively. Both HA2 and HA3 compound showed low cytotoxicity effect as determined using MTT Assay. Cells viability following 72 hours incubation at maximum concentration of both HA2 and HA3 (200 mg/ml) were 75.3 +/- 8.8% and 86.7 +/- 13.1% respectively. However, the cytotoxicity effect of ZnSO4.7H2O as a positive control showed an IC50 values of 46 mg/ml (160 microM). On the other hand, both HA2 and HA3 compound showed a slight genotoxicity effect as determined using the Alkaline Comet Assay following incubation at the concentration 200 mg/ml for 72 hours. This assay has been widely used in genetic toxicology to detect DNA strand breaks and alkali-labile site. The percentage of the cells with DNA damage for both substance was 27.7 +/- 1.3% and 15.6 +/- 1.0% for HA2 and HA3 respectively. Incubation of the cells for 24 hours with 38 microg/ml (IC25) of positive control showed an increase in percentage of cells with DNA damage (67.5 +/- 0.7%). In conclusion, our study indicated that both hydroxyapatite compounds showed a good biocompatibility in fibroblast cells.
Xing, Yun-Peng; Liu, Chun; Zhou, Xiao-Hong; Shi, Han-Chang
2015-01-01
This work was the first to report that the kanamycin-binding DNA aptamer (5'-TGG GGG TTG AGG CTA AGC CGA-3') can form stable parallel G-quadruplex DNA (G4-DNA) structures by themselves and that this phenomenon can be verified by nondenaturing polyacrylamide gel electrophoresis and circular dichroism spectroscopy. Based on these findings, we developed a novel label-free strategy for kanamycin detection based on the G4-DNA aptamer-based fluorescent intercalator displacement assay with thiazole orange (TO) as the fluorescence probe. In the proposed strategy, TO became strongly fluorescent upon binding to kanamycin-binding G4-DNA. However, the addition of kanamycin caused the displacement of TO from the G4-DNA-TO conjugate, thereby resulting in decreased fluorescent signal, which was inversely related to the kanamycin concentration. The detection limit of the proposed assay decreased to 59 nM with a linear working range of 0.1 μM to 20 μM for kanamycin. The cross-reactivity against six other antibiotics was negligible compared with the response to kanamycin. A satisfactory recovery of kanamycin in milk samples ranged from 80.1% to 98.0%, confirming the potential of this bioassay in the measurement of kanamycin in various applications. Our results also served as a good reference for developing similar fluorescent G4-DNA-based bioassays in the future.
Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food.
Ali, Md Eaqub; Al Amin, Md; Hamid, Sharifah Bee Abd; Hossain, M A Motalib; Mustafa, Shuhaimi
2015-01-01
Wider availability but lack of legal market trades has given feline meat a high potential for use as an adulterant in common meat and meat products. However, mixing of feline meat or its derivatives in food is a sensitive issue, since it is a taboo in most countries and prohibited in certain religions such as Islam and Judaism. Cat meat also has potential for contamination with of severe acute respiratory syndrome, anthrax and hepatitis, and its consumption might lead to an allergic reaction. We developed a very short-amplicon-length (69 bp) PCR assay, authenticated the amplified PCR products by AluI-restriction digestion followed by its separation and detection on a lab-on-a-chip-based automated electrophoretic system, and proved its superiority over the existing long-amplicon-based assays. Although it has been assumed that longer DNA targets are susceptible to breakdown under compromised states, scientific evidence for this hypothesis has been rarely documented. Strong evidence showed that shorter targets are more stable than the longer ones. We confirmed feline-specificity by cross-challenging the primers against 10 different species of terrestrial, aquatic and plant origins in the presence of a 141-bp site of an 18S rRNA gene as a universal eukaryotic control. RFLP analysis separated 43- and 26-bp fragments of AluI-digest in both the gel-image and electropherograms, confirming the original products. The tested detection limit was 0.01% (w/w) feline meat in binary and ternary admixed as well as meatball matrices. Shorter target, better stability and higher sensitivity mean such an assay would be valid for feline identification even in degraded specimens.
Jayakumar, Sundarraj; Bhilwade, Hari N; Pandey, Badri N; Sandur, Santosh K; Chaubey, Ramesh C
2012-10-09
The assessment of tumor radiosensitivity would be particularly useful in optimizing the radiation dose during radiotherapy. Therefore, the degree of correlation between radiation-induced DNA damage, as measured by the alkaline and the neutral comet assays, and the clonogenic survival of different human tumor cells was studied. Further, tumor radiosensitivity was compared with the expression of genes associated with the cellular response to radiation damage. Five different human tumor cell lines were chosen and the radiosensitivity of these cells was established by clonogenic assay. Alkaline and neutral comet assays were performed in γ-irradiated cells (2-8Gy; either acute or fractionated). Quantitative PCR was performed to evaluate the expression of DNA damage response genes in control and irradiated cells. The relative radiosensitivity of the cell lines assessed by the extent of DNA damage (neutral comet assay) immediately after irradiation (4Gy or 6Gy) was in agreement with radiosensitivity pattern obtained by the clonogenic assay. The survival fraction of irradiated cells showed a better correlation with the magnitude of DNA damage measured by the neutral comet assay (r=-0.9; Pcomet assay (r=-0.73; Pcomet assay was better than alkaline comet assay for assessment of radiosensitivities of tumor cells after acute or fractionated doses of irradiation. © 2012 Elsevier B.V. All rights reserved.
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
Lucas, Andrew T; O'Neal, Sara K; Santos, Charlene M; White, Taylor F; Zamboni, William C
2016-02-05
Doxorubicin, a widely used anticancer agent, exhibits antitumor activity against a wide variety of malignancies. The drug exerts its cytotoxic effects by binding to and intercalating within the DNA of tumor and tissue cells. However, current assays are unable to accurately determine the concentration of the intracellular active form of doxorubicin. Thus, the development of a sample processing method and a high-performance liquid chromatography (HPLC) methodology was performed in order to quantify doxorubicin that is associated with DNA in tumors and tissues, which provided an intracellular cytotoxic measure of doxorubicin exposure after administration of small molecule and nanoparticle formulations of doxorubicin. The assay uses daunorubicin as an internal standard; liquid-liquid phase extraction to isolate drug associated with DNA; a Shimadzu HPLC with fluorescence detection equipped with a Phenomenex Luna C18 (2μm, 2.0×100mm) analytical column and a gradient mobile phase of 0.1% formic acid in water or acetonitrile for separation and quantification. The assay has a lower limit of detection (LLOQ) of 10ng/mL and is shown to be linear up to 3000ng/mL. The intra- and inter-day precision of the assay expressed as a coefficient of variation (CV%) ranged from 4.01 to 8.81%. Furthermore, the suitability of this assay for measuring doxorubicin associated with DNA in vivo was demonstrated by using it to quantify the doxorubicin concentration within tumor samples from SKOV3 and HEC1A mice obtained 72h after administration of PEGylated liposomal doxorubicin (Doxil(®); PLD) at 6mg/kg IV x 1. This HPLC assay allows for sensitive intracellular quantification of doxorubicin and will be an important tool for future studies evaluating intracellular pharmacokinetics of doxorubicin and various nanoparticle formulations of doxorubicin. Copyright © 2015 Elsevier B.V. All rights reserved.
Komar, Dorota N; Mouriz, Alfonso; Jarillo, José A; Piñeiro, Manuel
2016-01-14
Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.
Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E
2015-08-18
The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect
Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M
2015-02-01
In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.
Cascade DNA nanomachine and exponential amplification biosensing.
Xu, Jianguo; Wu, Zai-Sheng; Shen, Weiyu; Xu, Huo; Li, Hongling; Jia, Lee
2015-11-15
DNA is a versatile scaffold for the assembly of multifunctional nanostructures, and potential applications of various DNA nanodevices have been recently demonstrated for disease diagnosis and treatment. In the current study, a powerful cascade DNA nanomachine was developed that can execute the exponential amplification of p53 tumor suppressor gene. During the operation of the newly-proposed DNA nanomachine, dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) was ingeniously introduced, where the target trigger is repeatedly used as the fuel molecule and the nicked fragments are dramatically accumulated. Moreover, each displaced nicked fragment is able to activate the another type of cyclical strand-displacement amplification, increasing exponentially the value of fluorescence intensity. Essentially, one target binding event can induce considerable number of subsequent reactions, and the nanodevice was called cascade DNA nanomachine. It can implement several functions, including recognition element, signaling probe, polymerization primer and template. Using the developed autonomous operation of DNA nanomachine, the p53 gene can be quantified in the wide concentration range from 0.05 to 150 nM with the detection limit of 50 pM. If taking into account the final volume of mixture, the detection limit is calculated as lower as 6.2 pM, achieving an desirable assay ability. More strikingly, the mutant gene can be easily distinguished from the wild-type one. The proof-of-concept demonstrations reported herein is expected to promote the development and application of DNA nanomachine, showing great potential value in basic biology and medical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.
Immunochemical approach to the study of DNA damage and repair. Technical progress report
International Nuclear Information System (INIS)
1986-01-01
We are studying damages that have been shown to be stable radiolysis products found in x-irradiation DNA and thus products that have potential biological consequences. Four thymine ring saturation or fragmentation products were chosen as models for pyrimidine radiolysis products. The first product we synthesized and to which antibodies were elicited was thymine glycol. Thymine glycols are the major stable radiolysis products produced in DNA x-radiation in vitro. Although they retain base pairing characteristics, the stacking properties of thymine glycols are altered due to the saturation of the 5.6 double bond. Thymine glucol is also a useful model because alternative assay proceudres are available and they can selectively be produced in DNA by osmium tetroxide oxidation allowing the development of standards for subsequent measurement of DNA damage in x-irradiated DNA. We have also raised antibodies to dihydrothymine, a major radiolysis product produced in NDA under anaerobic conditions, to 5-hydroxy-5-methylhydantoin, the second most predominant stable radiolysis product producted under aerobic conditions, and to urea, a totally non-instructive DNA fragmentation product of thymine hydroperoxides. 29 refs., 2 figs
Characterization of ionizing radiation damage in DNA. Progress report, May 1, 1974--April 30, 1975
International Nuclear Information System (INIS)
Hawkins, R.B.
1975-01-01
The objective of this research is the characterization and quantitative assay of ionizing radiation induced damage in DNA and nucleoprotein. Two lines of investigation have been pursued. The first is aimed at detection and assay of the amount of DNA to protein covalent cross linkage in coliphage T7. Protein and DNA are labeled with 14 C and 32 P, respectively. Cross linkage is assessed from the amount of labeled protein remaining with DNA after efforts to separate the two components by countercurrent distribution in a phenol-water system. It has been found that cross linkage occurs in phage irradiated with cobalt 60 gamma radiation while in dilute neutral aqueous solutions of phosphate buffer and phosphate buffer plus 1-histidine. Cross linkage is largely due to indirect effects and accompanied by protein and DNA fragmentation. The second line of investigation is a study of the hydrodynamic and viscoelastic properties of dilute solution of DNA from irradiated bacteriophage and cells. A device for this purpose, which will measure the elastic retardation time of DNA solutions, is being constructed. (U.S.)
Kurashige, Tomomi; Shimamura, Mika; Nagayama, Yuji
2016-06-01
The biological effect of ionizing radiation (IR) on genomic DNA is thought to be either direct or indirect; the latter is mediated by IR induction of free radicals and reactive oxygen species (ROS). This study was designed to evaluate the effect of N-acetyl-L-cysteine (NAC), a well-known ROS-scavenging antioxidant, on IR induction of genotoxicity, cytotoxicity and ROS production in mammalian cells, and aimed to clarify the conflicting data in previous publications. Although we clearly demonstrate the beneficial effect of NAC on IR-induced genotoxicity and cytotoxicity (determined using the micronucleus assay and cell viability/clonogenic assays), the data on NAC's effect on DNA double-strand break (DSB) formation were inconsistent in different assays. Specifically, mitigation of IR-induced DSBs by NAC was readily detected by the neutral comet assay, but not by the γH2AX or 53BP1 focus assays. NAC is a glutathione precursor and exerts its effect after conversion to glutathione, and presumably it has its own biological activity. Assuming that the focus assay reflects the biological responses to DSBs (detection and repair), while the comet assay reflects the physical status of genomic DNA, our results indicate that the comet assay could readily detect the antioxidant effect of NAC on DSB formation. However, NAC's biological effect might affect the detection of DSB repair by the focus assays. Our data illustrate that multiple parameters should be carefully used to analyze DNA damage when studying potential candidates for radioprotective compounds. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.
Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia
2007-08-01
As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.
In vitro assays for predicting tumor cell response to radiation by apoptotic pathways
International Nuclear Information System (INIS)
Algan, Oe.; Hanks, G.E.; Biade, S.; Chapman, J.D.
1995-01-01
were detected by gel electrophoresis procedures but this technique is laborious and difficult to quantify. Centrifugation procedures of irradiation cells which had been pre-labeled with 3 H-thymidine showed ∼18% of total cellular DNA to be fragmented within 12 hr, after which time the extent of DNA fragmentation plateaued. The labeling of 3'-OH ends in cellular DNA by the immunofluorescence reagent, ApopTag[reg], showed ∼15% of cells to undergo apoptotic degradation. Staining of irradiated cells with LIVE/DEAD[reg] EUKOLIGHT TM and trypan blue showed 20-25% cell death. Although the vital stain assays are not specific for apoptosis, the proportion of rapid cell death (within 24-48 hr) which they measure is close to that obtained with the apoptotic-specific assays. These studies indicate that 24 hr after irradiation with 10 Gy, approximately 20% of DU-145 cells undergo death by apoptosis. Survival curves constructed with different radiation doses indicate that this rapid mechanism of cell death follows single-hit kinetics and constitutes between 10-30% of the total α coefficient measured by clonogenic assays with this cell line. Conclusion: Two phases of cell death are observed after ionizing radiation of the DU-145 prostate cancer cell line. Rapid cell death occurs within ∼24 hr and appears to correlate with apoptotic cell death. The vital stains, LIVE/DEAD[reg] EUKOLIGHT TM and trypan blue, yield quantitatively similar estimates of rapid cell killing to the apoptosis-specific assays. We are currently extending these studies to other human prostate tumor cell lines and to tumor cells released from human prostate biopsies. Such assays may provide additional prognostic information for predicting radiotherapy outcome of patients receiving radiotherapy
Directory of Open Access Journals (Sweden)
Karin Regnström
Full Text Available Surface Plasmon Resonance (SPR is rarely used as a primary High-throughput Screening (HTS tool in fragment-based approaches. With SPR instruments becoming increasingly high-throughput it is now possible to use SPR as a primary tool for fragment finding. SPR becomes, therefore, a valuable tool in the screening of difficult targets such as the ubiquitin E3 ligase Parkin. As a prerequisite for the screen, a large number of SPR tests were performed to characterize and validate the active form of Parkin. A set of compounds was designed and used to define optimal SPR assay conditions for this fragment screen. Using these conditions, more than 5000 pre-selected fragments from our in-house library were screened for binding to Parkin. Additionally, all fragments were simultaneously screened for binding to two off target proteins to exclude promiscuous binding compounds. A low hit rate was observed that is in line with hit rates usually obtained by other HTS screening assays. All hits were further tested in dose responses on the target protein by SPR for confirmation before channeling the hits into Nuclear Magnetic Resonance (NMR and other hit-confirmation assays.
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi
2017-04-26
We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.
Directory of Open Access Journals (Sweden)
José Carlos Pelielo de Mattos
2008-12-01
Full Text Available Reactive oxygen species (ROS can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl2 is a ROS generator, leading to lethality in Escherichia coli (E. coli, with the base excision repair (BER mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms.Espécies reativas de oxigênio (ERO podem induzir lesões em diferentes alvos celulares, incluindo o DNA. O cloreto estanoso (SnCl2 é um gerador de ERO que induz letalidade em E. coli, sendo o reparo por excisão de bases (BER um mecanismo importante neste processo. Técnicas como o ensaio cometa (em eucariotos e a eletroforese de DNA plasmidial em gel de agarose têm sido utilizadas para detectar genotoxicidade. No presente estudo, uma adaptação do método de eletroforese em gel alcalino de agarose foi usada para verificar a indução de quebras, pelo SnCl2, no DNA de E. coli, bem como a participação de enzimas do BER na restauração das lesões. Os resultados mostraram que o SnCl2 induziu quebras no DNA de todas as cepas testadas. Além disso, endonuclease IV e exonuclease III estão envolvidas na reparação dos danos. Em resumo, os dados obtidos indicam que a metodologia de eletroforese em gel alcalino de agarose pode ser empregada tanto para o estudo de quebras no DNA, quanto para avaliação dos
Gul, Sheraz; Brown, Richard; May, Earl; Mazzulla, Marie; Smyth, Martin G; Berry, Colin; Morby, Andrew; Powell, David J
2004-11-01
DNA ligases are key enzymes involved in the repair and replication of DNA. Prokaryotic DNA ligases uniquely use NAD+ as the adenylate donor during catalysis, whereas eukaryotic enzymes use ATP. This difference in substrate specificity makes the bacterial enzymes potential targets for therapeutic intervention. We have developed a homogeneous chemiluminescence-based hybridization protection assay for Staphylococcus aureus DNA ligase that uses novel acridinium ester technology and demonstrate that it is an alternative to the commonly used radiometric assays for ligases. The assay has been used to determine a number of kinetic constants for S. aureus DNA ligase catalysis. These included the K(m) values for NAD+ (2.75+/-0.1 microM) and the acridinium-ester-labelled DNA substrate (2.5+/-0.2 nM). A study of the pH-dependencies of kcat, K(m) and kcat/K(m) has revealed values of kinetically influential ionizations within the enzyme-substrate complexes (kcat) and free enzyme (kcat/K(m)). In each case, the curves were shown to be composed of one kinetically influential ionization, for k(cat), pK(a)=6.6+/-0.1 and kcat/K(m), pK(a)=7.1+/-0.1. Inhibition characteristics of the enzyme against two Escherichia coli DNA ligase inhibitors have also been determined with IC50 values for these being 3.30+/-0.86 microM for doxorubicin and 1.40+/-0.07 microM for chloroquine diphosphate. The assay has also been successfully miniaturized to a sufficiently low volume to allow it to be utilized in a high-throughput screen (384-well format; 20 microl reaction volume), enabling the assay to be used in screening campaigns against libraries of compounds to discover leads for further drug development.
Comet assay in the detection of irradiated garlic; Teste do cometa na deteccao de alho irradiado
Energy Technology Data Exchange (ETDEWEB)
Villavicencio, Anna Lucia C.H.; Marin-Huachaca, Nelida Simona; Romanelli, Maria Fernanda [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)]. E-mail: villavic@net.ipen.br; Delincee, Henry [Federal Research Centre for Nutrition - BFE, Karlsruhe (Germany)]. E-mail: henry.delincee@bfe.uni-karlsruhe.de
2002-07-01
The increased claim for fresh produce has forced a consensus between nations to pay more attention to the phytosanitary regulations. Inhibition of sprouting of bulbs and tubers by applying ionising radiation is authorised by the National Food Codes in Brazil. The availability of methods for detection of irradiated food will contribute to increase consumers' confidence. A quick and simple screening test to indicate whether a food product has been irradiated or not was utilised in this study. The DNA comet assay was applied to verify whether garlic imported from China had been irradiated or not. This test has already been adopted as a European Standard (EN 13784), for detection of irradiated food. Non-irradiated control samples of garlic and garlic treated with maleic hydrazide were compared with garlic samples irradiated in our department. The unirradiated samples exhibited only limited DNA migration. If samples were irradiated, an increased DNA fragmentation was observed which permitted the discrimination between non-irradiated and irradiated samples. Since the garlic samples from China showed only very limited DNA fragmentation, they were deemed non-irradiated. Thus, this simple screening test was shown to be successful for identification of an irradiation treatment. (author)
Praveen Kumar, M K; Shyama, S K; Sonaye, B S; Naik, U Roshini; Kadam, S B; Bipin, P D; D'costa, A; Chaubey, R C
2014-05-01
Ionizing radiation is known to induce genetic damage in diverse groups of organisms. Under accidental situations, large quantities of radioactive elements get released into the environment and radiation emitted from these radionuclides may adversely affect both the man and the non-human biota. The present study is aimed (a) to know the genotoxic effect of gamma radiation on aquatic fauna employing two species of selected bivalves, (b) to evaluate the possible use of 'Comet assay' for detecting genetic damage in haemocytes of bivalves as a biomarker for environmental biomonitoring and also (c) to compare the relative sensitivity of two species of bivalves viz. Paphia malabarica and Meretrix casta to gamma radiation. The comet assays was optimized and validated using different concentrations (18, 32 and 56 mg/L) of ethyl methanesulfonate (EMS), a direct-acting reference genotoxic agent, to which the bivalves were exposed for various times (24, 48 and 72 h). Bivalves were irradiated (single acute exposure) with 5 different doses (viz. 2, 4, 6, 8 and 10 Gy) of gamma radiation and their genotoxic effects on the haemocytes were studied using the comet assay. Haemolymph was collected from the adductor muscle at 24, 48 and 72 h of both EMS-exposed and irradiated bivalves and comet assay was carried out using standard protocol. A significant increase in DNA damage was observed as indicated by an increase in % tail DNA damage at different concentrations of EMS and all the doses of gamma radiation as compared to controls in both bivalve species. This showed a dose-dependent increase of genetic damage induced in bivalves by EMS as well as gamma radiation. Further, the highest DNA damage was observed at 24h. The damage gradually decreased with time, i.e. was smaller at 48 and 72 h than at 24h post irradiation in both species of bivalves. This may indicate repair of the damaged DNA and/or loss of heavily damaged cells as the post irradiation time advanced. The present study
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
Effect of low dose tritium on mouse lymphocyte DNA estimated by comet assay
International Nuclear Information System (INIS)
Ichimasa, Yusuke; Otsuka, Kensuke; Maruyama, Satoko; Tauchi, Hiroshi; Ichimasa, Michiko; Uda, Tatsuhiko
2003-01-01
This paper deals with low dose effect of HTO on mouse lymphocytes DNA (in vitro irradiation) estimated by the comet assay using ICR male mouse of 20 to 23 weeks old. Lymphocytes were isolated by centrifugation of whole blood sample on Ficoll-Paque solution and embedded in agarose gel just after mixed with HTO. After lymphocytes were exposed to 17-50 mGy of HTO, the agarose gel slides were washed to remove HTO and cell lysis treatment on the slides was conducted before electrophoresis. The individual comets on stained slides after electrophoresis were analyzed using imaging software. No significant DNA damages were observed. (author)
Fragman: an R package for fragment analysis.
Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan
2016-04-21
Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.
C. Selva Kumar
2011-01-01
Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...
Directory of Open Access Journals (Sweden)
S.M. Mahan
2004-11-01
Full Text Available White-tailed deer are susceptible to heartwater (Ehrlichia [Cowdria] ruminantium infection and are likely to suffer high mortality if the disease spreads to the United States. It is vital, therefore, to validate a highly specific and sensitive detection method for E. ruminantium infection that can be reliably used in testing white-tailed deer, which are reservoirs of antigenically or genetically related agents such as Ehrlichia chaffeensis, Anaplasma (Ehrlichia phagocytophilum (HGE agent and Ehrlichia ewingii. Recently, a novel but as yet unnamed ehrlichial species, the white-tailed deer ehrlichia (WTDE, has been discovered in deer populations in the United States. Although the significance of WTDE as a pathogen is unknown at present, it can be distinguished from other Ehrlichia spp. based on 16S rRNA gene sequence analysis. In this study it was differentiated from E. ruminantium by the use of the pCS20 PCR assay which has high specificity and sensitivity for the detection of E. ruminantium. This assay did not amplify DNA from the WTDE DNA samples isolated from deer resident in Florida, Georgia and Missouri, but amplified the specific 279 bp fragment from E. ruminantium DNA. The specificity of the pCS20 PCR assay for E. ruminantium was confirmed by Southern hybridization. Similarly, the 16S PCR primers (nested that amplify a specific 405-412 bp fragment from the WTDE DNA samples, did not amplify any product from E. ruminantium DNA. This result demonstrates that it would be possible to differentiate between E. ruminantium and the novel WTDE agent found in white tailed deer by applying the two respective PCR assays followed by Southern hybridizations. Since the pCS20 PCR assay also does not amplify any DNA products from E. chaffeensis or Ehrlichia canis DNA, it is therefore the method of choice for the detection of E. ruminantium in these deer and other animal hosts.
Park, Seungman; Kang, Youjin; Kim, Dong Geun; Kim, Eui-Chong; Park, Sung Sup; Seong, Moon-Woo
2013-08-01
The detection of high-risk (HR) HPV in cervical cancer screening is important for early diagnosis of cervical cancer or pre-cancerous lesions. We evaluated the analytical and clinical performances of 3 HR HPV assays in Gynecology patients. A total of 991 specimens were included in this study: 787 specimens for use with a Hybrid Capture 2 (HC2) and 204 specimens for a HPV DNA microarray (DNA Chip). All specimens were tested using an Abbott RealTime High Risk HPV assay (Real-time HR), PGMY PCR, and sequence analysis. Clinical sensitivities for severe abnormal cytology (severe than high-grade squamous intraepithelial lesion) were 81.8% for Real-time HR, 77.3% for HC2, and 66.7% for DNA Chip, and clinical sensitivities for severe abnormal histology (cervical intraepithelial neoplasia grade 2+) were 91.7% for HC2, 87.5% for Real-time HR, and 73.3% for DNA Chip. As compared to results of the sequence analysis, HC2, Real-time HR, and DNA Chip showed concordance rates of 94.3% (115/122), 90.0% (117/130), and 61.5% (16/26), respectively. The HC2 assay and Real-time HR assay showed comparable results to each other in both clinical and analytical performances, while the DNA Chip assay showed poor clinical and analytical performances. The Real-time HR assay can be a good alternative option for HR HPV testing with advantages of allowing full automation and simultaneous genotyping of HR types 16 and 18. Copyright © 2013 Elsevier Inc. All rights reserved.
Feyfant, Eric; Cross, Jason B; Paris, Kevin; Tsao, Désirée H H
2011-01-01
Fragment-based drug design (FBDD), which is comprised of both fragment screening and the use of fragment hits to design leads, began more than 15 years ago and has been steadily gaining in popularity and utility. Its origin lies on the fact that the coverage of chemical space and the binding efficiency of hits are directly related to the size of the compounds screened. Nevertheless, FBDD still faces challenges, among them developing fragment screening libraries that ensure optimal coverage of chemical space, physical properties and chemical tractability. Fragment screening also requires sensitive assays, often biophysical in nature, to detect weak binders. In this chapter we will introduce the technologies used to address these challenges and outline the experimental advantages that make FBDD one of the most popular new hit-to-lead process.
Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng
2018-06-29
The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Donnelly, Erling T.; Liu Yanfeng; Paul, Tracy K.; Rockwell, Sara
2005-01-01
Purpose: To investigate the effects of motexafin gadolinium (MGd) on the levels of reactive oxygen species (ROS), glutathione (GSH), and DNA damage in EMT6 mouse mammary carcinoma cells. The ability of MGd to alter radiosensitivity and to inhibit DNA damage repair after X-ray irradiation was also evaluated. Methods and Materials: Reactive oxygen species and GSH levels were assessed by 2,7-dichlorofluorescein fluorescence flow cytometry and the Tietze method, respectively. Cellular radiosensitivity was assessed by clonogenic assays. Deoxyribonucleic acid damage and DNA damage repair were assessed in plateau-phase EMT6 cells by the Comet assay and clonogenic assays. Results: Cells treated with 100 μmol/L MGd plus equimolar ascorbic acid (AA) had significantly increased levels of ROS and a 58.9% ± 3.4% decrease in GSH levels, relative to controls. Motexafin gadolinium plus AA treatment increased the hypoxic, but not the aerobic, radiosensitivity of EMT6 cells. There were increased levels of single-strand breaks in cells treated with 100 μmol/L MGd plus equimolar AA, as evidenced by changes in the alkaline tail moment (MGd + AA, 6 h: 14.7 ± 1.8; control: 2.8 ± 0.9). The level of single-strand breaks was dependent on the length of treatment. Motexafin gadolinium plus AA did not increase double-strand breaks. The repair of single-strand breaks at 2 h, but not at 4 h and 6 h, after irradiation was altered significantly in cells treated with MGd plus AA (MGd + AA, 2 h: 15.8 ± 3.4; control: 5.8 ± 0.6). Motexafin gadolinium did not alter the repair of double-strand breaks at any time after irradiation with 10 Gy. Conclusions: Motexafin gadolinium plus AA generated ROS, which in turn altered GSH homeostasis and induced DNA strand breaks. The MGd plus AA-mediated alteration of GSH levels increased the hypoxic, but not aerobic, radiosensitivity of EMT6 cells. Motexafin gadolinium altered the kinetics of single-strand break repair soon after irradiation but did not
Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.
2015-01-01
Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard
Aitken, R John; De Iuliis, Geoffry N; Finnie, Jane M; Hedges, Andrew; McLachlan, Robert I
2010-10-01
DNA damage in human spermatozoa is known to be associated with a variety of adverse clinical outcomes affecting both reproductive efficiency and the health and wellbeing of the offspring. However, the origin of this damage, its biochemical nature and strategies for its amelioration, still await resolution. Using novel methods to simultaneously assess DNA fragmentation (modified TUNEL assay), DNA-base adduct formation (8-hydroxy-2'-deoxyguanosine [8OHdG]) and cell vitality, spermatozoa from a cohort of 50 assisted conception patients were examined and compared with a group of donors. Receiver operating characteristic (ROC) curve analysis was then used to examine the frequency distribution of the data and to determine optimized thresholds for identifying patients exhibiting abnormally high levels of DNA damage. 8OHdG formation and DNA fragmentation were highly correlated with each other and frequently associated with cell death. Percoll centrifugation improved sperm quality but, unexpectedly, increased 8OHdG formation in live cells, as did sperm fractionation using Puresperm gradients. ROC analysis indicated that the frequency distribution of 8OHdG and DNA fragmentation data were significantly different between patients and donors (P live cells. However, the development of novel methods and optimized thresholds for diagnosing oxidative DNA damage in human spermatozoa should assist in the clinical management of this pathology.
Utility of a Multiplex PCR Assay for Detecting Herpesvirus DNA in Clinical Samples
Druce, Julian; Catton, Mike; Chibo, Doris; Minerds, Kirsty; Tyssen, David; Kostecki, Renata; Maskill, Bill; Leong-Shaw, Wendy; Gerrard, Marie; Birch, Chris
2002-01-01
A multiplex PCR was designed to amplify herpes simplex virus types 1 and 2, cytomegalovirus, and varicella-zoster virus DNA present in a diverse range of clinical material. The susceptibility of these viruses to in vivo inhibition by at least one antiviral drug was an important consideration in their inclusion in the multiplex detection system. An aliquot of equine herpesvirus was introduced into each specimen prior to extraction and served as an indicator of potential inhibitors of the PCR and a detector of suboptimal PCR conditions. Compared to virus isolation and immunofluorescence-based antigen detection, the multiplex assay yielded higher detection rates for all viruses represented in the assay. The turnaround time for performance of the assay was markedly reduced compared to those for the other techniques used to identify these viruses. More than 21,000 tests have been performed using the assay. Overall, the multiplex PCR enabled the detection of substantially increased numbers of herpesviruses, in some cases in specimens or anatomical sites where previously they were rarely if ever identified using traditional detection methods. PMID:11980951
Qu, Xinshun; Christ, Barbara J
2006-10-01
ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.
Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard
2009-10-07
Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.
Directory of Open Access Journals (Sweden)
Svetlana Kostyuk
2015-01-01
Full Text Available Background. Cell free DNA (cfDNA circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci. As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR, PCNA (FACS and antiapoptotic genes (BCL2 (RT-PCR and FACS, BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR. Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs. Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR, in the level of fatty acid binding protein FABP4 (FACS analysis and in the level of fat (Oil Red O. Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.
Fragmentation of chromatin with 125I radioactive disintegrations
International Nuclear Information System (INIS)
Turner, G.N.; Nobis, P.; Dewey, W.C.
1976-01-01
The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated
Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N
2016-05-01
To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.
International Nuclear Information System (INIS)
Seidel, Clemens; Lautenschläger, Christine; Dunst, Jürgen; Müller, Arndt-Christian
2012-01-01
To investigate whether different conditions of DNA structure and radiation treatment could modify heterogeneity of response. Additionally to study variance as a potential parameter of heterogeneity for radiosensitivity testing. Two-hundred leukocytes per sample of healthy donors were split into four groups. I: Intact chromatin structure; II: Nucleoids of histone-depleted DNA; III: Nucleoids of histone-depleted DNA with 90 mM DMSO as antioxidant. Response to single (I-III) and twice (IV) irradiation with 4 Gy and repair kinetics were evaluated using %Tail-DNA. Heterogeneity of DNA damage was determined by calculation of variance of DNA-damage (V) and mean variance (Mvar), mutual comparisons were done by one-way analysis of variance (ANOVA). Heterogeneity of initial DNA-damage (I, 0 min repair) increased without histones (II). Absence of histones was balanced by addition of antioxidants (III). Repair reduced heterogeneity of all samples (with and without irradiation). However double irradiation plus repair led to a higher level of heterogeneity distinguishable from single irradiation and repair in intact cells. Increase of mean DNA damage was associated with a similarly elevated variance of DNA damage (r = +0.88). Heterogeneity of DNA-damage can be modified by histone level, antioxidant concentration, repair and radiation dose and was positively correlated with DNA damage. Experimental conditions might be optimized by reducing scatter of comet assay data by repair and antioxidants, potentially allowing better discrimination of small differences. Amount of heterogeneity measured by variance might be an additional useful parameter to characterize radiosensitivity
Wang, Cuini; Cheng, Yuanyuan; Liu, Biao; Wang, Yuanyuan; Gong, Weiming; Qian, Yihong; Guan, Zhifang; Lu, Haikong; Gu, Xin; Shi, Mei; Zhou, Pingyu
2018-05-09
The aim of this work was to investigate the application of the nested PCR assay for the detection of Treponema pallidum (TP) DNA from the blood of patients with different stages of syphilis. In this study, a nested PCR method targeting the Tpp47 and polA genes (Tpp47-Tp-PCR and polA-Tp-PCR) was developed to detect TP-DNA in whole blood samples collected from 262 patients with different stages of syphilis (84 primary syphilis, 97 secondary syphilis, and 81 latent syphilis patients). The PCR assay detected T. pallidum DNA in 53.6% and 62.9% of the patients with primary and secondary syphilis, respectively, which was much higher than the detection levels in patients with latent syphilis (7.4%) (both p PCR in the early phase of the latent infection. Thus, blood RPR titers were correlated with the blood T. pallidum burden, but the correlations varied with primary and secondary syphilis. The results indicate that nested PCR is a sensitive method for detecting blood TP-DNA and is especially useful for detecting early syphilis including primary syphilis and secondary syphilis. The findings also suggest that the PCR assay may be used to complement other methods to enhance the diagnosis of syphilis.
Energy Technology Data Exchange (ETDEWEB)
Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu
2016-09-02
Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.
International Nuclear Information System (INIS)
Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan
2016-01-01
Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.
DNA probe labeling with digoxigenin-dUTP and its application in gene diagnosis
International Nuclear Information System (INIS)
Liu Guoyang
1992-01-01
DNA probe labeling by the randomly primed incorporation of digoxigenin-dUTP is reported. The sensitivity of color reaction and hybridization were 32 fg and 200 fg, respectively, and both were specific for the target. Single-copy and multi-copy gene fragments among 2 μg human genomic DNA were detected by β IVS II, Fr 3-42 and 3'HVR labeled with digoxigenin-dUTP. The results were consistent with a radioactive control assay. This method has been successfully used in the gene diagnosis of adult polycystic kidney disease
A multiplex PCR mini-barcode assay to identify processed shark products in the global trade.
Directory of Open Access Journals (Sweden)
Diego Cardeñosa
Full Text Available Protecting sharks from overexploitation has become global priority after widespread population declines have occurred. Tracking catches and trade on a species-specific basis has proven challenging, in part due to difficulties in identifying processed shark products such as fins, meat, and liver oil. This has hindered efforts to implement regulations aimed at promoting sustainable use of commercially important species and protection of imperiled species. Genetic approaches to identify shark products exist but are typically based on sequencing or amplifying large DNA regions and may fail to work on heavily processed products in which DNA is degraded. Here, we describe a novel multiplex PCR mini-barcode assay based on two short fragments of the cytochrome oxidase I (COI gene. This assay can identify to species all sharks currently listed on the Convention of International Trade of Endangered Species (CITES and most shark species present in the international trade. It achieves species diagnosis based on a single PCR and one to two downstream DNA sequencing reactions. The assay is capable of identifying highly processed shark products including fins, cooked shark fin soup, and skin-care products containing liver oil. This is a straightforward and reliable identification method for data collection and enforcement of regulations implemented for certain species at all governance levels.
Flow cytometric measurement of DNA level and steroid hormone receptor assay in breast cancer
International Nuclear Information System (INIS)
Zubrikhina, G.N.; Kuz'mina, Eh.V.; Bassalyk, L.S.; Murav'eva, N.I.
1989-01-01
DNA level measured by flow cytometry and estrogen and progesteron receptors assayed in tissue samples obtained from 85 malignant and 16 benign lesions of the breast. All the benign tumors revealed 2c DNA content and most of them were receptor-negative, while 74.1% of breast carcinomas displayed aneuploidy. Three patients (3.5%) had two lines of aneuploid cells. Many aneuploid tumors were receptor-negative. Preoperative radiation treatmet (14-20 Gy) did not significantly influence the level of steroid hormone receptors in tumors. Estrogen receptor level was higher in menopausal patients than in premenopausal ones
Polymer fragmentation in extensional flow
Energy Technology Data Exchange (ETDEWEB)
Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech
2001-06-01
In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.
Directory of Open Access Journals (Sweden)
Yuqian Luo
2016-11-01
Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.
Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA
Directory of Open Access Journals (Sweden)
Ana Lisa do Vale Gomes
2006-10-01
Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
International Nuclear Information System (INIS)
Praveen Kumar, M.K.; Shyama, S.K.; Sonaye, B.S.; Naik, U Roshini; Kadam, S.B.; Bipin, P.D.; D’costa, A.; Chaubey, R.C.
2014-01-01
Highlights: • Possible genotoxic effect of accidental exposure of aquatic fauna to γ radiation. • Relative sensitivity of bivalves to γ radiation is also analyzed using comet assay. • γ radiation induced significant genetic damage in both the species of bivalves. • P. malabarica and M. casta exhibited a similar level of sensitivity to γ radiation. • Comet assay may be used as a biomarker for the environmental biomonitoring. - Abstract: Ionizing radiation is known to induce genetic damage in diverse groups of organisms. Under accidental situations, large quantities of radioactive elements get released into the environment and radiation emitted from these radionuclides may adversely affect both the man and the non-human biota. The present study is aimed (a) to know the genotoxic effect of gamma radiation on aquatic fauna employing two species of selected bivalves, (b) to evaluate the possible use of ‘Comet assay’ for detecting genetic damage in haemocytes of bivalves as a biomarker for environmental biomonitoring and also (c) to compare the relative sensitivity of two species of bivalves viz. Paphia malabarica and Meretrix casta to gamma radiation. The comet assays was optimized and validated using different concentrations (18, 32 and 56 mg/L) of ethyl methanesulfonate (EMS), a direct-acting reference genotoxic agent, to which the bivalves were exposed for various times (24, 48 and 72 h). Bivalves were irradiated (single acute exposure) with 5 different doses (viz. 2, 4, 6, 8 and 10 Gy) of gamma radiation and their genotoxic effects on the haemocytes were studied using the comet assay. Haemolymph was collected from the adductor muscle at 24, 48 and 72 h of both EMS-exposed and irradiated bivalves and comet assay was carried out using standard protocol. A significant increase in DNA damage was observed as indicated by an increase in % tail DNA damage at different concentrations of EMS and all the doses of gamma radiation as compared to controls in
Energy Technology Data Exchange (ETDEWEB)
Praveen Kumar, M.K., E-mail: here.praveen@gmail.com [Department of Zoology, Goa University, Goa 403206 (India); Shyama, S.K., E-mail: skshyama@gmail.com [Department of Zoology, Goa University, Goa 403206 (India); Sonaye, B.S. [Department of Radiation Oncology, Goa Medical College, Goa (India); Naik, U Roshini; Kadam, S.B.; Bipin, P.D.; D’costa, A. [Department of Zoology, Goa University, Goa 403206 (India); Chaubey, R.C. [Radiation Biology and Health Science Division, Bhabha Atomic Research Centre, Mumbai (India)
2014-05-01
Highlights: • Possible genotoxic effect of accidental exposure of aquatic fauna to γ radiation. • Relative sensitivity of bivalves to γ radiation is also analyzed using comet assay. • γ radiation induced significant genetic damage in both the species of bivalves. • P. malabarica and M. casta exhibited a similar level of sensitivity to γ radiation. • Comet assay may be used as a biomarker for the environmental biomonitoring. - Abstract: Ionizing radiation is known to induce genetic damage in diverse groups of organisms. Under accidental situations, large quantities of radioactive elements get released into the environment and radiation emitted from these radionuclides may adversely affect both the man and the non-human biota. The present study is aimed (a) to know the genotoxic effect of gamma radiation on aquatic fauna employing two species of selected bivalves, (b) to evaluate the possible use of ‘Comet assay’ for detecting genetic damage in haemocytes of bivalves as a biomarker for environmental biomonitoring and also (c) to compare the relative sensitivity of two species of bivalves viz. Paphia malabarica and Meretrix casta to gamma radiation. The comet assays was optimized and validated using different concentrations (18, 32 and 56 mg/L) of ethyl methanesulfonate (EMS), a direct-acting reference genotoxic agent, to which the bivalves were exposed for various times (24, 48 and 72 h). Bivalves were irradiated (single acute exposure) with 5 different doses (viz. 2, 4, 6, 8 and 10 Gy) of gamma radiation and their genotoxic effects on the haemocytes were studied using the comet assay. Haemolymph was collected from the adductor muscle at 24, 48 and 72 h of both EMS-exposed and irradiated bivalves and comet assay was carried out using standard protocol. A significant increase in DNA damage was observed as indicated by an increase in % tail DNA damage at different concentrations of EMS and all the doses of gamma radiation as compared to controls in
International Nuclear Information System (INIS)
Chaudhari, Manjari; Jayaraj, R.; Bhaskar, A.S.B.; Lakshmana Rao, P.V.
2009-01-01
T-2 toxin is the most toxic trichothecene and both humans and animals suffer from several pathological conditions after consumption of foodstuffs contaminated with trichothecenes. We investigated the molecular mechanism of T-2 toxin induced cytotoxicity and cell death in HeLa cells. T-2 toxin at LC50 of 10 ng/ml caused time dependent increase in cytotoxicity as assessed by dye uptake, lactatedehydrogenase leakage and MTT assay. The toxin caused generation of reactive oxygen species as early as 30 min followed by significant depletion of glutathione levels and increased lipid peroxidation. The results indicate oxidative stress as underlying mechanism of cytotoxicity. Single stranded DNA damage after T-2 treatment was observed as early as 2 and 4 h by DNA diffusion assay. The cells exhibited apoptotic morphology like condensed chromatin and nuclear fragmentation after 4 h of treatment. Downstream of T-2 induced oxidative stress and DNA damage a time dependent increase in expression level of p53 protein was observed. The increase in Bax/Bcl2 ratio indicated shift in response, in favour of apoptotic process in T-2 toxin treated cells. Western blot analysis showed increase in levels of mitochondrial apoptogenic factors Bax, Bcl-2, cytochrome-c followed by activation of caspases-9, -3 and -7 leading to DNA fragmentation and apoptosis. In addition to caspase-dependent pathway, our results showed involvement of caspase-independent AIF pathway in T-2 induced apoptosis. Broad spectrum caspase inhibitor z-VAD-fmk could partially protect the cells from DNA damage but could not inhibit AIF induced oligonucleosomal DNA fragmentation beyond 4 h. Results of the study clearly show that oxidative stress is the underlying mechanism by which T-2 toxin causes DNA damage and apoptosis.
EVALUATION OF DNA INTEGRITY USING TUNEL AND COMET ASSAY IN HUMAN SEMEN: IMMEDIATE- VERSUS DELAYED-FREEZING K. Young,* L. Xun,* S. Rothmann,? S. Perreault, ? W. Robbins**University of California, Los Angeles, Los Angeles, California; ?Fertility Solutions Inc., Cleveland, ...
Energy Technology Data Exchange (ETDEWEB)
Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others
1994-09-15
In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.
Directory of Open Access Journals (Sweden)
Seidel Clemens
2012-04-01
Full Text Available Abstract Background To investigate whether different conditions of DNA structure and radiation treatment could modify heterogeneity of response. Additionally to study variance as a potential parameter of heterogeneity for radiosensitivity testing. Methods Two-hundred leukocytes per sample of healthy donors were split into four groups. I: Intact chromatin structure; II: Nucleoids of histone-depleted DNA; III: Nucleoids of histone-depleted DNA with 90 mM DMSO as antioxidant. Response to single (I-III and twice (IV irradiation with 4 Gy and repair kinetics were evaluated using %Tail-DNA. Heterogeneity of DNA damage was determined by calculation of variance of DNA-damage (V and mean variance (Mvar, mutual comparisons were done by one-way analysis of variance (ANOVA. Results Heterogeneity of initial DNA-damage (I, 0 min repair increased without histones (II. Absence of histones was balanced by addition of antioxidants (III. Repair reduced heterogeneity of all samples (with and without irradiation. However double irradiation plus repair led to a higher level of heterogeneity distinguishable from single irradiation and repair in intact cells. Increase of mean DNA damage was associated with a similarly elevated variance of DNA damage (r = +0.88. Conclusions Heterogeneity of DNA-damage can be modified by histone level, antioxidant concentration, repair and radiation dose and was positively correlated with DNA damage. Experimental conditions might be optimized by reducing scatter of comet assay data by repair and antioxidants, potentially allowing better discrimination of small differences. Amount of heterogeneity measured by variance might be an additional useful parameter to characterize radiosensitivity.
National Research Council Canada - National Science Library
Inouye, Laura
2000-01-01
This technical note reviews the existing technology for cell-based biomarker assays and cDNA arrays and explores their potential as rapid, sensitive, and low-cost tools for sediment/soil toxicity screening...
Detection of radiation-induced apoptosis using the comet assay
International Nuclear Information System (INIS)
Wada, Seiichi; Kobayashi, Yasuhiko; Funayama, Tomoo; Yamamoto, Kazuo; Khoa, Tran Van; Natsuhori, Masahiro; Ito, Nobuhiko
2003-01-01
The electrophoresis pattern of apoptotic cells detected by the comet assay has a characteristic small head and spread tail. This image has been referred to as an apoptotic comet, but it has not been previously proven to be apoptotic cells by any direct method. In order to identify this image obtained by the comet assay as corresponding to an apoptotic cell, the frequency of appearance of apoptosis was examined using CHO-K1 and L5178Y cells which were exposed to gamma irradiation. As a method for detecting apoptosis, the terminal deoxynucleotidyl transferase mediated dUTP nick end labeling (TUNEL) assay was used. When the frequency of appearance of apoptotic cells following gamma irradiation was observed over a period of time, there was a significant increase in appearance of apoptosis when using the TUNEL assay. However, there was only a slight increase when using the comet assay. In order to verify the low frequency of appearance of apoptosis when using the comet assay, we attempted to use the TUNEL assay to satin the apoptotic comets detected in the comet assay. The apoptotic comets were TUNEL positive and the normal comets were TUNEL negative. This indicates that the apoptotic comets were formed from DNA fragments with 3'-hydroxy ends that are generated as cells undergo apoptosis. Therefore, it was understood that the characteristic pattern of apoptotic comets detected by the comet assay corresponds to cells undergoing apoptosis. (author)
Generation of a reliable full-length cDNA of infectiousTembusu virus using a PCR-based protocol.
Liang, Te; Liu, Xiaoxiao; Cui, Shulin; Qu, Shenghua; Wang, Dan; Liu, Ning; Wang, Fumin; Ning, Kang; Zhang, Bing; Zhang, Dabing
2016-02-02
Full-length cDNA of Tembusu virus (TMUV) cloned in a plasmid has been found instable in bacterial hosts. Using a PCR-based protocol, we generated a stable full-length cDNA of TMUV. Different cDNA fragments of TMUV were amplified by reverse transcription (RT)-PCR, and cloned into plasmids. Fragmented cDNAs were amplified and assembled by fusion PCR to produce a full-length cDNA using the recombinant plasmids as templates. Subsequently, a full-length RNA was transcribed from the full-length cDNA in vitro and transfected into BHK-21 cells; infectious viral particles were rescued successfully. Following several passages in BKH-21 cells, the rescued virus was compared with the parental virus by genetic marker checks, growth curve determinations and animal experiments. These assays clearly demonstrated the genetic and biological stabilities of the rescued virus. The present work will be useful for future investigations on the molecular mechanisms involved in replication and pathogenesis of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
D. Vaamonde
2014-12-01
Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.
DEFF Research Database (Denmark)
Kokotovic, Branko; Friis, N.F.; Ahrens, Peter
2002-01-01
, were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...
Protein subcellular localization assays using split fluorescent proteins
Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM
2009-09-08
The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).
Directory of Open Access Journals (Sweden)
Michele E Murphy
2016-01-01
Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.
Plazar, Janja; Hrejac, Irena; Pirih, Primoz; Filipic, Metka; Groothuis, Geny M. M.
The comet assay is a simple and sensitive method for measuring DNA damage at the level of individual cells and is extensively used in genotoxicity studies. It is commonly applied to cultured cells. The aim of this study was to apply the comet assay for use in fresh liver tissue, where metabolic
Synchronization of DNA array replication kinetics
Manturov, Alexey O.; Grigoryev, Anton V.
2016-04-01
In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.
Chen, M H; Kuo, S T; Renault, T; Chang, P H
2014-02-01
A loop-mediated isothermal amplification (LAMP) assay was developed for the detection of abalone herpesvirus DNA. Two pairs of primers were designed, based on the sequence of the DNA polymerase gene of abalone herpesvirus. The reaction temperature and time were optimized to 63°C and 60min, respectively. LAMP amplicons were analyzed by 2% agarose gel electrophoresis or by visual inspection of a colour change emitted by fluorescent dye. The method developed was specific for the detection of abalone herpesvirus, without cross-reactions with other tested herpesviruses including ostreid herpesvirus 1 (OsHV-1), European eel herpesvirus, koi herpesvirus (KHV) and an avian herpesvirus. The LAMP assay was 100 folds more sensitive than a conventional PCR and 10 folds less sensitive than a SYBR Green PCR. These results indicate that the developed LAMP assay is a simple, rapid, sensitive, specific and reliable technique for the detection of abalone herpesvirus. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
J Strzezek
2004-03-01
Full Text Available The comet assay, under neutral conditions, allows the assessment of DNA integrity influenced by sperm ageing, which is manifested in DNA double-strand breaks. Here, we attempted to use a modified neutral comet assay test (single-cell gel electrophoresis, to our knowledge for the first time, to assess DNA integrity of boar spermatozoa during liquid storage for 96 h at 5 degrees C and 16 degrees C. In this comet assay protocol we used 2% beta-mercaptoethanol prior to the lysis procedure, to aid in removing nuclear proteins. Ejaculates from 3 boars (designated A, C and G were diluted with a standard semen extender, Kortowo-3 (K-3, which was supplemented with lipoprotein fractions extracted from hen egg yolk (LPFh or ostrich egg yolk (LPFo. Irrespective of the extender type, the percentage of comet-detected spermatozoa with damaged DNA increased gradually during prolonged storage at 5 degrees C and 16 degrees C. Spermatozoa stored in K-3 extender exhibited elevated levels of DNA damage at both storage temperatures. Significant differences in DNA damage among the boars were more pronounced during storage in LPF-based extenders at 5 degrees C: spermatozoa of boars A and G were less susceptible to DNA damage. The percent of tail DNA in comets was lower in LPF-based extenders, and there were individual variations among the boars. We observed that changes in DNA integrity were dependent on the extender type and storage temperature. A higher level of DNA instability was observed in K-3 extended semen compared with K-3/LPFh or K-3/LPFo extended semen during storage at 5 degrees C. No significant difference in the level of DNA damage between K-3/LPFh and K-3/LPFo was observed. It seems that a long-term storage can affect genomic integrity of boar spermatozoa. The modified neutral comet assay can be used to detect low levels of DNA damage in boar spermatozoa during liquid preservation. Therefore, screening for sperm DNA damage may be used as an additional
Fraser, L; Strzezek, J
2004-01-01
The comet assay, under neutral conditions, allows the assessment of DNA integrity influenced by sperm ageing, which is manifested in DNA double-strand breaks. Here, we attempted to use a modified neutral comet assay test (single-cell gel electrophoresis), to our knowledge for the first time, to assess DNA integrity of boar spermatozoa during liquid storage for 96 h at 5 degrees C and 16 degrees C. In this comet assay protocol we used 2% beta-mercaptoethanol prior to the lysis procedure, to aid in removing nuclear proteins. Ejaculates from 3 boars (designated A, C and G) were diluted with a standard semen extender, Kortowo-3 (K-3), which was supplemented with lipoprotein fractions extracted from hen egg yolk (LPFh) or ostrich egg yolk (LPFo). Irrespective of the extender type, the percentage of comet-detected spermatozoa with damaged DNA increased gradually during prolonged storage at 5 degrees C and 16 degrees C. Spermatozoa stored in K-3 extender exhibited elevated levels of DNA damage at both storage temperatures. Significant differences in DNA damage among the boars were more pronounced during storage in LPF-based extenders at 5 degrees C: spermatozoa of boars A and G were less susceptible to DNA damage. The percent of tail DNA in comets was lower in LPF-based extenders, and there were individual variations among the boars. We observed that changes in DNA integrity were dependent on the extender type and storage temperature. A higher level of DNA instability was observed in K-3 extended semen compared with K-3/LPFh or K-3/LPFo extended semen during storage at 5 degrees C. No significant difference in the level of DNA damage between K-3/LPFh and K-3/LPFo was observed. It seems that a long-term storage can affect genomic integrity of boar spermatozoa. The modified neutral comet assay can be used to detect low levels of DNA damage in boar spermatozoa during liquid preservation. Therefore, screening for sperm DNA damage may be used as an additional test of sperm
Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad
2017-09-01
Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed
International Nuclear Information System (INIS)
Garaj-Vrhovac, V.; Kopjar, N.
2003-01-01
Genotoxic risks of occupational exposure in a radar facility were evaluated by using alkaline comet assay, micronucleus assay and chromatid breakage assay on peripheral blood leukocytes in exposed subjects and corresponding controls. Results show that occupational exposure to microwave radiation correlates with an increase of genome damage in somatic cells. The levels of DNA damage in exposed subjects determined by using alkaline comet assay were increased compared to control and showed interindividual variations. Incidence of micronuclei was also significantly increased compared to baseline control values. After short exposure of cultured lymphocytes to bleomycin, cells of occupationally exposed subjects responded with high numbers of chromatid breaks. Although the level of chromosome damage generated by bleomycin varied greatly between individuals, in exposed subjects a significantly elevated number of chromatid breaks was observed. Our results support data reported in literature indicating that microwave radiation represents a potential DNA-damaging hazard. Alkaline comet assay is confirmed as a sensitive and highly reproducible technique for detection of primary DNA damage inflicted in somatic cells. Micronucleus assay was confirmed as reliable bio-markers of effect and chromatid breakage assay as sensitive bio-marker of individual cancer susceptibility. The results obtained also confirm the necessity to improve measures and to perform accurate health surveillance of individuals occupationally exposed to microwave radiation
Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin
2017-04-15
Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Eliane Silva
Full Text Available Endogenous retroviruses, non-retroviral RNA viruses and DNA viruses have been found in the mammalian genomes. The origin of Hepatitis C virus (HCV, the major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma in humans, remains unclear since its discovery. Here we show that fragments homologous to HCV structural and non-structural (NS proteins present in the European rabbit (Oryctolagus cuniculus and hare (Lepus europaeus genomes replicate in bovine cell cultures. The HCV genomic homolog fragments were demonstrated by RT-PCR, PCR, mass spectrometry, and replication in bovine cell cultures by immunofluorescence assay (IFA and immunogold electron microscopy (IEM using specific MAbs for HCV NS3, NS4A, and NS5 proteins. These findings may lead to novel research approaches on the HCV origin, genesis, evolution and diversity.
ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping
DEFF Research Database (Denmark)
Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir
2008-01-01
A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...
Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.
2014-01-01
Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...
Zare Sakhvidi, Mohammad Javad; Hajaghazadeh, Mohammad; Mostaghaci, Mehrdad; Mehrparvar, Amir Houshang; Zare Sakhvidi, Fariba; Naghshineh, Elham
2016-01-01
Unintended occupational exposure to antineoplastic drugs (ANDs) may occur in medical personnel. Some ANDs are known human carcinogens and exposure can be monitored by genotoxic biomarkers. To evaluate the obstacles to obtaining conclusive results from a comet assay test to determine DNA damage among AND exposed healthcare workers. We systematically reviewed studies that used alkaline comet assay to determine the magnitude and significance of DNA damage among health care workers with potential AND exposure. Fifteen studies were eligible for review and 14 studies were used in the meta-analysis. Under random effect assumption, the estimated standardized mean difference (SMD) in the DNA damage of health care workers was 1.93 (95% CI: 1.15-2.71, p comet moment, I2 test results, as a measure of heterogeneity, dropped to zero. Heterogeneity analysis showed that date of study publication was a possible source of heterogeneity (B = -0.14; p comet assay methodological variables, and exposure characteristics may be responsible for heterogenic data from comet assay studies and interfere with obtaining conclusive results. Lack of quantitative environmental exposure measures and variation in comet assay protocols across studies are important obstacles in generalization of results.
Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi
2011-07-15
presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.
The DNA comet assay and the germination test in detection of food treated by ionizing radiation
International Nuclear Information System (INIS)
Huachaca, Nelida Simona Marin
2002-01-01
Two methods of irradiated food detection, one biochemical, the comet assay and, other biological, the germination test, were applied in bovine meat and fruit samples. The comet assay detects the damage on DNA caused by ionizing radiation. The germination test evaluates the sensitivity to radiation of seeds as for germination ability, shooting and, rooting. The samples were irradiated in gamma font and electron accelerator. For bovine meat samples, the doses were 0.0; 2.5; 4.5 e 7.0 kGy at chilled condition and, 0.0; 2.5; 4.5; 7.0 e 8.5 kGy at frozen conditions. For fruit samples such as melon, watermelon, apple, orange, papaya and, tomato, the doses were: 0.0; 0.5; 0.75; 1.0; 2.0 e 4.0 kGy. The differences between the gamma rays and the electron beam effects on extent of DNA migration and, on shooting and rooting, showed to be similar. The comet assay, under neutral conditions, permitted to discriminate between irradiated and unirradiated bovine meat samples, until one month of storage. Also, it was possible to distinguish, by the comet assay, the control sample with regard to irradiated fruit, at doses as low as 0,5 kGy. In the germination test, the root length was the best parameter to discriminate irradiated and unirradiated samples of melon, watermelon and tomato, while the germination percent was the best parameter for apple and orange. (author)
Directory of Open Access Journals (Sweden)
Florenza Lüder Ripoli
2016-05-01
Full Text Available Mammary neoplasms are the tumors most affecting female dogs and women. Formalin-fixed, paraffin-embedded (FFPE tissues are an invaluable source of archived biological material. Fresh frozen (FF tissue is considered ideal for gene expression analysis. However, strategies based on FFPE material offer several advantages. Branched-DNA assays permit a reliable and fast workflow when analyzing gene expression. The aim of this study was to assess the comparability of the branched-DNA assay when analyzing certain gene expression patterns between FF and FFPE samples in canine mammary tumors. RNA was isolated from 109 FFPE samples and from 93 FF samples of different canine mammary tissues. Sixteen (16 target genes (Tp53; Myc; HMGA1; Pik3ca; Mcl1; MAPK3; FOXO3; PTEN; GATA4; PFDN5; HMGB1; MAPK1; BRCA2; BRCA1; HMGA2; and Her2 were analyzed via branched-DNA assay (b-DNA. ACTB, GAPDH, and HPRT1 were used as data normalizers. Overall, the relative gene expression of the two different origins of samples showed an agreement of 63%. Still, care should be taken, as FFPE specimens showed lower expression of the analyzed targets when compared to FF samples. The fact that the gene expression in FFPE proved to be lower than in FF specimens is likely to have been caused by the effect of storage time. ACTB had the best performance as a data normalizer.
Energy Technology Data Exchange (ETDEWEB)
Alapetite, C. [Institut Curie, 75 - Paris (France)
1998-09-01
Some are hereditary syndromes demonstrate high cancer risk and hypersensitivity in response to exposures to agents such as ultraviolet or ionising radiation, and are characterized by a defective processing of DNA damage. They highlight the importance of the individual risk associated to exposures. The comet assay, a simple technique that detects DNA strand breaks, requires few cells and allows examination of DNA repair capacities in established cell lines, in blood samples or biopsies. The assay has been validated on cellular systems with known repair defects such as xeroderma pigmentosum defective in nucleotide excision repair, on mutant rodent cell lines defective in DNA single strand breaks rejoining (XRCC5/Ku80 and XRCC7/DNAPKcs) (neutral conditions). This assay does not allow to distinguish a defective phenotype in ataxia telangiectasia cells. It shows in homozygous mouse embryo fibroblasts Brca2-/- an impaired DNA double strand break rejoining. Simplicity, rapidity and sensitivity of the alkaline comet assay allow to examine the response of lymphocytes. It has been applied to the analysis of the role of DNA repair in the pathogenesis of collagen diseases, and the involvement of individual DNA repair proficiency in the thyroid tumorigenesis induced in some patients after therapeutic irradiation at childhood has been questioned. Preliminary results of these studies suggest that this type of approach could help for adapting treatment modalities and surveillance in subgroups of patients defective in DNA repair process. It could also have some incidence in the radioprotection field. (author)
DEFF Research Database (Denmark)
Stronati, A; Manicardi, G C; Cecati, M
2006-01-01
Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...
Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko
2008-04-01
The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.
International Nuclear Information System (INIS)
Fu, F.Z.; Liu, L.X.; Wang, W.Q.; Sun, S. H.; Liu, L.B.
2002-01-01
Nucleic acids detection method is vital to the clinical pathogen diagnosis. The established method can be classified into target direct amplification and signal amplification format according to the target DNA or RNA being directly amplified or not. Those methods have advantages and disadvantages respectively in the clinical application. In the United States of American, branched-DNA as a strong signal amplifier is broadly used in the quantification of the nucleic acids. To gain satisfied sensitivity, some expensive label molecular and instruments should be adopted. Personnel should be special trained to perform. Hence, those can't be widely carried out in the Third World. To avoid those disadvantages, we used the branched-DNA amplifier in the paper chromatography hybridization assay. Methods: Branched DNA signal amplifier and series of probes complementary to the nucleic acid sequence of hepatitis B virus (HBV) have been synthesized. HBV-DNA or it's capture probe were immobilized on the high flow nitrocellulose strip. Having loaded at one end of the strip in turn, probes or HBV-DNA in the hybridization solution migrate to the opposite end of the strip by capillary forces and hybridizes to the immobilized DNA. The branched-DNA signal amplifier and probe labeled with biotin or 32P were then loaded. Through streptavidin-alkaline phosphatase (SA-AP) conjugate and NBT/BCIP ( the specific chromogenic substrate of AP) or autoradiography, the result can be visualized by color reaction or image production on the X-ray film. Results: The sensitivity of this HBV-DNA detection method used probe labeled with biotin and 32P are 1ng and 10pg. The method using the probe labeled with biotin is simple and rapid (2h) without depending on special instruments, it also avoids the pollution of EtBr which can lead to tumor. And the method using the probe labeled with 32P is simple and sensitive, with the exception of long time autoradiography and the inconvenient isotopic disposal
Kutchukian, Peter S; Wassermann, Anne Mai; Lindvall, Mika K; Wright, S Kirk; Ottl, Johannes; Jacob, Jaison; Scheufler, Clemens; Marzinzik, Andreas; Brooijmans, Natasja; Glick, Meir
2015-06-01
A first step in fragment-based drug discovery (FBDD) often entails a fragment-based screen (FBS) to identify fragment "hits." However, the integration of conflicting results from orthogonal screens remains a challenge. Here we present a meta-analysis of 35 fragment-based campaigns at Novartis, which employed a generic 1400-fragment library against diverse target families using various biophysical and biochemical techniques. By statistically interrogating the multidimensional FBS data, we sought to investigate three questions: (1) What makes a fragment amenable for FBS? (2) How do hits from different fragment screening technologies and target classes compare with each other? (3) What is the best way to pair FBS assay technologies? In doing so, we identified substructures that were privileged for specific target classes, as well as fragments that were privileged for authentic activity against many targets. We also revealed some of the discrepancies between technologies. Finally, we uncovered a simple rule of thumb in screening strategy: when choosing two technologies for a campaign, pairing a biochemical and biophysical screen tends to yield the greatest coverage of authentic hits. © 2014 Society for Laboratory Automation and Screening.
Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn
2014-01-01
The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.
Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI
DEFF Research Database (Denmark)
Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels
1988-01-01
Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....
Electronic transport in methylated fragments of DNA
Energy Technology Data Exchange (ETDEWEB)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
International Nuclear Information System (INIS)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.
2015-01-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics
The comet assay: ready for 30 more years.
Møller, Peter
2018-02-24
During the last 30 years, the comet assay has become widely used for the measurement of DNA damage and repair in cells and tissues. A landmark achievement was reached in 2016 when the Organization for Economic Co-operation and Development adopted a comet assay guideline for in vivo testing of DNA strand breaks in animals. However, the comet assay has much more to offer than being an assay for testing DNA strand breaks in animal organs. The use of repair enzymes increases the range of DNA lesions that can be detected with the assay. It can also be modified to measure DNA repair activity. Still, despite the long-term use of the assay, there is a need for studies that assess the impact of variation in specific steps of the procedure. This is particularly important for the on-going efforts to decrease the variation between experiments and laboratories. The articles in this Special Issue of Mutagenesis cover important technical issues of the comet assay procedure, nanogenotoxicity and ionising radiation sensitivity on plant cells. The included biomonitoring studies have assessed seasonal variation and certain predictors for the basal level of DNA damage in white blood cells. Lastly, the comet assay has been used in studies on genotoxicity of environmental and occupational exposures in human biomonitoring studies and animal models. Overall, the articles in this Special Issue demonstrate the versatility of the comet assay and they hold promise that the assay is ready for the next 30 years.
Zare Sakhvidi, Mohammad Javad; Hajaghazadeh, Mohammad; Mostaghaci, Mehrdad; Mehrparvar, Amir houshang; Zare Sakhvidi, Fariba; Naghshineh, Elham
2016-01-01
Background Unintended occupational exposure to antineoplastic drugs (ANDs) may occur in medical personnel. Some ANDs are known human carcinogens and exposure can be monitored by genotoxic biomarkers. Objective To evaluate the obstacles to obtaining conclusive results from a comet assay test to determine DNA damage among AND exposed healthcare workers. Methods We systematically reviewed studies that used alkaline comet assay to determine the magnitude and significance of DNA damage among health care workers with potential AND exposure. Fifteen studies were eligible for review and 14 studies were used in the meta-analysis. Results Under random effect assumption, the estimated standardized mean difference (SMD) in the DNA damage of health care workers was 1.93 (95% CI: 1.15–2.71, p comet moment, I2 test results, as a measure of heterogeneity, dropped to zero. Heterogeneity analysis showed that date of study publication was a possible source of heterogeneity (B = −0.14; p comet assay methodological variables, and exposure characteristics may be responsible for heterogenic data from comet assay studies and interfere with obtaining conclusive results. Lack of quantitative environmental exposure measures and variation in comet assay protocols across studies are important obstacles in generalization of results. PMID:27110842
Rockne, Karl J; Strand, Stuart E
2003-09-01
Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.
Harrington, Dean J; Cemeli, Eduardo; Carder, Joanna; Fearnley, Jamie; Estdale, Sian; Perry, Philip J; Jenkins, Terence C; Anderson, Diana
2003-01-01
Telomerase-targeted strategies have aroused recent interest in anti-cancer chemotherapy, because DNA-binding drugs can interact with high-order tetraplex rather than double-stranded (duplex) DNA targets in tumour cells. However, the protracted cell-drug exposure times necessary for clinical application require that telomerase inhibitory efficacy must be accompanied by both low inherent cytotoxicity and the absence of mutagenicity/genotoxicity. For the first time, the genotoxicity of a number of structurally diverse DNA-interactive telomerase inhibitors is examined in the Ames test using six Salmonella typhimurium bacterial strains (TA1535, TA1537, TA1538, TA98, TA100, and TA102). DNA damage induced by each agent was also assessed using the Comet assay with human lymphocytes. The two assay procedures revealed markedly different genotoxicity profiles that are likely to reflect differences in metabolism and/or DNA repair between bacterial and mammalian cells. The mutational spectrum for a biologically active fluorenone derivative, shown to be mutagenic in the TA100 strain, was characterised using a novel and rapid assay method based upon PCR amplification of a fragment of the hisG46 allele, followed by RFLP analysis. Preliminary analysis indicates that the majority (84%) of mutations induced by this compound are C --> A transversions at position 2 of the missense proline codon of the hisG46 allele. However, despite its genotoxic bacterial profile, this fluorenone agent gave a negative response in the Comet assay, and demonstrates how unwanted systemic effects (e.g., cytotoxicity and genotoxicity) can be prevented or ameliorated through suitable molecular fine-tuning of a candidate drug in targeted human tumour cells. Copyright 2003 Wiley-Liss, Inc.
A DNA Microarray-Based Assay to Detect Dual Infection with Two Dengue Virus Serotypes
Directory of Open Access Journals (Sweden)
Alvaro Díaz-Badillo
2014-04-01
Full Text Available Here; we have described and tested a microarray based-method for the screening of dengue virus (DENV serotypes. This DNA microarray assay is specific and sensitive and can detect dual infections with two dengue virus serotypes and single-serotype infections. Other methodologies may underestimate samples containing more than one serotype. This technology can be used to discriminate between the four DENV serotypes. Single-stranded DNA targets were covalently attached to glass slides and hybridised with specific labelled probes. DENV isolates and dengue samples were used to evaluate microarray performance. Our results demonstrate that the probes hybridized specifically to DENV serotypes; with no detection of unspecific signals. This finding provides evidence that specific probes can effectively identify single and double infections in DENV samples.
Vautrin, Sonia; Zhang, David
2007-01-01
A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.
International Nuclear Information System (INIS)
Simonyan, A.E.; Gevorgyan, A.L.; Sargsyan, A.A.; Arakelyan, M.S.; Minasyan, S.H.
2015-01-01
The levels of DNA damage in erythrocytes of rock lizards Darevskia raddei from reserve Shikahogh and Kajaran (Republic of Armenia) and Zuar (Nagorno-Karabakh Republic), were assessed using the comet assay. Female lizards were more sensitive to environmental pollutants than males. Significant positive correlation was found between DNA damage in female lizards and content of Cu, Mo, Pb, Cd, V and As in soil
Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei
2013-01-01
A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746
Wang, Xiayan; Wang, Shili; Veerappan, Vijaykumar; Byun, Chang Kyu; Nguyen, Han; Gendhar, Brina; Allen, Randy D.; Liu, Shaorong
2009-01-01
In this work, we demonstrate DNA separation and genotyping analysis in gel-free solutions using a nanocapillary under pressure-driven conditions without application of an external electric field. The nanocapillary is a ~50-cm-long and 500-nm-radius bare fused silica capillary. After a DNA sample is injected, the analytes are eluted out in a chromatographic separation format. The elution order of DNA molecules follows strictly with their sizes, with the longer DNA being eluted out faster than the shorter ones. High resolutions are obtained for both short (a few bases) and long (tens of thousands of base pairs) DNA fragments. Effects of key experimental parameters, such as eluent composition and elution pressure, on separation efficiency and resolution are investigated. We also apply this technique for DNA separations of real-world genotyping samples to demonstrate its feasibility in biological applications. PCR products (without any purification) amplified from Arabidopsis plant genomic DNA crude preparations are directly injected into the nanocapillary, and PCR-amplified DNA fragments are well resolved, allowing for unambiguous identification of samples from heterozygous and homozygous individuals. Since the capillaries used to conduct the separations are uncoated, column lifetime is virtually unlimited. The only material that is consumed in these assays is the eluent, and hence the operation cost is low. PMID:18500828
Gialeraki, Argyri; Markatos, Christos; Grouzi, Elisabeth; Merkouri, Efrosyni; Travlou, Anthi; Politou, Marianna
2010-04-01
Acenocoumarol is mainly catabolized by CYP2C9 isoform of cytochrome P450 (CYP) liver complex and exerts its anticoagulant effect through the inhibition of Vitamin K Epoxide Reductase (VKOR). The most important genetic polymorphisms which lead to an impaired enzymatic activity and therefore predispose to acenocoumarol sensitivity, are considered to be CYP2C9*2 (Arg144Cys), CYP2C9*3 (Ile359Leu) and VKORC1-1639G>A, respectively. In this study we compared the results of the PGXThrombo StripAssay kit (ViennaLab Diagnostics,Vienna, Austria) with direct DNA sequencing and in house Restriction Fragment Length Polymorphisms (RFLP) for the detection of the aforementioned Single Nucleotide Polymorphisms (SNPs). The reverse hybridization StripAssay was found to be equally effective with RFLP and direct DNA sequencing for the detection of CYP2C9*2 and CYP2C9*3 polymorphisms, respectively. The comparison of the RFLP reference method with the reverse hybridization StripAssay for the detection of VKORC1-1639 G>A polymorphism showed that the reverse hybridization StripAsssay might misclassify some A/A homozygotes as heterozygotes. Optimization of the hybridization procedures may eliminate the extra low signal band observed in some samples at the reverse hybridization StripAssay and improve its diagnostic value.
Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping
2004-10-01
Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.
RAPD analysis of alfalfa DNA mutation via N+ implantation
International Nuclear Information System (INIS)
Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang
2003-01-01
Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength
International Nuclear Information System (INIS)
Kasuba, V.; Milic, M.; Pejakovic Hlede, J.; Gottstein, Z.; Karadjole, M.; Miljanic, S.
2013-01-01
The existence of dose-related induction of DNA strand breaks in spermatozoa following in vitro exposure to ionising radiation represents sperm DNA integrity as an important parameter in the evaluation of semen functionality. Maintaining of normal sperm becomes even more important when it is known that DNA in semen samples is already fragmentated in certain amount in human and turkey semen and that it lacks DNA repair mechanisms making DNA damage irreversible. The aim of this paper was to provide an insight in the amount of DNA damage detected in chicken spermatozoa (5 cocks, 45 weeks old) of heavy line after radiation with doses of 0.3, 0.5, 1 and 2 Gy gamma radiation and to address the question of the potential ecological consequences of the damage that was measured with comet assay. Scored parameters included tail intensity, tail length and tail moment. Results showed sensitivity of comet assay technique that detected significant DNA damage even after exposure to 0.3 Gy, but also showed no dose-related responses after 0.5, 1 and 2 Gy. Distribution of damaged cells was widely spread for the higher doses, showing the influence of possible adaptive response, but for further conclusions, larger studies are needed to answer that question.(author)
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
Rodriguez, Eleazar; Azevedo, Raquel; Fernandes, Pedro; Santos, Conceição
2011-07-18
Chromium(VI) is recognized as the most toxic valency of Cr, but its genotoxicity and cytostaticity in plants is still poorly studied. In order to analyze Cr(VI) cyto- and gentotoxicity, Pisum sativum L. plants were grown in soil and watered with solutions with different concentrations of Cr up to 2000 mg/L. After 28 days of exposure, leaves showed no significant variations in either cell cycle dynamics or ploidy level. As for DNA damage, flow cytometric (FCM) histograms showed significant differences in full peak coefficient of variation (FPCV) values, suggesting clastogenicity. This is paralleled by the Comet assay results, showing an increase in DNA damage for 1000 and 2000 mg/L. In roots, exposure to 2000 mg/L resulted in cell cycle arrest at the G(2)/M checkpoint. It was also verified that under the same conditions 40% of the individuals analyzed suffered polyploidization having both 2C and 4C levels. DNA damage analysis by the Comet assay and FCM revealed dose-dependent increases in DNA damage and FPCV. Through this, we have unequivocally demonstrated for the first time in plants that Cr exposure can result in DNA damage, cell cycle arrest, and polyploidization. Moreover, we critically compare the validity of the Comet assay and FCM in evaluating cytogenetic toxicity tests in plants and demonstrate that the data provided by both techniques complement each other and present high correlation levels. In conclusion, the data presented provides new insight on Cr effects in plants in general and supports the use of the parameters tested in this study as reliable endpoints for this metal toxicity in plants. © 2011 American Chemical Society
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing
2007-05-02
An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.
Arora, Shagun; Tandon, Simran
2015-01-01
In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.
The c-Myc (MYC) transcription factor is a major cancer driver and a well-validated therapeutic target. However, directly targeting MYC has been challenging. Thus, identifying proteins that interact with and regulate MYC may provide alternative strategies to inhibit its oncogenic activity. Here we report the development of a NanoLuc®-based protein-fragment complementation assay (NanoPCA) and mapping of the MYC protein interaction hub in live mammalian cells.
Energy Technology Data Exchange (ETDEWEB)
Leprat, F.; Sarasin, A.; Suarez, H.G. [Institut de Recherches sur le Cancer, 94 - Villesuif (France); Leprat, F.; Alapetite, C.; Rosselli, F.; Ridet, A.; Moustacch, E.; Alapetite, C. [Institut Curie, 75 - Paris (France); Schlumberger, M. [Institut Gustave Roussy, 94 - Villejuif (France)
1997-03-01
A defective cellular response to DNA lesions induced be genotoxic agents may be associated to an increased cancer proneness. This has been clearly identified in some rare but extensively studied genetic diseases such as xeroderma pigmentosum (XP), ataxia telangiectasia (AT) and Fanconi anemia (FA). In practical oncology, most patients receive genotoxic therapeutic agents and the presence of so far unidentified sensitive genotypes could account for an increased susceptibility to cancer in a subgroup of exposed patients. The thyroid gland of children is especially sensitive to the carcinogenic effect of ionizing radiation. Evidence for risk is reported even at doses as low as 0.1 Gy, and the excess relative risk to develop a thyroid tumor following a radiation dose of 1 Gy in childhood is of 7.7 [l]. In order to determine if a defect in repair of DNA strand breaks could be involved, as an early step, in the development of secondary thyroid tumors after radiotherapy, we examined, using the alkaline single cell gel electrophoresis assay (SCGE or `comet`), the response to in vitro {gamma}-rays exposure of lymphocytes of a small group of patients who developed thyroid carcinoma after radiotherapy for a primary tumor. Because of its practical advantages, the alkaline comet assay offers the opportunity to question the role of DNA strand beaks rejoining capacity of the individual in the radiation induced carcinogenesis of thyroid tumors. This preliminary study of a small group of patients with therapeutic irradiation at childhood for a primary tumor indicates that, at the time of blood sampling, lymphocytes of some of these patients demonstrated reduced rejoining capacity. These results suggest that the comet assay might help to distinguish a subgroup of individuals at risk for radiation induced genomic instability and encourage further investigation. (authors)
The current study evaluates the potential of using high resolution DNA melting assays to discriminate species in the genus, Isaria. The study utilizes a previously identified 103 base pair PCR amplicon, which was reported to be selective for Isaria fumosorosea. Our study finds the amplicon selective...
Directory of Open Access Journals (Sweden)
A. Yu. Popova
2015-01-01
Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm.
Sensitive detection of colorectal cancer in peripheral blood by septin 9 DNA methylation assay.
Directory of Open Access Journals (Sweden)
Robert Grützmann
Full Text Available BACKGROUND: Colorectal cancer (CRC is the second leading cause of cancer deaths despite the fact that detection of this cancer in early stages results in over 90% survival rate. Currently less than 45% of at-risk individuals in the US are screened regularly, exposing a need for better screening tests. We performed two case-control studies to validate a blood-based test that identifies methylated DNA in plasma from all stages of CRC. METHODOLOGY/PRINCIPAL FINDINGS: Using a PCR assay for analysis of Septin 9 (SEPT9 hypermethylation in DNA extracted from plasma, clinical performance was optimized on 354 samples (252 CRC, 102 controls and validated in a blinded, independent study of 309 samples (126 CRC, 183 controls. 168 polyps and 411 additional disease controls were also evaluated. Based on the training study SEPT9-based classification detected 120/252 CRCs (48% and 7/102 controls (7%. In the test study 73/126 CRCs (58% and 18/183 control samples (10% were positive for SEPT9 validating the training set results. Inclusion of an additional measurement replicate increased the sensitivity of the assay in the testing set to 72% (90/125 CRCs detected while maintaining 90% specificity (19/183 for controls. Positive rates for plasmas from the other cancers (11/96 and non-cancerous conditions (41/315 were low. The rate of polyp detection (>1 cm was approximately 20%. CONCLUSIONS/SIGNIFICANCE: Analysis of SEPT9 DNA methylation in plasma represents a straightforward, minimally invasive method to detect all stages of CRC with potential to satisfy unmet needs for increased compliance in the screening population. Further clinical testing is warranted.
Mórocz, Mónika; Gali, Himabindu; Raskó, István; Downes, C. Stephen; Haracska, Lajos
2013-01-01
Damage to DNA can block replication progression resulting in gaps in the newly synthesized DNA. Cells utilize a number of post-replication repair (PRR) mechanisms such as the RAD18 controlled translesion synthesis or template switching to overcome the discontinuities formed opposite the DNA lesions and to complete DNA replication. Gaining more insights into the role of PRR genes promotes better understanding of DNA damage tolerance and of how their malfunction can lead to increased genome instability and cancer. However, a simple and efficient method to characterise gene specific PRR deficiencies at a single cell level has not been developed. Here we describe the so named BrdU comet PRR assay to test the contribution of human RAD18 to PRR at a single cell level, by which we kinetically characterized the consequences of the deletion of human RAD18 on the replication of UV-damaged DNA. Moreover, we demonstrate the capability of our method to evaluate PRR at a single cell level in unsynchronized cell population. PMID:23936422
Repair of potentially lethal damage by introduction of T4 DNA ligase in eucaryotic cells
International Nuclear Information System (INIS)
Durante, M.; Grossi, G.F.; Napolitano, M.; Gialanella, G.
1991-01-01
The bacterial enzyme PvuII, which generates blunt-ended DNA double-strand breaks, and T4 DNA ligase, which seals adjacent DNA fragments in coupling to ATP cleavage, were introduced in mouse C3H10T1/2 fibroblasts using osmolytic shock of pinocytic vesicles. Cells were then assayed for their clonogenic ability. In agreement with previous studies by others, the authors found that PvuII restriction endonuclease simulates ionizing radiation effects by causing a dose-dependent loss of reproductive capacity. They show that concomitant treatment with DNA ligase considerably increases cell survival. Survival curves were shown to be dependent on ligase enzyme dose and on ATP concentration in the hypertonic medium. They conclude that T4 DNA ligase is able to repair some potentially lethal damage produced by restriction endonucleases in eucaryotic cells. (author)
Behravan, Javad; Mosafa, Fatemeh; Soudmand, Negar; Taghiabadi, Elahe; Razavi, Bibi Marjan; Karimi, Gholamreza
2011-09-01
The comet assay is a standard method for measuring DNA damage. In this study, the protective effects of ethanolic and aqueous extracts of Portulaca oleracea L. (P. oleracea) on human lymphocyte DNA lesions were evaluated with the comet assay. Lymphocytes were isolated from blood samples taken from healthy volunteers. Human lymphocytes were incubated in H(2)O(2) (50,100, and 200 μM), aqueous extract (0.05, 0.1, 0.5, 1, and 2.5mg/ml), and ethanolic extracts (0.05, 0.1, 0.5, 1, and 2.5mg/ml) of P. oleraceae aerial parts alone with a combination of H(2)O(2) (100 μM) with either 1 or 2.5mg/ml of both extracts at 4°C for 30 minutes. The extent of DNA migration was measured using the alkaline single cell gel electrophoresis approach assay, and DNA damage was expressed as percentage tail DNA. We found that the aqueous extract of P. oleracea significantly inhibited DNA damage, while there was no effect of the ethanolic extract. These data suggest that the aqueous extract of P. oleracea can prevent oxidative DNA damage to human lymphocytes, which is likely due to antioxidant constituents in the extract. Copyright © 2011. Published by Elsevier B.V.
Development of a PCR Assay to detect Papillomavirus Infection in the Snow Leopard
Directory of Open Access Journals (Sweden)
Eng Curtis
2011-07-01
Full Text Available Abstract Background Papillomaviruses (PVs are a group of small, non-encapsulated, species-specific DNA viruses that have been detected in a variety of mammalian and avian species including humans, canines and felines. PVs cause lesions in the skin and mucous membranes of the host and after persistent infection, a subset of PVs can cause tumors such as cervical malignancies and head and neck squamous cell carcinoma in humans. PVs from several species have been isolated and their genomes have been sequenced, thereby increasing our understanding of the mechanism of viral oncogenesis and allowing for the development of molecular assays for the detection of PV infection. In humans, molecular testing for PV DNA is used to identify patients with persistent infections at risk for developing cervical cancer. In felids, PVs have been isolated and sequenced from oral papillomatous lesions of several wild species including bobcats, Asian lions and snow leopards. Since a number of wild felids are endangered, PV associated disease is a concern and there is a need for molecular tools that can be used to further study papillomavirus in these species. Results We used the sequence of the snow leopard papillomavirus UuPV1 to develop a PCR strategy to amplify viral DNA from samples obtained from captive animals. We designed primer pairs that flank the E6 and E7 viral oncogenes and amplify two DNA fragments encompassing these genes. We detected viral DNA for E6 and E7 in genomic DNA isolated from saliva, but not in paired blood samples from snow leopards. We verified the identity of these PCR products by restriction digest and DNA sequencing. The sequences of the PCR products were 100% identical to the published UuPV1 genome sequence. Conclusions We developed a PCR assay to detect papillomavirus in snow leopards and amplified viral DNA encompassing the E6 and E7 oncogenes specifically in the saliva of animals. This assay could be utilized for the molecular
Wolbachia and DNA barcoding insects: patterns, potential, and problems.
Smith, M Alex; Bertrand, Claudia; Crosby, Kate; Eveleigh, Eldon S; Fernandez-Triana, Jose; Fisher, Brian L; Gibbs, Jason; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hind, Katharine; Hrcek, Jan; Huang, Da-Wei; Janda, Milan; Janzen, Daniel H; Li, Yanwei; Miller, Scott E; Packer, Laurence; Quicke, Donald; Ratnasingham, Sujeevan; Rodriguez, Josephine; Rougerie, Rodolphe; Shaw, Mark R; Sheffield, Cory; Stahlhut, Julie K; Steinke, Dirk; Whitfield, James; Wood, Monty; Zhou, Xin
2012-01-01
Wolbachia is a genus of bacterial endosymbionts that impacts the breeding systems of their hosts. Wolbachia can confuse the patterns of mitochondrial variation, including DNA barcodes, because it influences the pathways through which mitochondria are inherited. We examined the extent to which these endosymbionts are detected in routine DNA barcoding, assessed their impact upon the insect sequence divergence and identification accuracy, and considered the variation present in Wolbachia COI. Using both standard PCR assays (Wolbachia surface coding protein--wsp), and bacterial COI fragments we found evidence of Wolbachia in insect total genomic extracts created for DNA barcoding library construction. When >2 million insect COI trace files were examined on the Barcode of Life Datasystem (BOLD) Wolbachia COI was present in 0.16% of the cases. It is possible to generate Wolbachia COI using standard insect primers; however, that amplicon was never confused with the COI of the host. Wolbachia alleles recovered were predominantly Supergroup A and were broadly distributed geographically and phylogenetically. We conclude that the presence of the Wolbachia DNA in total genomic extracts made from insects is unlikely to compromise the accuracy of the DNA barcode library; in fact, the ability to query this DNA library (the database and the extracts) for endosymbionts is one of the ancillary benefits of such a large scale endeavor--which we provide several examples. It is our conclusion that regular assays for Wolbachia presence and type can, and should, be adopted by large scale insect barcoding initiatives. While COI is one of the five multi-locus sequence typing (MLST) genes used for categorizing Wolbachia, there is limited overlap with the eukaryotic DNA barcode region.
Application of DNA fingerprints for cell-line individualization.
Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J
1990-01-01
DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...
Nikolova, Teodora; Marini, Federico; Kaina, Bernd
2017-10-01
Genotoxicity testing relies on the quantitative measurement of adverse effects, such as chromosome aberrations, micronuclei, and mutations, resulting from primary DNA damage. Ideally, assays will detect DNA damage and cellular responses with high sensitivity, reliability, and throughput. Several novel genotoxicity assays may fulfill these requirements, including the comet assay and the more recently developed γH2AX assay. Although they are thought to be specific for genotoxicants, a systematic comparison of the assays has not yet been undertaken. In the present study, we compare the γH2AX focus assay with the alkaline and neutral versions of the comet assay, as to their sensitivities and limitations for detection of genetic damage. We investigated the dose-response relationships of γH2AX foci and comet tail intensities at various times following treatment with four prototypical genotoxicants, methyl methanesulfonate (MMS), N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), mitomycin C, and hydrogen peroxide (H 2 O 2 ) and we tested whether there is a correlation between the endpoints, i.e., alkali-labile sites and DNA strand breaks on the one hand and the cell's response to DNA double-strand breaks and blocked replication forks on the other. Induction of γH2AX foci gave a linear dose response and all agents tested were positive in the assay. The increase in comet tail intensity was also a function of dose; however, mitomycin C was almost completely ineffective in the comet assay, and the doses needed to achieve a significant effect were somewhat higher for some treatments in the comet assay than in the γH2AX foci assay, which was confirmed by threshold analysis. There was high correlation between tail intensity and γH2AX foci for MMS and H 2 O 2 , less for MNNG, and none for mitomycin C. From this we infer that the γH2AX foci assay is more reliable, sensitive, and robust than the comet assay for detecting genotoxicant-induced DNA damage. Copyright © 2017 Elsevier
Directory of Open Access Journals (Sweden)
Taiebeh Ghyasvand
2015-12-01
Full Text Available Background: Oxidative stress in reproductive system leads to sperm DNA damage and sperm membrane lipid peroxidation and may play an important role in the pathogenesis of male infertility, especially in idiopathic cases. Antioxidants such as carotenoids function against free radical damages. Objective: The aim of this study was to determine the levels of lycopene, beta-carotene and retinol in serum and their relationship with sperm DNA damage and lipid peroxidation in infertile and normospermic males. Materials and Methods: Sixty two infertile men and 71 normospermic men participated in this study. Blood and semen samples were collected from all subjects. Sperm DNA damage was measured using TUNEL method. Carotenoids, retinol, and malonedildehyde in serum were also determined. Results: DNA fragmentation was higher in infertile group comparing to control group. Serum levels of lycopene, beta-carotene and, vitamin A in infertile men were significantly lower than normospermic men (p< 0.001, =0.005, and =0.003 respectively. While serum MDA was not significantly different between two groups, MDA in seminal plasma of infertile men was significantly higher than control group (p< 0.001. Conclusion: We concluded that lycopene, beta-carotene, and retinol can reduce sperm DNA fragmentation and lipid peroxidation through their antioxidant effect. Therefore the DNA fragmentation assay and determination of antioxidants factors such as lycopene, beta-carotene and retinol, along with sperm analysis can be useful in diagnosis and treatment of men with idiopathic infertility.
Townsend, Todd A; Parrish, Marcus C; Engelward, Bevin P; Manjanatha, Mugimane G
2017-08-01
DNA damage and alterations in global DNA methylation status are associated with multiple human diseases and are frequently correlated with clinically relevant information. Therefore, assessing DNA damage and epigenetic modifications, including DNA methylation, is critical for predicting human exposure risk of pharmacological and biological agents. We previously developed a higher-throughput platform for the single cell gel electrophoresis (comet) assay, CometChip, to assess DNA damage and genotoxic potential. Here, we utilized the methylation-dependent endonuclease, McrBC, to develop a modified alkaline comet assay, "EpiComet," which allows single platform evaluation of genotoxicity and global DNA methylation [5-methylcytosine (5-mC)] status of single-cell populations under user-defined conditions. Further, we leveraged the CometChip platform to create an EpiComet-Chip system capable of performing quantification across simultaneous exposure protocols to enable unprecedented speed and simplicity. This system detected global methylation alterations in response to exposures which included chemotherapeutic and environmental agents. Using EpiComet-Chip on 63 matched samples, we correctly identified single-sample hypermethylation (≥1.5-fold) at 87% (20/23), hypomethylation (≥1.25-fold) at 100% (9/9), with a 4% (2/54) false-negative rate (FNR), and 10% (4/40) false-positive rate (FPR). Using a more stringent threshold to define hypermethylation (≥1.75-fold) allowed us to correctly identify 94% of hypermethylation (17/18), but increased our FPR to 16% (7/45). The successful application of this novel technology will aid hazard identification and risk characterization of FDA-regulated products, while providing utility for investigating epigenetic modes of action of agents in target organs, as the assay is amenable to cultured cells or nucleated cells from any tissue. Environ. Mol. Mutagen. 58:508-521, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Klautau-Guimarães Maria N
2010-05-01
Full Text Available Abstract Background Normal cellular metabolism is well established as the source of endogenous reactive oxygen species which account for the background levels of oxidative DNA damage detected in normal tissue. Hydrogen peroxide imposes an oxidative stress condition on cells that can result in DNA damage, leading to mutagenesis and cell death. Several potentially significant genetic variants related to oxidative stress have already been identified, and angiotensin I-converting enzyme (ACE inhibitors have been reported as possible antioxidant agents that can reduce vascular oxidative stress in cardiovascular events. Methods We investigate the influences of haptoglobin, manganese superoxide dismutase (MnSOD Val9Ala, catalase (CAT -21A/T, glutathione peroxidase 1 (GPx-1 Pro198Leu, ACE (I/D and gluthatione S-transferases GSTM1 and GSTT1 gene polymorphisms against DNA damage and oxidative stress. These were induced by exposing leukocytes from peripheral blood of healthy humans (N = 135 to hydrogen peroxide (H2O2, and the effects were tested by comet assay. Blood samples were submitted to genotyping and comet assay (before and after treatment with H2O2 at 250 μM and 1 mM. Results After treatment with H2O2 at 250 μM, the GPx-1 polymorphism significantly influenced results of comet assay and a possible association of the Pro/Leu genotype with higher DNA damage was found. The highest or lowest DNA damage also depended on interaction between GPX-1/ACE and Hp/GSTM1T1 polymorphisms when hydrogen peroxide treatment increased oxidative stress. Conclusions The GPx-1 polymorphism and the interactions between GPX-1/ACE and Hp/GSTM1T1 can be determining factors for DNA oxidation provoked by hydrogen peroxide, and thus for higher susceptibility to or protection against oxidative stress suffered by healthy individuals.
Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C
1998-10-01
The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.
Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki
Directory of Open Access Journals (Sweden)
Silvia W. Lestari
2015-12-01
Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on
Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine
International Nuclear Information System (INIS)
Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.
1982-01-01
The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af
Differentiation of drug and non-drug Cannabis using a single nucleotide polymorphism (SNP) assay.
Rotherham, D; Harbison, S A
2011-04-15
Cannabis sativa is both an illegal drug and a legitimate crop. The differentiation of illegal drug Cannabis from non-drug forms of Cannabis is relevant in the context of the growth of fibre and seed oil varieties of Cannabis for commercial purposes. This differentiation is currently determined based on the levels of tetrahydrocannabinol (THC) in adult plants. DNA based methods have the potential to assay Cannabis material unsuitable for analysis using conventional means including seeds, pollen and severely degraded material. The purpose of this research was to develop a single nucleotide polymorphism (SNP) assay for the differentiation of "drug" and "non-drug"Cannabis plants. An assay was developed based on four polymorphisms within a 399 bp fragment of the tetrahydrocannabinolic acid (THCA) synthase gene, utilising the snapshot multiplex kit. This SNP assay was tested on 94 Cannabis plants, which included 10 blind samples, and was able to differentiate between "drug" and "non-drug"Cannabis in all cases, while also differentiating between Cannabis and other species. Non-drug plants were found to be homozygous at the four sites assayed while drug Cannabis plants were either homozygous or heterozygous. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Extraction of ultrashort DNA molecules from herbarium specimens.
Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A
2017-02-01
DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.
Tengs, T; Bowers, H A; Ziman, A P; Stoecker, D K; Oldach, D W
2001-02-01
Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtained from several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses and comparison of sequences indicate that the chloroplast sequences show a higher degree of sequence divergence than the nuclear homologue. The chloroplast sequences were chosen as targets for the development of a 5'--3' exonuclease assay for detection of the organism. The assay has a very high degree of specificity and has been used to screen environmental water samples from a fish farm where the presence of this dinoflagellate species has previously been associated with fish kills. Various hypotheses for the derived nature of the chloroplast sequences are discussed, as well as what is known about the toxicity of the species.
International Nuclear Information System (INIS)
Nascimento, Patricia A. do; Suzuki, Miriam F.; Okazaki, Kayo
1997-01-01
The comet assay, also called single cell gel electrophoresis technique, permits to evaluate quantitatively DNA breakage induced by chemical and physical agents at the level of the single cell. The present paper refers to the construction of dose-response curves to DNA damage and repair studies in human peripheral lymphocytes, utilizing the comet assay for the radiosensitivity analysis. So, the blood samples were obtained from healthy donors (40-50 year old), irradiated in a 60 Co source (GAMMACEL 220) with doses of 0.17, 0.25, 0.57, 1.10, 2.12 and 4.22 Gy (0.59 Gy/min.) and processed 1 and 24 hours after the exposition. Results obtained showed a increase in the total lenght of comet (DNA migration) as a function of radiation dose in samples processed 1 and 24 hours after the treatment. The DNA lesion in irradiated lymphocytes with 4.22 Gy (means value of 101.4 μm) were 3.4 times higher than in the untreated lymphocytes (mean value of 30 μm) instead of 24 hours after the irradiation were 1.5 times higher (mean value of 46.3 μm). This reduction on DNA repair occurred in these cells. It was also possible visualized the presence of subpopulations of the cells with different sensitivity and repair capacity to ionizing radiation in these donors. (author). 8 refs., 3 figs
International Nuclear Information System (INIS)
Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile
2016-01-01
Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)
Knowledge-based Fragment Binding Prediction
Tang, Grace W.; Altman, Russ B.
2014-01-01
Target-based drug discovery must assess many drug-like compounds for potential activity. Focusing on low-molecular-weight compounds (fragments) can dramatically reduce the chemical search space. However, approaches for determining protein-fragment interactions have limitations. Experimental assays are time-consuming, expensive, and not always applicable. At the same time, computational approaches using physics-based methods have limited accuracy. With increasing high-resolution structural data for protein-ligand complexes, there is now an opportunity for data-driven approaches to fragment binding prediction. We present FragFEATURE, a machine learning approach to predict small molecule fragments preferred by a target protein structure. We first create a knowledge base of protein structural environments annotated with the small molecule substructures they bind. These substructures have low-molecular weight and serve as a proxy for fragments. FragFEATURE then compares the structural environments within a target protein to those in the knowledge base to retrieve statistically preferred fragments. It merges information across diverse ligands with shared substructures to generate predictions. Our results demonstrate FragFEATURE's ability to rediscover fragments corresponding to the ligand bound with 74% precision and 82% recall on average. For many protein targets, it identifies high scoring fragments that are substructures of known inhibitors. FragFEATURE thus predicts fragments that can serve as inputs to fragment-based drug design or serve as refinement criteria for creating target-specific compound libraries for experimental or computational screening. PMID:24762971