WorldWideScience

Sample records for dna fragment anchoring

  1. Fracture resistance of reattached incisor fragments with mini fibre-reinforced composite anchors.

    NARCIS (Netherlands)

    Fennis, W.M.M.; Kreulen, C.M.; Wolke, J.G.C.; Fokkinga, W.A.; Machado, C.; Creugers, N.H.J.

    2009-01-01

    OBJECTIVES: Fractured coronal fragments of incisors can be adhered to the remaining tooth with resin composite, but are prone to failure. This study explores whether mini fibre-reinforced composite (FRC) anchors increase fracture resistance of reattached fragments. METHODS: Forty-five extracted

  2. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  3. Functionalized Nanostructures: Redox-Active Porphyrin Anchors for Supramolecular DNA Assemblies

    KAUST Repository

    Börjesson, Karl

    2010-09-28

    We have synthesized and studied a supramolecular system comprising a 39-mer DNA with porphyrin-modified thymidine nucleosides anchored to the surface of large unilamellar vesicles (liposomes). Liposome porphyrin binding characteristics, such as orientation, strength, homogeneity, and binding site size, was determined, suggesting that the porphyrin is well suited as a photophysical and redox-active lipid anchor, in comparison to the inert cholesterol anchor commonly used today. Furthermore, the binding characteristics and hybridization capabilities were studied as a function of anchor size and number of anchoring points, properties that are of importance for our future plans to use the addressability of these redox-active nodes in larger DNA-based nanoconstructs. Electron transfer from photoexcited porphyrin to a lipophilic benzoquinone residing in the lipid membrane was characterized by steady-state and time-resolved fluorescence and verified by femtosecond transient absorption. © 2010 American Chemical Society.

  4. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  5. Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

    Science.gov (United States)

    Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

    2010-01-19

    Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

  6. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  7. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  9. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  10. Oligo-dT anchored cDNA-SCoT: a novel differential display method for analyzing differential gene expression in response to several stress treatments in mango (Mangifera indica L.).

    Science.gov (United States)

    Luo, Cong; He, Xin-Hua; Hu, Ying; Yu, Hai-xia; Ou, Shi-Jin; Fang, Zhong-Bin

    2014-09-15

    Differential display is a powerful technique for analyzing differences in gene expression. Oligo-dT cDNAstart codon targeted marker (cDNA-SCoT) technique is a novel, simple, cheap, rapid, and efficient method for differential gene expression research. In the present study, the oligo-dT anchored cDNA-SCoT technique was exploited to identify differentially expressed genes during several stress treatments in mango. A total of 37 primers combined with oligo-dT anchor primers 3side amplified approximately 150 fragments of 150 bp to 1500 bp in length. Up to 100 fragments were differentially expressed among the stress treatments and control samples, among which 92 were obtained and sequenced. Out of the 92 transcript derived fragments (TDFs), 70% were highly homologous to known genes, and 30% encoded unclassified proteins with unknown functions. The expression pattern of nine genes with known functions involved in several abiotic stresses in other species was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) under cold (4 °C), salinity (NaCl), polyethylene glycol (PEG, MW 6000), and heavy metal treatments in leaves and stems at different time points (0, 24, 48, and 72 h). The expression patterns of the genes (TDF4, TDF7, TDF23, TDF45, TDF49, TDF50, TDF57, TDF91 and TDF92) that had direct or indirect relationships with cold, salinity, drought and heavy metal stress response were analyzed through qRT-PCR. The possible roles of these genes are discussed. This study suggests that the oligo-dT anchored cDNA-SCoT differential display method is a useful tool to serve as an initial step for characterizing transcriptional changes induced by abiotic stresses and provide gene information for further study and application in genetic improvement and breeding in mango. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  12. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  13. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  14. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  15. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  16. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  17. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  18. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  19. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  20. Effect of anchor positioning on binding and diffusion of elongated 3D DNA nanostructures on lipid membranes

    International Nuclear Information System (INIS)

    Khmelinskaia, Alena; Franquelim, Henri G; Petrov, Eugene P; Schwille, Petra

    2016-01-01

    DNA origami is a state-of-the-art technology that enables the fabrication of nano-objects with defined shapes, to which functional moieties, such as lipophilic anchors, can be attached with a nanometre scale precision. Although binding of DNA origami to lipid membranes has been extensively demonstrated, the specific requirements necessary for membrane attachment are greatly overlooked. Here, we designed a set of amphipathic rectangular-shaped DNA origami structures with varying placement and number of chol-TEG anchors used for membrane attachment. Single- and multiple-cholesteryl-modified origami nanostructures were produced and studied in terms of their membrane localization, density and dynamics. We show that the positioning of at least two chol-TEG moieties near the corners is essential to ensure efficient membrane binding of large DNA nanostructures. Quantitative fluorescence correlation spectroscopy data further confirm that increasing the number of corner-positioned chol-TEG anchors lowers the dynamics of flat DNA origami structures on freestanding membranes. Taken together, our approach provides the first evidence of the importance of the location in addition to the number of hydrophobic moieties when rationally designing minimal DNA nanostructures with controlled membrane binding. (paper)

  1. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  2. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  3. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  4. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  5. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  6. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  7. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  9. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  10. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  11. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  12. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  13. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  14. Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

    Directory of Open Access Journals (Sweden)

    Ma G

    2013-03-01

    Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

  15. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  16. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  17. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  18. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  19. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  20. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  1. PCR-based detection of a rare linear DNA in cell culture.

    Science.gov (United States)

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  2. Drosophila acetylcholinesterase: demonstration of a glycoinositol phospholipid anchor and an endogenous proteolytic cleavage

    International Nuclear Information System (INIS)

    Haas, R.; Marshall, T.L.; Rosenberry, T.L.

    1988-01-01

    The presence of a glycoinositol phospholipid anchor Drosophila acetylcholinesterase (AChE) was shown by several criteria. Chemical analysis of highly purified Drosophila AChE demonstrated approximately one residue of inositol per enzyme subunit. Selective cleavage by Staphylococcus aureus phosphatidylinositol-specific phospholipase C (PI-PLC) was tested with Drosophila AChE radiolabeled by the photoactivatable affinity probe 3-(trifluoromethyl)-3-(m-[ 125 I]iodophenyl)diazirine ([ 125 I]TID), a reagent that specifically labels the lipid moiety of glycoinositol phospholipid-anchored proteins. Digestion with PI-PLC released 75% of this radiolabel from the protein. Gel electrophoresis of Drosophila AChE in sodium dodecyl sulfate indicated prominent 55- and 16-kDa bands and a faint 70-kDa band. The [ 125 ]I]TID label was localized on the 55-kDa fragment, suggesting that this fragment is the C-terminal portion of the protein. In support of this conclusion, a sensitive microsequencing procedure that involved manual Edman degradation combined with radiomethylation was used to determine residues 2-5 of the 16-kDa fragment. Comparison with the Drosophila AChE cDNA sequence confirmed that the 16-kDa fragment includes the N-terminus of AChE. Furthermore, the position of the N-terminal amino acid of the mature Drosophila AChE is closely homologous to that of Torpedo AChE. The presence of radiomethylatable ethanolamine in both 16- and 55-kDa fragments was also confirmed. Thus, Drosophila AChE may include a second posttranslational modification involving ethanolamine

  3. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  4. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  5. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  6. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  7. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  8. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  9. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  10. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  11. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  12. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  13. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  14. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  15. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  16. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  17. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  18. Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

    Science.gov (United States)

    Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

    2015-07-13

    We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

  19. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  20. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  1. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  3. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  4. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  5. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  6. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  7. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  8. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  9. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  11. Functionalized Nanostructures: Redox-Active Porphyrin Anchors for Supramolecular DNA Assemblies

    KAUST Repository

    Börjesson, Karl; Wiberg, Joanna; El-Sagheer, Afaf H.; Ljungdahl, Thomas; Må rtensson, Jerker; Brown, Tom; Nordén, Bengt; Albinsson, Bo

    2010-01-01

    , such as orientation, strength, homogeneity, and binding site size, was determined, suggesting that the porphyrin is well suited as a photophysical and redox-active lipid anchor, in comparison to the inert cholesterol anchor commonly used today. Furthermore

  12. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  13. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  14. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  15. Anchoring cationic amphiphiles for nucleotide delivery: significance of DNA release from cationic liposomes for transfection.

    Science.gov (United States)

    Hirashima, Naohide; Minatani, Kazuhiro; Hattori, Yoshifumi; Ohwada, Tomohiko; Nakanishi, Mamoru

    2007-06-01

    We have designed and synthesized lithocholic acid-based cationic amphiphile molecules as components of cationic liposomes for gene transfection (lipofection). To study the relationship between the molecular structures of those amphiphilic molecules, particularly the extended hydrophobic appendant (anchor) at the 3-hydroxyl group, and transfection efficiency, we synthesized several lithocholic and isolithocholic acid derivatives, and examined their transfection efficiency. We also compared the physico-chemical properties of cationic liposomes prepared from these derivatives. We found that isolithocholic acid derivatives exhibit higher transfection efficiency than the corresponding lithocholic acid derivatives. This result indicates that the orientation and extension of hydrophobic regions influence the gene transfection process. Isolithocholic acid derivatives showed a high ability to encapsulate DNA in a compact liposome-DNA complex and to protect it from enzymatic degradation. Isolithocholic acid derivatives also facilitated the release of DNA from the liposome-DNA complex, which is a crucial step for DNA entry into the nucleus. Our results show that the transfection efficiency is directly influenced by the ability of the liposome complex to release DNA, rather than by the DNA-encapsulating ability. Molecular modeling revealed that isolithocholic acid derivatives take relatively extended conformations, while the lithocholic acid derivatives take folded structures. Thus, the efficiency of release of DNA from cationic liposomes in the cytoplasm, which contributes to high transfection efficiency, appears to be dependent upon the molecular shape of the cationic amphiphiles.

  16. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  17. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  18. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  19. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  20. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  1. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  2. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  3. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  4. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  5. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  6. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  7. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  8. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  9. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  10. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  11. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  12. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  13. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  14. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  15. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  17. [Single-molecule detection and characterization of DNA replication based on DNA origami].

    Science.gov (United States)

    Wang, Qi; Fan, Youjie; Li, Bin

    2014-08-01

    To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

  18. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  19. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  20. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  1. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  2. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  3. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  4. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  5. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  6. Double-Row Suture Anchor Repair of Posterolateral Corner Avulsion Fractures.

    Science.gov (United States)

    Gilmer, Brian B

    2017-08-01

    Posterolateral corner avulsion fractures are a rare variant of ligamentous knee injury primarily described in the skeletally immature population. Injury is often related to a direct varus moment placed on the knee during sporting activities. Various treatment strategies have been discussed ranging from nonoperative management, to excision of the bony fragment, to primary repair with screws or suture. The described technique is a means for achieving fixation of the bony avulsion using principles familiar to double-row transosseous equivalent rotator cuff repair. Proximal anchors are placed in the epiphysis, and sutures are passed in horizontal mattress fashion. Once tied, the limbs of these same sutures are then passed to more distal anchors. Remaining eyelet sutures can be used to manage peripheral tissue. The final repair provides anatomic reduction and compression of the fragment to its bony bed with minimal extracortical hardware prominence and no violation of the physis. Risks include potential for physeal injury or chondral damage to the lateral femoral condyle through aberrant anchor placement. Postoperative care includes toe-touch weight-bearing restrictions and range of motion restrictions of 0°-90° in a hinged brace for 6 weeks followed by gradual return to activity.

  7. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  8. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  9. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  10. Zwitterionic peptide anchored to conducting polymer PEDOT for the development of antifouling and ultrasensitive electrochemical DNA sensor.

    Science.gov (United States)

    Wang, Guixiang; Han, Rui; Su, Xiaoli; Li, Yinan; Xu, Guiyun; Luo, Xiliang

    2017-06-15

    Zwitterionic peptides were anchored to a conducting polymer of citrate doped poly(3,4-ethylenedioxythiophene) (PEDOT) via the nickel cation coordination, and the obtained peptide modified PEDOT, with excellent antifouling ability and good conductivity, was further used for the immobilization of a DNA probe to construct an electrochemical biosensor for the breast cancer marker BRCA1. The DNA biosensor was highly sensitive (with detection limit of 0.03fM) and selective, and it was able to detect BRCA1 in 5% (v/v) human plasma with satisfying accuracy and low fouling. The marriage of antifouling and biocompatible peptides with conducting polymers opened a new avenue to construct electrochemical biosensors capable of assaying targets in complex biological media with high sensitivity and without biofouling. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  12. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  13. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  14. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  15. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  16. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  17. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  18. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  19. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  20. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  1. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  2. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  3. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  4. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  5. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  6. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  7. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  8. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  9. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  10. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  11. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  12. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  13. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  14. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  15. A cell-surface-anchored ratiometric fluorescent probe for extracellular pH sensing.

    Science.gov (United States)

    Ke, Guoliang; Zhu, Zhi; Wang, Wei; Zou, Yuan; Guan, Zhichao; Jia, Shasha; Zhang, Huimin; Wu, Xuemeng; Yang, Chaoyong James

    2014-09-10

    Accurate sensing of the extracellular pH is a very important yet challenging task in biological and clinical applications. This paper describes the development of an amphiphilic lipid-DNA molecule as a simple yet useful cell-surface-anchored ratiometric fluorescent probe for extracellular pH sensing. The lipid-DNA probe, which consists of a hydrophobic diacyllipid tail and a hydrophilic DNA strand, is modified with two fluorescent dyes; one is pH-sensitive as pH indicator and the other is pH-insensitive as an internal reference. The lipid-DNA probe showed sensitive and reversible response to pH change in the range of 6.0-8.0, which is suitable for most extracellular studies. In addition, based on simple hydrophobic interactions with the cell membrane, the lipid-DNA probe can be easily anchored on the cell surface with negligible cytotoxicity, excellent stability, and unique ratiometric readout, thus ensuring its accurate sensing of extracellular pH. Finally, this lipid-DNA-based ratiometric pH indicator was successfully used for extracellular pH sensing of cells in 3D culture environment, demonstrating the potential applications of the sensor in biological and medical studies.

  16. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  17. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  18. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  19. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  20. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  1. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  2. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  3. AnchorDock: Blind and Flexible Anchor-Driven Peptide Docking.

    Science.gov (United States)

    Ben-Shimon, Avraham; Niv, Masha Y

    2015-05-05

    The huge conformational space stemming from the inherent flexibility of peptides is among the main obstacles to successful and efficient computational modeling of protein-peptide interactions. Current peptide docking methods typically overcome this challenge using prior knowledge from the structure of the complex. Here we introduce AnchorDock, a peptide docking approach, which automatically targets the docking search to the most relevant parts of the conformational space. This is done by precomputing the free peptide's structure and by computationally identifying anchoring spots on the protein surface. Next, a free peptide conformation undergoes anchor-driven simulated annealing molecular dynamics simulations around the predicted anchoring spots. In the challenging task of a completely blind docking test, AnchorDock produced exceptionally good results (backbone root-mean-square deviation ≤ 2.2Å, rank ≤15) for 10 of 13 unbound cases tested. The impressive performance of AnchorDock supports a molecular recognition pathway that is driven via pre-existing local structural elements. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  5. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  6. The Ogden Anchor.

    Science.gov (United States)

    Knudson, W E; Cerniglia, M W; Carro, A

    1998-06-01

    Many procedures performed by podiatric surgeons today require the use of a soft-tissue anchoring device. In recent years, many new anchoring devices have become available for use in the foot and ankle. The authors introduce a new soft-tissue anchoring device that has yet to be described in the podiatric literature and present two cases in which the new anchor was used.

  7. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  8. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  9. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Science.gov (United States)

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  10. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Directory of Open Access Journals (Sweden)

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  11. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  12. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  14. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  15. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  16. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Science.gov (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  17. Scar-less multi-part DNA assembly design automation

    Science.gov (United States)

    Hillson, Nathan J.

    2016-06-07

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

  18. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Science.gov (United States)

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  19. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  20. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

    OpenAIRE

    Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

    2015-01-01

    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

  1. Anchor Bolt Position in Base Plate In Terms Of T and J Anchor Bolt

    Directory of Open Access Journals (Sweden)

    b Osman Mohamad Hairi

    2017-01-01

    Full Text Available Generally, L anchor bolt system has been used for a long period of time in construction industry as one of the distributing load structures. However, there are some weaknesses in L anchor bolt which may straighten and pullup when charged with tensile load. Current practices prefer to use other types of anchor bolt systems, such as headed studs anchor bolt system to replace the L anchor bolt design. There has been lack of studies to prove that it is more effective in terms of performance. A new T anchor bolt which was basically modified from headed studs anchor bolt was proposed in this study to compare its performance of tensile loading in concrete failure to typical L design. This study aims to determine whether the T anchor bolt system gives better performance as compared to an L anchor bolt system. The performance was rated based on tensile loading on concrete failure pattern. A pullout test was conducted on two different anchor bolt systems, namely L and T. The anchor bolt embedded depth, h in concrete were varied according to their hook or bend radius. Each sample was repeated twice. There were totally eight samples. The hook or bend radius used were 50 mm and 57.5 mm for sample L1 and L2, respectively. 90-degree bend were used on sample T1 and T2. Based on test results, it can be seen that the performance of concrete failure pattern under tensile load on both L and T anchor bolt design samples with 200 mm embedment depth was better than deeper embedment depth of 230 mm. But the L anchor bolt design gives the best results as compared to T design. Although T anchor bolt design shows higher resistance before first bond failure to the concrete sample. T anchor bolt was analysed and needed deeper embedment depth to allow formation of cone pull-out shape to acquire better performance.

  2. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  3. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

    1986-01-01

    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  4. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  5. Analysis of Anchoring Mechanism of Fully Grouted Prestressed Anchor

    Directory of Open Access Journals (Sweden)

    WEN Zhi-jie

    2014-01-01

    Full Text Available Some researchers have been carried out on analysis of the influence of the full grouted prestressed anchor shape of borehole wall on its carrying capacity. Based on the self-affine fractal feature of anchor borehole wall structural plane, the relation equation among structural plane shear strength, liquid injection pressure, tensile load and structural plane fractal dimension D was built, the instability judgment criterion of anchoring bearing strata and rock structural plane was determined, the solving equations of disintegrated rock support density were derived. Based on the experimental results, the theoretical basis of support design under the disintegrated rock condition was offered.

  6. Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

    Science.gov (United States)

    Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

    2013-01-01

    Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

  7. Anchors as Semantic Primes in Value Construction: An EEG Study of the Anchoring Effect.

    Directory of Open Access Journals (Sweden)

    Qingguo Ma

    Full Text Available Previous research regarding anchoring effects has demonstrated that human judgments are often assimilated to irrelevant information. Studies have demonstrated that anchors influence the economic valuation of various products and experiences; however, the cognitive explanations of this effect remain controversial, and its neural mechanisms have rarely been explored. In the current study, we conducted an electroencephalography (EEG experiment to investigate the anchoring effect on willingness to accept (WTA for an aversive hedonic experience and the role of anchors in this judgment heuristic. The behavioral results demonstrated that random numbers affect participants' WTA for listening to pieces of noise. The participants asked for higher pay after comparing their WTA with higher numbers. The EEG results indicated that anchors also influenced the neural underpinnings of the valuation process. Specifically, when a higher anchor number was drawn, larger P2 and late positive potential amplitudes were elicited, reflecting the anticipation of more intensive pain from the subsequent noise. Moreover, higher anchors induced a stronger theta band power increase compared with lower anchors when subjects listened to the noises, indicating that the participants felt more unpleasant during the actual experience of the noise. The levels of unpleasantness during both anticipation and experience were consistent with the semantic information implied by the anchors. Therefore, these data suggest that a semantic priming process underlies the anchoring effect in WTA. This study provides proof for the robustness of the anchoring effect and neural evidence of the semantic priming model. Our findings indicate that activated contextual information, even seemingly irrelevant, can be embedded in the construction of economic value in the brain.

  8. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  9. Susceptibility to anchoring effects

    Directory of Open Access Journals (Sweden)

    Todd McElroy

    2007-02-01

    Full Text Available Previous research on anchoring has shown this heuristic to be a very robust psychological phenomenon ubiquitous across many domains of human judgment and decision-making. Despite the prevalence of anchoring effects, researchers have only recently begun to investigate the underlying factors responsible for how and in what ways a person is susceptible to them. This paper examines how one such factor, the Big-Five personality trait of openness-to-experience, influences the effect of previously presented anchors on participants' judgments. Our findings indicate that participants high in openness-to-experience were significantly more influenced by anchoring cues relative to participants low in this trait. These findings were consistent across two different types of anchoring tasks providing convergent evidence for our hypothesis.

  10. Anchor-dependent lipofection with non-glycerol based cytofectins containing single 2-hydroxyethyl head groups.

    Science.gov (United States)

    Venkata Srilakshmi, Gollapudi; Sen, Joyeeta; Chaudhuri, Arabinda; Ramadas, Yerramsetti; Madhusudhana Rao, Nalam

    2002-02-15

    Detailed structure-activity investigations aimed at probing the anchor chain length dependency for glycerol-based lipofectins have been reported previously. Herein, we report on the first detailed investigation on the anchor-dependent transfection biology of non-glycerol based simple monocationic cytofectins containing single 2-hydroxyethyl head group functionality using 11 new structural analogs of our previously published first generation of non-glycerol based transfection lipids (lipids 1-11). The C-14 and C-16 analogs of DOMHAC (lipids 4 and 5, respectively) were found to be remarkably efficient in transfecting COS-1 cells. In addition, the present anchor-dependency investigation also revealed that the C-14 analog of DOHEMAB (lipid 10) is significantly efficient in transfecting both COS-1 and NIH3T3 cells. Our results also indicate that too strong lipid-DNA interactions might result in weaker transfection for non-glycerol based cationic lipids. In summary, the anchor-dependence investigations presented here convincingly demonstrate that non-glycerol based cationic lipids containing a single hydroxyethyl head group and hydrophobic C-14 or C-16 anchors are promising non-toxic cationic transfection lipids for future use in liposomal gene delivery.

  11. Comparison of Suture-Based Anchors and Traditional Bioabsorbable Anchors in Foot and Ankle Surgery.

    Science.gov (United States)

    Hembree, W Chad; Tsai, Michael A; Parks, Brent G; Miller, Stuart D

    We compared the pullout strength of a suture-based anchor versus a bioabsorbable anchor in the distal fibula and calcaneus and evaluated the relationship between bone mineral density and peak load to failure. Eight paired cadaveric specimens underwent a modified Broström procedure and Achilles tendon reattachment. The fibula and calcaneus in the paired specimens received either a suture-based anchor or a bioabsorbable suture anchor. The fibular and calcaneal specimens were loaded to failure, defined as a substantial decrease in the applied load or pullout from the bone. In the fibula, the peak load to failure was significantly greater with the suture-based versus the bioabsorbable anchors (133.3 ± 41.8 N versus 76.8 ± 35.3 N; p = .002). No significant difference in load with 5 mm of displacement was found between the 2 groups. In the calcaneus, no difference in the peak load to failure was found between the 2 groups, and the peak load to failure with 5 mm of displacement was significantly lower with the suture-based than with the bioabsorbable anchors (52.2 ± 9.8 N versus 75.9 ± 12.4 N; p = .003). Bone mineral density and peak load to failure were significantly correlated in the fibula with the suture-based anchor. An innovative suture-based anchor had a greater peak load to failure compared with a bioabsorbable anchor in the fibula. In the calcaneus, the load at 5 mm of displacement was significantly lower in the suture-based than in the bioabsorbable group. The correlation findings might indicate the need for a cortical bone shelf with the suture-based anchor. Suture-based anchors could be a viable alternative to bioabsorbable anchors for certain foot and ankle procedures. Copyright © 2016 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  12. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  13. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  14. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  15. Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

    Science.gov (United States)

    Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

    2015-09-01

    To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

  16. Double row anchor fixation: a novel technique for a diabetic calanceal insufficiency avulsion fracture.

    Science.gov (United States)

    Greenhagen, Robert M; Highlander, Peter D; Burns, Patrick R

    2012-01-01

    Avulsion fractures of the calcaneal tuberosity represent only 1.3% to 2.7% of calcaneal fractures. These fractures are common pathologically in nature and attributed to decreased bone mineral density. Calcaneal insufficiency avulsion (CIA) fracture in patients with diabetes mellitus is most likely due to Charcot neuroarthropathy (CN) as described by the Brodsky classification (Brodsky 3B). Traditional open reduction and internal fixation is difficult in all calcaneal avulsion fractures because of poor bone quality. The authors report the first known description of the use of fracture fragment excision and double row anchor fixation.A 39-year-old woman with type I diabetes mellitus and a history of CN presented with an avulsion fracture of the calcaneal tuberosity. Excision of the fracture fragment and a gastrocnemius recession and reattachment of the Achilles tendon with double row anchor fixation to the calcaneus were performed. At 1 year, the patient's American Orthopaedic Foot & Ankle Society rearfoot score improved from 27/100 to 88/100. CIA fractures are an infrequently described injury. Because diabetes mellitus is frequently associated with this disease, it most likely represents a CN event. Traditionally, CIA fractures have been operatively treated with open reduction internal fixation. Previous authors have described difficulty with fixation because of poor quality. In the current report, the authors describe a novel operative approach to CIA fractures through the use of double row anchor fixation and excision of the fracture fragments. The authors feel that this previously undescribed treatment is superior to traditional methods and may serve as a new treatment option for all patients who have sustained this unusual pathology regardless of the underlying cause. The current authors provide a novel operative technique that provides inherent advantages to the traditional repair of CIA fractures. We believe CIA fractures represent a CN-type event and care

  17. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  18. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    OpenAIRE

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  19. Fragmentation of chromatin with 125I radioactive disintegrations

    International Nuclear Information System (INIS)

    Turner, G.N.; Nobis, P.; Dewey, W.C.

    1976-01-01

    The DNA in Chinese hamster cells was labeled first for 3 h with [ 3 H]TdR and then for 3 h with [ 125 I]UdR. Chromatin was extracted, frozen, and stored at -30 0 C until 1.0 x 10 17 and 1.25 x 10 17 disintegrations/g of labeled DNA occurred for 125 I and 3 H, respectively. Velocity sedimentation of chromatin (DNA with associated chromosomal proteins) in neutral sucrose gradients indicated that the localized energy from the 125 I disintegrations, which gave about 1 double-strand break/disintegration plus an additional 1.3 single strand breaks, selectively fragmented the [ 125 I] chromatin into pieces smaller than the [ 3 H] chromatin. In other words, 125 I disintegrations caused much more localized damage in the chromatin labeled with 125 I than in the chromatin labeled with 3 H, and fragments induced in DNA by 125 I disintegrations were not held together by the associated chromosomal proteins. Use of this 125 I technique for studying chromosomal proteins associated with different regions in the cellular DNA is discussed. For these studies, the number of disintegrations required for fragmenting DNA molecules of different sizes is illustrated

  20. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  1. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    International Nuclear Information System (INIS)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  2. Quantum mechanical fragment methods based on partitioning atoms or partitioning coordinates.

    Science.gov (United States)

    Wang, Bo; Yang, Ke R; Xu, Xuefei; Isegawa, Miho; Leverentz, Hannah R; Truhlar, Donald G

    2014-09-16

    atoms for capping dangling bonds, and we have shown that they can greatly improve the accuracy. Finally we present a new approach that goes beyond QM/MM by combining the convenience of molecular mechanics with the accuracy of fitting a potential function to electronic structure calculations on a specific system. To make the latter practical for systems with a large number of degrees of freedom, we developed a method to interpolate between local internal-coordinate fits to the potential energy. A key issue for the application to large systems is that rather than assigning the atoms or monomers to fragments, we assign the internal coordinates to reaction, secondary, and tertiary sets. Thus, we make a partition in coordinate space rather than atom space. Fits to the local dependence of the potential energy on tertiary coordinates are arrayed along a preselected reaction coordinate at a sequence of geometries called anchor points; the potential energy function is called an anchor points reactive potential. Electrostatically embedded fragment methods and the anchor points reactive potential, because they are based on treating an entire system by quantum mechanical electronic structure methods but are affordable for large and complex systems, have the potential to open new areas for accurate simulations where combined QM/MM methods are inadequate.

  3. Experimental Research on Destruction Mode and Anchoring Performance of Carbon Fiber Phyllostachys pubescens Anchor Rod with Different Forms

    Directory of Open Access Journals (Sweden)

    Wang Yulan

    2018-01-01

    Full Text Available The anchoring technology is extensively applied in reinforcing protection of the earth relics. Now that no specification is available for different new anchor rods in earth relics protection due to diversified destruction modes of earth relics and complexity of engineering technology conditions, it is urgent to guide reinforcing design and construction with a complete detailed anchor rod research document. With the new carbon fiber Phyllostachys pubescens anchor rod as the research object, six lots of in situ tests are designed to, respectively, study the destruction mode and anchoring performance of the carbon fiber Phyllostachys pubescens anchor rod under different anchor length L, anchor rod diameter D, bore diameter H, grouting material S, rib spacing R, and inclination angle A in this paper. By studying load shift curve experiment in drawing of the anchor rod, the destruction mode and ultimate bearing capacity of the carbon fiber Phyllostachys pubescens anchor rod in different experiment lots are obtained, and the concept of permitted application value N in anchor rod design is proposed. By studying strain distribution characteristics of anchor rods in experimental lots along the length direction under action of the permitted application value N and combining the existing destruction mode and ultimate bearing capacity, this paper analyzes influences of L, D, H, S, R, and A on anchoring effect of the carbon fiber Phyllostachys pubescens anchor rod; gives the reasonable value range of L, D, H, and R when the carbon fiber Phyllostachys pubescens anchor rod is used for reinforcing design of the earth relics; and provides favorable experiment basis for reinforcing design of the earth relics based on the carbon fiber Phyllostachys pubescens anchor rod.

  4. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  5. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  6. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  7. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  8. Experimental testing of anchoring devices for bottom rails in partially anchored timber frame shear walls

    OpenAIRE

    Caprolu, Giuseppe

    2011-01-01

    Källsner and Girhammar have presented a new plastic design method of wood-framed shear walls at ultimate limit state. This method allows the designer to calculate the load-carrying capacity of shear walls partially anchored, where the leading stud is not anchored against the uplift.The anchorage system of shear walls is provided from anchor bolts and hold downs. Anchor bolts provide horizontal shear continuity between the bottom rail and the foundation. Hold downs are directly connected from ...

  9. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  10. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  11. [Treatment of calcaneal avulsion fractures with twinfix suture anchors fixation].

    Science.gov (United States)

    Zhao, Bin-xiu; Wang, Kun-zheng; Wang, Chun-sheng; Xie, Yue; Dai, Zhi-tang; Liu, Gang; Liu, Wei-dong

    2011-06-01

    For the calcaneal avulsion fracture, the current method is more commonly used screws or Kirschner wire to fix fracture fragment. This article intended to explore the feasibility and clinical efficacy for the treatment of avulsion fractures with TwinFix suture anchors. From July 2007 to November 2010, 21 patients were reviewed, including 15 males and 6 females, ranging in age from 49 to 65 years,with a mean of 58.7 years. Twelve patients had nodules in the right heel and 9 patients had nodules in the left heel. All the patients had closed fractures. The typical preoperative symptoms of the patients included pain in the upper heel and weak in heel lift. Body examination results: palpable sense of bone rubbing in the back of the heel, and swelling in the heel. Surgery treatment with TwinFix suture anchors performed as follows : to fix TwinFix suture anchors into the calcaneal body, then to drill the fracture block, to make the double strand suture through the fracture holes, to knot the suture eachother to fix the block, and to use stitch to fix the remaining suture in the Achilles tendon in order to improve the block fixation. The criteria of the AOFAS Foot and Ankle Surgery by the United States Association of ankle-rear foot functional recovery was used to evaluate the Achilles tendon. Total average score was (95.5 +/- 3.12) points, including pain items of(38.5 +/- 2.18) points,the average score of functional items of (49.5 +/- 3.09) points,and power lines of 10 points in all patients. Twenty-one patients got an excellent result, 16 good and 5 poor. The methods of treatment for the calcaneal avulsion fractures with TwinFix suture anchors is a simple operation, and have excellent clinical effect, which is worthy of promotion.

  12. Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells

    Directory of Open Access Journals (Sweden)

    Sharma Shikhar

    2012-01-01

    Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.

  13. Synchronization of DNA array replication kinetics

    Science.gov (United States)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  14. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  16. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    OpenAIRE

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  17. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Science.gov (United States)

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  18. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  19. High-resolution structure of TBP with TAF1 reveals anchoring patterns in transcriptional regulation.

    Science.gov (United States)

    Anandapadamanaban, Madhanagopal; Andresen, Cecilia; Helander, Sara; Ohyama, Yoshifumi; Siponen, Marina I; Lundström, Patrik; Kokubo, Tetsuro; Ikura, Mitsuhiko; Moche, Martin; Sunnerhagen, Maria

    2013-08-01

    The general transcription factor TFIID provides a regulatory platform for transcription initiation. Here we present the crystal structure (1.97 Å) and NMR analysis of yeast TAF1 N-terminal domains TAND1 and TAND2 bound to yeast TBP, together with mutational data. We find that yeast TAF1-TAND1, which in itself acts as a transcriptional activator, binds TBP's concave DNA-binding surface by presenting similar anchor residues to TBP as does Mot1 but from a distinct structural scaffold. Furthermore, we show how TAF1-TAND2 uses an aromatic and acidic anchoring pattern to bind a conserved TBP surface groove traversing the basic helix region, and we find highly similar TBP-binding motifs also presented by the structurally distinct TFIIA, Mot1 and Brf1 proteins. Our identification of these anchoring patterns, which can be easily disrupted or enhanced, provides insight into the competitive multiprotein TBP interplay critical to transcriptional regulation.

  20. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  1. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  2. Decay accelerating factor (DAF) is anchored to membranes by a C-terminal glycolipid

    International Nuclear Information System (INIS)

    Medof, M.E.; Haas, R.; Walter, E.I.; Rosenberry, T.L.

    1986-01-01

    Purified 70 kDa membrane (m) DAF incorporates into cells when added in vitro. A 2 kDa smaller DAF form which functions extrinsically like C4bp but is unable to incorporate can be isolated from urine (u). Because of common deficits of mDAF and acetylcholinesterase (AChE) in erythrocytes (E) of patients with paroxysmal nocturnal hemoglobinuria (PNH), mDAF was analyzed for a O-terminal glycolipid membrane anchor similar to that in E AChE. Incubation of E with phosphatidylinositol-specific phospholipase C, an enzyme which cleaves a similar glycolipid anchor in trypanosome variant surface glycoproteins (mfVSGs), released 20% of the DAF antigen. The released DAF species resembled uDAF in size, extrinsic model of C4b2a decay, and lack of hydrophobicity. Reductive radiomethylation of mDAF with [ 14 C]HCHO and NaCNBH 3 revealed ethanolamine and glucosamine in proportions similar to those in the E AChE glycolipid anchor. Papain cleavage of radiomethylated mDAF released the labeled ethanolamine and glucosamine in small O-terminal fragments from the residual DAF that retained N-terminal Asp. Following labeling of the anchors of mDAF and E AChE with the lipophilic photoreagent 3-trifluoromethyl-3-(m-[ 125 I]iodophenyl)diazirine, cleavage at the glucosamine residue by deamination quantitatively released the label from both proteins. Biosynthetic labeling of Hela cells with [ 3 H]ethanolamine resulted in rapid 3 H incorporation into both 48 kDa proDAF and 70 kDa mDAF. These data indicate that mDAF is anchored by a glycolipid similar to that in E AChE, mfVSGs and Thy-1 antigen and raise the possibility that a defect in the assembly or attachment of this structure could account for the deficits of mDAF and E AChE in PNH

  3. Not all Anchors Weigh Equally.

    Science.gov (United States)

    Greenstein, Michael; Velazquez, Alexandra

    2017-11-01

    The anchoring bias is a reliable effect wherein a person's judgments are affected by initially presented information, but it is unknown specifically why this effect occurs. Research examining this bias suggests that elements of both numeric and semantic priming may be involved. To examine this, the present research used a phenomenon wherein people treat numeric information presented differently in Arabic numeral or verbal formats. We presented participants with one of many forms of an anchor that represented the same value (e.g., twelve hundred or 1,200). Thus, we could examine how a concept's meaning and its absolute numeric value affect anchoring. Experiments 1 and 2 showed that people respond to Arabic and verbal anchors differently. Experiment 3 showed that these differences occurred largely because people tend to think of numbers in digit format. This suggests that one's conceptual understanding of the anchored information matters more than its strict numeric value.

  4. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  5. Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

    DEFF Research Database (Denmark)

    Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

    1988-01-01

    Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

  6. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  7. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  8. SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat map and reveal synteny with model species.

    Directory of Open Access Journals (Sweden)

    Rebekah E Oliver

    Full Text Available A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42 has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources.

  9. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  10. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  11. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  12. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

  13. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  14. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  15. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  16. Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

    Directory of Open Access Journals (Sweden)

    A. Yu. Popova

    2015-01-01

    Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

  17. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  18. Biomechanical comparison of traditional anchors to all-suture anchors in a double-row rotator cuff repair cadaver model.

    Science.gov (United States)

    Goschka, Andrew M; Hafer, Jason S; Reynolds, Kirk A; Aberle, Nicholas S; Baldini, Todd H; Hawkins, Monica J; McCarty, Eric C

    2015-10-01

    To further reduce the invasiveness of arthroscopic rotator cuff repair surgery the all-suture anchor has been developed. The all-suture anchor requires less bone removal and reduces the potential of loose body complications. The all-suture anchor must also have adequate biomechanical strength for the repair to heal. The hypothesis is there is no significant difference in the biomechanical performance of supraspinatus repairs using an all-suture anchor when compared to traditional solid-body suture anchors. Using nine shoulders per group, the supraspinatus tendon was dissected from the greater tuberosity. The four different double row repairs tested were (medial row/lateral row): A: ICONIX2/ICONIX2; B: ICONIX2/Stryker ReelX 3.9mm; C: ICONIX2/Stryker ReelX 4.5mm; D: Arthrex BioComposite CorkScrew FT 4.5mm/Arthrex BioComposite SwiveLock 4.75mm. The ICONIX2 was the only all-suture anchor tested. Tendons underwent cyclic loading from 10 to 100N for 500 cycles, followed by load-to-failure. Data was collected at cycles 5, 100, 200, 300, 400, and 500. One-way ANOVA analysis was used to assess significance (P≤0.05). The anchor combinations tested did not differ significantly in anterior (P>0.4) or posterior (P>0.3) gap formation, construct stiffness (P>0.7), ultimate load (P=0.06), or load to 5mm gap formation (P=0.84). The all-suture anchor demonstrated comparable biomechanical performance in multiple double-row anchor combinations to a combination of traditional solid-body anchors. Thus it may be an attractive option to further reduce the invasiveness of rotator cuff repairs. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  20. Convenient synthesis and application of versatile nucleic acid lipid membrane anchors in the assembly and fusion of liposomes

    DEFF Research Database (Denmark)

    Ries, Oliver; Löffler, Philipp M. G.; Vogel, Stefan

    2015-01-01

    or the construction of DNA origami structures. We herein present the synthesis and applications of versatile lipid membrane anchor building blocks suitable for solid phase oligonucleotide synthesis. These are readily synthesized in bulk in five to seven steps from commercially available precursors and can...

  1. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Science.gov (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  2. Microgravity Drill and Anchor System

    Science.gov (United States)

    Parness, Aaron; Frost, Matthew A.; King, Jonathan P.

    2013-01-01

    This work is a method to drill into a rock surface regardless of the gravitational field or orientation. The required weight-on-bit (WOB) is supplied by a self-contained anchoring mechanism. The system includes a rotary percussive coring drill, forming a complete sampling instrument usable by robot or human. This method of in situ sample acquisition using micro - spine anchoring technology enables several NASA mission concepts not currently possible with existing technology, including sampling from consolidated rock on asteroids, providing a bolt network for astronauts visiting a near-Earth asteroid, and sampling from the ceilings or vertical walls of lava tubes and cliff faces on Mars. One of the most fundamental parameters of drilling is the WOB; essentially, the load applied to the bit that allows it to cut, creating a reaction force normal to the surface. In every drilling application, there is a minimum WOB that must be maintained for the system to function properly. In microgravity (asteroids and comets), even a small WOB could not be supported conventionally by the weight of the robot or astronaut. An anchoring mechanism would be needed to resist the reactions, or the robot or astronaut would push themselves off the surface and into space. The ability of the system to anchor itself to a surface creates potential applications that reach beyond use in low gravity. The use of these anchoring mechanisms as end effectors on climbing robots has the potential of vastly expanding the scope of what is considered accessible terrain. Further, because the drill is supported by its own anchor rather than by a robotic arm, the workspace is not constrained by the reach of such an arm. Yet, if the drill is on a robotic arm, it has the benefit of not reflecting the forces of drilling back to the arm s joints. Combining the drill with the anchoring feet will create a highly mobile, highly stable, and highly reliable system. The drilling system s anchor uses hundreds of

  3. Fragmentasi DNA Spermatozoa: Penyebab, Deteksi, dan Implikasinya pada Infertilitas Laki-Laki

    Directory of Open Access Journals (Sweden)

    Silvia W. Lestari

    2015-12-01

    Full Text Available Prediksi fertilitas laki-laki dapat dilakukan dengan analisis semen. Analisis semen konvensionalmerupakan pemeriksaan sederhana dan tidak mahal, tetapi memiliki variabilitas yang tinggi.Integritas DNA spermatozoa penting untuk transmisi informasi genetik. Fragmentasi DNAspermatozoa sebagai akibat gangguan spermatogenesis, maturasi spermatozoa, stres oksidatifdan infeksi, dapat menyebabkan infertilitas laki-laki, gangguan perkembangan embrio dan abortusberulang. Hubungan fragmentasi DNA spermatozoa dengan luaran teknologi reproduksi berbantu(TRB mengarahkan fragmentasi DNA spermatozoa sebagai pemeriksaan infertilitas laki-laki. Dariberbagai metode fragmentasi DNA spermatozoa yang umum dilakukan, sperm chromatin dispersion(SCD merupakan metode pemeriksaan fragmentasi DNA spermatozoa yang sederhana, akuratdan tidak mahal, sehingga dapat dilaksanakan di laboratorium andrologi. Selain menghasilkandiagnosis yang lebih baik, pemeriksaan fragmentasi DNA spermatozoa juga menggambarkanprognosis infertilitas termasuk luaran program TRB. Kata kunci: infertilitas laki-laki, fragmentasi DNA spermatozoa, SCD   Sperm DNA Fragmentation: Etiology, Detection and Implicationto Male Infertility Abstract The prediction of male fertility is determined by semen analysis. The conventional semenanalysis is simple and inexpensive but prone to variability. The integrity of sperm DNA is essentialfor the transmission of genetic information. Fragmentation of sperm DNA as result of disruptionin spermatogenesis and sperm maturation, oxidative stress, and infection may lead to maleinfertility, abnormal embryonic development and recurrent abortion. The association betweensperm DNA fragmentation and diminished reproductive outcomes has led to the introduction ofsperm DNA fragmentation testing on the clinical assessment of male infertility. Of all the spermDNA fragmentation tests, sperm chromatin dispersion (SCD test is quite simple, accurate, andinexpensive to be conducted on

  4. Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution

    Science.gov (United States)

    Soo, Oi Yoon Michelle; Tan, Wooi Boon; Lim, Lee Hong Susan

    2016-01-01

    Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae) species infecting two marine mugilid (Teleostei: Mugilidae) fish hosts: Moolgarda buchanani (Bleeker) and Liza subviridis (Valenciennes) from Malaysia. Anchor shape and size data (n = 530) were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams’s Kmult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogenean anchor geometric morphometric data with morphological and phylogenetic data. Results. We discriminated 12 of the 13 Ligophorus species using anchor shape data. Significant phylogenetic signal was detected in anchor shape. Thus, we discovered new morphological characters based on anchor shaft shape, the length between the inner root point and the outer root

  5. Cloning and characterization of BKV(MM) DNA and its use for detection of BKV DNA in human urine

    International Nuclear Information System (INIS)

    Harley, E.H.; Olliver, C.L.; Rhodes-Harrison, L.; Mew, R.T.; Lecatsas, G.; Naude, W. du T.

    1982-01-01

    The two fragments produced by restriction of BKV(MM) DNA with the endonucleases Pst I and Eco RI have been cloned separately into the vector pBR322 and amplified in E. coli HB101. Eight recombinant plasmids were characterized by gel electrophoresis of Pst I/Eco RI double digestions or Hind III digestions of the DNA and by hybridization of Southern gel blots to a nick-translated BKV(MM) DNA probe. Four of the recombinant plasmids contained the large Pst I/Eco RI BKV(MM) DNA fragment and four contained the small fragment. Two of these recombinant plasmids were then used to make a probe for the identification of BK DNA in a urine specimen from a patient known to be exreting particles with the morphological features of papovavirus [af

  6. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  7. The Holding Power of Anchors

    Indian Academy of Sciences (India)

    The efficiency of an anchor may be expressed as the ratio (holding force + weight of anchor). In dry sand .... the market at the beginning of the coming season in three sizes, namely 20, 35 and. 60 lb. These are ... Taylor frozen-flow hypothesis.

  8. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  9. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  10. AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

    Science.gov (United States)

    Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

    2017-11-14

    Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

  11. Visualization of DNA in highly processed botanical materials.

    Science.gov (United States)

    Lu, Zhengfei; Rubinsky, Maria; Babajanian, Silva; Zhang, Yanjun; Chang, Peter; Swanson, Gary

    2018-04-15

    DNA-based methods have been gaining recognition as a tool for botanical authentication in herbal medicine; however, their application in processed botanical materials is challenging due to the low quality and quantity of DNA left after extensive manufacturing processes. The low amount of DNA recovered from processed materials, especially extracts, is "invisible" by current technology, which has casted doubt on the presence of amplifiable botanical DNA. A method using adapter-ligation and PCR amplification was successfully applied to visualize the "invisible" DNA in botanical extracts. The size of the "invisible" DNA fragments in botanical extracts was around 20-220 bp compared to fragments of around 600 bp for the more easily visualized DNA in botanical powders. This technique is the first to allow characterization and visualization of small fragments of DNA in processed botanical materials and will provide key information to guide the development of appropriate DNA-based botanical authentication methods in the future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Science.gov (United States)

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  13. Anchoring effects on early autobiographical memories.

    Science.gov (United States)

    Greenberg, Daniel L; Bishara, Anthony J; Mugayar-Baldocchi, Marino A

    2017-10-01

    Studies of childhood memory typically show that our earliest memories come from between three and four years of age. This finding is not universal, however. The age estimate varies across cultures and is affected by social influences. Research from the judgments and decision-making literature suggests that these estimates might also involve a judgment under uncertainty. Therefore, they might be susceptible to less social influences such as heuristics and biases. To investigate this possibility, we conducted two experiments that used anchoring paradigms to influence participants' estimates of their age during early autobiographical memories. In Experiment 1, participants answered either a high-anchor or a low-anchor question, and were warned that the anchor was uninformative; they went on to estimate their age during their earliest autobiographical memory. In Experiment 2, we replicated Experiment 1 and extended the design to examine additional early autobiographical memories. In both experiments, participants in the low-anchor condition gave earlier age estimates than those in the high-anchor condition. These results provide new insights into the methods used to investigate autobiographical memory. Moreover, they show that reports of early autobiographical memories can be influenced by a relatively light touch - a change to a single digit in a single question.

  14. Fingerprinting and quantification of GMOs in the agro-food sector.

    Science.gov (United States)

    Taverniers, I; Van Bockstaele, E; De Loose, M

    2003-01-01

    Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

  15. An earth anchor system: installation and design guide.

    Science.gov (United States)

    R.L. Copstead; D.D. Studier

    1990-01-01

    A system for anchoring the guylines and skylines of cable yarding equipment is presented. A description of three types of tipping plate anchors is given. Descriptions of the installation equipment and methods specific to each type are given. Procedures for determining the correct number of anchors to install are included, as are guidelines for installing the anchors so...

  16. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  17. Sequence specificity of DNA cleavage by Micrococcus luteus γ endonuclease

    International Nuclear Information System (INIS)

    Hentosh, P.; Henner, W.D.; Reynolds, R.J.

    1985-01-01

    DNA fragments of defined sequence have been used to determine the sites of cleavage by γ-endonuclease activity in extracts prepared from Micrococcus luteus. End-labeled DNA restriction fragments of pBR322 DNA that had been irradiated under nitrogen in the presence of potassium iodide or t-butanol were treated with M. luteus γ endonuclease and analyzed on irradiated DNA preferentially at the positions of cytosines and thymines. DNA cleavage occurred immediately to the 3' side of pyrimidines in irradiated DNA and resulted in fragments that terminate in a 5'-phosphoryl group. These studies indicate that both altered cytosines and thymines may be important DNA lesions requiring repair after exposure to γ radiation

  18. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  19. Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

    NARCIS (Netherlands)

    Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

    1991-01-01

    Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

  20. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  1. Bacterial DNA in water and dialysate: detection and significance for patient outcomes.

    Science.gov (United States)

    Handelman, Garry J; Megdal, Peter A; Handelman, Samuel K

    2009-01-01

    The fluid used for hemodialysis may contain DNA fragments from bacteria, which could be harmful for patient outcomes. DNA fragments from bacteria, containing the nonmethylated CpG motif, can trigger inflammation through the monocyte and lymphocyte Toll-like receptor 9, and these DNA fragments have been observed in dialysate. The fragments may transfer across the dialyzer into the patient's bloodstream during hemodialysis treatment. During hemodiafiltration, the fragments would be introduced directly into the bloodstream. The DNA fragments may arise from biofilm in the pipes of the water system, from growth of bacteria in the water, or as contaminants in the bicarbonate and salt mixture used for preparation of dialysate. Current filtration methods, such as Diasafe filters, are not able to remove these fragments. It would be prudent to seek to reduce or eliminate these contaminants. However, the cost and effort of decreasing bacterial DNA content may ultimately require substantial facility improvements; we therefore need to fund research studies to determine if modifications to reduce bacterial DNA content are clinically warranted. This research will require methods to accurately determine the species of bacteria that contribute the DNA, since this information will allow the source to be established as biofilm, bicarbonate mixtures, or other problems in the dialysis system such as bacterial growth or leakage during water preparation. In this review, the evidence for bacterial DNA fragments will be examined and suggestions for further studies will be described.

  2. Improving performance by anchoring movement and "nerves".

    Science.gov (United States)

    Iso-Ahola, Seppo E; Dotson, Charles O; Jagodinsky, Adam E; Clark, Lily C; Smallwood, Lorraine L; Wilburn, Christopher; Weimar, Wendi H; Miller, Matthew W

    2016-10-01

    Golf's governing bodies' recent decision to ban all putting styles "anchoring one end of the club against the body" bridges an important practical problem with psychological theory. We report the first experiment testing whether anchoring provides technical and/or psychological advantage in competitive performance. Many "greats" of professional golf from Arnold Palmer and Jack Nicklaus to Tiger Woods have argued against anchoring, believing that it takes "nerves" out of competitive performance and therefore artificially levels the playing field. To shed more light on the issue, we tested participants' performance with anchored and unanchored putters under low and high pressure when controlling for the putter length. We found no statistically significant evidence for a technical advantage due to anchoring but a clear psychological advantage: participants who anchored their putters significantly outperformed unanchored counterparts under high, but not low, pressure. Results provide tentative evidence for the ban's justification from a competitive standpoint. However, before any definite conclusions can be made, more research is needed when using high-level golfers. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Testing and modeling of cyclically loaded rock anchors

    Directory of Open Access Journals (Sweden)

    Joar Tistel

    2017-12-01

    Full Text Available The Norwegian Public Roads Administration (NPRA is planning for an upgrade of the E39 highway route at the westcoast of Norway. Fixed links shall replace ferries at seven fjord crossings. Wide spans and large depths at the crossings combined with challenging subsea topography and environmental loads call for an extension of existing practice. A variety of bridge concepts are evaluated in the feasibility study. The structures will experience significant loads from deadweight, traffic and environment. Anchoring of these forces is thus one of the challenges met in the project. Large-size subsea rock anchors are considered a viable alternative. These can be used for anchoring of floating structures but also with the purpose of increasing capacity of fixed structures. This paper presents first a thorough study of factors affecting rock anchor bond capacity. Laboratory testing of rock anchors subjected to cyclic loading is thereafter presented. Finally, the paper presents a model predicting the capacity of a rock anchor segment, in terms of a ribbed bar, subjected to a cyclic load history. The research assumes a failure mode occurring in the interface between the rock anchor and the surrounding grout. The constitutive behavior of the bonding interface is investigated for anchors subjected to cyclic one-way tensile loads. The model utilizes the static bond capacity curve as a basis, defining the ultimate bond τbu and the slip s1 at τbu. A limited number of input parameters are required to apply the model. The model defines the bond-slip behavior with the belonging rock anchor capacity depending on the cyclic load level (τmax cy/τbu, the cyclic load ratio (R = τmin cy/τmax cy, and the number of load cycles (N. The constitutive model is intended to model short anchor lengths representing an incremental length of a complete rock anchor.

  4. DNA based radiological dosimetry technology

    International Nuclear Information System (INIS)

    Diaz Quijada, Gerardo A.; Roy, Emmanuel; Veres, Teodor; Dumoulin, Michel M.; Vachon, Caroline; Blagoeva, Rosita; Pierre, Martin

    2008-01-01

    Full text: The purpose of this project is to develop a personal and wearable dosimeter using a highly-innovative approach based on the specific recognition of DNA damage with a polymer hybrid. Our biosensor will be sensitive to breaks in nucleic acid macromolecules and relevant to mixed-field radiation. The dosimeter proposed will be small, field deployable and will sense damages for all radiation types at the DNA level. The generalized concept for the novel-based radiological dosimeter: 1) Single or double stranded oligonucleotide is immobilized on surface; 2) Single stranded has higher cross-section for fragmentation; 3) Double stranded is more biological relevant; 4) Radiation induces fragmentation; 5) Ultra-sensitive detection of fragments provides radiation dose. Successful efforts have been made towards a proof-of-concept personal wearable DNA-based dosimeter that is appropriate for mixed-field radiation. The covalent immobilization of oligonucleotides on large areas of plastic surfaces has been demonstrated and corroborated spectroscopically. The surface concentration of DNA was determined to be 8 x 1010 molecules/cm 2 from a Ce(IV) catalyzed hydrolysis study of a fluorescently labelled oligonucleotide. Current efforts are being directed at studying radiation induced fragmentation of DNA followed by its ultra-sensitive detection via a novel method. In addition, proof-of-concept wearable personal devices and a detection platform are presently being fabricated. (author)

  5. DNA polymerase beta participates in mitochondrial DNA repair

    DEFF Research Database (Denmark)

    Sykora, P; Kanno, S; Akbari, M

    2017-01-01

    We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

  6. Influence of Anchoring on Burial Depth of Submarine Pipelines.

    Science.gov (United States)

    Zhuang, Yuan; Li, Yang; Su, Wei

    2016-01-01

    Since the beginning of the twenty-first century, there has been widespread construction of submarine oil-gas transmission pipelines due to an increase in offshore oil exploration. Vessel anchoring operations are causing more damage to submarine pipelines due to shipping transportation also increasing. Therefore, it is essential that the influence of anchoring on the required burial depth of submarine pipelines is determined. In this paper, mathematical models for ordinary anchoring and emergency anchoring have been established to derive an anchor impact energy equation for each condition. The required effective burial depth for submarine pipelines has then been calculated via an energy absorption equation for the protection layer covering the submarine pipelines. Finally, the results of the model calculation have been verified by accident case analysis, and the impact of the anchoring height, anchoring water depth and the anchor weight on the required burial depth of submarine pipelines has been further analyzed.

  7. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  8. Ringstone anchors from Gujarat, west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Gaur, A.S.; Sundaresh; Tripati, S.; Bandodkar, S.N.

    of Dwarka and Somanath have yielded several ringstone anchors along with other stone anchors such as triangular and grapnel types. The raw material used for these ring stones comprises basalt, sandstone and limestone. Earlier, these anchors were identified...

  9. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  10. Spin selection at organic spinterface by anchoring group

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Zhao; Qiu, Shuai; Miao, Yuan-yuan; Ren, Jun-feng; Wang, Chuan-kui [School of Physics and Electronics, Shandong Normal University, Jinan 250014 (China); Hu, Gui-chao, E-mail: hgc@sdnu.edu.cn [School of Physics and Electronics, Shandong Normal University, Jinan 250014 (China); Institute of Theoretical Physics, Technische Universität Dresden, 01062 Dresden (Germany)

    2017-07-01

    Highlights: • The sign of interfacial spin polarization can be selected by using different anchoring groups. • A sp{sup 3}-d or sp-d hybridization may occur and induce spin polarization when the anchoring group changes. • Interfacial spin polarization depends on both the type of the outer orbital of the anchoring atom as well as its energy. - Abstract: Control of organic interfacial spin polarization is crucial in organic spintronics. Based on ab initio theory, here we proposed a spin selection at organic interface via anchoring group by adsorbing an organic molecule onto Ni(111) surface. The results demonstrate that either a positive or negative interfacial spin polarization may be obtained by choosing different anchoring groups. The orbital analysis via the projected density of states shows that the interfacial spin polarization is sensitive to the hybridization of the outer orbital of the anchoring atom as well as its energy relative to the d orbital of the ferromagnetic atom. The work indicates a feasible way to realize spin selection at the organic spinterface by anchoring group.

  11. Influence of Anchoring on Burial Depth of Submarine Pipelines.

    Directory of Open Access Journals (Sweden)

    Yuan Zhuang

    Full Text Available Since the beginning of the twenty-first century, there has been widespread construction of submarine oil-gas transmission pipelines due to an increase in offshore oil exploration. Vessel anchoring operations are causing more damage to submarine pipelines due to shipping transportation also increasing. Therefore, it is essential that the influence of anchoring on the required burial depth of submarine pipelines is determined. In this paper, mathematical models for ordinary anchoring and emergency anchoring have been established to derive an anchor impact energy equation for each condition. The required effective burial depth for submarine pipelines has then been calculated via an energy absorption equation for the protection layer covering the submarine pipelines. Finally, the results of the model calculation have been verified by accident case analysis, and the impact of the anchoring height, anchoring water depth and the anchor weight on the required burial depth of submarine pipelines has been further analyzed.

  12. Heat degradation of eukaryotic and bacterial DNA: an experimental model for paleomicrobiology

    Directory of Open Access Journals (Sweden)

    Nguyen-Hieu Tung

    2012-09-01

    Full Text Available Abstract Background Theoretical models suggest that DNA degradation would sharply limit the PCR-based detection of both eukaryotic and prokaryotic DNA within ancient specimens. However, the relative extent of decay of eukaryote and prokaryote DNA over time is a matter of debate. In this study, the murine macrophage cell line J774, alone or infected with Mycobacterium smegmatis bacteria, were killed after exposure to 90°C dry heat for intervals ranging from 1 to 48 h in order to compare eukaryotic cells, extracellular bacteria and intracellular bacteria. The sizes of the resulting mycobacterial rpoB and murine rpb2 homologous gene fragments were then determined by real-time PCR and fluorescent probing. Findings The cycle threshold (Ct values of PCR-amplified DNA fragments from J774 cells and the M. smegmatis negative controls (without heat exposure varied from 26–33 for the J774 rpb2 gene fragments and from 24–29 for M. smegmatis rpoB fragments. After 90°C dry heat incubation for up to 48 h, the Ct values of test samples increased relative to those of the controls for each amplicon size. For each dry heat exposure time, the Ct values of the 146-149-bp fragments were lower than those of 746-747-bp fragments. During the 4- to 24-h dry heat incubation, the non-infected J774 cell DNA was degraded into 597-bp rpb2 fragments. After 48 h, however, only 450-bp rpb2 fragments of both non-infected and infected J774 cells could be amplified. In contrast, the 746-bp rpoB fragments of M. smegmatis DNA could be amplified after the 48-h dry heat exposure in all experiments. Infected and non-infected J774 cell DNA was degraded more rapidly than M. smegmatis DNA after dry heat exposure (ANOVA test, p  Conclusion In this study, mycobacterial DNA was more resistant to dry-heat stress than eukaryotic DNA. Therefore, the detection of large, experimental, ancient mycobacterial DNA fragments is a suitable approach for paleomicrobiological studies.

  13. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)

    The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

  14. Membrane-assisted growth of DNA origami nanostructure arrays.

    Science.gov (United States)

    Kocabey, Samet; Kempter, Susanne; List, Jonathan; Xing, Yongzheng; Bae, Wooli; Schiffels, Daniel; Shih, William M; Simmel, Friedrich C; Liedl, Tim

    2015-01-01

    Biological membranes fulfill many important tasks within living organisms. In addition to separating cellular volumes, membranes confine the space available to membrane-associated proteins to two dimensions (2D), which greatly increases their probability to interact with each other and assemble into multiprotein complexes. We here employed two DNA origami structures functionalized with cholesterol moieties as membrane anchors--a three-layered rectangular block and a Y-shaped DNA structure--to mimic membrane-assisted assembly into hierarchical superstructures on supported lipid bilayers and small unilamellar vesicles. As designed, the DNA constructs adhered to the lipid bilayers mediated by the cholesterol anchors and diffused freely in 2D with diffusion coefficients depending on their size and number of cholesterol modifications. Different sets of multimerization oligonucleotides added to bilayer-bound origami block structures induced the growth of either linear polymers or two-dimensional lattices on the membrane. Y-shaped DNA origami structures associated into triskelion homotrimers and further assembled into weakly ordered arrays of hexagons and pentagons, which resembled the geometry of clathrin-coated pits. Our results demonstrate the potential to realize artificial self-assembling systems that mimic the hierarchical formation of polyhedral lattices on cytoplasmic membranes.

  15. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  16. Comparative gene expression in sexual and apomictic ovaries of Pennisetum ciliare (L.) Link.

    Science.gov (United States)

    Vielle-Calzada, J P; Nuccio, M L; Budiman, M A; Thomas, T L; Burson, B L; Hussey, M A; Wing, R A

    1996-12-01

    Limited emphasis has been given to the molecular study of apomixis, an asexual method of reproduction where seeds are produced without fertilization. Most buffelgrass (Pennisetum ciliare (L.) Link syn = Cenchrus ciliaris L.) genotypes reproduce by obligate apomixis (apospory); however, rare sexual plants have been recovered. A modified differential display procedure was used to compare gene expression in unpollinated ovaries containing ovules with either sexual or apomictic female gametophytes. The modification incorporated end-labeled poly(A)+ anchored primers as the only isotopic source, and was a reliable and consistent approach for detecting differentially displayed transcripts. Using 20 different decamers and two anchor primers, 2268 cDNA fragments between 200 and 600 bp were displayed. From these, eight reproducible differentially displayed cDNAs were identified and cloned. Based on northern analysis, one cDNA was detected in only the sexual ovaries, two cDNAs in only apomictic ovaries and one cDNA was present in both types of ovaries. Three fragments could not be detected and one fragment was detected in ovaries, stems, and leaves. Comparison of gene expression during sexual and apomictic development in buffelgrass represents a new model system and a strategy for investigating female reproductive development in the angiosperms.

  17. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  18. The Use of Comics-Based Cases in Anchored Instruction

    Science.gov (United States)

    Kneller, Matthew F.

    2009-01-01

    The primary purpose of this research was to understand how comics fulfill the role of anchor in an anchored instruction learning environment. Anchored instruction addresses the inert knowledge problem through the use of realistic multimedia stories, or "anchors," that embed a problem and the necessary data to solve it within the narrative. In the…

  19. Effects of accuracy motivation and anchoring on metacomprehension judgment and accuracy.

    Science.gov (United States)

    Zhao, Qin

    2012-01-01

    The current research investigates how accuracy motivation impacts anchoring and adjustment in metacomprehension judgment and how accuracy motivation and anchoring affect metacomprehension accuracy. Participants were randomly assigned to one of six conditions produced by the between-subjects factorial design involving accuracy motivation (incentive or no) and peer performance anchor (95%, 55%, or no). Two studies showed that accuracy motivation did not impact anchoring bias, but the adjustment-from-anchor process occurred. Accuracy incentive increased anchor-judgment gap for the 95% anchor but not for the 55% anchor, which induced less certainty about the direction of adjustment. The findings offer support to the integrative theory of anchoring. Additionally, the two studies revealed a "power struggle" between accuracy motivation and anchoring in influencing metacomprehension accuracy. Accuracy motivation could improve metacomprehension accuracy in spite of anchoring effect, but if anchoring effect is too strong, it could overpower the motivation effect. The implications of the findings were discussed.

  20. Dynamic performance of concrete undercut anchors for Nuclear Power Plants

    Energy Technology Data Exchange (ETDEWEB)

    Mahrenholtz, Christoph, E-mail: christoph@mahrenholtz.net; Eligehausen, Rolf

    2013-12-15

    Graphical abstract: - Highlights: • Behavior of undercut anchors under dynamic actions simulating earthquakes. • First high frequency load and crack cycling tests on installed concrete anchors ever. • Comprehensive review of anchor qualification for Nuclear Power Plants. - Abstract: Post-installed anchors are widely used for structural and nonstructural connections to concrete. In many countries, concrete anchors used for Nuclear Power Plants have to be qualified to ensure reliable behavior even under extreme conditions. The tests required for qualification of concrete anchors are carried out at quasi-static loading rates well below the rates to be expected for dynamic actions deriving from earthquakes, airplane impacts or explosions. To investigate potentially beneficial effects of high loading rates and cycling frequencies, performance tests on installed undercut anchors were conducted. After introductory notes on anchor technology and a comprehensive literature review, this paper discusses the qualification of anchors for Nuclear Power Plants and the testing carried out to quantify experimentally the effects of dynamic actions on the load–displacement behavior of undercut anchors.

  1. Homology of yeast photoreactivating gene fragment with human genomic digests

    International Nuclear Information System (INIS)

    Meechan, P.J.; Milam, K.M.; Cleaver, J.E.

    1984-01-01

    Enzymatic photoreactivation of UV-induced DNA lesions has been demonstrated for a variety of prokaryotic and eukaryotic organisms. Its presence in placental mammals, however, has not been clearly established. The authors attempted to resolve this question by assaying for the presence (or absence) of sequences in human DNA complimentary to a fragment of the photoreactivating gene from S. cerevisiae that has recently been cloned. In another study, DNA from human, chick E. coli and yeast cells was digested with either HindIII of BglII, electrophoresed on a 0.5% agarose gel, transferred (Southern blot) to a nylon membrane and probed for homology against a Sau3A restriction fragment from S. cerevisiae that compliments phr/sup -/ cells. Hybridization to human DNA digests was observed only under relatively non-stringent conditions indicating the gene is not conserved in placental mammals. These results are correlated with current literature data concerning photoreactivating enzymes

  2. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  3. Investigation of DNA double strand breaks induced by α particle and 7Li ions

    International Nuclear Information System (INIS)

    Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

    2006-01-01

    α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

  4. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  5. End-anchored polymers in good solvents from the single chain limit to high anchoring densities.

    Science.gov (United States)

    Whitmore, Mark D; Grest, Gary S; Douglas, Jack F; Kent, Michael S; Suo, Tongchuan

    2016-11-07

    An increasing number of applications utilize grafted polymer layers to alter the interfacial properties of solid substrates, motivating refinement in our theoretical understanding of such layers. To assess existing theoretical models of them, we have investigated end-anchored polymer layers over a wide range of grafting densities, σ, ranging from a single chain to high anchoring density limits, chain lengths ranging over two orders of magnitude, for very good and marginally good solvent conditions. We compare Monte Carlo and molecular dynamics simulations, numerical self-consistent field calculations, and experimental measurements of the average layer thickness, h, with renormalization group theory, the Alexander-de Gennes mushroom theory, and the classical brush theory. Our simulations clearly indicate that appreciable inter-chain interactions exist at all simulated areal anchoring densities so that there is no mushroom regime in which the layer thickness is independent of σ. Moreover, we find that there is no high coverage regime in which h follows the predicted scaling, h ∼ Nσ 1/3 , for classical polymer brushes either. Given that no completely adequate analytic theory seems to exist that spans wide ranges of N and σ, we applied scaling arguments for h as a function of a suitably defined reduced anchoring density, defined in terms of the solution radius of gyration of the polymer chains and N. We find that such a scaling approach enables a smooth, unified description of h in very good solvents over the full range of anchoring density and chain lengths, although this type of data reduction does not apply to marginal solvent quality conditions.

  6. DNA-DNA hybridization determined in micro-wells using covalent attachment of DNA

    DEFF Research Database (Denmark)

    Christensen, H.; Angen, Øystein; Mutters, R.

    2000-01-01

    The present study was aimed at reducing the time and labour used to perform DNA-DNA hybridizations for classification of bacteria at the species level. A micro-well-format DNA hybridization method was developed and validated. DNA extractions were performed by a small-scale method and DNA...... was sheared mechanically into fragments of between 400 and 700 bases. The hybridization conditions were calibrated according to DNA similarities obtained by the spectrophotometric method using strains within the family Pasteurellaceae, Optimal conditions were obtained with 300 ng DNA added per well and bound...... by covalent attachment to NucleoLink. Hybridization was performed with 500 ng DNA, 5% (w/w) of which was labelled with photo-activatable biotin (competitive hybridization) for 2.5 h at 65 degrees C in 2 x SSC followed by stringent washing with 2 x SSC at the same temperature. The criteria for acceptance...

  7. Studies on the mechanical behavior of rock anchors. ; Results of in-situ pull-out tests. Rock anchor no rikigaku kyodo ni kansuru kenkyu. ; Gen prime ichi shiken ni okeru anchor no kyodo

    Energy Technology Data Exchange (ETDEWEB)

    Arimoto, K.; Ebisu, S.; Nakagawa, M.; Usui, M.; Someya, T.; Machida, N. (Okumura Corp., Tokyo (Japan))

    1991-10-31

    The rock anchor method is planned to apply to some permanent structures but since this method was developed for temporary structures, the clarification of the transferring mechanism of force from an anchor to a rockmass, the fracture mechanism and the development of the dynamic model have not been established. This paper arranged the data obtained by a full-scale, in-situ pulling out test of a rock anchor as the first step to understand the dynamic behavior and analyzed by paying attetion to the modulus of deformation of the rockmass where the anchor was embedded to elucidate the affecting degree of rockmass modulus of deformation, the embedded length and the tendon diameter on the dynamic behavior of the anchor. The rock anchor behavior could be expressed accurately by applying a theoretical solution derived by the balancing condition of forces at the boundary face. Especially, when the rockmass is uniform and the fracture occurrs at the interface between the tendon and grout, this approach can express the fracture with the accuracy similar to that made by the finite element method. 6 refs., 11 figs.,1 tab.

  8. Cut-and-Paste of DNA Using an Artificial Restriction DNA Cutter

    Directory of Open Access Journals (Sweden)

    Makoto Komiyama

    2013-02-01

    Full Text Available DNA manipulations using a completely chemistry-based DNA cutter (ARCUT have been reviewed. This cutter, recently developed by the authors, is composed of Ce(IV/EDTA complex and two strands of pseudo-complementary peptide nucleic acid. The site-selective scission proceeds via hydrolysis of targeted phosphodiester linkages, so that the resultant scission fragments can be easily ligated with other fragments by using DNA ligase. Importantly, scission-site and site-specificity of the cutter are freely tuned in terms of the Watson–Crick rule. Thus, when one should like to manipulate DNA according to the need, he or she does not have to think about (1 whether appropriate “restriction enzyme sites” exist near the manipulation site and (2 whether the site-specificity of the restriction enzymes, if any, are sufficient to cut only the aimed position without chopping the DNA at non-targeted sites. Even the human genome can be manipulated, since ARCUT can cut the genome at only one predetermined site. Furthermore, the cutter is useful to promote homologous recombination in human cells, converting a site to desired sequence. The ARCUT-based DNA manipulation should be promising for versatile applications.

  9. Containment liner plate anchors and steel embedments test results

    International Nuclear Information System (INIS)

    Chang-Lo, P.L.; Johnson, T.E.; Pfeifer, B.W.

    1977-01-01

    This paper summarizes test data on shear load and deformation capabilities for liner plate line anchors and structural steel embedments in reinforced and prestressed concrete nuclear containments. Reinforced and prestressed nuclear containments designed and constructed in the United States are lined with a minimum of 0.64 cm steel plate. The liner plates are anchored by the use of either studs or structural members (line anchors) which usually run in the vertical direction. This paper will only address line anchors. Static load versus displacement test data is necessary to assure that the design is adequate for the maximum loads. The test program for the liner anchors had the following major objectives: determine load versus displacement data for a variety of anchors considering structural tees and small beams with different weld configurations, from the preceding tests, determine which anchors would lead to an economical and extremely safe design and test these anchors for cyclic loads resulting from thermal fluctuations. Various concrete embeds in the containment and other structures are subjected to loads such as pipe rupture which results in shear. Since many of the loads are transient by nature, it is necessary to know the load-displacement relationship so that the energy absorption can be determined. The test program for the embeds had the following objectives: determine load-displacement relationship for various size anchors from 6.5 cm 2 to 26 cm 2 with maximum capacities of approximately 650 kN; determine the effect of various anchor width-to-thickness ratios for the same shear area

  10. Dissecting fragment-based lead discovery at the von Hippel-Lindau protein:hypoxia inducible factor 1α protein-protein interface.

    Science.gov (United States)

    Van Molle, Inge; Thomann, Andreas; Buckley, Dennis L; So, Ernest C; Lang, Steffen; Crews, Craig M; Ciulli, Alessio

    2012-10-26

    Fragment screening is widely used to identify attractive starting points for drug design. However, its potential and limitations to assess the tractability of often challenging protein:protein interfaces have been underexplored. Here, we address this question by means of a systematic deconstruction of lead-like inhibitors of the pVHL:HIF-1α interaction into their component fragments. Using biophysical techniques commonly employed for screening, we could only detect binding of fragments that violate the Rule of Three, are more complex than those typically screened against classical druggable targets, and occupy two adjacent binding subsites at the interface rather than just one. Analyses based on ligand and group lipophilicity efficiency of anchored fragments were applied to dissect the individual subsites and probe for binding hot spots. The implications of our findings for targeting protein interfaces by fragment-based approaches are discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Modified Kidner procedure utilizing a Mitek bone anchor.

    Science.gov (United States)

    Dawson, D M; Julsrud, M E; Erdmann, B B; Jacobs, P M; Ringstrom, J B

    1998-01-01

    The recent development of small bone suture anchors has created several potential applications in reconstructive surgery of the foot. Mitek bone anchors are simple to insert, require less aggressive dissection and surgical time than reefing of the redundant posterior tibial tendon, and are a reliable method of tendon-to-bone fixation. Mitek bone anchors are an excellent technique for the treatment of redundant tibialis posterior tendon following a modified Kidner procedure. In modified Kidner procedures involving an excessively large os tibiale externum, Mitek anchoring of the redundant tibialis posterior tendon to the navicular bone is an excellent means for secure plication of the posterior tibial tendon in cases involving intraoperative tendon laxity. A description of the Mitek Anchor System and technique of application in a modified Kinder procedure is presented. The purpose of this study was to describe patient satisfaction and long-term clinical outcomes of the modified Kinder procedure with and without the Mitek bone anchoring system. A retrospective study of the modified Kinder procedure was performed with 13 patients being evaluated, seven with Mitek anchoring and six without. The University of Maryland 100-point Painful Foot Center Scoring System was modified to be more specific to the modified Kinder procedure for assessment of subjective long-term results. Patient overall satisfaction was rated good to excellent by 85.6% of patients in the Mitek group and by 100% of patients in the non-Mitek group. Use of the Mitek anchor allowed for quicker postoperative recovery to resumption of ambulation without assistive devices (average of 3 weeks vs. 4.42 weeks) and a quicker return to pain-free ambulation in normal shoegear (average of 4 weeks vs. 6 weeks). Mitek anchoring of the tibialis posterior tendon, theoretically, increases medial arch support as evidenced by 14% of the Mitek group and 67% of the non-Mitek group requiring postoperative orthotics.

  12. Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

    Science.gov (United States)

    Jorgez, Carolina J; Bischoff, Farideh Z

    2009-01-01

    Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

  13. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

    Science.gov (United States)

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

    2005-12-01

    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  14. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  16. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Editorial Commentary: All-Suture Anchors, Foam Blocks, and Biomechanical Testing.

    Science.gov (United States)

    Brand, Jefferson C

    2017-06-01

    Barber's biomechanical work is well known to Arthroscopy's readers as thorough, comprehensive, and inclusive of new designs as they become available. In "All-Suture Anchors: Biomechanical Analysis of Pullout Strength, Displacement, and Failure Mode," the latest iteration, Barber and Herbert test all-suture anchors in both porcine femurs and biphasic foam. While we await in vivo clinical trials that compare all-suture anchors to currently used anchors, Barber and Herbert have provided data to inform anchor choice, and using their biomechanical data at time zero from all-suture anchor trials in an animal model, we can determine the anchors' feasibility for human clinical investigations. Copyright © 2017 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  18. Performances of Different Fragment Sizes for Reduced Representation Bisulfite Sequencing in Pigs.

    Science.gov (United States)

    Yuan, Xiao-Long; Zhang, Zhe; Pan, Rong-Yang; Gao, Ning; Deng, Xi; Li, Bin; Zhang, Hao; Sangild, Per Torp; Li, Jia-Qi

    2017-01-01

    Reduced representation bisulfite sequencing (RRBS) has been widely used to profile genome-scale DNA methylation in mammalian genomes. However, the applications and technical performances of RRBS with different fragment sizes have not been systematically reported in pigs, which serve as one of the important biomedical models for humans. The aims of this study were to evaluate capacities of RRBS libraries with different fragment sizes to characterize the porcine genome. We found that the Msp I-digested segments between 40 and 220 bp harbored a high distribution peak at 74 bp, which were highly overlapped with the repetitive elements and might reduce the unique mapping alignment. The RRBS library of 110-220 bp fragment size had the highest unique mapping alignment and the lowest multiple alignment. The cost-effectiveness of the 40-110 bp, 110-220 bp and 40-220 bp fragment sizes might decrease when the dataset size was more than 70, 50 and 110 million reads for these three fragment sizes, respectively. Given a 50-million dataset size, the average sequencing depth of the detected CpG sites in the 110-220 bp fragment size appeared to be deeper than in the 40-110 bp and 40-220 bp fragment sizes, and these detected CpG sties differently located in gene- and CpG island-related regions. In this study, our results demonstrated that selections of fragment sizes could affect the numbers and sequencing depth of detected CpG sites as well as the cost-efficiency. No single solution of RRBS is optimal in all circumstances for investigating genome-scale DNA methylation. This work provides the useful knowledge on designing and executing RRBS for investigating the genome-wide DNA methylation in tissues from pigs.

  19. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    Science.gov (United States)

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  20. Immobilization and stretching of 5'-pyrene-terminated DNA on carbon film deposited on electron microscope grid.

    Science.gov (United States)

    Loukanov, Alexandre; Filipov, Chavdar; Lecheva, Marta; Emin, Saim

    2015-11-01

    The immobilization and stretching of randomly coiled DNA molecules on hydrophobic carbon film is a challenging microscopic technique, which possess various applications, especially for genome sequencing. In this report the pyrenyl nucleus is used as an anchor moiety to acquire higher affinity of double stranded DNA to the graphite surface. DNA and pyrene are joined through a linker composed of four aliphatic methylene groups. For the preparation of pyrene-terminated DNA a multifunctional phosphoramidite monomer compound was designed. It contains pyrenylbutoxy group as an anchor moiety for π-stacking attachment to the carbon film, 2-cyanoethyloxy, and diisopropylamino as coupling groups for conjugation to activated oligonucleotide chain or DNA molecule. This monomer derivative was suitable for incorporation into automated solid-phase DNA synthesis and was attached to the 5' terminus of the DNA chain through a phosphodiester linkage. The successful immobilization and stretching of pyrene-terminated DNA was demonstrated by conventional 100 kV transmission electron microscope. The microscopic analysis confirmed the stretched shape of the negatively charged nucleic acid pieces on the hydrophobic carbon film. © 2015 Wiley Periodicals, Inc.

  1. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  2. Origin of DNA in human serum and usefulness of serum as a material for DNA typing.

    Science.gov (United States)

    Takayama, T; Yamada, S; Watanabe, Y; Hirata, K; Nagai, A; Nakamura, I; Bunai, Y; Ohya, I

    2001-06-01

    The aims of this study were to clarify the origin of DNA in human serum and to investigate whether serum is a material available for DNA typing in routine forensic practice. Blood was donated from 10 healthy adult volunteers and stored for up to 8 days, at 4 degrees C and at room temperature. The serum DNA concentration at zero time was in the range of 5.6 to 21.8 ng/ml with a mean of 12.2+/-1.6 ng/ml. The concentrations increased with storage time. On agarose gel electrophoresis, all serum samples showed ladder patterns and the size of each band was an integer multiple of approximately 180 bp considered to be characteristic of apoptosis. DNA typing from DNA released by apoptosis was possible. Exact DNA typing of D1S80, HLA DQA1, PM, CSF1PO, TPOX, TH01 and vWA was possible for each sample. These results indicate that serum contains fragmented DNA derived from apoptosis of leukocytes, especially neutrophils, and that fragmented DNA is an appropriate material for DNA typing.

  3. Adsorption phenomena and anchoring energy in nematic liquid crystals

    CERN Document Server

    Barbero, Giovanni

    2005-01-01

    Despite the large quantity of phenomenological information concerning the bulk properties of nematic phase liquid crystals, little is understood about the origin of the surface energy, particularly the surface, interfacial, and anchoring properties of liquid crystals that affect the performance of liquid crystal devices. Self-contained and unique, Adsorption Phenomena and Anchoring Energy in Nematic Liquid Crystals provides an account of new and established results spanning three decades of research into the problems of anchoring energy and adsorption phenomena in liquid crystals.The book contains a detailed discussion of the origin and possible sources of anchoring energy in nematic liquid crystals, emphasizing the dielectric contribution to the anchoring energy in particular. Beginning with fundamental surface and anchoring properties of liquid crystals and the definition of the nematic phase, the authors explain how selective ion adsorption, dielectric energy density, thickness dependence, and bias voltage...

  4. Outcomes of the modified Brostrom procedure using suture anchors for chronic lateral ankle instability--a prospective, randomized comparison between single and double suture anchors.

    Science.gov (United States)

    Cho, Byung-Ki; Kim, Yong-Min; Kim, Dong-Soo; Choi, Eui-Sung; Shon, Hyun-Chul; Park, Kyoung-Jin

    2013-01-01

    The present prospective, randomized study was conducted to compare the clinical outcomes of the modified Brostrom procedure using single and double suture anchors for chronic lateral ankle instability. A total of 50 patients were followed up for more than 2 years after undergoing the modified Brostrom procedure. Of the 50 procedures, 25 each were performed using single and double suture anchors by 1 surgeon. The Karlsson scale had improved significantly to 89.8 points and 90.6 points in the single and double anchor groups, respectively. Using the Sefton grading system, 23 cases (92%) in the single anchor group and 22 (88%) in the double anchor group achieved satisfactory results. The talar tilt angle and anterior talar translation on stress radiographs using the Telos device had improved significantly to an average of 5.7° and 4.6 mm in the single anchor group and 4.5° and 4.3 mm in the double anchor group, respectively. The double anchor technique was superior with respect to the postoperative talar tilt. The single and double suture anchor techniques produced similar clinical and functional outcomes, with the exception of talar tilt as a reference of mechanical stability. The modified Brostrom procedure using both single and double suture anchors appears to be an effective treatment method for chronic lateral ankle instability. Copyright © 2013 American College of Foot and Ankle Surgeons. Published by Elsevier Inc. All rights reserved.

  5. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    Science.gov (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  6. The Y4-RNA fragment, a potential diagnostic marker, exists in saliva

    Directory of Open Access Journals (Sweden)

    Tatsuya Ishikawa

    2017-06-01

    Full Text Available The 94-nt full-length Y4-RNA is thought to have roles in the initiation of DNA replication and RNA quality control. Although its 31/32-nt fragment also exists abundantly in plasma, little is known about its physiological role. Since the 31/32-nt Y4-RNA fragment in sera is reported to be more abundant in patients with coronary artery disease than healthy persons, the fragment may have a potential for a diagnostic and/or prognostic biomarker for some diseases regardless of its functionality. As a step toward further investigation of its potential utility, we examined if the 31/32-nt Y4-RNA fragment also exists in saliva that can be obtained noninvasively, and showed that, in addition to the 31/32-nt fragment, 14- and 11-nt Y4-RNA fragments are present in all saliva RNA samples from four healthy persons. We established a PCR method to accurately quantitate the amount of the 31/32-nt Y4-RNA fragment, and estimated its amount in saliva of healthy persons to be 0.06 ± 0.04 fmol per nanogram of saliva RNA. We also tried to develop an easier quantitation method using a DNA molecular beacon. Keywords: Y4-RNA fragment, Saliva RNA, Diagnostic/prognostic marker, Next-generation sequencing, RT-PCR, Molecular beacon

  7. On some surprising statistical properties of a DNA fingerprinting technique called AFLP

    NARCIS (Netherlands)

    Gort, G.

    2010-01-01

    AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

  8. Understanding the low uptake of bone-anchored hearing aids: a review.

    Science.gov (United States)

    Powell, R; Wearden, A; Pardesi, S M; Green, K

    2017-03-01

    Bone-anchored hearing aids improve hearing for patients for whom conventional behind-the-ear aids are problematic. However, uptake of bone-anchored hearing aids is low and it is important to understand why this is the case. A narrative review was conducted. Studies examining why people accept or decline bone-anchored hearing aids and satisfaction levels of people with bone-anchored hearing aids were reviewed. Reasons for declining bone-anchored hearing aids included limited perceived benefits, concerns about surgery, aesthetic concerns and treatment cost. No studies providing in-depth analysis of the reasons for declining or accepting bone-anchored hearing aids were identified. Studies of patient satisfaction showed that most participants reported benefits with bone-anchored hearing aids. However, most studies used cross-sectional and/or retrospective designs and only included people with bone-anchored hearing aids. Important avenues for further research are in-depth qualitative research designed to fully understand the decision-making process for bone-anchored hearing aids and rigorous quantitative research comparing satisfaction of people who receive bone-anchored hearing aids with those who receive alternative (or no) treatments.

  9. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    Science.gov (United States)

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Career anchors and learning plan (part one

    Directory of Open Access Journals (Sweden)

    Daniela Brečko

    2006-12-01

    Full Text Available The article is divided into three parts. The first part concentrates on how important career is for an individual, organization and society. The author establishes that understanding of career has changed dramatically and does not only refer to climbing up the career ladder, but also moving off or even down the career ladder. The notion of career, as a lifelong and professional path, encompasses all aspects of human personality and their roles acquired through one's life. On basis of vast and longitudinal research, where the author has studied career anchors of individuals, it is the objective of the author to find out on basis of what grounds do the individuals decide to take certain directions in their careers and how learning contributes to such decisions. As a source the author has used Shein's theory of career anchors. Part one describes in greater detail 8 different career anchors and introduces their main features with the findings of the research, which refer to the analysis of professions (work positions and established career anchors. The author thus verifies the hypothesis that career anchors do exist in our area.

  11. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  12. Self-tapping ability of carbon fibre reinforced polyetheretherketone suture anchors.

    Science.gov (United States)

    Feerick, Emer M; Wilson, Joanne; Jarman-Smith, Marcus; Ó'Brádaigh, Conchur M; McGarry, J Patrick

    2014-10-01

    An experimental and computational investigation of the self-tapping ability of carbon fibre reinforced polyetheretherketone (CFR-PEEK) has been conducted. Six CFR-PEEK suture anchor designs were investigated using PEEK-OPTIMA® Reinforced, a medical grade of CFR-PEEK. Experimental tests were conducted to investigate the maximum axial force and torque required for self-taping insertion of each anchor design. Additional experimental tests were conducted for some anchor designs using pilot holes. Computational simulations were conducted to determine the maximum stress in each anchor design at various stages of insertion. Simulations also were performed to investigate the effect of wall thickness in the anchor head. The maximum axial force required to insert a self-tapping CFR-PEEK suture anchor did not exceed 150 N for any anchor design. The maximum torque required to insert a self-tapping CFR-PEEK suture anchor did not exceed 0.8 Nm. Computational simulations reveal significant stress concentrations in the region of the anchor tip, demonstrating that a re-design of the tip geometry should be performed to avoid fracture during self-tapping, as observed in the experimental component of this study. This study demonstrates the ability of PEEK-OPTIMA Reinforced suture anchors to self-tap polyurethane foam bone analogue. This provides motivation to further investigate the self-tapping ability of CFR-PEEK suture anchors in animal/cadaveric bone. An optimised design for CFR-PEEK suture anchors offers the advantages of radiolucency, and mechanical properties similar to bone with the ability to self-tap. This may have positive implications for reducing surgery times and the associated costs with the procedure. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  13. Career anchors and values from different career management perspectives

    Directory of Open Access Journals (Sweden)

    Rodrigo Cunha da Silva

    2016-06-01

    Full Text Available Purpose – To analyze the relationships between career anchors and young Generation Y professionals’ values, from the career concept perspective. Design/methodology/approach – Research concerning the proposed objective was carried out through quantitative research involving 189 Business Administration majors from a Catholic university in São Paulo, Brazil. We used two instruments to identify the career anchors and values of respondents: Schein (1990 and Schwartz (1994, respectively. We used statistical techniques to explore the relationships between career anchors and values. Findings – Among the results, mention should be made to the statistical relationships found between analyzed career anchors and values. It is also important to stress that, although the Lifestyle career anchor was predominantly present in the conglomerate division, this anchor was the predominant characteristic in the differentiation of the smaller group of respondents, the new career group. The General Management Career Anchor, which presents a lower incidence, is the predominant characteristic of the larger group, referring to organizational careers. As well as the Lifestyle career anchor, the Hedonism value was predominant among respondents. Originality/value – The need to consider the following was found: Generation Y presents generational characteristics that drive people management to propose work structures that offer activities to generate learning, pleasure, self-fulfillment and conciliation between work and personal life.

  14. Test Score Equating Using Discrete Anchor Items versus Passage-Based Anchor Items: A Case Study Using "SAT"® Data. Research Report. ETS RR-14-14

    Science.gov (United States)

    Liu, Jinghua; Zu, Jiyun; Curley, Edward; Carey, Jill

    2014-01-01

    The purpose of this study is to investigate the impact of discrete anchor items versus passage-based anchor items on observed score equating using empirical data.This study compares an "SAT"® critical reading anchor that contains more discrete items proportionally, compared to the total tests to be equated, to another anchor that…

  15. Cell wall-anchored nuclease of Streptococcus sanguinis contributes to escape from neutrophil extracellular trap-mediated bacteriocidal activity.

    Directory of Open Access Journals (Sweden)

    Chisato Morita

    Full Text Available Streptococcus sanguinis, a member of the commensal mitis group of streptococci, is a primary colonizer of the tooth surface, and has been implicated in infectious complications including bacteremia and infective endocarditis. During disease progression, S. sanguinis may utilize various cell surface molecules to evade the host immune system to survive in blood. In the present study, we discovered a novel cell surface nuclease with a cell-wall anchor domain, termed SWAN (streptococcal wall-anchored nuclease, and investigated its contribution to bacterial resistance against the bacteriocidal activity of neutrophil extracellular traps (NETs. Recombinant SWAN protein (rSWAN digested multiple forms of DNA including NET DNA and human RNA, which required both Mg(2+ and Ca(2+ for optimum activity. Furthermore, DNase activity of S. sanguinis was detected around growing colonies on agar plates containing DNA. In-frame deletion of the swan gene mostly reduced that activity. These findings indicated that SWAN is a major nuclease displayed on the surface, which was further confirmed by immuno-detection of SWAN in the cell wall fraction. The sensitivity of S. sanguinis to NET killing was reduced by swan gene deletion. Moreover, heterologous expression of the swan gene rendered a Lactococcus lactis strain more resistant to NET killing. Our results suggest that the SWAN nuclease on the bacterial surface contributes to survival in the potential situation of S. sanguinis encountering NETs during the course of disease progression.

  16. Cell wall-anchored nuclease of Streptococcus sanguinis contributes to escape from neutrophil extracellular trap-mediated bacteriocidal activity.

    Science.gov (United States)

    Morita, Chisato; Sumioka, Ryuichi; Nakata, Masanobu; Okahashi, Nobuo; Wada, Satoshi; Yamashiro, Takashi; Hayashi, Mikako; Hamada, Shigeyuki; Sumitomo, Tomoko; Kawabata, Shigetada

    2014-01-01

    Streptococcus sanguinis, a member of the commensal mitis group of streptococci, is a primary colonizer of the tooth surface, and has been implicated in infectious complications including bacteremia and infective endocarditis. During disease progression, S. sanguinis may utilize various cell surface molecules to evade the host immune system to survive in blood. In the present study, we discovered a novel cell surface nuclease with a cell-wall anchor domain, termed SWAN (streptococcal wall-anchored nuclease), and investigated its contribution to bacterial resistance against the bacteriocidal activity of neutrophil extracellular traps (NETs). Recombinant SWAN protein (rSWAN) digested multiple forms of DNA including NET DNA and human RNA, which required both Mg(2+) and Ca(2+) for optimum activity. Furthermore, DNase activity of S. sanguinis was detected around growing colonies on agar plates containing DNA. In-frame deletion of the swan gene mostly reduced that activity. These findings indicated that SWAN is a major nuclease displayed on the surface, which was further confirmed by immuno-detection of SWAN in the cell wall fraction. The sensitivity of S. sanguinis to NET killing was reduced by swan gene deletion. Moreover, heterologous expression of the swan gene rendered a Lactococcus lactis strain more resistant to NET killing. Our results suggest that the SWAN nuclease on the bacterial surface contributes to survival in the potential situation of S. sanguinis encountering NETs during the course of disease progression.

  17. On Moderator Detection in Anchoring Research: Implications of Ignoring Estimate Direction

    Directory of Open Access Journals (Sweden)

    Nathan N. Cheek

    2018-05-01

    Full Text Available Anchoring, whereby judgments assimilate to previously considered standards, is one of the most reliable effects in psychology. In the last decade, researchers have become increasingly interested in identifying moderators of anchoring effects. We argue that a drawback of traditional moderator analyses in the standard anchoring paradigm is that they ignore estimate direction—whether participants’ estimates are higher or lower than the anchor value. We suggest that failing to consider estimate direction can sometimes obscure moderation in anchoring tasks, and discuss three potential analytic solutions that take estimate direction into account. Understanding moderators of anchoring effects is essential for a basic understanding of anchoring and for applied research on reducing the influence of anchoring in real-world judgments. Considering estimate direction reduces the risk of failing to detect moderation.

  18. Effect of Cisplatin on the Flexibility of Linear DNA

    International Nuclear Information System (INIS)

    Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye

    2011-01-01

    With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)

  19. Targeting Ligandable Pockets on Plant Homeodomain (PHD) Zinc Finger Domains by a Fragment-Based Approach.

    Science.gov (United States)

    Amato, Anastasia; Lucas, Xavier; Bortoluzzi, Alessio; Wright, David; Ciulli, Alessio

    2018-04-20

    Plant homeodomain (PHD) zinc fingers are histone reader domains that are often associated with human diseases. Despite this, they constitute a poorly targeted class of readers, suggesting low ligandability. Here, we describe a successful fragment-based campaign targeting PHD fingers from the proteins BAZ2A and BAZ2B as model systems. We validated a pool of in silico fragments both biophysically and structurally and solved the first crystal structures of PHD zinc fingers in complex with fragments bound to an anchoring pocket at the histone binding site. The best-validated hits were found to displace a histone H3 tail peptide in competition assays. This work identifies new chemical scaffolds that provide suitable starting points for future ligand optimization using structure-guided approaches. The demonstrated ligandability of the PHD reader domains could pave the way for the development of chemical probes to drug this family of epigenetic readers.

  20. Monoclonal antibody to the rat glucocorticoid receptor. Relationship between the immunoreactive and DNA-binding domain

    International Nuclear Information System (INIS)

    Eisen, L.P.; Reichman, M.E.; Thompson, E.B.; Gametchu, B.; Harrison, R.W.; Eisen, H.J.

    1985-01-01

    The region of the glucocorticoid receptor that reacted with a monoclonal antibody (BUGR-1) was identified. In order to identify the immunoreactive region, the rat liver glucocorticoid receptor was subjected to limited proteolysis; immunoreactive fragments were identified by Western blotting. The monoclonal antibody reacted with both the undigested Mr approximately 97,000 receptor subunit and a Mr approximately 45,000 fragment containing the steroid-binding and DNA-binding domains. Digestion by trypsin also produced two steroid-binding fragments of Mr approximately 27,000 and 31,000 which did not react with the antibody and an immunoreactive Mr approximately 16,000 fragment. This Mr approximately 16,000 fragment was shown to bind to DNA-cellulose, indicating that it contained a DNA-binding domain of the receptor. The undigested receptor must have steroid associated with it to undergo activation to a DNA-binding form. However, the Mr approximately 16,000 immunoreactive fragment binds to DNA-cellulose even if it is obtained by digestion of the steroid-free holoreceptor which does not itself bind to DNA

  1. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  2. Structure solution of DNA-binding proteins and complexes with ARCIMBOLDO libraries

    Energy Technology Data Exchange (ETDEWEB)

    Pröpper, Kevin [University of Göttingen, (Germany); Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Meindl, Kathrin; Sammito, Massimo [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Dittrich, Birger; Sheldrick, George M. [University of Göttingen, (Germany); Pohl, Ehmke, E-mail: ehmke.pohl@durham.ac.uk [Durham University, (United Kingdom); Usón, Isabel, E-mail: ehmke.pohl@durham.ac.uk [Instituto de Biologia Molecular de Barcelona (IBMB-CSIC), (Spain); Institucio Catalana de Recerca i Estudis Avancats (ICREA), (Spain); University of Göttingen, (Germany)

    2014-06-01

    The structure solution of DNA-binding protein structures and complexes based on the combination of location of DNA-binding protein motif fragments with density modification in a multi-solution frame is described. Protein–DNA interactions play a major role in all aspects of genetic activity within an organism, such as transcription, packaging, rearrangement, replication and repair. The molecular detail of protein–DNA interactions can be best visualized through crystallography, and structures emphasizing insight into the principles of binding and base-sequence recognition are essential to understanding the subtleties of the underlying mechanisms. An increasing number of high-quality DNA-binding protein structure determinations have been witnessed despite the fact that the crystallographic particularities of nucleic acids tend to pose specific challenges to methods primarily developed for proteins. Crystallographic structure solution of protein–DNA complexes therefore remains a challenging area that is in need of optimized experimental and computational methods. The potential of the structure-solution program ARCIMBOLDO for the solution of protein–DNA complexes has therefore been assessed. The method is based on the combination of locating small, very accurate fragments using the program Phaser and density modification with the program SHELXE. Whereas for typical proteins main-chain α-helices provide the ideal, almost ubiquitous, small fragments to start searches, in the case of DNA complexes the binding motifs and DNA double helix constitute suitable search fragments. The aim of this work is to provide an effective library of search fragments as well as to determine the optimal ARCIMBOLDO strategy for the solution of this class of structures.

  3. Comparative Study on Different Slot Forms of Prestressed Anchor Blocks

    Science.gov (United States)

    Fan, Rong; Si, Jianhui; Jian, Zheng

    2018-03-01

    In this paper, two models of prestressed pier, rectangular cavity anchor block and arch hollow anchor block are established. The ABAQUS software was used to calculate the stress of the surface of the neck of the pier and the cavity of the anchor block, through comparative analysis. The results show that compared with the rectangular cavity anchor block, the stress of the pier and the cavity can be effectively reduced when the arch hole is used, and the amount of prestressed anchor can be reduced, so as to obtain obvious economic benefits.

  4. Influence of DNA conformation on radiation-induced single-strand breaks

    International Nuclear Information System (INIS)

    Barone, F.; Belli, M.; Mazzei, F.

    1994-01-01

    We performed experiments on two DNA fragments of about 300 bp having different conformation to test whether radiation-induced single-strand breakage is dependent on DNA conformation. Breakage analysis was carried out by denaturing polyacrylamide gel electrophoresis, which allows determination of the broken site at single nucleotide resolution. We found uniform cutting patterns in B-form regions. On the contrary, X- or γ-irradiation of curved fragments of kinetoplast DNA showed that the distribution of single-strand breaks was not uniform along the fragment, as the cleavage pattern was modulated in phase with the runs of A-T pairs. This modulation likely reflected the reduced accessibility of the sites which on hydroxyl-radical attack give rise to strand breaks. The cleavage pattern was phased with the runs of A-T pairs. Moreover, the overall yield of strand breaks was considerably lower in curved DNA fragments than in those with extended straight regions. The conformation effect found here indicates that the cleavage pattern reflects the fine structural features of DNA. (orig./MG)

  5. Biased calculations: Numeric anchors influence answers to math equations

    Directory of Open Access Journals (Sweden)

    Andrew R. Smith

    2011-02-01

    Full Text Available People must often perform calculations in order to produce a numeric estimate (e.g., a grocery-store shopper estimating the total price of his or her shopping cart contents. The current studies were designed to test whether estimates based on calculations are influenced by comparisons with irrelevant anchors. Previous research has demonstrated that estimates across a wide range of contexts assimilate toward anchors, but none has examined estimates based on calculations. In two studies, we had participants compare the answers to math problems with anchors. In both studies, participants' estimates assimilated toward the anchor values. This effect was moderated by time limit such that the anchoring effects were larger when the participants' ability to engage in calculations was limited by a restrictive time limit.

  6. DNA hybridization sensing for cytogenetic analysis

    DEFF Research Database (Denmark)

    Kwasny, Dorota; Dapra, Johannes; Brøgger, Anna Line

    2013-01-01

    are rearrangements between two chromosome arms that results in two derivative chromosomes having a mixed DNA sequence. The current detection method is a Fluorescent In situ Hybridization, which requires a use of expensive, fluorescently labeled probes that target the DNA sequences of two chromosomes involved...... in the translocation (Kwasny et al., 2012). We have developed a new double hybridization assay that allows for sorting of the DNA chromosomal fragments into separate compartment, moreover allowing for detection of the translocation. To detect the translocation it is necessary to determine that the two DNA sequences...... forming a derivative chromosome are connected, which is achieved by two subsequent hybridization steps. The first example of the translocation detection was presented on lab-on-a-disc using fluorescently labeled DNA fragments, representing the derivative chromosome (Brøgger et al., 2012). To allow...

  7. Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

    DEFF Research Database (Denmark)

    Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

    1988-01-01

    Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

  8. Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.

    Science.gov (United States)

    Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko

    2016-01-01

    The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for

  9. In silico fragment-based drug discovery: setup and validation of a fragment-to-lead computational protocol using S4MPLE.

    Science.gov (United States)

    Hoffer, Laurent; Renaud, Jean-Paul; Horvath, Dragos

    2013-04-22

    This paper describes the use and validation of S4MPLE in Fragment-Based Drug Design (FBDD)--a strategy to build drug-like ligands starting from small compounds called fragments. S4MPLE is a conformational sampling tool based on a hybrid genetic algorithm that is able to simulate one (conformer enumeration) or more molecules (docking). The goal of the current paper is to show that due to the judicious design of genetic operators, S4MPLE may be used without any specific adaptation as an in silico FBDD tool. Such fragment-to-lead evolution involves either growing of one or linking of several fragment-like binder(s). The native ability to specifically "dock" a substructure that is covalently anchored to its target (here, some prepositioned fragment formally part of the binding site) enables it to act like dedicated de novo builders and differentiates it from most classical docking tools, which may only cope with non-covalent interactions. Besides, S4MPLE may address growing/linking scenarios involving protein site flexibility, and it might also suggest "growth" moves by bridging the ligand to the site via water-mediated interactions if H2O molecules are simply appended to the input files. Therefore, the only development overhead required to build a virtual fragment→ligand growing/linking strategy based on S4MPLE were two chemoinformatics programs meant to provide a minimalistic management of the linker library. The first creates a duplicate-free library by fragmenting a compound database, whereas the second builds new compounds, attaching chemically compatible linkers to the starting fragments. S4MPLE is subsequently used to probe the optimal placement of the linkers within the binding site, with initial restraints on atoms from initial fragments, followed by an optimization of all kept poses after restraint removal. Ranking is mainly based on two criteria: force-field potential energy and RMSD shifts of the original fragment moieties. This strategy was applied to

  10. 76 FR 30301 - Commercial Acquisition; Anchor Tenancy

    Science.gov (United States)

    2011-05-25

    ... NATIONAL AERONAUTICS AND SPACE ADMINISTRATION 48 CFR Part 1812 RIN 2700-AD64 Commercial... consistent with NASA's authority under Section 401 of the Commercial Space Competitiveness Act (CSCA) of 1992. NASA may enter into multi-year anchor tenancy contracts for commercial space goods or services. Anchor...

  11. Gene prediction in metagenomic fragments: A large scale machine learning approach

    Directory of Open Access Journals (Sweden)

    Morgenstern Burkhard

    2008-04-01

    Full Text Available Abstract Background Metagenomics is an approach to the characterization of microbial genomes via the direct isolation of genomic sequences from the environment without prior cultivation. The amount of metagenomic sequence data is growing fast while computational methods for metagenome analysis are still in their infancy. In contrast to genomic sequences of single species, which can usually be assembled and analyzed by many available methods, a large proportion of metagenome data remains as unassembled anonymous sequencing reads. One of the aims of all metagenomic sequencing projects is the identification of novel genes. Short length, for example, Sanger sequencing yields on average 700 bp fragments, and unknown phylogenetic origin of most fragments require approaches to gene prediction that are different from the currently available methods for genomes of single species. In particular, the large size of metagenomic samples requires fast and accurate methods with small numbers of false positive predictions. Results We introduce a novel gene prediction algorithm for metagenomic fragments based on a two-stage machine learning approach. In the first stage, we use linear discriminants for monocodon usage, dicodon usage and translation initiation sites to extract features from DNA sequences. In the second stage, an artificial neural network combines these features with open reading frame length and fragment GC-content to compute the probability that this open reading frame encodes a protein. This probability is used for the classification and scoring of gene candidates. With large scale training, our method provides fast single fragment predictions with good sensitivity and specificity on artificially fragmented genomic DNA. Additionally, this method is able to predict translation initiation sites accurately and distinguishes complete from incomplete genes with high reliability. Conclusion Large scale machine learning methods are well-suited for gene

  12. A comparison of lateral ankle ligament suture anchor strength.

    Science.gov (United States)

    Barber, F Alan; Herbert, Morley A; Crates, John M

    2013-06-01

    Lateral ankle ligament repairs increasingly use suture anchors instead of bone tunnels. Our purpose was to compare the biomechanical properties of a knotted and knotless suture anchor appropriate for a lateral ankle ligament reconstruction. In porcine distal fibulae, 10 samples of 2 different PEEK anchors were inserted. The attached sutures were cyclically loaded between 10N and 60N for 200 cycles. A destructive pull was performed and failure loads, cyclic displacement, stiffness, and failure mode recorded. PushLock 2.5 anchors failed before 200 cycles. PushLock 100 cycle displacement was less than Morphix 2.5 displacement (panchors completing 200 cycles was 86.5N (PushLock) and 252.1N (Morphix) (panchor breaking and suture breakage. The knotted Morphix demonstrated more displacement and greater failure strength than the knotless PushLock. The PushLock failed consistently with suture breaking. The Morphix anchor failed both by anchor breaking and by suture breaking. Copyright © 2012 European Foot and Ankle Society. Published by Elsevier Ltd. All rights reserved.

  13. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  14. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  15. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  16. Trapping and breaking of in vivo nicked DNA during pulsed-field gel electrophoresis

    Science.gov (United States)

    Khan, Sharik R.; Kuzminov, Andrei

    2013-01-01

    Pulsed field gel electrophoresis (PFGE) offers a high-resolution approach to quantify chromosomal fragmentation in bacteria, measured as percent of chromosomal DNA entering the gel. The degree of separation in PFG depends upon the size of DNA, as well as various conditions of electrophoresis, such as electric field strength (FS), time of electrophoresis, switch time and buffer composition. Here we describe a new parameter, the structural integrity of the sample DNA itself, that influences its migration through PFGs. We show that sub-chromosomal fragments containing both spontaneous and DNA damage-induced nicks are prone to breakage during PFGE. Such breakage at single strand interruptions results in artefactual decrease in molecular weight of linear DNA making accurate determination of the number of double strand breaks difficult. While breakage of nicked sub-chromosomal fragments is FS-independent, some high molecular weight sub-chromosomal fragments are also trapped within wells under the standard PFGE conditions. This trapping can be minimized by lowering the field strength and increasing the time of electrophoresis. We discuss how breakage of nicked DNA may be mechanistically linked to trapping. Our results suggest how to optimize conditions for PFGE when quantifying chromosomal fragmentation induced by DNA damage. PMID:23770235

  17. Studies on DNA damage: discordant responses of rate of DNA disentanglement (viscosimetrically evaluated) and alkaline elution rate, obtained for several compounds. Possible explanations of the discrepancies.

    Science.gov (United States)

    Parodi, S; Balbi, C; Abelmoschi, M L; Pala, M; Russo, P; Santi, L

    1983-12-01

    Alkaline elution is a well-known method for detecting DNA damage. Recently we have developed a viscosimetric method that is even more sensitive than alkaline elution. Here we report that the two methods, although apparently both revealing alkaline DNA fragmentation, can give dramatically different results for a significant series of compounds. We suspect that alkaline elution might reveal not only DNA fragmentation but also the extent of disentanglement of chromatin structure, whereas this DNA disentanglement rate, when evaluated viscosimetrically , is more strictly correlated with the initiation of DNA unwinding.

  18. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  19. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.

    Science.gov (United States)

    Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A

    2016-06-01

    Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.

  20. Monolayer Assemblies of a De Novo Designed 4-alpha-Helix Bundle Carboprotein and Its Sulfur Anchor Fragment on Au(111) Surfaces Addressed by Voltammetry and In Situ Scanning Tunneling Microscopy

    DEFF Research Database (Denmark)

    Brask, Jesper; Wackerbarth, Hainer; Jensen, Knud J.

    2003-01-01

    carboprotein without thiol anchor have been prepared and investigated for comparison. Cyclic and differential pulse voltammetry (DPV) of the proteins show desorption peaks around -750 mV (SCE), whereas the thiol anchor desorption peak is at -685 mV. The peaks are by far the highest for thiol monomeric 4-R...

  1. Post-installed concrete anchors in nuclear power plants: Performance and qualification

    International Nuclear Information System (INIS)

    Mahrenholtz, Philipp; Eligehausen, Rolf

    2015-01-01

    Graphical abstract: - Highlights: • Review of qualification and design regulations for anchors in nuclear power plants. • First complete set of nuclear anchor load–displacement data and its evaluation ever. • Demonstration of robust test behavior of a qualified post-installed anchor product. - Abstract: In nuclear power plants (NPPs), post-installed anchors are widely used for structural and non-structural connections to concrete. In many countries, anchor products employed for safety relevant applications have to be approved by the authorities. For the high safety standards in force for NPPs, special requirements have to be met to allow for extreme design situations. This paper presents an experimental test program conducted to evaluate the performance of anchors according to the German Guideline for Anchorages in Nuclear Power Plants and Nuclear Technology Installations (DIBt KKW Leitfaden, 2010). After a brief introduction to anchor behavior and the regulative context, the results of tension and shear tests carried out on undercut anchors are discussed. Robust load capacities and relatively small displacements determined for demanding load and crack cycling tests demonstrated the suitability of anchors qualified according to a state-of-the-art qualification guideline

  2. 利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

    Institute of Scientific and Technical Information of China (English)

    范惠玲; 白生文; 李华清; 孙万仓

    2016-01-01

    Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系,也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官,并分离与自交亲和性有关的 cDNA 片段,以芸芥的一对近等基因系,自交亲和系(SC)与自交不亲和系(SI)为试材,利用差异显示 RT-PCR

  3. Anchorage Behaviors of Frictional Tieback Anchors in Silty Sand

    Science.gov (United States)

    Hsu, Shih-Tsung; Hsiao, Wen-Ta; Chen, Ke-Ting; Hu, Wen-Chi; Wu, Ssu-Yi

    2017-06-01

    Soil anchors are extensively used in geotechnical applications, most commonly serve as tieback walls in deep excavations. To investigate the anchorage mechanisms of this tieback anchor, a constitutive model that considers both strain hardening and softening and volume dilatancy entitled SHASOVOD model, and FLAC3D software are used to perform 3-D numerical analyses. The results from field anchor tests are compared with those calculated by numerical analyses to enhance the applicability of the numerical method. After the calibration, this research carried out the parameter studies by numerical analyses. The numerical results reveal that whether the yield of soil around an anchor develops to ground surface and/or touches the diaphragm wall depending on the overburden depth H and the embedded depth Z of an anchor, this study suggests the minimum overburden and embedded depths to avoid the yield of soils develop to ground surface and/or touch the diaphragm wall. When the embedded depth, overburden depth or fixed length of an anchor increases, the anchorage capacity also increases. Increasing fixed length should be the optimum method to increase the anchorage capacity for fixed length less than 20m. However, when the fixed length of an anchor exceeds 30 m, the increasing rate of anchorage capacity per fixed length decreases, and progressive yield occurs obviously between the fixed length and surrounding soil.

  4. Constrained Active Learning for Anchor Link Prediction Across Multiple Heterogeneous Social Networks.

    Science.gov (United States)

    Zhu, Junxing; Zhang, Jiawei; Wu, Quanyuan; Jia, Yan; Zhou, Bin; Wei, Xiaokai; Yu, Philip S

    2017-08-03

    Nowadays, people are usually involved in multiple heterogeneous social networks simultaneously. Discovering the anchor links between the accounts owned by the same users across different social networks is crucial for many important inter-network applications, e.g., cross-network link transfer and cross-network recommendation. Many different supervised models have been proposed to predict anchor links so far, but they are effective only when the labeled anchor links are abundant. However, in real scenarios, such a requirement can hardly be met and most anchor links are unlabeled, since manually labeling the inter-network anchor links is quite costly and tedious. To overcome such a problem and utilize the numerous unlabeled anchor links in model building, in this paper, we introduce the active learning based anchor link prediction problem. Different from the traditional active learning problems, due to the one-to-one constraint on anchor links, if an unlabeled anchor link a = ( u , v ) is identified as positive (i.e., existing), all the other unlabeled anchor links incident to account u or account v will be negative (i.e., non-existing) automatically. Viewed in such a perspective, asking for the labels of potential positive anchor links in the unlabeled set will be rewarding in the active anchor link prediction problem. Various novel anchor link information gain measures are defined in this paper, based on which several constraint active anchor link prediction methods are introduced. Extensive experiments have been done on real-world social network datasets to compare the performance of these methods with state-of-art anchor link prediction methods. The experimental results show that the proposed Mean-entropy-based Constrained Active Learning (MC) method can outperform other methods with significant advantages.

  5. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  6. DNA strand breakage by 125I-decay in oligoDNA

    International Nuclear Information System (INIS)

    Lobachevsky, P.; Martin, R.F.

    1996-01-01

    Full text: A double-stranded oligodeoxynucleotide containing 125 I-dC in a defined location, with 5'- or 3'- 32 P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125 I decay. Samples of the 32 P-end-labelled and 125 I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32 P-end-labelled DNA fragments produced by 125 I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125 I decay event produces at least one break in the 125 I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125 I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125 I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125 I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125 I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25 I-decay, and may provide new mechanistic insights

  7. Link Anchors in Images: Is there Truth?

    NARCIS (Netherlands)

    Aly, Robin; McGuinness, Kevin; Kleppe, Martijn; Ordelman, Roeland J.F.; O'Connor, Noel; de Jong, Franciska M.G.

    2012-01-01

    While automatic linking in text collections is well understood, little is known about links in images. In this work, we investigate two aspects of anchors, the origin of a link, in images: 1) the requirements of users for such anchors, e.g. the things users would like more information on, and 2)

  8. Carbon ion induced DNA double-strand breaks in melanophore B16

    International Nuclear Information System (INIS)

    Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu

    1997-01-01

    DNA double-strand breaks (DSBs) in melanophore B 16 induced by plateau and extended Bragg peak of 75 MeV/u 12 C 6+ ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B 16 . Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau ∝85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  9. A fragment-based approach leading to the discovery of a novel binding site and the selective CK2 inhibitor CAM4066.

    Science.gov (United States)

    De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R

    2017-07-01

    Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.

  10. The Effect of Mini and Midi Anchor Tests on Test Equating

    Science.gov (United States)

    Arikan, Çigdem Akin

    2018-01-01

    The main purpose of this study is to compare the test forms to the midi anchor test and the mini anchor test performance based on item response theory. The research was conducted with using simulated data which were generated based on Rasch model. In order to equate two test forms the anchor item nonequivalent groups (internal anchor test) was…

  11. Dual-Specificity Anti-HER-2/neu Antisense DNA Agents for Breast Cancer Therapy

    National Research Council Canada - National Science Library

    Stein, Stanley

    2001-01-01

    .... To achieve high avidity and specificity, we designed chimeric antisense molecules consisting of a short active DNA fused to a short "anchor" 2'-0-methyl RNA complementary to non-contiguous single...

  12. Use of the ROC anchor in foot and ankle surgery. A retrospective study.

    Science.gov (United States)

    Kuwada, G T

    1999-05-01

    A retrospective study was conducted on the use of the ROC (Radial Osteo Compression) soft-tissue anchor in foot and ankle surgery. This article describes how the anchor is deployed, problematic aspects of using the anchor, and complications and success rates associated with the anchor in ankle stabilizations, posterior tibial tendon reconstruction, peroneus brevis tendon reconstruction after fracture of the base of the fifth metatarsal, and detachment and reattachment of the Achilles tendon. The ROC anchor consists of the anchor with nonabsorbable suture attached to the shaft, the deployment handle, and drill bits. The anchor and shaft are snapped into the deployment handle and inserted into the drill hole. Compression of the trigger deploys the anchor into the hole. The ROC anchor was found to be reliable, useful, and relatively easy to deploy, with outcomes similar to those of other soft-tissue anchors.

  13. Application of DNA fingerprints for cell-line individualization.

    Science.gov (United States)

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-09-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.

  14. Improved production and function of llama heavy chain antibody fragments by molecular evolution

    NARCIS (Netherlands)

    Linden, van der R.H.; Geus, de B.; Frenken, G.J.; Peters, H.; Verrips, C.T.

    2000-01-01

    The aim of this study was to improve production level of llama heavy chain antibody fragments (V (HH)) in Saccharomyces cerevisiae while retaining functional characteristics. For this purpose, the DNA shuffling technique was used on llama V (HH) fragments specific for the azo-dye reactive red-6. In

  15. COP9 signalosome: a provider of DNA building blocks

    DEFF Research Database (Denmark)

    Nielsen, Olaf

    2003-01-01

    In fission yeast, the COP9 signalosome is required to activate ribonucleotide reductase for DNA synthesis. This is mediated via the ubiquitin ligase Pcu4, activation of which leads to degradation of the scaffold protein Spd1, which anchors the small ribonucleotide reductase subunit in the nucleus...

  16. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    International Nuclear Information System (INIS)

    Dallas, J.F.

    1988-01-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  17. Construction of recombinant DNA clone for bovine viral diarrhea virus

    International Nuclear Information System (INIS)

    Yeo, S.G.; Cho, H.J.; Masri, S.A.

    1992-01-01

    Molecular cloning was carried out on the Danish strain of bovine viral diarrhea virus (BVDV) to construct strategy for the diagnostic tools and effective vaccine of BVD afterwards. A recombinant DNA clone (No. 29) was established successfully from cDNA for viral RNA tailed with adenine homopolymer at 3 -end. 32 P-labeled DNA probes of 300~1, 800bp fragments, originating from the clone 29, directed specific DNA-RNA hybridization results with BVDV RNA. Recombinant DNA of the clone 29 was about 5,200bp representing 41.6% of the full length of Danish strain's RNA, and restriction sites were recognized for EooR I, Sst I, Hind III and Pst I restriction enzymes in the DNA fragment

  18. Anchoring Proteins as Regulators of Signaling Pathways

    Science.gov (United States)

    Perino, Alessia; Ghigo, Alessandra; Scott, John D.; Hirsch, Emilio

    2012-01-01

    Spatial and temporal organization of signal transduction is coordinated through the segregation of signaling enzymes in selected cellular compartments. This highly evolved regulatory mechanism ensures the activation of selected enzymes only in the vicinity of their target proteins. In this context, cAMP-responsive triggering of protein kinase A is modulated by a family of scaffold proteins referred to as A-kinase anchoring proteins. A-kinase anchoring proteins form the core of multiprotein complexes and enable simultaneous but segregated cAMP signaling events to occur in defined cellular compartments. In this review we will focus on the description of A-kinase anchoring protein function in the regulation of cardiac physiopathology. PMID:22859670

  19. On the Robustness of Anchoring Effects in WTP and WTA Experiments

    OpenAIRE

    Drew Fudenberg; David K Levine; Zacharias Maniadis

    2010-01-01

    We reexamine the effects of the anchoring manipulation of Ariely, Loewenstein, and Prelec (2003) on the evaluation of common market goods and find very weak anchoring effects. We perform the same manipulation on the evaluation of binary lotteries, and find no anchoring effects at all. This suggests limits on the robustness of anchoring effects. (JEL C91, D12, D44)

  20. Size distribution of DNA molecules recovered from non-denaturing filter elution

    International Nuclear Information System (INIS)

    Bloecher, D.; Iliakis, G.

    1991-01-01

    DNA fragments removed from the filter during non-denaturing filter elution were collected and loaded on top of neutral sucrose gradients. Their size distribution was determined by low-speed centrifugation in neutral sucrose gradients. The average size of eluted DNA was found to be approximately 110 S; the average size of DNA collected after short elution times was found to be slightly larger than after long elution times. It is concluded that the size of eluted DNA fragments is not correlated with elution rate, and it is proposed that shear forces generated at the filter pores cause degradation of the DNA. Comparison of sedimentation profiles of carefully prepared cellular DNA before and after elution revealed that generated shear forces during elution break down DNA to an extent equivalent to around 20 000 DNA double-strand breaks (dsb) per G 1 cell. The size of DNA fragments decreased with increasing radiation dose; five times more dsb were found than expected after exposure to radiation alone. It is proposed that excess of dsb may derive from the transformation of other radiation-induced lesions to dsb under the action of shear forces generated during elution. (author)

  1. Amplification of a transcriptionally active DNA sequence in the human brain

    International Nuclear Information System (INIS)

    Yakovlev, A.G.; Sazonov, A.E.; Spunde, A.Ya.; Gindilis, V.M.

    1986-01-01

    The authors present their findings of tissue-specific amplification of a DNA fragment actively transcribed in the human brain. This genome fragment was found in the library complement of cDNA of the human brain and evidently belongs to a new class of moderate repetitions of DNA with an unstable copying capacity in the human genome. The authors isolated total cell RNA from various human tissues (brain, placenta), and rat tissues (brain, liver), by the method of hot phenol extraction with guanidine thiocynate. The poly(A + ) RNA fraction was isolated by chromatography. Synthesis of cDNA was done on a matrix of poly(A + ) RNA of human brain. The cDNA obtained was cloned in plasmid pBR322 for the PstI site using (dC/dG) sequences synthesized on the 3' ends of the vector molecule and cDNA respectively. In cloning 75 ng cDNA, the authors obtained approximately 10 5 recombinant. This library was analyzed by the hybridization method on columns with two radioactive ( 32 P) probes: the total cDNA preparation and the total nuclear DNA from the human brain. The number of copies of the cloned DNA fragment in the genome was determined by dot hybridization. Restricting fragments of human and rat DNA genomes homologous to the cloned cDNA were identified on radio-autographs. In each case, 10 micrograms of EcoRI DNA hydrolyzate was fractionated in 1% agarose gel. The probe was also readied with RNA samples fractionated in agarose gel with formaldehyde and transferred to a nitrocellulose filter under weak vacuum. The filter was hybridized with 0.1 micrograms DNA pAG 02, labeled with ( 32 P) to a specific activity of 0.5-1 x 10 9 counts/min x microgram. The autograph was exposed with amplifying screens at -70 0 C for 2 days

  2. Career Paths, Images and Anchors: A Study with Brazilian Professionals

    Science.gov (United States)

    Kilimnik, Zelia Miranda; de Oliveira, Luiz Claudio Vieira; Sant'anna, Anderson De Souza; Barros, Delba Teixeira Rodrigues

    2011-01-01

    This article analyses career anchors changes associated to images and professionals trajectories. Its main question: Do anchors careers change through time? We conducted twelve interviews involving professionals from the Administration Area, applying Schein's Career Anchors Inventory (1993). We did the same two years later. In both of them, the…

  3. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  4. Mismatch discrimination of lipidated DNA and LNA-probes (LiNAs) in hybridization-controlled liposome assembly

    DEFF Research Database (Denmark)

    Jakobsen, Ulla; Vogel, Stefan

    2016-01-01

    Assays for mismatch discrimination and detection of single nucleotide variations by hybridization-controlled assembly of liposomes, which do not require tedious surface chemistry, are versatile for both DNA and RNA targets. We report herein a comprehensive study on different DNA and LNA (locked...... assay in the context of mismatch discrimination and SNP detection are presented. The advantages of membrane-anchored LiNA-probes compared to chemically attached probes on solid nanoparticles (e.g. gold nanoparticles) are described. Key functionalities such as non-covalent attachment of LiNA probes...... without the need for long spacers and the inherent mobility of membrane-anchored probes in lipid-bilayer membranes will be described for several different probe designs....

  5. Stone anchors of India: Findings, classification and significance.

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    Various types of stone anchors have been observed during inshore and offshore explorations along the east and west coasts of India. The earliest stone anchors of India have been recorded from the Harappan sites (3rd millennium BC), but their shape...

  6. Replication-Coupled PCNA Unloading by the Elg1 Complex Occurs Genome-wide and Requires Okazaki Fragment Ligation

    Directory of Open Access Journals (Sweden)

    Takashi Kubota

    2015-08-01

    Full Text Available The sliding clamp PCNA is a crucial component of the DNA replication machinery. Timely PCNA loading and unloading are central for genome integrity and must be strictly coordinated with other DNA processing steps during replication. Here, we show that the S. cerevisiae Elg1 replication factor C-like complex (Elg1-RLC unloads PCNA genome-wide following Okazaki fragment ligation. In the absence of Elg1, PCNA is retained on chromosomes in the wake of replication forks, rather than at specific sites. Degradation of the Okazaki fragment ligase Cdc9 leads to PCNA accumulation on chromatin, similar to the accumulation caused by lack of Elg1. We demonstrate that Okazaki fragment ligation is the critical prerequisite for PCNA unloading, since Chlorella virus DNA ligase can substitute for Cdc9 in yeast and simultaneously promotes PCNA unloading. Our results suggest that Elg1-RLC acts as a general PCNA unloader and is dependent upon DNA ligation during chromosome replication.

  7. Investigation of suction anchor pullout capacity under undrained conditions

    OpenAIRE

    Jarand, Pollestad

    2015-01-01

    Master's thesis in Offshore technology Floating units are dependent on reliable mooring systems to ensure safety during marine operations. Suction anchors have proved to be a technologically viable and cost-effective concept. They are capable of precision installation, re-use, and provide large resistive capacity. This thesis investigates load capacity and failure modes of suction anchors subjected to vertical, horizontal (lateral), and incline loading. Suction anchor design co...

  8. DNA moves sequentially towards the nuclear matrix during DNA replication in vivo

    Directory of Open Access Journals (Sweden)

    Aranda-Anzaldo Armando

    2011-01-01

    Full Text Available Abstract Background In the interphase nucleus of metazoan cells DNA is organized in supercoiled loops anchored to a nuclear matrix (NM. There is varied evidence indicating that DNA replication occurs in replication factories organized upon the NM and that DNA loops may correspond to the actual replicons in vivo. In normal rat liver the hepatocytes are arrested in G0 but they synchronously re-enter the cell cycle after partial-hepatectomy leading to liver regeneration in vivo. We have previously determined in quiescent rat hepatocytes that a 162 kbp genomic region containing members of the albumin gene family is organized into five structural DNA loops. Results In the present work we tracked down the movement relative to the NM of DNA sequences located at different points within such five structural DNA loops during the S phase and after the return to cellular quiescence during liver regeneration. Our results indicate that looped DNA moves sequentially towards the NM during replication and then returns to its original position in newly quiescent cells, once the liver regeneration has been achieved. Conclusions Looped DNA moves in a sequential fashion, as if reeled in, towards the NM during DNA replication in vivo thus supporting the notion that the DNA template is pulled progressively towards the replication factories on the NM so as to be replicated. These results provide further evidence that the structural DNA loops correspond to the actual replicons in vivo.

  9. Pyramidal anchor stone from Baga waters of Goa, west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    . Pyramidal anchor stones have an apex hole which goes up to the round hole, however Goa anchor stone has no such perforation, but, instead has a rectangular cutting on the apex. The anchor stone is compared with Greek pyramidal anchor stones, and probably...

  10. Mutational analysis of the glycosylphosphatidylinositol (GPI) anchor pathway demonstrates that GPI-anchored proteins are required for cell wall biogenesis and normal hyphal growth in Neurospora crassa.

    Science.gov (United States)

    Bowman, Shaun M; Piwowar, Amy; Al Dabbous, Mash'el; Vierula, John; Free, Stephen J

    2006-03-01

    Using mutational and proteomic approaches, we have demonstrated the importance of the glycosylphosphatidylinositol (GPI) anchor pathway for cell wall synthesis and integrity and for the overall morphology of the filamentous fungus Neurospora crassa. Mutants affected in the gpig-1, gpip-1, gpip-2, gpip-3, and gpit-1 genes, which encode components of the N. crassa GPI anchor biosynthetic pathway, have been characterized. GPI anchor mutants exhibit colonial morphologies, significantly reduced rates of growth, altered hyphal growth patterns, considerable cellular lysis, and an abnormal "cell-within-a-cell" phenotype. The mutants are deficient in the production of GPI-anchored proteins, verifying the requirement of each altered gene for the process of GPI-anchoring. The mutant cell walls are abnormally weak, contain reduced amounts of protein, and have an altered carbohydrate composition. The mutant cell walls lack a number of GPI-anchored proteins, putatively involved in cell wall biogenesis and remodeling. From these studies, we conclude that the GPI anchor pathway is critical for proper cell wall structure and function in N. crassa.

  11. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  12. Quantification of damage in DNA recovered from highly degraded samples – a case study on DNA in faeces

    Directory of Open Access Journals (Sweden)

    Eveson J Paige

    2006-08-01

    Full Text Available Abstract Background Poorly preserved biological tissues have become an important source of DNA for a wide range of zoological studies. Measuring the quality of DNA obtained from these samples is often desired; however, there are no widely used techniques available for quantifying damage in highly degraded DNA samples. We present a general method that can be used to determine the frequency of polymerase blocking DNA damage in specific gene-regions in such samples. The approach uses quantitative PCR to measure the amount of DNA present at several fragment sizes within a sample. According to a model of random degradation the amount of available template will decline exponentially with increasing fragment size in damaged samples, and the frequency of DNA damage (λ can be estimated by determining the rate of decline. Results The method is illustrated through the analysis of DNA extracted from sea lion faecal samples. Faeces contain a complex mixture of DNA from several sources and different components are expected to be differentially degraded. We estimated the frequency of DNA damage in both predator and prey DNA within individual faecal samples. The distribution of fragment lengths for each target fit well with the assumption of a random degradation process and, in keeping with our expectations, the estimated frequency of damage was always less in predator DNA than in prey DNA within the same sample (mean λpredator = 0.0106 per nucleotide; mean λprey = 0.0176 per nucleotide. This study is the first to explicitly define the amount of template damage in any DNA extracted from faeces and the first to quantify the amount of predator and prey DNA present within individual faecal samples. Conclusion We present an approach for characterizing mixed, highly degraded PCR templates such as those often encountered in ecological studies using non-invasive samples as a source of DNA, wildlife forensics investigations and ancient DNA research. This method will

  13. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  14. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  15. Peptide-Mediated Liposome Fusion: The Effect of Anchor Positioning

    Directory of Open Access Journals (Sweden)

    Niek S. A. Crone

    2018-01-01

    Full Text Available A minimal model system for membrane fusion, comprising two complementary peptides dubbed “E” and “K” joined to a cholesterol anchor via a polyethyleneglycol spacer, has previously been developed in our group. This system promotes the fusion of large unilamellar vesicles and facilitates liposome-cell fusion both in vitro and in vivo. Whilst several aspects of the system have previously been investigated to provide an insight as to how fusion is facilitated, anchor positioning has not yet been considered. In this study, the effects of placing the anchor at either the N-terminus or in the center of the peptide are investigated using a combination of circular dichroism spectroscopy, dynamic light scattering, and fluorescence assays. It was discovered that anchoring the “K” peptide in the center of the sequence had no effect on its structure, its ability to interact with membranes, or its ability to promote fusion, whereas anchoring the ‘E’ peptide in the middle of the sequence dramatically decreases fusion efficiency. We postulate that anchoring the ‘E’ peptide in the middle of the sequence disrupts its ability to form homodimers with peptides on the same membrane, leading to aggregation and content leakage.

  16. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  17. Testing methods of steel wi re ropes at the anchor

    Directory of Open Access Journals (Sweden)

    Stanislav Kropuch

    2012-12-01

    Full Text Available The present paper introduces an application of the acoustic andthermographic method in the defectoscopic testing of immobilesteel wire ropes at the most critical point, the anchor. Firstmeasurements and their results by these new defectoscopic methodsare shown. In defectoscopic tests at the anchor, the widelyused magnetic method gives unreliable results, and therefore presentsa problem for steel wire defectoscopy. Application of the two new methods in the steel wire defectoscopy at the anchor point will enableincreased safety measures at the anchor of steel wire ropes in bridge, roof, tower and aerial cable lift constructions.

  18. DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis

    DEFF Research Database (Denmark)

    Morling, N; Friis, J; Fugger, L

    1991-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...

  19. Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

    Science.gov (United States)

    Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

    1994-11-01

    Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.

  20. Structural organization of the human glucocorticoid receptor determined by one- and two-dimensional gel electrophoresis of proteolytic receptor fragments

    International Nuclear Information System (INIS)

    Smith, A.C.; Harmon, J.M.

    1987-01-01

    The structural organization of the steroid-binding protein of the IM-9 cell glucocorticoid receptor was investigated by using one- and two-dimensional gel electrophoresis of proteolytic receptor fragments. One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) of receptor fragments isolated after trypsin digestion of immunopurified [ 3 H]dexamethasone 21-mesylate ([ 3 H]DM-) labeled receptor revealed the presence of a stable 26.5-kilodalton (kDa) steroid-containing non-DNA-binding fragment, derived from a larger, less stable, 29-kDa fragment. The 26.5-kDa tryptic fragment appeared to be completely contained within a 41-kDa, steroid-containing, DNA-binding species isolated after chymotrypsin digestion of the intact protein. Two-dimensional electrophoretic analysis of the [ 3 H]DM-labeled tryptic fragments resolved two 26.5-kDa and two 29-kDa components. This was the same number of isoforms seen in the intact protein, indicating that the charge heterogeneity of the steroid-binding protein is the result of modification within the steroid-containing, non-DNA-binding, 26.5-kDa tryptic fragment. Two-dimensional analysis of the 41-kDa [ 3 H]DM-labeled chymotryptic species revealed a pattern of isoforms more complex than that seen either in the intact protein or in the steroid-containing tryptic fragments. These results suggest that the 41-kDa [ 3 H]DM-labeled species resolved by one-dimensional SDS-PAGE after chymotrypsin digestion may be composed of several distinct proteolytic fragments

  1. Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

    Science.gov (United States)

    Ares, Manuel

    2014-01-01

    This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

  2. A tailored biocatalyst achieved by the rational anchoring of imidazole groups on a natural polymer: furnishing a potential artificial nuclease by sustainable materials engineering.

    Science.gov (United States)

    Ferreira, José G L; Grein-Iankovski, Aline; Oliveira, Marco A S; Simas-Tosin, Fernanda F; Riegel-Vidotti, Izabel C; Orth, Elisa S

    2015-04-11

    Foreseeing the development of artificial enzymes by sustainable materials engineering, we rationally anchored reactive imidazole groups on gum arabic, a natural biocompatible polymer. The tailored biocatalyst GAIMZ demonstrated catalytic activity (>10(5)-fold) in dephosphorylation reactions with recyclable features and was effective in cleaving plasmid DNA, comprising a potential artificial nuclease.

  3. Rapid transfer of DNA from agarose gels to nylon membranes.

    OpenAIRE

    Reed, K C; Mann, D A

    1985-01-01

    The unique properties of nylon membranes allow for dramatic improvement in the capillary transfer of DNA restriction fragments from agarose gels (Southern blotting). By using 0.4 M NaOH as the transfer solvent following a short pre-treatment of the gel in acid, DNA is depurinated during transfer. Fragments of all sizes are eluted and retained quantitatively by the membrane; furthermore, the alkaline solvent induces covalent fixation of DNA to the membrane. The saving in time and materials aff...

  4. Biological activity of SV40 DNA

    International Nuclear Information System (INIS)

    Abrahams, P.J.

    1978-01-01

    This thesis deals with a study on the biological activity of SV40 DNA. The transforming activity of SV40 DNA and DNA fragments is investigated in order to define as precisely as possible the area of the viral genome that is involved in the transformation. The infectivity of SV40 DNA is used to study the defective repair mechanisms of radiation damages of human xeroderma pigmentosum cells. (C.F.)

  5. DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.

    Science.gov (United States)

    Elmroth, Kecke; Stenerlöw, Bo

    2005-04-01

    The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.

  6. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

  7. Carbon ion induced DNA double-strand breaks in melanophore B{sub 16}

    Energy Technology Data Exchange (ETDEWEB)

    Zengquan, Wei; Guangming, Zhou; Jufang, Wang; Jing, He; Qiang, Li; Wenjian, Li; Hongmei, Xie; Xichen, Cai; Huang, Tao; Bingrong, Dang; Guangwu, Han [Chinese Academy of Sciences, Lanzhou (China). Inst. of Modern Physics; Qingxiang, Gao [Lanzhou Univ. (China)

    1997-09-01

    DNA double-strand breaks (DSBs) in melanophore B{sub 16} induced by plateau and extended Bragg peak of 75 MeV/u {sup 12}C{sup 6+} ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B{sub 16}. Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau {proportional_to}85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  8. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  9. Assessing tether anchor labeling and usability in pickup trucks.

    Science.gov (United States)

    Klinich, Kathleen D; Manary, Miriam A; Malik, Laura A; Flannagan, Carol A; Jermakian, Jessica S

    2018-04-03

    The objective of this study was to investigate vehicle factors associated with child restraint tether use and misuse in pickup trucks and evaluate 4 labeling interventions designed to educate consumers on proper tether use. Volunteer testing was performed with 24 subjects and 4 different pickup trucks. Each subject performed 8 child restraint installations among the 4 pickups using 2 forward-facing restraints: a Britax Marathon G4.1 and an Evenflo Triumph. Vehicles were selected to represent 4 different implementations of tether anchors among pickups: plastic loop routers (Chevrolet Silverado), webbing routers (Ram), back wall anchors (Nissan Frontier), and webbing routers plus metal anchors (Toyota Tundra). Interventions included a diagram label, Quick Response (QR) Code linked to video instruction, coordinating text label, and contrasting text tag. Subjects used the child restraint tether in 93% of trials. However, tether use was completely correct in only 9% of trials. An installation was considered functional if the subject attached the tether to a tether anchor and had a tight installation (ignoring routing and head restraint position); 28% of subjects achieved a functional installation. The most common installation error was attaching the tether hook to the anchor/router directly behind the child restraint (near the top of the seatback) rather than placing the tether through the router and attaching it to the anchor in the adjacent seating position. The Nissan Frontier, with the anchor located on the back wall of the cab, had the highest rate of correct installations but also had the highest rate of attaching the tether to components other than the tether anchor (seat adjustor, child restraint storage hook, around head restraint). None of the labeling interventions had a significant effect on correct installation; not a single subject scanned the QR Code to access the video instruction. Subjects with the most successful installations spent extensive time

  10. Ligand deconstruction: Why some fragment binding positions are conserved and others are not

    Science.gov (United States)

    Kozakov, Dima; Hall, David R.; Jehle, Stefan; Luo, Lingqi; Ochiana, Stefan O.; Jones, Elizabeth V.; Pollastri, Michael; Allen, Karen N.; Whitty, Adrian; Vajda, Sandor

    2015-01-01

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots—regions of the protein where interactions with a ligand contribute substantial binding free energy—the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand. PMID:25918377

  11. Ligand deconstruction: Why some fragment binding positions are conserved and others are not.

    Science.gov (United States)

    Kozakov, Dima; Hall, David R; Jehle, Stefan; Jehle, Sefan; Luo, Lingqi; Ochiana, Stefan O; Jones, Elizabeth V; Pollastri, Michael; Allen, Karen N; Whitty, Adrian; Vajda, Sandor

    2015-05-19

    Fragment-based drug discovery (FBDD) relies on the premise that the fragment binding mode will be conserved on subsequent expansion to a larger ligand. However, no general condition has been established to explain when fragment binding modes will be conserved. We show that a remarkably simple condition can be developed in terms of how fragments coincide with binding energy hot spots--regions of the protein where interactions with a ligand contribute substantial binding free energy--the locations of which can easily be determined computationally. Because a substantial fraction of the free energy of ligand binding comes from interacting with the residues in the energetically most important hot spot, a ligand moiety that sufficiently overlaps with this region will retain its location even when other parts of the ligand are removed. This hypothesis is supported by eight case studies. The condition helps identify whether a protein is suitable for FBDD, predicts the size of fragments required for screening, and determines whether a fragment hit can be extended into a higher affinity ligand. Our results show that ligand binding sites can usefully be thought of in terms of an anchor site, which is the top-ranked hot spot and dominates the free energy of binding, surrounded by a number of weaker satellite sites that confer improved affinity and selectivity for a particular ligand and that it is the intrinsic binding potential of the protein surface that determines whether it can serve as a robust binding site for a suitably optimized ligand.

  12. Hair Dye–DNA Interaction: Plausible Cause of Mutation

    Directory of Open Access Journals (Sweden)

    Swati Maiti

    2015-09-01

    Full Text Available Hair dye is one of the most popular cosmetic products which are used more widely and frequently to improve an individual’s appearance. Although the genotoxic effects of dye ingredients are widely reported, hair dye in its usable form is not reported extensively. In this contribution, we report the possible mode of interaction of hair dye with DNA which leads to genotoxicity. The effect of dye DNA interaction was studied on the most popular and globally used hair dye with Calf Thymus DNA and plasmid DNA. This interaction of dye DNA was studied by spectroscopic analyses and gel electrophoresis. The result had shown positive interaction of dye with DNA. Gel electrophoresis study confirms the binding of dye with DNA which results in linearization and fragmentation of the plasmid DNA. Dye–DNA interaction causes fragmentation and oxidation of DNA in absence of any catalyst, implies high toxicity of commercial hair dyes. Thus, it can be deduced from the present studies that hair dye in its usable form may lead to its penetration through skin affecting genomic DNA possesses genotoxic property and can be treated as one of the most common mutagen.

  13. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  14. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  15. High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

    Science.gov (United States)

    Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

    2015-06-17

    High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This

  16. Anchoring submersible ultrasonic receivers in river channels with stable substrate

    Science.gov (United States)

    Bettoli, Phillip William; Scholten, G.D.; Hubbs, D.

    2010-01-01

    We developed an anchoring system for submersible ultrasonic receivers (SURs) that we placed on the bottom of the riverine reaches of three main-stem reservoirs in the upper Tennessee River. Each anchor consisted of a steel tube (8.9 x 35.6 cm) welded vertically to a round plate of steel (5.1 x 40.6 cm). All seven SURs and their 57-kg anchors were successfully deployed and retrieved three times over 547 d by a dive team employing surface air-breathing equipment and a davit-equipped boat. All of the anchors and their SURs remained stationary over two consecutive winters on the hard-bottom, thalweg sites where they were deployed. The SUR and its anchor at the most downriver site experienced flows that exceeded 2,100 m(3)/s and mean water column velocities of about 0.9 m/s.

  17. Comparison of Suitability of the Most Common Ancient DNA Quantification Methods.

    Science.gov (United States)

    Brzobohatá, Kristýna; Drozdová, Eva; Smutný, Jiří; Zeman, Tomáš; Beňuš, Radoslav

    2017-04-01

    Ancient DNA (aDNA) extracted from historical bones is damaged and fragmented into short segments, present in low quantity, and usually copurified with microbial DNA. A wide range of DNA quantification methods are available. The aim of this study was to compare the five most common DNA quantification methods for aDNA. Quantification methods were tested on DNA extracted from skeletal material originating from an early medieval burial site. The tested methods included ultraviolet (UV) absorbance, real-time quantitative polymerase chain reaction (qPCR) based on SYBR ® green detection, real-time qPCR based on a forensic kit, quantification via fluorescent dyes bonded to DNA, and fragmentary analysis. Differences between groups were tested using a paired t-test. Methods that measure total DNA present in the sample (NanoDrop ™ UV spectrophotometer and Qubit ® fluorometer) showed the highest concentrations. Methods based on real-time qPCR underestimated the quantity of aDNA. The most accurate method of aDNA quantification was fragmentary analysis, which also allows DNA quantification of the desired length and is not affected by PCR inhibitors. Methods based on the quantification of the total amount of DNA in samples are unsuitable for ancient samples as they overestimate the amount of DNA presumably due to the presence of microbial DNA. Real-time qPCR methods give undervalued results due to DNA damage and the presence of PCR inhibitors. DNA quantification methods based on fragment analysis show not only the quantity of DNA but also fragment length.

  18. DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

    African Journals Online (AJOL)

    We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

  19. Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

    Science.gov (United States)

    Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

    2010-01-01

    This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

  20. Participation of ATM in cellular response to DNA damage induced by ionizing radiation

    International Nuclear Information System (INIS)

    Meng Xiangbing; Song Yi; Mao Jianping; Gong Bo; Dong Yan; Liu Bin; Sun Zhixian

    2000-01-01

    Objective: To clone ATM full length cDNA and cDNA fragments containing some functional domains and to identify proteins that interact with ATM and mediate DNA damage signal transduction in cellular response to DNA damage. Methods: ATM cDNA was amplified from MarthomTM-Ready cDNA kit of human leukocytes by LD-PCR. ATM-interacting proteins were screened by yeast two hybrid system. Results: ATM full-length cDNA and cDNA fragments containing PI3K kinase domain, leucine zipper and proline rich region were amplified from human cDNAs. Several candidate clones that interacted with ATM PI3K domain were identified. Conclusion: ATM mediates DNA damage signal transduction by interacting with many proteins

  1. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  2. Archaeometallurgical investigation of the iron anchor from the Tantura F shipwreck

    Energy Technology Data Exchange (ETDEWEB)

    Aronson, A. [Faculty of Engineering, Tel Aviv University, Ramat Aviv 69978 (Israel); Ashkenazi, D., E-mail: dana@eng.tau.ac.il [Faculty of Engineering, Tel Aviv University, Ramat Aviv 69978 (Israel); Barkai, O.; Kahanov, Y. [Leon Recanati Institute for Maritime Studies, University of Haifa, Haifa 31905 (Israel)

    2013-04-15

    The Tantura F shipwreck was a coaster or a fishing vessel about 15.7 m long, discovered in the Dor/Tantura lagoon, Israel in 1995. It was dated to between the mid-7th and the end of the 8th centuries CE. Among the finds excavated were two T-shaped type iron anchors. Of the two anchors, one (anchor A) was thoroughly studied by archaeometallurgical methods in order to identify forge-welding lines, to determine the welding quality and to understand the manufacturing technology. The examinations included X-ray radiography, XRF analysis, optical microscopy, SEM/EDS observation and analysis, OES analysis and microhardness tests. The investigation included characterization of the composition, microstructure, thermal treatments, forge-welding junctions and slag analysis. The results revealed a heterogeneous microstructure, rich in glassy, fayalite and wüstite slag. Iron based phases included ferrite, pearlite, cementite and Widmanstätten plates, all typical to wrought iron. The forge-welds of Anchor A were located. Each arm was made of one piece, weighing about 2.5–3 kg and the shank was made of a few 1.5–2 kg pieces. The second anchor (anchor B) was only briefly examined visually and with a few radiographs, which support the results from anchor A. The research results revealed significant information about T-shaped anchors and their manufacturing process, including hot-working processes without any additional heat treatments, and folding techniques. The microstructure was similar to other ancient simple tools such as saws, sickles, axes and mortise chisels, and though the technology to make complicated structures and objects, such as swords, existed at that time, the anchors did not require this sophistication; thus simpler techniques were used, presumably because they were more cost-effective. - Highlights: ► Tantura F was a coaster dated to mid-7th–end-8th centuries. ► Two iron anchors were discovered at the Tantura F shipwreck-site. ► Anchor A was

  3. Do budget balance rules anchor budget balance expectations? -- Some international evidence

    OpenAIRE

    Rülke, Jan-Christoph; Frenkel, Michael; Lis, Eliza

    2013-01-01

    This is the first study that analyzes whether budget balance expectations are anchored and whether budget balance rules effectively anchor expectations. To this end, we use a unique data set which covers budget balance expectations in 17 countries that implemented a budget balance rules. While our results are mixed concerning the general impact of budget balance rules on anchoring expectations, we do find that specific features of budget balance rules are important to successfully anchor budg...

  4. Ultimate load capacities of expansion anchor bolts

    International Nuclear Information System (INIS)

    Czarnecki, R.M.; Manrique, M.A.; Samaddar, S.K.

    1993-01-01

    A summary of available experimental expansion anchor bolt test data is presented. These data were collected as part of programs by the nuclear industry to address generic issues related to verification of seismic adequacy of equipment in nuclear power plants. Some of the data presented are suitable for use in seismic probabilistic risk assessments. For example, mean values of ultimate strength, along with their standard deviation and coefficients of variation, for a range of most typical expansion anchor bolt sizes are presented. Effects of interaction between shear and tension, edge distance, spacing, and cracking of the concrete are presented in a manner that is more suitable for use in deterministic evaluations. Related industry programs to derive anchor bolt capacities are briefly discussed. Recommendations for areas of further investigation are also presented

  5. Label-free, electrochemical detection of methicillin-resistant staphylococcus aureus DNA with reduced graphene oxide-modified electrodes

    KAUST Repository

    Wang, Zhijuan

    2011-05-01

    Reduced graphene oxide (rGO)-modified glassy carbon electrode is used to detect the methicillin-resistant Staphylococcus aureus (MRSA) DNA by using electrochemical impedance spectroscopy. Our experiments confirm that ssDNA, before and after hybridization with target DNA, are successfully anchored on the rGO surface. After the probe DNA, pre-adsorbed on rGO electrode, hybridizes with target DNA, the measured impedance increases dramatically. It provides a new method to detect DNA with high sensitivity (10-13M, i.e., 100 fM) and selectivity. © 2011 Elsevier B.V.

  6. Novel applications for glycosylphosphatidylinositol-anchored proteins in pharmaceutical and industrial biotechnology.

    Science.gov (United States)

    Müller, Günter

    2011-04-01

    Glycosylphosphatidylinositol (GPI)-anchored proteins have been regarded as typical cell surface proteins found in most eukaryotic cells from yeast to man. They are embedded in the outer plasma membrane leaflet via a carboxy-terminally linked complex glycolipid GPI structure. The amphiphilic nature of the GPI anchor, its compatibility with the function of the attached protein moiety and the capability of GPI-anchored proteins for spontaneous insertion into and transfer between artificial and cellular membranes initially suggested their potential for biotechnological applications. However, these expectations have been hardly fulfilled so far. Recent developments fuel novel hopes with regard to: (i) Automated online expression, extraction and purification of therapeutic proteins as GPI-anchored proteins based on their preferred accumulation in plasma membrane lipid rafts, (ii) multiplex custom-made protein chips based on GPI-anchored cell wall proteins in yeast, (iii) biomaterials and biosensors with films consisting of sets of distinct GPI-anchored binding-proteins or enzymes for sequential or combinatorial catalysis, and (iv) transport of therapeutic proteins across or into relevant tissue cells, e.g., enterocytes or adipocytes. Latter expectations are based on the demonstrated translocation of GPI-anchored proteins from plasma membrane lipid rafts to cytoplasmic lipid droplets and eventually further into microvesicles which upon release from donor cells transfer their GPI-anchored proteins to acceptor cells. The value of these technologies, which are all based on the interaction of GPI-anchored proteins with membranes and surfaces, for the engineering, production and targeted delivery of biomolecules for a huge variety of therapeutic and biotechnological purposes should become apparent in the near future.

  7. Do anchor investors create value for initial public offerings? An empirical investigation

    Directory of Open Access Journals (Sweden)

    Seshadev Sahoo

    2017-12-01

    Full Text Available The concept of anchor investors was introduced by the market regulator, Securities Exchange Board of India (SEBI, to bring transparency in the book building mechanism. We examine anchor investors' investment in initial public offerings (IPOs to determine how they create value for issuing firms and participating investors. Using a database of 135 IPOs issued in the Indian market through book building mechanism during 2009–2014, we find that anchor investors' investment in IPOs reduces underpricing. Larger subscription from retail investors for anchor-supported IPOs indicates that anchor investors' participation is viewed as a credible attestation of quality of the issue. We document that anchor-supported IPOs are more liquid and less volatile in the short run. We also find that by controlling for other factors such as offer size, subscription rate and age of the firm, a part of the underpricing is reduced by anchor investors.

  8. Considerations on the design of through-wall anchors

    International Nuclear Information System (INIS)

    Ricklefs, Ulf

    2012-01-01

    Connections to existing buildings are often the most difficult planning challenge for the realization of construction measures in case of piping system replacements in nuclear power plants. This is due to restricted space or limited load reserves of the building structure. Usually the realization of support connections to the existing buildings is achieved by anchor bolts. But in critical cases the preferred alternative solution uses through-wall anchors. Up to now uniform assessment thresholds are not available, no technical guidelines or regulations for construction variants exist. Through-wall anchors allow significantly higher load capacities for tensile and shear loads but require enhanced planning and realization efforts.

  9. Anchor enhanced capsulorraphy in bunionectomies using an L-shaped capsulotomy.

    Science.gov (United States)

    Gould, John S; Ali, Sheriff; Fowler, Rachel; Fleisig, Glenn S

    2003-01-01

    The objective of this study was to investigate potential benefit of a suture anchor-enhanced capsulorraphy in the early maintenance of correction in bunionectomies. We compared, retrospectively, in successive series, the loss of correction of the Hallux Valgus (HV) and intermetatarsal (IM) angle, in those repaired with an L-shaped capsulorraphy enhanced with anchors to those without. Intraoperative and second week postoperative simulated weightbearing anterior posterior (AP) X-rays were used to evaluate results. By using only intraoperative and early postoperative X-rays, we should have effectively eliminated extraneous factors that might have influenced our results. A Total of 106 cases were investigated, 65 of which were repaired using anchors, the remaining 41 without. In the anchor group, 38 underwent a proximal metatarsal concentric shelf osteotomy (CSO)/modified McBride procedure, while the remaining 27 had a distal Chevron correction. In the without-anchor group, 21 had a CSO/modified McBride procedure while 20 underwent the Chevron procedure. In the without-anchor group, the average HV and IM loss of correction was 4.60 degrees (range, -2 to 21 degrees) and 0.6 degrees (range, -1 to 9 degrees) respectively. In the anchor group, the corresponding loss was 2.8 degrees (range, -3 to 17 degrees) and 0.6 degrees (range, -2 to 14 degrees) respectively. These results, when statistically analyzed, demonstrated that while the IM angle change was not statistically significant, the HV angle change was statistically significant, implying that the anchor plays a significant role in maintaining the surgical correction in both the distal Chevron and CSO/ modified McBride bunionectomies.

  10. Model for how type I restriction enzymes select cleavage sites in DNA

    International Nuclear Information System (INIS)

    Studier, F.W.; Bandyopadhyay, P.K.

    1988-01-01

    Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected

  11. Stone anchors from the Okhamandal region, Gujarat Coast, India

    Digital Repository Service at National Institute of Oceanography (India)

    Sundaresh; Gaur, A.S.; Gudigar, P.; Tripati, S.; Vora, K.H.; Bandodkar, S.N.

    During marine archaeological explorations since 1983, off Dwarka, a large number of stone anchors were discovered and dated to 1400 BC, comparing with anchors found in Mediterranean waters. In recent archaeological explorations off Dwarka, Bet...

  12. Cavity-Type DNA Origami-Based Plasmonic Nanostructures for Raman Enhancement.

    Science.gov (United States)

    Zhao, Mengzhen; Wang, Xu; Ren, Shaokang; Xing, Yikang; Wang, Jun; Teng, Nan; Zhao, Dongxia; Liu, Wei; Zhu, Dan; Su, Shao; Shi, Jiye; Song, Shiping; Wang, Lihua; Chao, Jie; Wang, Lianhui

    2017-07-05

    DNA origami has been established as addressable templates for site-specific anchoring of gold nanoparticles (AuNPs). Given that AuNPs are assembled by charged DNA oligonucleotides, it is important to reduce the charge repulsion between AuNPs-DNA and the template to realize high yields. Herein, we developed a cavity-type DNA origami as templates to organize 30 nm AuNPs, which formed dimer and tetramer plasmonic nanostructures. Transmission electron microscopy images showed that high yields of dimer and tetramer plasmonic nanostructures were obtained by using the cavity-type DNA origami as the template. More importantly, we observed significant Raman signal enhancement from molecules covalently attached to the plasmonic nanostructures, which provides a new way to high-sensitivity Raman sensing.

  13. Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase

    International Nuclear Information System (INIS)

    Heller, E.P.; Goldthwait, D.A.

    1983-01-01

    Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair

  14. Synthesis, Characterization and DNA Cleavage of Copper(II ...

    African Journals Online (AJOL)

    Keywords: DNA shearing, Copper(II) complex, Dithiothreitol, Attenuated total reflectance-Fourier transform .... confirm the fragmentation of DNA by the newly .... sperm. Biochem Biophys Acta 1986; 884: 124-134. 7. Cornell NW, Crivaro KE.

  15. DNA labeled during phosphonoacetate inhibition and following its reversal in herpesvirus infected cells

    International Nuclear Information System (INIS)

    Jacob, R.J.

    1984-01-01

    Human embryonic lung cells were pre-equilibrated with phosphonoacetate and 32 P orthophosphate label, then infected with phosphonoacetate-sensitive herpes simplex virus (HSV) type 1. Analyses of viral DNA produced in these cells showed the following. i) Viral DNA was synthesized in infected cells exposed to 100 μg of the drug per ml of medium but not in cells exposed to four-fold higher concentrations of the drug. ii) At 300 μg/ml a region of the DNA between 0.58 and 0.69 map units became transiently labeled, but the restriction endonuclease fragment containing these sequences migrated more slowly than the corresponding fragment from virion DNA. iii) Viral DNA extracted from infected cells 1.5 hours post drug withdrawal (300 μg/ml) was preferentially labeled in 2 regions of the genome mapping between 0.17 and 0.23 and 0.58-0.69 map units. This finding is in agreement with a report of Friedman et al. suggesting that HSV DNA contains two different sites if initiation. In addition a 4.8 x 10 6 molecular weight fragment was also preferentially labeled. This fragment could represent a smaller, aberrantly migrating fragment from the 0.17-0.27 map unit region of the DNA. iv) Viral DNA extracted from infected cells at longer intervals after drug withdrawal showed an increasing gradient of radioactivity progressively labeling the genome. These results are consistent with the hypothesis that viral DNA has at least two sites of initiation of DNA synthesis and that both sites are within the L component of the DNA. Alternatively, the results could be interpreted as two sites of localized synthesis (repair) that are detected at high concentrations of phosphonoacetate and immediately following reversal of inhibition of DNA synthesis. The results do not exclude the possibility that secondary sites in both L and S are utilized late in infection or in untreated cells. (Author)

  16. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    Science.gov (United States)

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  17. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  18. Effectiveness of TAD-anchored maxillary protraction in late mixed dentition.

    Science.gov (United States)

    Feng, Xiaoxia; Li, Jianhua; Li, Yu; Zhao, Zhihe; Zhao, Sen; Wang, Jue

    2012-11-01

    To evaluate the effectiveness of temporary anchorage device (TAD)-anchored maxillary protraction (MP) in terms of the skeletal and dentoalveolar changes and to compare it with traditional tooth-anchored MP. A computerized literature search for relative randomized controlled trials and prospective controlled trials was performed in PubMed, MEDLINE, Cochrane Central Register of Controlled Trials, Embase, CNKI, and Google Scholar, complemented with manual search. Data extraction and quality assessment were carried out by two reviewers independently. Meta-analysis was followed when possible; otherwise, description was done. Forty articles were found, among which four trials were qualified for meta-analysis. The results showed that there was significant difference between TAD-anchored MP and untreated control in terms of maxillary advancement (weighted mean differences (WMD) 3.08 mm; 95% CI: 1.61 to approximately 4.56; P TAD-anchored MP might have a greater maxillary advancement effect and might reduce skeletal and dental side effects, compared with tooth-anchored MP.

  19. Evaluation of plasmid and genomic DNA calibrants used for the quantification of genetically modified organisms.

    Science.gov (United States)

    Caprioara-Buda, M; Meyer, W; Jeynov, B; Corbisier, P; Trapmann, S; Emons, H

    2012-07-01

    The reliable quantification of genetically modified organisms (GMOs) by real-time PCR requires, besides thoroughly validated quantitative detection methods, sustainable calibration systems. The latter establishes the anchor points for the measured value and the measurement unit, respectively. In this paper, the suitability of two types of DNA calibrants, i.e. plasmid DNA and genomic DNA extracted from plant leaves, for the certification of the GMO content in reference materials as copy number ratio between two targeted DNA sequences was investigated. The PCR efficiencies and coefficients of determination of the calibration curves as well as the measured copy number ratios for three powder certified reference materials (CRMs), namely ERM-BF415e (NK603 maize), ERM-BF425c (356043 soya), and ERM-BF427c (98140 maize), originally certified for their mass fraction of GMO, were compared for both types of calibrants. In all three systems investigated, the PCR efficiencies of plasmid DNA were slightly closer to the PCR efficiencies observed for the genomic DNA extracted from seed powders rather than those of the genomic DNA extracted from leaves. Although the mean DNA copy number ratios for each CRM overlapped within their uncertainties, the DNA copy number ratios were significantly different using the two types of calibrants. Based on these observations, both plasmid and leaf genomic DNA calibrants would be technically suitable as anchor points for the calibration of the real-time PCR methods applied in this study. However, the most suitable approach to establish a sustainable traceability chain is to fix a reference system based on plasmid DNA.

  20. Empirical evidence for resource-rational anchoring and adjustment.

    Science.gov (United States)

    Lieder, Falk; Griffiths, Thomas L; M Huys, Quentin J; Goodman, Noah D

    2018-04-01

    People's estimates of numerical quantities are systematically biased towards their initial guess. This anchoring bias is usually interpreted as sign of human irrationality, but it has recently been suggested that the anchoring bias instead results from people's rational use of their finite time and limited cognitive resources. If this were true, then adjustment should decrease with the relative cost of time. To test this hypothesis, we designed a new numerical estimation paradigm that controls people's knowledge and varies the cost of time and error independently while allowing people to invest as much or as little time and effort into refining their estimate as they wish. Two experiments confirmed the prediction that adjustment decreases with time cost but increases with error cost regardless of whether the anchor was self-generated or provided. These results support the hypothesis that people rationally adapt their number of adjustments to achieve a near-optimal speed-accuracy tradeoff. This suggests that the anchoring bias might be a signature of the rational use of finite time and limited cognitive resources rather than a sign of human irrationality.

  1. Thermal anchoring of wires in large scale superconducting coil test experiment

    International Nuclear Information System (INIS)

    Patel, Dipak; Sharma, A.N.; Prasad, Upendra; Khristi, Yohan; Varmora, Pankaj; Doshi, Kalpesh; Pradhan, S.

    2013-01-01

    Highlights: • We addressed how thermal anchoring in large scale coil test is different compare to small cryogenic apparatus? • We did precise estimation of thermal anchoring length at 77 K and 4.2 K heat sink in large scale superconducting coil test experiment. • We addressed, the quality of anchoring without covering entire wires using Kapton/Teflon tape. • We obtained excellent results in temperature measurement without using GE Varnish by doubling estimated anchoring length. -- Abstract: Effective and precise thermal anchoring of wires in cryogenic experiment is mandatory to measure temperature in milikelvin accuracy and to avoid unnecessary cooling power due to additional heat conduction from room temperature (RT) to operating temperature (OT) through potential, field, displacement and stress measurement instrumentation wires. Instrumentation wires used in large scale superconducting coil test experiments are different compare to cryogenic apparatus in terms of unique construction and overall diameter/area due to errorless measurement in large time-varying magnetic field compare to small cryogenic apparatus, often shielded wires are used. Hence, along with other variables, anchoring techniques and required thermal anchoring length are entirely different in this experiment compare to cryogenic apparatus. In present paper, estimation of thermal anchoring length of five different types of instrumentation wires used in coils test campaign at Institute for Plasma Research (IPR), India has been discussed and some temperature measurement results of coils test campaign have been presented

  2. Results of the ANCHOR prospective, multicenter registry of EndoAnchors for type Ia endoleaks and endograft migration in patients with challenging anatomy.

    Science.gov (United States)

    Jordan, William D; Mehta, Manish; Varnagy, David; Moore, William M; Arko, Frank R; Joye, James; Ouriel, Kenneth; de Vries, Jean-Paul

    2014-10-01

    Proximal attachment site complications continue to occur after endovascular repair of abdominal aortic aneurysms (EVAR), specifically type Ia endoleak and endograft migration. EndoAnchors (Aptus Endosystems, Sunnyvale, Calif) were designed to enhance endograft proximal fixation and sealing, and the current study was undertaken to evaluate the potential benefit of this treatment. During the 23-month period ending in December 2013, 319 subjects were enrolled at 43 sites in the United States and Europe. EndoAnchors were implanted in 242 patients (75.9%) at the time of an initial EVAR procedure (primary arm) and in 77 patients with an existing endograft and proximal aortic neck complications (revision arm). Technical success was defined as deployment of the desired number of EndoAnchors, adequate penetration of the vessel wall, and absence of EndoAnchor fracture. Procedural success was defined as technical success without a type Ia endoleak at completion angiography. Values are expressed as mean ± standard deviation and interquartile range. The 238 male (74.6%) and 81 female (25.4%) subjects had a mean age of 74.1 ± 8.2 years. Aneurysms averaged 58 ± 13 (51-63) mm in diameter at the time of EndoAnchor implantation (core laboratory measurements). The proximal aortic neck averaged 16 ± 13 (7-23) mm in length (42.7% <10 mm and 42.7% conical) and 27 ± 4 mm (25-30 mm) in diameter; infrarenal neck angulation was 24 ± 15 (13-34) degrees. The number of EndoAnchors deployed was 5.8 ± 2.1 (4-7). Technical success was achieved in 303 patients (95.0%) and procedural success in 279 patients (87.5%), 217 of 240 (89.7%) and 62 of 77 (80.5%) in the primary and revision arms, respectively. There were 29 residual type Ia endoleaks (9.1%) at the end of the procedure. During mean follow-up of 9.3 ± 4.7 months, 301 patients (94.4%) were free from secondary procedures. Among the 18 secondary procedures, eight were performed for residual type Ia endoleaks and the others

  3. Interactions of tetracationic porphyrins with DNA and their effects on DNA cleavage

    Science.gov (United States)

    Lebedeva, Natalya Sh.; Yurina, Elena S.; Gubarev, Yury A.; Syrbu, Sergey A.

    2018-06-01

    The interaction of tetracationic porphyrins with DNA was studied using UV-Vis absorption, fluorescence spectroscopy and viscometry, and the particle sizes were determined. Аs cationic porphyrins, two isomer porphyrins, 3,3‧,3″,3‴-(5,10,15,20-Porphyrintetrayl)tetrakis(1-methylpyridinium) (TMPyP3) and 4,4‧,4″,4‴-(5,10,15,20-Porphyrintetrayl)tetrakis(1-methylpyridinium) (TMPyP4), were studied. They differ in the position of NCH3+ group in phenyl ring of the porphyrins and hence, in degree of freedom of rotation of the phenyl rings about the central macrocycle. It was found that intercalated complexes are formed at DNA/porphyrin molar ratios (R) of 2.2 and 3.9 for TMPyP3 и TMPyP4, respectively. Decreasing R up to 0.4 and 0.8 for TMPyP3 и TMPyP4, respectively, leads mainly to formation of outside complexes due to π-π stacking between the porphyrin chromophores interacting electrostatically with phosphate framework of DNA. Each type of the obtained complexes was characterized using Scatchard approach. It was ascertained that the affinity of TMPyP4 to DNA is stronger than TMPyP3, meanwhile the wedge effect of the latter is higher. The differences between the porphyrin isomers become more evident at irradiation of their complexes with DNA. It was established that irradiation of the intercalated complexes results in DNA fragmentation. In the case of TMPyP4, DNA fragments of different size are formed. The irradiation of the outside DNA/porphyrin complexes leads to cleavage of DNA (TMPyP3 and TMPyP4) and partial destruction of the complex due to photolysis of the porphyrin (TMPyP3).

  4. KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

    Directory of Open Access Journals (Sweden)

    Gusti Ngurah Permana

    2016-11-01

    The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

  5. LINKAGE ANALYSIS BY 2-DIMENSIONAL DNA TYPING

    NARCIS (Netherlands)

    MEERMAN, GJT; MULLAART, E; VANDERMEULEN, MA; DENDAAS, JHG; MOROLLI, B; UITTERLINDEN, AG; VIJG, J

    1993-01-01

    In two-dimensional (2-D) DNA typing, genomic DNA fragments are separated, first according to size by electrophoresis in a neutral polyacrylamide gel and second according to sequence by denaturing gradient gel electrophoresis, followed by hybridization analysis using micro- and minisatellite core

  6. Linkage analysis by two-dimensional DNA typing

    NARCIS (Netherlands)

    te Meerman, G J; Mullaart, E; Meulen ,van der Martin; den Daas, J H; Morolli, B; Uitterlinden, A G; Vijg, J

    1993-01-01

    In two-dimensional (2-D) DNA typing, genomic DNA fragments are separated, first according to size by electrophoresis in a neutral polyacrylamide gel and second according to sequence by denaturing gradient gel electrophoresis, followed by hybridization analysis using micro- and minisatellite core

  7. Insulin-like growth factor-1 (IGF-1) promotes primordial follicle growth and reduces DNA fragmentation through the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signalling pathway.

    Science.gov (United States)

    Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T

    2018-05-30

    We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.

  8. Chromatin Constrains the Initiation and Elongation of DNA Replication.

    Science.gov (United States)

    Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk

    2017-01-05

    Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Eukaryotic transcriptomics in silico: Optimizing cDNA-AFLP efficiency

    NARCIS (Netherlands)

    Stölting, K.N.; Gort, G.; Wüst, C.; Wilson, A.B.

    2009-01-01

    Background - Complementary-DNA based amplified fragment length polymorphism (cDNA-AFLP) is a commonly used tool for assessing the genetic regulation of traits through the correlation of trait expression with cDNA expression profiles. In spite of the frequent application of this method, studies on

  10. Recurrence plot analysis of DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

    2004-11-15

    Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

  11. Cyclic biomechanical testing of biocomposite lateral row knotless anchors in a human cadaveric model.

    Science.gov (United States)

    Barber, F Alan; Bava, Eric D; Spenciner, David B; Piccirillo, Justin

    2013-06-01

    The purpose of this study was to assess the mechanical performance of biocomposite knotless lateral row anchors based on both anchor design and the direction of pull. Two lateral row greater tuberosity insertion sites (anterior and posterior) were identified in matched pairs of fresh-frozen human cadaveric shoulders DEXA (dual energy X-ray absorptiometry) scanned to verify comparability. The humeri were stripped of all soft tissue and 3 different biocomposite knotless lateral row anchors: HEALIX Knotless BR (DePuy Mitek, Raynham MA), BioComposite PushLock (Arthrex, Naples, FL), and Bio-SwiveLock (Arthrex). Fifty-two anchors were distributed among the insertion locations and tested them with either an anatomic or axial pull. A fixed-gauge loop (15 mm) of 2 high-strength sutures from each anchor was created. After a 10-Nm preload, anchors were cycled from 10 to 45 Nm at 0.5 Hz for 200 cycles and tested to failure at 4.23 mm/second. The load to reach 3 mm and 5 mm displacement, ultimate failure load, displacement at ultimate failure, and failure mode were recorded. Threaded anchors (Bio-SwiveLock, P = .03; HEALIX Knotless, P = .014) showed less displacement with anatomic testing than did the nonthreaded anchor (BioComposite PushLock), and the HEALIX Knotless showed less overall displacement than did the other 2 anchors. The Bio-SwiveLock exhibited greater failure loads than did the other 2 anchors (P < .05). Comparison of axial and anatomic loading showed no maximum load differences for all anchors as a whole (P = .1084). Yet, anatomic pulling produced higher failure loads than did axial pulling for the Bio-SwiveLock but not for the BioComposite PushLock or the HEALIX Knotless. The nonthreaded anchor (BioComposite PushLock) displayed lower failure loads than did both threaded anchors with axial pulling. Threaded biocomposite anchors (HEALIX Knotless BR and Bio-SwiveLock) show less anatomic loading displacement and higher axial failure loads than do the nonthreaded

  12. Normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  13. Flow cytometric method for measuring chromatin fragmentation in fixed sperm from yellow perch (Perca flavescens).

    Science.gov (United States)

    Jenkins, J A; Draugelis-Dale, R O; Pinkney, A E; Iwanowicz, L R; Blazer, V S

    2015-03-15

    Declining harvests of yellow perch, Perca flavescens, in urbanized watersheds of Chesapeake Bay have prompted investigations of their reproductive fitness. The purpose of this study was to establish a flow cytometric technique for DNA analysis of fixed samples sent from the field to provide reliable gamete quality measurements. Similar to the sperm chromatin structure assay, measures were made on the susceptibility of nuclear DNA to acid-induced denaturation, but used fixed rather than live or thawed cells. Nuclei were best exposed to the acid treatment for 1 minute at 37 °C followed by the addition of cold (4 °C) propidium iodide staining solution before flow cytometry. The rationale for protocol development is presented graphically through cytograms. Field results collected in 2008 and 2009 revealed DNA fragmentation up to 14.5%. In 2008, DNA fragmentation from the more urbanized watersheds was significantly greater than from reference sites (P = 0.026) and in 2009, higher percentages of haploid testicular cells were noted from the less urbanized watersheds (P = 0.032) indicating better reproductive condition at sites with less urbanization. For both years, total and progressive live sperm motilities by computer-assisted sperm motion analysis ranged from 19.1% to 76.5%, being significantly higher at the less urbanized sites (P < 0.05). This flow cytometric method takes advantage of the propensity of fragmented DNA to be denatured under standard conditions, or 1 minute at 37 °C with 10% buffered formalin-fixed cells. The study of fixed sperm makes possible the restrospective investigation of germplasm fragmentation, spermatogenic ploidy patterns, and chromatin compaction levels from samples translocated over distance and time. The protocol provides an approach that can be modified for other species across taxa. Published by Elsevier Inc.

  14. The anchors of steel wire ropes, testing methods and their results

    Directory of Open Access Journals (Sweden)

    J. Krešák

    2012-10-01

    Full Text Available The present paper introduces an application of the acoustic and thermographic method in the defectoscopic testing of immobile steel wire ropes at the most critical point, the anchor. First measurements and their results by these new defectoscopic methods are shown. In defectoscopic tests at the anchor, the widely used magnetic method gives unreliable results, and therefore presents a problem for steel wire defectoscopy. Application of the two new methods in the steel wire defectoscopy at the anchor point will enable increased safety measures at the anchor of steel wire ropes in bridge, roof, tower and aerial cable lift constructions.

  15. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    Science.gov (United States)

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  16. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  17. Improved DNA electrophoresis in conditions favoring polyborates and lewis acid complexation.

    Directory of Open Access Journals (Sweden)

    Hari Singhal

    2010-06-01

    Full Text Available Spatial compression among the longer DNA fragments occurs during DNA electrophoresis in agarose and non-agarose gels when using certain ions in the conductive buffer, impairing the range of fragment sizes resolved well in a single gel. Substitutions using various polyhydroxyl anions supported the underlying phenomenon as the complexation of Lewis acids to DNA. We saw significant improvements using conditions (lithium borate 10 mM cations, pH 6.5 favoring the formation of borate polyanions and having lower conductance and Joule heating, delayed electrolyte exhaustion, faster electrophoretic run-speed, and sharper separation of DNA bands from 100 bp to 12 kb in a single run.

  18. Construction and identification of eukaryotic expression vector of pcDNA3-UHRF1

    International Nuclear Information System (INIS)

    Li Xinli; Zhu Ran; Zhu Wei; Fan Saijun; Meng Qinghui

    2011-01-01

    Objective: To generate eukaryotic expression vector of pcDNA3-UHRF1(ubiquitin-like, containing PHD and RING finger domains 1, UHRF1) and testify its expression in breast cancer cells MDA-MB-231. Methods: A 2.3 kb cDNA fragment was amplified from the total RNA of the human breast cancer cells MCF-7 by the RT-PCR method and was cloned into the plasmid pcDNA3. The vector was identified by the double digestion with restriction enzymes Kpn I and Xho I and was sequenced. The cDNA of UHRF1 was transfected into human breast cancer cells MDA-MB-231 by Lipofactamin2000. The positive clones were selected by G418. The expression of the UHRF1 was detected by RT-PCR and Western blot analysis. Results: The recombinant eukaryotic expression vector pcDNA3-UHRF1 was digested with Kpn I and BamH I, and the electrophoresis of the digested products showed two fragments; 2.3kb fragment of UHRF1 and 5.4 kb fragment of pcDNA3, and the sequence inserted was identical to the published sequence. The MDA-MB-231 cells transfected with the pcDNA3-UHRF1 plasmid expressed a high level of the UHRF1 mRNA and protein. Conclusion: The recombinant eukaryotic cell expression vector of pcDNA3-UHRF1 is constructed successfully. The recombinant plasmid pcDNA3-UHRF1 can provide a very useful tool and lay an important foundation for the research on the function of UHRF1. (authors)

  19. Failure Capacity Evaluation for Anchor System of NPP Facilities by using a Shaking Table Test

    International Nuclear Information System (INIS)

    Kwon, Hyung O; Jung, Min Ki; Park, Jin Wan; Lim, Ji Hoon

    2010-02-01

    This study investigate the destructive influence of crack locations on the anchor performance to evaluate the seismic performance of NPP equipment anchored on damaged concrete. For this purpose, small-scale specimens were fabricated according to the following three cases: 1) with a non-damaged anchor; 2) with cracks running through the anchor; and 3) with cracks along the expected corn-shape fracture away from the anchor. The result verified with the finite element method is as follows: In the first and second cases that is, with a non-damaged anchor and with cracks running through the anchor destruction occurred at the anchor steel. In the third case that is, with cracks around the anchor, a 30% decline in the seismic performance was identified. This result indicates that evaluation of seismic performance and relevant reinforcement are required when cracks occur away from the anchor along the expected destructive surface

  20. Development, distribution and application of DNA markers for cereal research

    International Nuclear Information System (INIS)

    Qi, X.; Stephenson, P.; Devos, K.M.; Gale, M.D.

    2001-01-01

    DNA probes and primers are important resources for molecular genetic research and molecular breeding. Presently, more than 2500 wheat probes, 400 barley probes, 800 foxtail, pearl millet and finger millet probes, and approximately 150 wheat microsatellite (SSR) primer pairs have been developed and maintained in our DNA Resource Centre at the John Innes Centre (JIC). To accelerate probe and primer distribution, an 'anchor set' and a 'supplementary anchor set', containing 73 and 31 wheat RFLP probes, respectively, and a standard set of 42 primer pairs for wheat SSR markers were selected. Similarly, a set of 52 pearl millet probes has been selected for distribution. More than 8000 wheat RFLP probes, 2000 wheat SSR primer pairs, 700 millet probes and 200 barley probes have been distributed to more than 250 research groups in 40 countries. Our wheat and millet probes and other grass cDNA probes have been used for comparative genetic studies. The revealed conservation of gene content and gene order has been used to construct maps of many grass species and to predict the locations of key genes from one crop species to another. Developed SSR and AFLP markers in wheat, barley and millet are particularly suited for genetic diversity analyses and map construction. (author)

  1. The anchoring bias reflects rational use of cognitive resources.

    Science.gov (United States)

    Lieder, Falk; Griffiths, Thomas L; M Huys, Quentin J; Goodman, Noah D

    2018-02-01

    Cognitive biases, such as the anchoring bias, pose a serious challenge to rational accounts of human cognition. We investigate whether rational theories can meet this challenge by taking into account the mind's bounded cognitive resources. We asked what reasoning under uncertainty would look like if people made rational use of their finite time and limited cognitive resources. To answer this question, we applied a mathematical theory of bounded rationality to the problem of numerical estimation. Our analysis led to a rational process model that can be interpreted in terms of anchoring-and-adjustment. This model provided a unifying explanation for ten anchoring phenomena including the differential effect of accuracy motivation on the bias towards provided versus self-generated anchors. Our results illustrate the potential of resource-rational analysis to provide formal theories that can unify a wide range of empirical results and reconcile the impressive capacities of the human mind with its apparently irrational cognitive biases.

  2. Anchored but not internalized: shape dependent endocytosis of nanodiamond

    Science.gov (United States)

    Zhang, Bokai; Feng, Xi; Yin, Hang; Ge, Zhenpeng; Wang, Yanhuan; Chu, Zhiqin; Raabova, Helena; Vavra, Jan; Cigler, Petr; Liu, Renbao; Wang, Yi; Li, Quan

    2017-04-01

    Nanoparticle-cell interactions begin with the cellular uptake of the nanoparticles, a process that eventually determines their cellular fate. In the present work, we show that the morphological features of nanodiamonds (NDs) affect both the anchoring and internalization stages of their endocytosis. While a prickly ND (with sharp edges/corners) has no trouble of anchoring onto the plasma membrane, it suffers from difficult internalization afterwards. In comparison, the internalization of a round ND (obtained by selective etching of the prickly ND) is not limited by its lower anchoring amount and presents a much higher endocytosis amount. Molecular dynamics simulation and continuum modelling results suggest that the observed difference in the anchoring of round and prickly NDs likely results from the reduced contact surface area with the cell membrane of the former, while the energy penalty associated with membrane curvature generation, which is lower for a round ND, may explain its higher probability of the subsequent internalization.

  3. Development of biometric DNA ink for authentication security.

    Science.gov (United States)

    Hashiyada, Masaki

    2004-10-01

    Among the various types of biometric personal identification systems, DNA provides the most reliable personal identification. It is intrinsically digital and unchangeable while the person is alive, and even after his/her death. Increasing the number of DNA loci examined can enhance the power of discrimination. This report describes the development of DNA ink, which contains synthetic DNA mixed with printing inks. Single-stranded DNA fragments encoding a personalized set of short tandem repeats (STR) were synthesized. The sequence was defined as follows. First, a decimal DNA personal identification (DNA-ID) was established based on the number of STRs in the locus. Next, this DNA-ID was encrypted using a binary, 160-bit algorithm, using a hashing function to protect privacy. Since this function is irreversible, no one can recover the original information from the encrypted code. Finally, the bit series generated above is transformed into base sequences, and double-stranded DNA fragments are amplified by the polymerase chain reaction (PCR) to protect against physical attacks. Synthesized DNA was detected successfully after samples printed in DNA ink were subjected to several resistance tests used to assess the stability of printing inks. Endurance test results showed that this DNA ink would be suitable for practical use as a printing ink and was resistant to 40 hours of ultraviolet exposure, performance commensurate with that of photogravure ink. Copyright 2004 Tohoku University Medical Press

  4. Eukaryotic DNA Replication Fork.

    Science.gov (United States)

    Burgers, Peter M J; Kunkel, Thomas A

    2017-06-20

    This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.

  5. Plant glycosylphosphatidylinositol (GPI) anchored proteins at the plasma membrane-cell wall nexus.

    Science.gov (United States)

    Yeats, Trevor H; Bacic, Antony; Johnson, Kim L

    2018-04-18

    Approximately 1% of plant proteins are predicted to be post-translationally modified with a glycosylphosphatidylinositol (GPI) anchor that tethers the polypeptide to the outer leaflet of the plasma membrane. While the synthesis and structure of GPI anchors is largely conserved across eukaryotes, the repertoire of functional domains present in the GPI-anchored proteome has diverged substantially. In plants, this includes a large fraction of the GPI-anchored proteome being further modified with plant-specific arabinogalactan (AG) O-glycans. The importance of the GPI-anchored proteome to plant development is underscored by the fact that GPI biosynthetic null mutants exhibit embryo lethality. Mutations in genes encoding specific GPI-anchored proteins (GAPs) further supports their contribution to diverse biological processes occurring at the interface of the plasma membrane and cell wall, including signaling, cell wall metabolism, cell wall polymer cross-linking, and plasmodesmatal transport. Here, we review the literature concerning plant GPI-anchored proteins in the context of their potential to act as molecular hubs that mediate interactions between the plasma membrane and the cell wall and their potential to transduce the signal into the protoplast and thereby activate signal transduction pathways. This article is protected by copyright. All rights reserved.

  6. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  7. Numerical Simulation of Electro-Mechanical Impedance Response in Cable-Anchor Connection Interface

    International Nuclear Information System (INIS)

    Nguyen, Khac Duy; Kim, Jeong Tae

    2011-01-01

    In this study, a finite element(FE) analysis on electro-mechanical impedance response of cable-anchor connection interface under various anchor force is presented. In order to achieve the objective, the following approaches are implemented. Firstly, an interface washer coupled with piezoelectric(PZT) material is designed for monitoring cable-force loss. The interface washer is a small aluminum plate on which a PZT patch is surface-bonded. Cable-force loss could be monitored by installing the interface washer between the anchor plate and the anchorage of cable-anchor connection and examining the changes of impedance of the interface washer. Secondly, a FE model for cable-anchor connection is established to examine the effect of cable-force on impedance response of interface washer. Also, the effects of geometrical and material properties of the interface washer on impedance responses under various cable-forces are investigated. Finally, validation of the FE analysis is experimentally evaluated by a lab-scale cable-anchor connection

  8. Unintended anchors: Building rating systems and energy performance goals for U.S. buildings

    International Nuclear Information System (INIS)

    Klotz, Leidy; Mack, Daniel; Klapthor, Brent; Tunstall, Casey; Harrison, Jennilee

    2010-01-01

    In the U.S., where buildings account for 40% of energy use, commercial buildings use more energy per unit area than ever before. However, exemplary buildings demonstrate the feasibility of much better energy performance at no additional first cost. This research examines one possible explanation for this inconsistency. The aim is to investigate whether the anchoring bias, which refers to our tendency to gravitate towards a pre-defined standard regardless of its relevance, influences energy performance goals in building design. The scope examines professionals who help set energy performance goals for U.S. buildings. Prior to being asked to set an energy performance goal, these professionals were randomly directed to one of three series of questions. One series set an anchor of 90% energy reduction beyond standard practice, one set a 30% anchor, and one set no anchor. Respondents exposed to the 90% anchor, and respondents exposed to no anchor at all, set higher energy performance goals than respondents exposed to the 30% anchor. These results suggest that building rating systems that only reward incremental energy improvements may inadvertently create anchors, thereby discouraging more advanced energy performance goals and inhibiting energy performance that is technically and economically feasible.

  9. DNA polymerase-beta is expressed early in neurons of Alzheimer's disease brain and is loaded into DNA replication forks in neurons challenged with beta-amyloid

    NARCIS (Netherlands)

    Copani, Agata; Hoozemans, Jeroen J. M.; Caraci, Filippo; Calafiore, Marco; van Haastert, Elise S.; Veerhuis, Robert; Rozemuller, Annemieke J. M.; Aronica, Eleonora; Sortino, Maria Angela; Nicoletti, Ferdinando

    2006-01-01

    Cultured neurons exposed to synthetic beta-amyloid (Abeta) fragments reenter the cell cycle and initiate a pathway of DNA replication that involves the repair enzyme DNA polymerase-beta (DNA pol-beta) before undergoing apoptotic death. In this study, by performing coimmunoprecipitation experiments

  10. Proteomic analysis of GPI-anchored membrane proteins

    DEFF Research Database (Denmark)

    Jung, Hye Ryung; Jensen, Ole Nørregaard

    2006-01-01

    Glycosyl-phosphatidyl-inositol-anchored proteins (GPI-APs) represent a subset of post-translationally modified proteins that are tethered to the outer leaflet of the plasma membrane via a C-terminal GPI anchor. GPI-APs are found in a variety of eukaryote species, from pathogenic microorganisms...... to humans. GPI-APs confer important cellular functions as receptors, enzymes and scaffolding molecules. Specific enzymes and detergent extraction methods combined with separation technologies and mass spectrometry permit proteomic analysis of GPI-APs from plasma membrane preparations to reveal cell...

  11. DNA polymorphism of HLA class II genes in systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Cowland, J B; Andersen, V; Halberg, P

    1994-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3......- and DRw6-associated 7.00 kb DRB TaqI DNA fragment was found in SLE patients compared to normal controls (83.3% vs 35.5%; RR = 9.1, p 1*0501-associated 4.56 kb DQA TaqI fragment and the DRB3*01/03-associated 9.79 kb TaqI fragment were also found to be significantly...... increased in SLE patients (70.8% vs 29.7%; RR = 5.8, p 1%; RR = 4.3, p

  12. Anchor stabilization of trapped particle modes in mirror machines

    International Nuclear Information System (INIS)

    Berk, H.L.; Roslyakov, G.V.

    1986-07-01

    It is shown that for trapped particle modes in tandem mirrors, the pressure of the passing particles in the anchor region introduces a stabilizing term proportional to the sum of the anchor's field line curvature and total diamagnetic pressure. The theory is applied to the proposed gas dynamic trap experiment

  13. Anchor stabilization of trapped particle modes in mirror machines

    International Nuclear Information System (INIS)

    Berk, H.L.; Roslyakov, G.V.

    1986-04-01

    It is shown that for trapped particle modes in tandem mirrors, the pressure of the passing particles in the anchor region introduces a stabilizing term proportional to the sum of the anchor's field line curvature and total diamagnetic pressure. The theory is applied to the proposed gas dynamic trap experiment

  14. DNA fingerprinting of pearls to determine their origins.

    Directory of Open Access Journals (Sweden)

    Joana B Meyer

    Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

  15. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  16. Genetic transformation of watermelon with pumpkin DNA by low energy ion beam-mediated introduction

    International Nuclear Information System (INIS)

    Wang Haobo; Guo Jinhua; Huang Qunce; Yu Zengliang

    2002-01-01

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N + implantation at the dosage of 7.8 x 10 16 ions/cm 2 . After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 degree C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor

  17. Genetic Transformation of Watermelon with Pumpkin DNA by Low Energy Ion Beam-Mediated Introduction

    Science.gov (United States)

    Wang, Hao-bo; Gao, Xiu-wu; Guo, Jin-hua; Huang, Qun-ce; Yu, Zeng-liang

    2002-12-01

    The No.601 watermelon (citrullus lanatus) seeds were treated with 25 keV N+ implantation at the dosage of 7.8 × 1016 ions/cm2. After treatment, watermelon seeds were incubated with 380 μg/μl pumpkin (Cucubita, maxima Duch) DNA solution at 35 °C for 5 hours. By two-generations of selection and resistance screening at seedling stage, one transformed material was selected out, whose rind color is similar to that of the donor pumpkin and whose size of seeds is between that of the donor and the receptor. Using AFLP (amplified fragment length polymorphism) technique, two polymorphic DNA fragments were amplified. This primarily testified that the donor DNA fragments/gene were introduced into the receptor cell and integrated into the genomic DNA of the receptor.

  18. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    International Nuclear Information System (INIS)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    2004-01-01

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component of oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication

  19. RAD51 interconnects between DNA replication, DNA repair and immunity.

    Science.gov (United States)

    Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame

    2017-05-05

    RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Steel shear strength of anchors with stand-off base plates.

    Science.gov (United States)

    2013-09-01

    Sign and signal structures are often connected to concrete foundations through a stand-off annular base plate with a double-nut anchor bolt connection, which leaves exposed anchor bolt lengths below leveling nuts used in these connections. Cantilever...

  1. Simplified design of flexible expansion anchored plates for nuclear structures

    International Nuclear Information System (INIS)

    Mehta, N.K.; Hingorani, N.V.; Longlais, T.G.; Sargent and Lundy, Chicago, IL)

    1984-01-01

    In nuclear power plant construction, expansion anchored plates are used to support pipe, cable tray and HVAC duct hangers, and various structural elements. The expansion anchored plates provide flexibility in the installation of field-routed lines where cast-in-place embedments are not available. General design requirements for expansion anchored plate assemblies are given in ACI 349, Appendix B (1). The manufacturers recommend installation procedures for their products. Recent field testing in response to NRC Bulletin 79-02 (2) indicates that anchors, installed in accordance with manufacturer's recommended procedures, perform satisfactorily under static and dynamic loading conditions. Finite element analysis is a useful tool to correctly analyze the expansion anchored plates subject to axial tension and biaxial moments, but it becomes expensive and time-consuming to apply this tool for a large number of plates. It is, therefore, advantageous to use a simplified method, even though it may be more conservative as compared to the exact method of analysis. This paper presents a design method referred to as the modified rigid plate analysis approach to simplify both the initial design and the review of as-built conditions

  2. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  3. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  4. Biomechanical advantages of triple-loaded suture anchors compared with double-row rotator cuff repairs.

    Science.gov (United States)

    Barber, F Alan; Herbert, Morley A; Schroeder, F Alexander; Aziz-Jacobo, Jorge; Mays, Matthew M; Rapley, Jay H

    2010-03-01

    To evaluate the strength and suture-tendon interface security of various suture anchors triply and doubly loaded with ultrahigh-molecular weight polyethylene-containing sutures and to evaluate the relative effectiveness of placing these anchors in a single-row or double-row arrangement by cyclic loading and then destructive testing. The infraspinatus muscle was reattached to the original humeral footprint by use of 1 of 5 different repair patterns in 40 bovine shoulders. Two single-row repairs and three double-row repairs were tested. High-strength sutures were used for all repairs. Five groups were studied: group 1, 2 triple-loaded screw suture anchors in a single row with simple stitches; group 2, 2 triple-loaded screw anchors in a single row with simple stitches over a fourth suture passed perpendicularly ("rip-stop" stitch); group 3, 2 medial and 2 lateral screw anchors with a single vertical mattress stitch passed from the medial anchors and 2 simple stitches passed from the lateral anchors; group 4, 2 medial double-loaded screw anchors tied in 2 mattress stitches and 2 push-in lateral anchors capturing the medial sutures in a "crisscross" spanning stitch; and group 5, 2 medial double-loaded screw anchors tied in 2 mattress stitches and 2 push-in lateral anchors creating a "suture-bridge" stitch. The specimens were cycled between 10 and 180 N at 1.0 Hz for 3,500 cycles or until failure. Endpoints were cyclic loading displacement (5 and 10 mm), total displacement, and ultimate failure load. A single row of triply loaded anchors was more resistant to stretching to a 5- and 10-mm gap than the double-row repairs with or without the addition of a rip-stop suture (P row repair (P row created by 2 medial double-loaded suture anchors and 2 lateral push-in anchors stretched more than any other group (P row repairs with either crossing sutures or 4 separate anchor points were more likely to fail (5- or 10-mm gap) than a single-row repair loaded with 3 simple sutures

  5. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  6. Management of subluxated capsular bag-fixated intraocular lenses using a capsular anchor

    NARCIS (Netherlands)

    Ton, Yokrat; Naftali, Modi; Lapid Gortzak, Ruth; Assia, Ehud I.

    2016-01-01

    We describe the use of the capsular anchor (AssiAnchor) to manage a subluxated intraocular lens (IOL) in the capsular bag. The anchor comprises 2 prongs that hold the anterior lens capsule and a central rod that is sutured to the scleral wall, enabling centration of the IOL-capsular bag complex. Six

  7. Suture slippage in knotless suture anchors resulting in subacromial-subdeltoid bursitis.

    Science.gov (United States)

    Hayeri, Mohammad Reza; Keefe, Daniel T; Chang, Eric Y

    2016-05-01

    Rotator cuff repair using a suture bridge and knotless suture anchors is a relatively new, but increasingly used technique. The suture bridge technique creates an anatomically similar and more secure rotator cuff repair compared with conventional arthroscopic techniques and the use of knotless anchors eliminates the challenges associated with knot tying during arthroscopic surgery. However, previous in vitro biomechanical tests have shown that the hold of the suture in a knotless suture anchor is far lower than the pullout strength of the anchor from bone. Up until now slippage has been a theoretical concern. We present a prospectively diagnosed case of in vivo suture loosening after rotator cuff repair using a knotless bridge technique resulting in subacromial-subdeltoid bursitis.

  8. Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

    Science.gov (United States)

    Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

    2018-01-01

    Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

  9. Understanding Rasch Measurement: Partial Credit Model and Pivot Anchoring.

    Science.gov (United States)

    Bode, Rita K.

    2001-01-01

    Describes the Rasch measurement partial credit model, what it is, how it differs from other Rasch models, and when and how to use it. Also describes the calibration of instruments with increasingly complex items. Explains pivot anchoring and illustrates its use and describes the effect of pivot anchoring on step calibrations, item hierarchy, and…

  10. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Science.gov (United States)

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  11. Intermittent use of an "anchor system" improves postural control in healthy older adults.

    Science.gov (United States)

    Freitas, Milena de Bem Zavanella; Mauerberg-deCastro, Eliane; Moraes, Renato

    2013-07-01

    Haptic information, provided by a non-rigid tool (i.e., an "anchor system"), can reduce body sway in individuals who perform a standing postural task. However, it was not known whether or not continuous use of the anchor system would improve postural control after its removal. Additionally, it was unclear as to whether or not frequency of use of the anchor system is related to improved control in older adults. The present study evaluated the effect of the prolonged use of the anchor system on postural control in healthy older individuals, at different frequencies of use, while they performed a postural control task (semi-tandem position). Participants were divided into three groups according to the frequency of the anchor system's use (0%, 50%, and 100%). Pre-practice phase (without anchor) was followed by a practice phase (they used the anchor system at the predefined frequency), and a post-practice phase (immediate and late-without anchor). All three groups showed a persistent effect 15min after the end of the practice phase (immediate post-practice phase). However, only the 50% group showed a persistent effect in the late post-practice phase (24h after finishing the practice phase). Older adults can improve their postural control by practicing the standing postural task, and use of the anchor system limited to half of their practice time can provide additional improvement in their postural control. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Model test of anchoring effect on zonal disintegration in deep surrounding rock masses.

    Science.gov (United States)

    Chen, Xu-Guang; Zhang, Qiang-Yong; Wang, Yuan; Liu, De-Jun; Zhang, Ning

    2013-01-01

    The deep rock masses show a different mechanical behavior compared with the shallow rock masses. They are classified into alternating fractured and intact zones during the excavation, which is known as zonal disintegration. Such phenomenon is a great disaster and will induce the different excavation and anchoring methodology. In this study, a 3D geomechanics model test was conducted to research the anchoring effect of zonal disintegration. The model was constructed with anchoring in a half and nonanchoring in the other half, to compare with each other. The optical extensometer and optical sensor were adopted to measure the displacement and strain changing law in the model test. The displacement laws of the deep surrounding rocks were obtained and found to be nonmonotonic versus the distance to the periphery. Zonal disintegration occurs in the area without anchoring and did not occur in the model under anchoring condition. By contrasting the phenomenon, the anchor effect of restraining zonal disintegration was revealed. And the formation condition of zonal disintegration was decided. In the procedure of tunnel excavation, the anchor strain was found to be alternation in tension and compression. It indicates that anchor will show the nonmonotonic law during suppressing the zonal disintegration.

  13. Model Test of Anchoring Effect on Zonal Disintegration in Deep Surrounding Rock Masses

    Directory of Open Access Journals (Sweden)

    Xu-Guang Chen

    2013-01-01

    Full Text Available The deep rock masses show a different mechanical behavior compared with the shallow rock masses. They are classified into alternating fractured and intact zones during the excavation, which is known as zonal disintegration. Such phenomenon is a great disaster and will induce the different excavation and anchoring methodology. In this study, a 3D geomechanics model test was conducted to research the anchoring effect of zonal disintegration. The model was constructed with anchoring in a half and nonanchoring in the other half, to compare with each other. The optical extensometer and optical sensor were adopted to measure the displacement and strain changing law in the model test. The displacement laws of the deep surrounding rocks were obtained and found to be nonmonotonic versus the distance to the periphery. Zonal disintegration occurs in the area without anchoring and did not occur in the model under anchoring condition. By contrasting the phenomenon, the anchor effect of restraining zonal disintegration was revealed. And the formation condition of zonal disintegration was decided. In the procedure of tunnel excavation, the anchor strain was found to be alternation in tension and compression. It indicates that anchor will show the nonmonotonic law during suppressing the zonal disintegration.

  14. Calculation of anchor forces on penetration liners for the reactor vessel Schmehausen (Germany)

    International Nuclear Information System (INIS)

    Roennert, J.K.

    1976-01-01

    Penetrations through the walls of the single cavity PCPV Prestressed Concrete Pressure Vessel for the 300 MW(e) reactor are lined with steel penetration liners welded to the liner of the cavity. For gas-tightness of the system the penetrations are closed by covers. To secure their integration with the concrete, the liners are anchored to it by means of shear studs and/or angles. Being embedded in concrete, over the full width of the walls, the liners are exposed to lateral and longitudinal concrete deformations causing forces on the anchors. The axial blow-out force due to the pressure of the coolant on the closures must also be transferred through the anchors to the concrete. In the design of anchored penetration liners stress analyses are performed to determine anchor forces under different loading conditions and at several ages of the PCPV. The present paper deals with the mathematical estimation of the anchor forces on the basis of given concrete deformations, temperature of liners, and pressure in the vessel by the method of replacing the penetration liners and their anchors by a spring model with linear stiffness characteristics for both the liner and the anchors. An example of the computations on a digital computer is shown. (author)

  15. Metagenome Fragment Classification Using -Mer Frequency Profiles

    Directory of Open Access Journals (Sweden)

    Gail Rosen

    2008-01-01

    Full Text Available A vast amount of microbial sequencing data is being generated through large-scale projects in ecology, agriculture, and human health. Efficient high-throughput methods are needed to analyze the mass amounts of metagenomic data, all DNA present in an environmental sample. A major obstacle in metagenomics is the inability to obtain accuracy using technology that yields short reads. We construct the unique -mer frequency profiles of 635 microbial genomes publicly available as of February 2008. These profiles are used to train a naive Bayes classifier (NBC that can be used to identify the genome of any fragment. We show that our method is comparable to BLAST for small 25 bp fragments but does not have the ambiguity of BLAST's tied top scores. We demonstrate that this approach is scalable to identify any fragment from hundreds of genomes. It also performs quite well at the strain, species, and genera levels and achieves strain resolution despite classifying ubiquitous genomic fragments (gene and nongene regions. Cross-validation analysis demonstrates that species-accuracy achieves 90% for highly-represented species containing an average of 8 strains. We demonstrate that such a tool can be used on the Sargasso Sea dataset, and our analysis shows that NBC can be further enhanced.

  16. A scale distortion theory of anchoring.

    Science.gov (United States)

    Frederick, Shane W; Mochon, Daniel

    2012-02-01

    We propose that anchoring is often best interpreted as a scaling effect--that the anchor changes how the response scale is used, not how the focal stimulus is perceived. Of importance, we maintain that this holds true even for so-called objective scales (e.g., pounds, calories, meters, etc.). In support of this theory of scale distortion, we show that prior exposure to a numeric standard changes respondents' use of that specific response scale but does not generalize to conceptually affiliated judgments rendered on similar scales. Our findings highlight the necessity of distinguishing response language effects from representational effects in places where the need for that distinction has often been assumed away.

  17. Retractable Robotic Anchor for Hard Rock and Granular Soils, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — ProtoInnovations, LLC, is developing an innovative retractable robotic anchor that works in hard rock and granular soils permitting anchoring and subsequent...

  18. Evaluation of irradiation in foods using DNA comet assay

    International Nuclear Information System (INIS)

    Khawar, Affaf; Bhatti, Ijaz Ahmad; Khan, Q.M.; Ali, T.; Khan, A.I.; Asi, M.R.

    2011-01-01

    Comet assay is a rapid, inexpensive and sensitive biological technique to detect DNA damage in food stuffs by irradiation. In this study the Comet assay is applied on foods of plant and animal origins. Samples were irradiated by using 60 Co gamma-radiation source. The applied doses were 2, 6 and 10 kGy for food of plant origin and 0.5, 1 and 2 kGy for meat items. The un-irradiated and irradiated samples were clearly differentiated on the basis of DNA fragmentation. During the electrophoresis study, it was found that in un-irradiated cells DNA remained intact and appeared as Comets without tail whereas in irradiated cells Comets with tails were visible due to stretching of fragmented DNA. Moreover, it was also revealed that the DNA tail length was dose dependent. Dry food stuffs (seeds) showed good results as compared to moist foods (meat, fruits and vegetables) due to the absence of background damage. (author)

  19. Software Note: Using BILOG for Fixed-Anchor Item Calibration

    Science.gov (United States)

    DeMars, Christine E.; Jurich, Daniel P.

    2012-01-01

    The nonequivalent groups anchor test (NEAT) design is often used to scale item parameters from two different test forms. A subset of items, called the anchor items or common items, are administered as part of both test forms. These items are used to adjust the item calibrations for any differences in the ability distributions of the groups taking…

  20. Not all nutrition claims are perceived equal: anchoring effects and moderating mechanisms in food advertising.

    Science.gov (United States)

    Paek, Hye-Jin; Yoon, Hye Jin; Hove, Thomas

    2011-03-01

    Despite the increased use of health claims in food advertising, few studies have investigated how specific nutrition claims have differential effects depending on how they are presented. In this context, the current study tests the anchoring hypothesis. Anchoring refers to a common human tendency to evaluate information differently depending on the presence or absence of a numerical "anchor" or reference point. Two (pilot and main) experimental studies explore anchoring effects on audience response to food advertising both directly and moderated by cognitive, motivational, and message factors. The pilot study finds that food product ads employing nutrition claims with an anchor rather than without an anchor generate two results: First, participants perceive the product to have lower fat/lower calorie contents (anchoring hypothesis); second, they prefer the messages with an anchor over those without an anchor. The main study reports that when anchoring is successfully evoked, it produces favorable attitudes toward the ad, favorable attitudes toward the brand, and purchase intention-but only when moderated by health orientation, claim believability, and nutrition knowledge. Practical implications are provided with respect to regulatory guidelines and effective communication strategies for promoting low-fat and low-calorie products in food advertising.

  1. Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

    Science.gov (United States)

    Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

    2014-01-01

    DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic

  2. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  3. Career Anchors: Results of an Organisational Study in the UK.

    Science.gov (United States)

    Yarnall, Jane

    1998-01-01

    Career anchors of 374 British employees were identified using Schein's questionnaire. Age, gender, and length of service had no significant effect on distribution of anchors. Job level had some relationship. The information could be used to determine appropriate career-development strategies. (SK)

  4. Robotic Ankle for Omnidirectional Rock Anchors

    Science.gov (United States)

    Parness, Aaron; Frost, Matthew; Thatte, Nitish

    2013-01-01

    Future robotic exploration of near-Earth asteroids and the vertical and inverted rock walls of lava caves and cliff faces on Mars and other planetary bodies would require a method of gripping their rocky surfaces to allow mobility without gravitational assistance. In order to successfully navigate this terrain and drill for samples, the grippers must be able to produce anchoring forces in excess of 100 N. Additionally, the grippers must be able to support the inertial forces of a moving robot, as well gravitational forces for demonstrations on Earth. One possible solution would be to use microspine arrays to anchor to rock surfaces and provide the necessary load-bearing abilities for robotic exploration of asteroids. Microspine arrays comprise dozens of small steel hooks supported on individual suspensions. When these arrays are dragged along a rock surface, the steel hooks engage with asperities and holes on the surface. The suspensions allow for individual hooks to engage with asperities while the remaining hooks continue to drag along the surface. This ensures that the maximum possible number of hooks engage with the surface, thereby increasing the load-bearing abilities of the gripper. Using the microspine array grippers described above as the end-effectors of a robot would allow it to traverse terrain previously unreachable by traditional wheeled robots. Furthermore, microspine-gripping robots that can perch on cliffs or rocky walls could enable a new class of persistent surveillance devices for military applications. In order to interface these microspine grippers with a legged robot, an ankle is needed that can robotically actuate the gripper, as well as allow it to conform to the large-scale irregularities in the rock. The anchor serves three main purposes: deploy and release the anchor, conform to roughness or misalignment with the surface, and cancel out any moments about the anchor that could cause unintentional detachment. The ankle design contains a

  5. Isolation of a sex-linked DNA sequence in cranes.

    Science.gov (United States)

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  6. Assessment of behavior, design and testing of anchors for fastening to concrete

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Young Soo; Choi, Han Tae; Jung, Woo Young; Park, Sung Kyun [Korea Univ., Seoul (Korea, Republic of)

    1998-11-15

    This report presents the evaluation of behavior and the prediction of tensile capacity of anchors that fail concrete, as the design basis for anchorage. Tests of cast-in place headed anchors, domestically manufactured and installed in uncracked, unreinforced concrete were performed to investigate the behavior of single anchors and multiple anchors with the consideration of various embedment lengths and edge distances. The failure mode and the load-deformation response of these anchors are discussed and the concrete failure data then compared with capacities by the two exiting methods : the 45 degree cone method of ACI 349, appendix B and the Concrete Capacity Design (CCD) method. Discrepancies between the test results and these two prediction methods are assessed and also the basic differences in philosophy and the factors contributing to the philosophical differences in these two methods are addressed.

  7. Architecture of the human and yeast general transcription and DNA repair factor TFIIH

    Science.gov (United States)

    Luo, Jie; Cimermancic, Peter; Viswanath, Shruthi; Ebmeier, Christopher C.; Kim, Bong; Dehecq, Marine; Raman, Vishnu; Greenberg, Charles H.; Pellarin, Riccardo; Sali, Andrej; Taatjes, Dylan J.; Hahn, Steven; Ranish, Jeff

    2015-01-01

    Summary TFIIH is essential for both RNA polymerase II transcription and DNA repair, and mutations in TFIIH can result in human disease. Here, we determine the molecular architecture of human and yeast TFIIH by an integrative approach using chemical crosslinking/mass spectrometry (CXMS) data, biochemical analyses, and previously published electron microscopy maps. We identified four new conserved “topological regions” that function as hubs for TFIIH assembly and more than 35 conserved topological features within TFIIH, illuminating a network of interactions involved in TFIIH assembly and regulation of its activities. We show that one of these conserved regions, the p62/Tfb1 Anchor region, directly interacts with the DNA helicase subunit XPD/Rad3 in native TFIIH and is required for the integrity and function of TFIIH. We also reveal the structural basis for defects in patients with Xeroderma pigmentosum and Trichothiodystrophy, with mutations found at the interface between the p62 Anchor region and the XPD subunit. PMID:26340423

  8. Effects of anchoring and adjustment in the evaluation of product pricing.

    Science.gov (United States)

    Elaad, Eitan; Sayag, Neta; Ezer, Aliya

    2010-08-01

    Anchoring and adjustment comprise a heuristic that creates expectations. Two types of anchors were applied on participants' evaluation of products: the price reference of the product (maximum, minimum, or no price reference) and the context in which the products were evaluated (the prestige of the shopping center). Results showed that both factors anchored evaluations of products' value. Context effects were explained by the different expectations of visitors in prestigious (looking for quality) and less prestigious (seeking a bargain) centers.

  9. Characterization of the C-terminal ER membrane anchor of PTP1B

    International Nuclear Information System (INIS)

    Anderie, Ines; Schulz, Irene; Schmid, Andreas

    2007-01-01

    The tyrosine phosphatase PTP1B is an important regulator of cell function. In living cells PTP1B activity is restricted to the vicinity of the endoplasmic reticulum (ER) by post-translational C-terminal attachment of PTP1B to the ER membrane network. In our study we investigated the membrane anchor of PTP1B by use of EGFP fusion proteins. We demonstrate that the membrane anchor of PTP1B cannot be narrowed down to a unique amino acid sequence with a defined start and stop point but rather is moveable within several amino acids. Removal of up to seven amino acids from the C-terminus, as well as exchange of single amino acids in the putative transmembrane sequence did not influence subcellular localization of PTP1B. With the method of bimolecular fluorescence complementation we could demonstrate dimerization of PTP1B in vivo. Homodimerization was, in contrast to other tail-anchored proteins, not dependent on the membrane anchor. Our data demonstrate that the C-terminal membrane anchor of PTP1B is formed by a combination of a single stretch transmembrane domain (TMD) followed by a tail. TMD and tail length are variable and there are no sequence-specific features. Our data for PTP1B are consistent with a concept that explains the ER membrane anchor of tail-anchored proteins as a physicochemical structure

  10. Bone anchors or interference screws? A biomechanical evaluation for autograft ankle stabilization.

    Science.gov (United States)

    Jeys, Lee; Korrosis, Sotiris; Stewart, Todd; Harris, Nicholas J

    2004-01-01

    Autograft stabilization uses free semitendinosus tendon grafts to anatomically reconstruct the anterior talofibular ligament. Study aims were to evaluate the biomechanical properties of Mitek GII anchors compared with the Arthrex Bio-Tenodesis Screw for free tendon reconstruction of the anterior talofibular ligament. There are no differences in load to failure and percentage specimen elongation at failure between the 2 methods. Controlled laboratory study using porcine models. Sixty porcine tendon constructs were failure tested. Re-creating the pull of the anterior talofibular ligament, loads were applied at 70 degrees to the bones. Thirty-six tendons were fixed to porcine tali and tested using a single pull to failure; 10 were secured with anchors and No. 2 Ethibond, 10 with anchors and FiberWire, 10 with screws and Fiberwire, and 6 with partially gripped screws. Cyclic preloading was conducted on 6 tendons fixed by anchors and on 6 tendons fixed by screws before failure testing. Two groups of 6 components fixed to the fibula were also tested. The talus single-pull anchor group produced a mean load of 114 N and elongation of 37% at failure. The talus single-pull screw group produced a mean load of 227 N and elongation of 22% at failure (P anchors. The improved biomechanics of interference screws suggests that these may be more suited to in vivo reconstruction of the anterior talofibular ligament than are bone anchors.

  11. Reinforcing mechanism of anchors in slopes: a numerical comparison of results of LEM and FEM

    Science.gov (United States)

    Cai, Fei; Ugai, Keizo

    2003-06-01

    This paper reports the limitation of the conventional Bishop's simplified method to calculate the safety factor of slopes stabilized with anchors, and proposes a new approach to considering the reinforcing effect of anchors on the safety factor. The reinforcing effect of anchors can be explained using an additional shearing resistance on the slip surface. A three-dimensional shear strength reduction finite element method (SSRFEM), where soil-anchor interactions were simulated by three-dimensional zero-thickness elasto-plastic interface elements, was used to calculate the safety factor of slopes stabilized with anchors to verify the reinforcing mechanism of anchors. The results of SSRFEM were compared with those of the conventional and proposed approaches for Bishop's simplified method for various orientations, positions, and spacings of anchors, and shear strengths of soil-grouted body interfaces. For the safety factor, the proposed approach compared better with SSRFEM than the conventional approach. The additional shearing resistance can explain the influence of the orientation, position, and spacing of anchors, and the shear strength of soil-grouted body interfaces on the safety factor of slopes stabilized with anchors.

  12. Differential expression analysis of genic male sterility by cDNA-AFLP in maize

    International Nuclear Information System (INIS)

    Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju

    2009-01-01

    The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)

  13. Anchoring in a novel bimanual coordination pattern.

    Science.gov (United States)

    Maslovat, Dana; Lam, Melanie Y; Brunke, Kirstin M; Chua, Romeo; Franks, Ian M

    2009-02-01

    Anchoring in cyclical movements has been defined as regions of reduced spatial or temporal variability [Beek, P. J. (1989). Juggling dynamics. PhD thesis. Amsterdam: Free University Press] that are typically found at movement reversal points. For in-phase and anti-phase movements, synchronizing reversal points with a metronome pulse has resulted in decreased anchor point variability and increased pattern stability [Byblow, W. D., Carson, R. G., & Goodman, D. (1994). Expressions of asymmetries and anchoring in bimanual coordination. Human Movement Science, 13, 3-28; Fink, P. W., Foo, P., Jirsa, V. K., & Kelso, J. A. S. (2000). Local and global stabilization of coordination by sensory information. Experimental Brain Research, 134, 9-20]. The present experiment examined anchoring during acquisition, retention, and transfer of a 90 degrees phase-offset continuous bimanual coordination pattern (whereby the right limb lags the left limb by one quarter cycle), involving horizontal flexion about the elbow. Three metronome synchronization strategies were imposed: participants either synchronized maximal flexion of the right arm (i.e., single metronome), both flexion and extension of the right arm (i.e., double metronome within-limb), or flexion of each arm (i.e., double metronome between-limb) to an auditory metronome. In contrast to simpler in-phase and anti-phase movements, synchronization of additional reversal points to the metronome did not reduce reversal point variability or increase pattern stability. Furthermore, practicing under different metronome synchronization strategies did not appear to have a significant effect on the rate of acquisition of the pattern.

  14. [Reconstruction of long polynucleotide sequences from fragments using the Iskra-226 personal computer

    Science.gov (United States)

    Kostetskiĭ, P V; Dobrova, I E

    1988-04-01

    An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.

  15. Automation of a single-DNA molecule stretching device

    DEFF Research Database (Denmark)

    Sørensen, Kristian Tølbøl; Lopacinska, Joanna M.; Tommerup, Niels

    2015-01-01

    We automate the manipulation of genomic-length DNA in a nanofluidic device based on real-time analysis of fluorescence images. In our protocol, individual molecules are picked from a microchannel and stretched with pN forces using pressure driven flows. The millimeter-long DNA fragments free...

  16. Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea).

    Science.gov (United States)

    Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa

    2012-05-01

    This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Conceptualization and Exploration of Composite Career Anchors: An Analysis of Information Systems Personnel.

    Science.gov (United States)

    Ramakrishna, Hindupur V.; Potosky, Denise

    2003-01-01

    Information systems professionals (n=163) completed measures of career anchors and outcomes (career/job satisfaction, job performance, perceived advancement prospects); 46% had multiple dominant anchors and these individuals did not have significantly different career outcomes than those with single dominant anchors. (Contains 26 references.) (SK)

  18. Chemical Reactive Anchoring Lipids with Different Performance for Cell Surface Re-engineering Application.

    Science.gov (United States)

    Vabbilisetty, Pratima; Boron, Mallorie; Nie, Huan; Ozhegov, Evgeny; Sun, Xue-Long

    2018-02-28

    Introduction of selectively chemical reactive groups at the cell surface enables site-specific cell surface labeling and modification opportunity, thus facilitating the capability to study the cell surface molecular structure and function and the molecular mechanism it underlies. Further, it offers the opportunity to change or improve a cell's functionality for interest of choice. In this study, two chemical reactive anchor lipids, phosphatidylethanolamine-poly(ethylene glycol)-dibenzocyclooctyne (DSPE-PEG 2000 -DBCO) and cholesterol-PEG-dibenzocyclooctyne (CHOL-PEG 2000 -DBCO) were synthesized and their potential application for cell surface re-engineering via lipid fusion were assessed with RAW 264.7 cells as a model cell. Briefly, RAW 264.7 cells were incubated with anchor lipids under various concentrations and at different incubation times. The successful incorporation of the chemical reactive anchor lipids was confirmed by biotinylation via copper-free click chemistry, followed by streptavidin-fluorescein isothiocyanate binding. In comparison, the cholesterol-based anchor lipid afforded a higher cell membrane incorporation efficiency with less internalization than the phospholipid-based anchor lipid. Low cytotoxicity of both anchor lipids upon incorporation into the RAW 264.7 cells was observed. Further, the cell membrane residence time of the cholesterol-based anchor lipid was evaluated with confocal microscopy. This study suggests the potential cell surface re-engineering applications of the chemical reactive anchor lipids.

  19. Chemical Reactive Anchoring Lipids with Different Performance for Cell Surface Re-engineering Application

    Science.gov (United States)

    2018-01-01

    Introduction of selectively chemical reactive groups at the cell surface enables site-specific cell surface labeling and modification opportunity, thus facilitating the capability to study the cell surface molecular structure and function and the molecular mechanism it underlies. Further, it offers the opportunity to change or improve a cell’s functionality for interest of choice. In this study, two chemical reactive anchor lipids, phosphatidylethanolamine–poly(ethylene glycol)–dibenzocyclooctyne (DSPE–PEG2000–DBCO) and cholesterol–PEG–dibenzocyclooctyne (CHOL–PEG2000–DBCO) were synthesized and their potential application for cell surface re-engineering via lipid fusion were assessed with RAW 264.7 cells as a model cell. Briefly, RAW 264.7 cells were incubated with anchor lipids under various concentrations and at different incubation times. The successful incorporation of the chemical reactive anchor lipids was confirmed by biotinylation via copper-free click chemistry, followed by streptavidin-fluorescein isothiocyanate binding. In comparison, the cholesterol-based anchor lipid afforded a higher cell membrane incorporation efficiency with less internalization than the phospholipid-based anchor lipid. Low cytotoxicity of both anchor lipids upon incorporation into the RAW 264.7 cells was observed. Further, the cell membrane residence time of the cholesterol-based anchor lipid was evaluated with confocal microscopy. This study suggests the potential cell surface re-engineering applications of the chemical reactive anchor lipids. PMID:29503972

  20. An anchoring system for fish habitat structures: field technique, evaluation, and application.

    Science.gov (United States)

    Barbara L. Fontaine; Thomas D. Merritt

    1988-01-01

    Steel cable can be used to bind rocks and logs together to construct fish habitat structures in streams. Cables must be securely anchored if structures are to withstand floods. This paper describes a way to anchor cables into bedrock or ballast boulders. Anchor tensile strength ranged from 7,500 to 36,500 pounds and was related to type of resin and embedment depth....

  1. Knotless single-row rotator cuff repair: a comparative biomechanical study of 2 knotless suture anchors.

    Science.gov (United States)

    Efird, Chad; Traub, Shaun; Baldini, Todd; Rioux-Forker, Dana; Spalazzi, Jeffrey P; Davisson, Twana; Hawkins, Monica; McCarty, Eric

    2013-08-01

    The purpose of this study was to compare the gap formation during cyclic loading, maximum repair strength, and failure mode of single-row full-thickness supraspinatus repairs performed using 2 knotless suture anchors with differing internal suture-retention mechanisms in a human cadaver model. Nine matched pairs of cadaver shoulders were used. Full-thickness tears were induced by detaching the supraspinatus tendon from the greater tuberosity. Single-row repairs were performed with either type I (Opus Magnum PI; ArthroCare, Austin, Texas) or type II (ReelX STT; Stryker, Mahwah, New Jersey) knotless suture anchors. The repaired tendon was cycled from 10 to 90 N for 500 cycles, followed by load to failure. Gap formation was measured at 5, 100, 200, 300, 400, and 500 cycles with a video digitizing system. Anchor type or location (anterior or posterior) had no effect on gap formation during cyclic loading regardless of position (anterior, P=.385; posterior, P=.389). Maximum load to failure was significantly greater (P=.018) for repairs performed with type II anchors (288±62 N) compared with type I anchors (179±39 N). Primary failure modes were anchor pullout and tendon tearing for type II anchors and suture slippage through the anchor for type I anchors. The internal ratcheting suture-retention mechanism of type II anchors may have helped this anchor outperform the suture-cinching mechanism of type I anchors by supporting significantly higher loads before failure and minimizing suture slippage, potentially leading to stronger repairs clinically. Copyright 2013, SLACK Incorporated.

  2. Characterization of DNA antigens from immune complexes deposited in the skin of patients with systemic lupus erythematosus

    Institute of Scientific and Technical Information of China (English)

    曾凡钦; 尹若菲; 谭国珍; 郭庆; 许德清

    2004-01-01

    Background Skin lesions are common manifestations in systemic lupus erythematosus (SLE). It is still unknown what the definite pathogenesis of skin involvement was and whether DNA participated in it. Our study was designed to explore the pathogenetic role and nature of nuclear antigen (DNA) deposited in the skin lesions of patients with SLE.Methods Thirty skin samples from patients with SLE and 2 normal skin samples were studied. Extracellular DNA was evaluated by indirect immunofluorescence methods. The deposited immune complexes were extracted by cryoprecipitation, and DNA was then isolated with phenol and chloroform. DNA fragment sizes were detected by agarose gel electrophoresis. Finally, 8 different probes were used to analyze the origin of these DNA molecules using Dot hybridization.Results Extracellular DNA staining was found only in skin lesions, mainly those located in the basement membrane zone, vascular wall, and hair follicle wall. Normal skin and non-lesion SLE skin showed no fluorescence at locations outside the nuclei. There were no differences in the rate and intensity of extracellular DNA staining when comparing active phase to remission phase patients. No relationship was found between extracellular DNA and circulating anti-dsDNA antibodies. Deposited DNA fragments clustered into four bands of somewhat discrete sizes: 20 000 bp, 1300 bp, 800-900 bp, 100-200 bp. Small sized fragments (100-200 bp) were positively correlated with disease activity (P<0.05, r=0.407). Dot hybridization showed significant homology of the various extracellular DNA fragments examined with human genomic DNA, but not with DNA from the microorganisms and viruses we examined. There were also homologies between DNA samples from different individuals.Conclusions DNA and its immune complexes may contribute to the pathogenesis of skin lesions in SLE. These DNA molecules range in size from 100 bp to 20 kb and may be endogenous in origin.

  3. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    Science.gov (United States)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  4. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    Science.gov (United States)

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample

  5. Extracellular glycosylphosphatidylinositol-anchored mannoproteins and proteases of Cryptococcus neoformans.

    Science.gov (United States)

    Eigenheer, Richard A; Jin Lee, Young; Blumwald, Eduardo; Phinney, Brett S; Gelli, Angie

    2007-06-01

    Extracellular proteins of Cryptococcus neoformans are involved in the pathogenesis of cryptococcosis, and some are immunoreactive antigens that may potentially serve as candidates for vaccine development. To further study the extracellular proteome of the human fungal pathogen Cry. neoformans, we conducted a proteomic analysis of secreted and cell wall-bound proteins with an acapsular strain of Cry. neoformans. Proteins were identified from both intact cells and cell walls. In both cases, extracellular proteins were removed with trypsin or beta-glucanase, and then all proteins/peptides were purified by solid-phase extraction, spin dialysis, and HPLC, and identified by liquid chromatography-mass spectrometry. This study identified 29 extracellular proteins with a predicted N-terminal signal sequence and also a predicted glycosylphosphatidylinositol anchor motif in more than half. Among the novel proteins identified were five glycosylphosphatidylinositol-anchored proteins with extensive Ser/Thr-rich regions but no apparent functional domains, a glycosylphosphatidylinositol-anchored aspartic protease, and a metalloprotease with structural similarity to an elastinolytic metalloprotease of Aspergillus fumigatus. This study suggests that Cry. neoformans has the machinery required to target glycosylphosphatidylinositol-anchored proteins to the cell wall, and it confirms the extracellular proteolytic ability of Cry. neoformans.

  6. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. DNA repair in proteus mirabilis. 5

    International Nuclear Information System (INIS)

    Hofemeister, J.; Boehme, H.; Fleischhacker, M.; Adler, B.; Eitner, G.; Steinborn, G.

    1979-01-01

    Inducible cell lysis in UV-irradiated cultures of Proteus mirabilis PG VI rec + derivatives is due to the induction of a defective prophage dP VI. This lytic response is found to account for the extraordinary high UV sensitivity of P. mirabilis rec + strains. Lysis of cells after UV or mitomycin C treatment is accompanied by the release of various defective phage particles including head-tail, tail and polysheath structures. Survival of P. mirabilis is shown to be strongly affected by the plating procedure. It is supposed that plating of UV-irradiated rec + cells after a distinct time of growth in liquid medium some how enhances the efficiency of repair activities rather than to prevent inducible cell lysis in P. mirabilis from occurring. The resident defective prophage interferes with the multiplication of infectious temperate phages (π1) as indicated by the efficiency of plating and plaque size. The extent of host-controlled reactivation of UV-irradiated phages, however, was not influenced by the lysogenic state of the host bacteria. The derepression of the resident prophage is thought to correlate with the appearence after UV exposure of a distinct and relatively stable low molecular weight DNA which is assumed to originate from enzymatic fragmentation rather than postmortal nicking of chromosomal DNA in P. mirabilis. Mutants are described which lost the inducible cell lysis response and, in case of PG 1300- also lost the immunity for bacteriolytic activities formed by PG VI strains after lysogenic induction. Whilst this derivative of P. mirabilis might either be cured for the defective prophage or rendered noninducible by mutation this substrain lost also both the extrasensitivity against UV and the chromosomal DNA fragmentation. The extent of the UV-induced DNA degradation response seems not to be markedly affected by these DNA fragmentations. (author)

  8. DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

    Directory of Open Access Journals (Sweden)

    Cheng-Yao eChen

    2014-06-01

    Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  9. Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

    Energy Technology Data Exchange (ETDEWEB)

    Morand, Patrice [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Budayova-Spano, Monika [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Perrissin, Monique [Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Müller, Christoph W., E-mail: mueller@embl-grenoble.fr; Petosa, Carlo [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France)

    2006-03-01

    A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiation (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.

  10. A new location to split Cre recombinase for protein fragment complementation.

    Science.gov (United States)

    Rajaee, Maryam; Ow, David W

    2017-11-01

    We have previously described a recombinase-mediated gene stacking system in which the Cre recombinase is used to remove lox-site flanked DNA no longer needed after each round of Bxb1 integrase-mediated site-specific integration. The Cre recombinase can be conveniently introduced by hybridization with a cre-expressing plant. However, maintaining an efficient cre-expressing line over many generations can be a problem, as high production of this DNA-binding protein might interfere with normal chromosome activities. To counter this selection against high Cre activity, we considered a split-cre approach, in which Cre activity is reconstituted after separate parts of Cre are brought into the same genome by hybridization. To insure that the recombinase-mediated gene stacking system retains its freedom to operate, we tested for new locations to split Cre into complementing fragments. In this study, we describe testing four new locations for splitting the Cre recombinase for protein fragment complementation and show that the two fragments of Cre split between Lys244 and Asn245 can reconstitute activity that is comparable to that of wild-type Cre. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Development of a Behaviorally Anchored Rating Scale for Leadership

    Science.gov (United States)

    2018-01-01

    Research Product 2018-06 Development of a Behaviorally Anchored Rating Scale for Leadership Tatiana H. Toumbeva Krista L...anchored Rating Scale for Leadership 5a. CONTRACT NUMBER W5J9CQ-11-D-0004 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 62278 6...observer- based behavioral measure to help instructors more reliably and accurately evaluate the development of leadership attributes and competencies

  12. Enhancement of Orthodontic Anchor Screw Stability Under Immediate Loading by Ultraviolet Photofunctionalization Technology.

    Science.gov (United States)

    Takahashi, Maiko; Motoyoshi, Mitsuru; Inaba, Mizuki; Hagiwara, Yoshiyuki; Shimizu, Noriyoshi

    Ultraviolet (UV)-mediated photofunctionalization technology is intended to enhance the osseointegration capability of titanium implants. There are concerns about orthodontic anchor screws loosening under immediate loading protocols in adolescent orthodontic treatment. The purpose of this in vivo study was to evaluate the effects of photofunctionalization on the intrabony stability of orthodontic titanium anchor screws and bone-anchor screw contact under immediate loading in growing rats. Custom-made titanium anchor screws (1.4 mm in diameter and 4.0 mm in length) with or without photofunctionalization pretreatment were placed on the proximal epiphysis of the tibial bone in 6-week-old male Sprague-Dawley rats and were loaded immediately after placement. After 2 weeks of loading, the stability of the anchor screws was evaluated using a Periotest device, and the bone-anchor screw contact ratio (BSC) was assessed by a histomorphometric analysis using field-emission scanning electron microscopy. In the unloaded group, Periotest values (PTVs) were ~25 for UV-untreated screws and 13 for UVtreated screws (P < .01), while in the immediate-loading group, PTVs were 28 for UV-untreated screws and 16 for UV-treated screws (P < .05). Significantly less screw mobility was observed in both UV-treated groups regardless of the loading protocol. The BSC was increased ~1.8 fold for UV-treated screws, compared with UV-untreated screws, regardless of the loading protocol. Photofunctionalization enhanced the intrabony stability of orthodontic anchor screws under immediate loading in growing rats by increasing bone-anchor screw contact.

  13. Management of subluxated capsular bag-fixated intraocular lenses using a capsular anchor.

    Science.gov (United States)

    Ton, Yokrat; Naftali, Modi; Gortzak, Ruth Lapid; Assia, Ehud I

    2016-05-01

    We describe the use of the capsular anchor (AssiAnchor) to manage a subluxated intraocular lens (IOL) in the capsular bag. The anchor comprises 2 prongs that hold the anterior lens capsule and a central rod that is sutured to the scleral wall, enabling centration of the IOL-capsular bag complex. Six pseudophakic patients presenting with subluxated posterior chamber IOLs in the capsular bag were operated on using the device. The anchor was used successfully in all cases, although in 2 cases only 1 prong was placed under the capsulorhexis edge. In 1 eye, 2 anchors were used 1 month apart following repeated traumatic zonular injury. The capsular bag holding the IOL remained centered and stable throughout the follow-up period. The anchoring device, which was originally designed to preserve the lens capsule and stabilize subluxated crystalline lenses, can also be used to treat subluxation of a capsular bag-fixated IOL. Dr. Assia is the inventor of the AssiAnchor, has a licensed patent of the anchor, and is consultant to Hanita Lenses. Dr. Lapid-Gortzak is a consultant to and speaker for Alcon Surgical, Inc., Hanita Lenses, Orca Surgical, and Sanoculis Ltd.; a speaker for Santen; and a consultant to Icon. Drs. Ton and Naftali have no financial or proprietary interest in any material or method mentioned. Copyright © 2016 ASCRS and ESCRS. Published by Elsevier Inc. All rights reserved.

  14. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. HKUST-1 Membranes Anchored on Porous Substrate by Hetero MIL-110 Nanorod Array Seeds.

    Science.gov (United States)

    Mao, Yiyin; Cao, Wei; Li, Junwei; Sun, Luwei; Peng, Xinsheng

    2013-09-02

    Great anchors and seeds: Hetero-seeding growth processes and anchored nanorod arrays were successfully utilized in the synthesis of HKUST-1 membranes. These arrays were firmly anchored on porous substrates by using a MIL-110 nanorod array as both the anchor and seed. The resulting HKUST-1 membranes demonstrated good separation factors for binary gases exceeding the Knudson selectivity. Copyright © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. A new model for ancient DNA decay based on paleogenomic meta-analysis.

    Science.gov (United States)

    Kistler, Logan; Ware, Roselyn; Smith, Oliver; Collins, Matthew; Allaby, Robin G

    2017-06-20

    The persistence of DNA over archaeological and paleontological timescales in diverse environments has led to a revolutionary body of paleogenomic research, yet the dynamics of DNA degradation are still poorly understood. We analyzed 185 paleogenomic datasets and compared DNA survival with environmental variables and sample ages. We find cytosine deamination follows a conventional thermal age model, but we find no correlation between DNA fragmentation and sample age over the timespans analyzed, even when controlling for environmental variables. We propose a model for ancient DNA decay wherein fragmentation rapidly reaches a threshold, then subsequently slows. The observed loss of DNA over time may be due to a bulk diffusion process in many cases, highlighting the importance of tissues and environments creating effectively closed systems for DNA preservation. This model of DNA degradation is largely based on mammal bone samples due to published genomic dataset availability. Continued refinement to the model to reflect diverse biological systems and tissue types will further improve our understanding of ancient DNA breakdown dynamics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Stability calculation method of slope reinforced by prestressed anchor in process of excavation.

    Science.gov (United States)

    Li, Zhong; Wei, Jia; Yang, Jun

    2014-01-01

    This paper takes the effect of supporting structure and anchor on the slope stability of the excavation process into consideration; the stability calculation model is presented for the slope reinforced by prestressed anchor and grillage beam, and the dynamic search model of the critical slip surface also is put forward. The calculation model of the optimal stability solution of each anchor tension of the whole process is also given out, through which the real-time analysis and checking of slope stability in the process of excavation can be realized. The calculation examples indicate that the slope stability is changed with the dynamic change of the design parameters of anchor and grillage beam. So it is relatively more accurate and reasonable by using dynamic search model to determine the critical slip surface of the slope reinforced by prestressed anchor and grillage beam. Through the relationships of each anchor layout and the slope height of various stages of excavation, and the optimal stability solution of prestressed bolt tension design value in various excavation stages can be obtained. The arrangement of its prestressed anchor force reflects that the layout of the lower part of bolt and the calculation of slope reinforcement is in line with the actual. These indicate that the method is reasonable and practical.

  18. Spontaneous insertion of GPI anchors into cholesterol-rich membrane domains

    Directory of Open Access Journals (Sweden)

    Jing Li

    2018-05-01

    Full Text Available GPI-Anchored proteins (GPI-APs can be exogenously transferred onto bilayer membranes both in vivo and in vitro, while the mechanism by which this transfer process occurs is unknown. In this work, we used atomistic molecular dynamics simulations and free energy calculations to characterize the essential influence of cholesterol on insertion of the GPI anchors into plasma membranes. We demonstrate, both dynamically and energetically, that in the presence of cholesterol, the tails of GPI anchors are able to penetrate inside the core of the lipid membrane spontaneously with a three-step mechanism, while in the absence of cholesterol no spontaneous insertion was observed. We ascribe the failure of insertion to the strong thermal fluctuation of lipid molecules in cholesterol-free bilayer, which generates a repulsive force in entropic origin. In the presence of cholesterol, however, the fluctuation of lipids is strongly reduced, thus decreasing the barrier for the anchor insertion. Based on this observation, we propose a hypothesis that addition of cholesterol creates vertical creases in membranes for the insertion of acyl chains. Moreover, we find that the GPI anchor could also spontaneously inserted into the boundary between cholesterol-rich and cholesterol-depleted domains. Our results shed light on the mechanism of cholesterol-mediated interaction between membrane proteins with acyl chain and plasma membranes in living cells.

  19. Spontaneous insertion of GPI anchors into cholesterol-rich membrane domains

    Science.gov (United States)

    Li, Jing; Liu, Xiuhua; Tian, Falin; Yue, Tongtao; Zhang, Xianren; Cao, Dapeng

    2018-05-01

    GPI-Anchored proteins (GPI-APs) can be exogenously transferred onto bilayer membranes both in vivo and in vitro, while the mechanism by which this transfer process occurs is unknown. In this work, we used atomistic molecular dynamics simulations and free energy calculations to characterize the essential influence of cholesterol on insertion of the GPI anchors into plasma membranes. We demonstrate, both dynamically and energetically, that in the presence of cholesterol, the tails of GPI anchors are able to penetrate inside the core of the lipid membrane spontaneously with a three-step mechanism, while in the absence of cholesterol no spontaneous insertion was observed. We ascribe the failure of insertion to the strong thermal fluctuation of lipid molecules in cholesterol-free bilayer, which generates a repulsive force in entropic origin. In the presence of cholesterol, however, the fluctuation of lipids is strongly reduced, thus decreasing the barrier for the anchor insertion. Based on this observation, we propose a hypothesis that addition of cholesterol creates vertical creases in membranes for the insertion of acyl chains. Moreover, we find that the GPI anchor could also spontaneously inserted into the boundary between cholesterol-rich and cholesterol-depleted domains. Our results shed light on the mechanism of cholesterol-mediated interaction between membrane proteins with acyl chain and plasma membranes in living cells.

  20. AnchorDock for Blind Flexible Docking of Peptides to Proteins.

    Science.gov (United States)

    Slutzki, Michal; Ben-Shimon, Avraham; Niv, Masha Y

    2017-01-01

    Due to increasing interest in peptides as signaling modulators and drug candidates, several methods for peptide docking to their target proteins are under active development. The "blind" docking problem, where the peptide-binding site on the protein surface is unknown, presents one of the current challenges in the field. AnchorDock protocol was developed by Ben-Shimon and Niv to address this challenge.This protocol narrows the docking search to the most relevant parts of the conformational space. This is achieved by pre-folding the free peptide and by computationally detecting anchoring spots on the surface of the unbound protein. Multiple flexible simulated annealing molecular dynamics (SAMD) simulations are subsequently carried out, starting from pre-folded peptide conformations, constrained to the various precomputed anchoring spots.Here, AnchorDock is demonstrated using two known protein-peptide complexes. A PDZ-peptide complex provides a relatively easy case due to the relatively small size of the protein, and a typical peptide conformation and binding region; a more challenging example is a complex between USP7 N-term and a p53-derived peptide, where the protein is larger, and the peptide conformation and a binding site are generally assumed to be unknown. AnchorDock returned native-like solutions ranked first and third for the PDZ and USP7 complexes, respectively. We describe the procedure step by step and discuss possible modifications where applicable.