WorldWideScience

Sample records for dna fragment anchoring

  1. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  2. Subcloning of DNA fragments.

    Science.gov (United States)

    Struhl, K

    2001-05-01

    The essence of recombinant DNA technology is the joining of two or more separate segments of DNA to generate a single DNA molecule that is capable of autonomous replication in a given host. The simplest constructions of hybrid DNA molecules involve the cloning of insert sequences into plasmid or bacteriophage cloning vectors. The insert sequences can derive from essentially any organism, and they may be isolated directly from the genome, from mRNA, or from previously cloned DNA segments (in which case, the procedure is termed subcloning). Alternatively, insert DNAs can be created directly by DNA synthesis. This unit provides protocols for the subcloning of DNA fragments and ligation of DNA fragments in gels.

  3. Vesicle Fusion Mediated by Solanesol-Anchored DNA.

    Science.gov (United States)

    Flavier, Kristina M; Boxer, Steven G

    2017-09-19

    Fusion between two lipid bilayers is one of the central processes in cell biology, playing a key role in endocytosis, exocytosis, and vesicle transport. We have previously developed a model system that uses the hybridization of complementary DNA strands to model the formation of the SNARE four-helix bundle that mediates synaptic vesicle fusion and used it to study vesicle fusion to a tethered lipid bilayer. Using single vesicle assays, 70% of observed fusion events in the DNA-lipid system are arrested at the hemifusion stage, whereas only 5% eventually go to full fusion. This may be because the diglycerol ether that anchors the DNA in the membrane spans only half the bilayer: upon hemifusion and mixing of the outer leaflets, the DNA-lipid is free to diffuse into the target membrane and away from the vesicle. Here, we test the hypothesis that the length of the membrane anchor may impact the outcome by comparing single leaflet-spanning DNA-lipid mediated vesicle fusion with fusion mediated by DNA anchored by solanesol, a C45 isoprenoid of sufficient length to span the bilayer. When the solanesol anchor was present on the incoming vesicles, target membrane, or both, ∼2-3 times as much full fusion was observed as in the DNA-lipid mediated system, as measured by lipid mixing or content transfer. These results indicate that a transmembrane anchor increases the efficiency of full fusion. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  4. Fracture resistance of reattached incisor fragments with mini fibre-reinforced composite anchors.

    NARCIS (Netherlands)

    Fennis, W.M.M.; Kreulen, C.M.; Wolke, J.G.C.; Fokkinga, W.A.; Machado, C.; Creugers, N.H.J.

    2009-01-01

    OBJECTIVES: Fractured coronal fragments of incisors can be adhered to the remaining tooth with resin composite, but are prone to failure. This study explores whether mini fibre-reinforced composite (FRC) anchors increase fracture resistance of reattached fragments. METHODS: Forty-five extracted

  5. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  6. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  7. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  9. DNA fragmentation by charged particle tracks

    Science.gov (United States)

    Stenerlöw, B.; Höglund, E.; Carlsson, J.

    High-LET (linear energy transfer) charged particles induce DNA double-strand breaks (DSB) in a non-random fashion in mammalian cells. The clustering of DSB, probably determined by track structure as well as chromatin conformation, results in an excess of small- and intermediate-sized DNA fragments. DNA fragmentation in normal human fibroblasts (GM5758) was analyzed by pulsed-field gel electrophoresis after irradiation with photons ( 60Co) or 125 keV/μm nitrogen ions. Compared to conventional DSB analysis, i.e. assays only measuring the fraction of DNA smaller than a single threshold, the relative biological effectiveness (RBE) for DSB induction increased with 100%. Further, the size distribution of DNA fragments showed a significant dependence on radiation quality, with an excess of fragments up to 1 Mbp. Irradiation of naked genomic DNA without histone proteins increased the DSB yields 25 and 13 times for photons and nitrogen ions, respectively. The results suggest possible roles of both track structure and chromatin organization in the distribution of DNA double-strand breaks along the chromosome.

  10. Nucleosomal DNA fragments in autoimmune diseases

    NARCIS (Netherlands)

    Holdenrieder, Stefan; Eichhorn, Peter; Beuers, Ulrich; Samtleben, Walter; Schoenermarck, Ulf; Zachoval, Reinhart; Nagel, Dorothea; Stieber, Petra

    2006-01-01

    The inadequate response of immune cells to circulating apoptotic products, such as nucleosomal DNA fragments, is assumed to be a potent stimulus for the production of autoantibodies during the pathogenesis and progression of systemic lupus erythematosus (SLE). Here, we analyzed the levels of

  11. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  12. Functionalized Nanostructures: Redox-Active Porphyrin Anchors for Supramolecular DNA Assemblies

    KAUST Repository

    Börjesson, Karl

    2010-09-28

    We have synthesized and studied a supramolecular system comprising a 39-mer DNA with porphyrin-modified thymidine nucleosides anchored to the surface of large unilamellar vesicles (liposomes). Liposome porphyrin binding characteristics, such as orientation, strength, homogeneity, and binding site size, was determined, suggesting that the porphyrin is well suited as a photophysical and redox-active lipid anchor, in comparison to the inert cholesterol anchor commonly used today. Furthermore, the binding characteristics and hybridization capabilities were studied as a function of anchor size and number of anchoring points, properties that are of importance for our future plans to use the addressability of these redox-active nodes in larger DNA-based nanoconstructs. Electron transfer from photoexcited porphyrin to a lipophilic benzoquinone residing in the lipid membrane was characterized by steady-state and time-resolved fluorescence and verified by femtosecond transient absorption. © 2010 American Chemical Society.

  13. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often <100 bp) and may persist in the environment for more than half a million years. Fragmented DNA is recognized as nutrient source f...... quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake...

  14. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  15. DNA fragmentation in spermatozoa and its relationship with impaired spermatogenesis

    Directory of Open Access Journals (Sweden)

    S. A. Rudneva

    2014-01-01

    Full Text Available Sperm cells DNA fragmentation is one of the factors of male sub-/infertility discovered recently. At present, pathophysiological mechanisms that cause DNA fragmentation have not been studied completely. It is suggested that they may be caused with defects of chromatin remodeling, apoptosis, and oxidative stress. Spermiological examination was performed in 461 infertile men. With 23 % of the patients examined, the frequency of sperm cells DNA fragmentation comprises over 15 %, with that, 18 % of the patients demonstrated its range from 15.1 to 30 %, and with 5 % of patients, it exceeded 30 %. We found that the amount of sperm cells with fragmented DNA with severe forms of pathozoospermia is higher that with less manifested disturbances of spermatogenesis. Negative dynamics was revealed regarding the change in sperm concentration in men that have increased frequency of DNA fragmentation. Obtained results confirm the suggestion of the correlation between some semen parameters (concentration, motility, and morphology and sperm DNA fragmentation. Thus, one can state that the DNA fragmentation parameter of sperm cells has a certain diagnostic and forecasting value for married couples with reproduction disorders.

  16. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  17. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  18. Bacterial species determination from DNA-DNA hybridization by using genome fragments and DNA microarrays.

    Science.gov (United States)

    Cho, J C; Tiedje, J M

    2001-08-01

    Whole genomic DNA-DNA hybridization has been a cornerstone of bacterial species determination but is not widely used because it is not easily implemented. We have developed a method based on random genome fragments and DNA microarray technology that overcomes the disadvantages of whole-genome DNA-DNA hybridization. Reference genomes of four fluorescent Pseudomonas species were fragmented, and 60 to 96 genome fragments of approximately 1 kb from each strain were spotted on microarrays. Genomes from 12 well-characterized fluorescent Pseudomonas strains were labeled with Cy dyes and hybridized to the arrays. Cluster analysis of the hybridization profiles revealed taxonomic relationships between bacterial strains tested at species to strain level resolution, suggesting that this approach is useful for the identification of bacteria as well as determining the genetic distance among bacteria. Since arrays can contain thousands of DNA spots, a single array has the potential for broad identification capacity. In addition, the method does not require laborious cross-hybridizations and can provide an open database of hybridization profiles, avoiding the limitations of traditional DNA-DNA hybridization.

  19. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  20. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  1. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  2. Advanced microinstrumentation for rapid DNA sequencing and large DNA fragment separation

    Energy Technology Data Exchange (ETDEWEB)

    Balch, J.; Davidson, J.; Brewer, L.; Gingrich, J.; Koo, J.; Mariella, R.; Carrano, A.

    1995-01-25

    Our efforts to develop novel technology for a rapid DNA sequencer and large fragment analysis system based upon gel electrophoresis are described. We are using microfabrication technology to build dense arrays of high speed micro electrophoresis lanes that will ultimately increase the sequencing rate of DNA by at least 100 times the rate of current sequencers. We have demonstrated high resolution DNA fragment separation needed for sequencing in polyacrylamide microgels formed in glass microchannels. We have built prototype arrays of microchannels having up to 48 channels. Significant progress has also been made in developing a sensitive fluorescence detection system based upon a confocal microscope design that will enable the diagnostics and detection of DNA fragments in ultrathin microchannel gels. Development of a rapid DNA sequencer and fragment analysis system will have a major impact on future DNA instrumentation used in clinical, molecular and forensic analysis of DNA fragments.

  3. Bacterial natural transformation by highly fragmented and damaged DNA.

    Science.gov (United States)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic A A; Mayar, J Victor Moreno; Rasmussen, Simon; Dahl, Tais W; Rosing, Minik T; Poole, Anthony M; Sicheritz-Ponten, Thomas; Brunak, Søren; Inselmann, Sabrina; de Vries, Johann; Wackernagel, Wilfried; Pybus, Oliver G; Nielsen, Rasmus; Johnsen, Pål Jarle; Nielsen, Kaare Magne; Willerslev, Eske

    2013-12-03

    DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often bacterial evolution. Here, we show that fragmented DNA molecules (≥ 20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations generated by uptake of short DNA fragments escape mismatch repair. Moreover, double-nucleotide polymorphisms appear more common among genomes of transformable than nontransformable bacteria. Our findings reveal that short and damaged, including truly ancient, DNA molecules, which are present in large quantities in the environment, can be acquired by bacteria through natural transformation. Our findings open for the possibility that natural genetic exchange can occur with DNA up to several hundreds of thousands years old.

  4. DNA fragmentation and sperm head morphometry in cat epididymal spermatozoa.

    Science.gov (United States)

    Vernocchi, Valentina; Morselli, Maria Giorgia; Lange Consiglio, Anna; Faustini, Massimo; Luvoni, Gaia Cecilia

    2014-10-15

    Sperm DNA fragmentation is an important parameter to assess sperm quality and can be a putative fertility predictor. Because the sperm head consists almost entirely of DNA, subtle differences in sperm head morphometry might be related to DNA status. Several techniques are available to analyze sperm DNA fragmentation, but they are labor-intensive and require expensive instrumentations. Recently, a kit (Sperm-Halomax) based on the sperm chromatin dispersion test and developed for spermatozoa of different species, but not for cat spermatozoa, became commercially available. The first aim of the present study was to verify the suitability of Sperm-Halomax assay, specifically developed for canine semen, for the evaluation of DNA fragmentation of epididymal cat spermatozoa. For this purpose, DNA fragmentation indexes (DFIs) obtained with Sperm-Halomax and terminal deoxynucleotidyl transferase-mediated nick-end labeling (TUNEL) were compared. The second aim was to investigate whether a correlation between DNA status, sperm head morphology, and morphometry assessed by computer-assisted semen analysis exists in cat epididymal spermatozoa. No differences were observed in DFIs obtained with Sperm-Halomax and TUNEL. This result indicates that Sperm-Halomax assay provides a reliable evaluation of DNA fragmentation of epididymal feline spermatozoa. The DFI seems to be independent from all the measured variables of sperm head morphology and morphometry. Thus, the evaluation of the DNA status of spermatozoa could effectively contribute to the completion of the standard analysis of fresh or frozen semen used in assisted reproductive technologies. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Digital analysis of cDNA abundance; expression profiling by means of restriction fragment fingerprinting

    Directory of Open Access Journals (Sweden)

    Regenbogen Johannes

    2002-03-01

    Full Text Available Abstract Background Gene expression profiling among different tissues is of paramount interest in various areas of biomedical research. We have developed a novel method (DADA, Digital Analysis of cDNA Abundance, that calculates the relative abundance of genes in cDNA libraries. Results DADA is based upon multiple restriction fragment length analysis of pools of clones from cDNA libraries and the identification of gene-specific restriction fingerprints in the resulting complex fragment mixtures. A specific cDNA cloning vector had to be constructed that governed missing or incomplete cDNA inserts which would generate misleading fingerprints in standard cloning vectors. Double stranded cDNA was synthesized using an anchored oligo dT primer, uni-directionally inserted into the DADA vector and cDNA libraries were constructed in E. coli. The cDNA fingerprints were generated in a PCR-free procedure that allows for parallel plasmid preparation, labeling, restriction digest and fragment separation of pools of 96 colonies each. This multiplexing significantly enhanced the throughput in comparison to sequence-based methods (e.g. EST approach. The data of the fragment mixtures were integrated into a relational database system and queried with fingerprints experimentally produced by analyzing single colonies. Due to limited predictability of the position of DNA fragments on the polyacrylamid gels of a given size, fingerprints derived solely from cDNA sequences were not accurate enough to be used for the analysis. We applied DADA to the analysis of gene expression profiles in a model for impaired wound healing (treatment of mice with dexamethasone. Conclusions The method proved to be capable of identifying pharmacologically relevant target genes that had not been identified by other standard methods routinely used to find differentially expressed genes. Due to the above mentioned limited predictability of the fingerprints, the method was yet tested only with

  6. Purification and cloning of DNA fragments fractionated on agarose gels.

    Science.gov (United States)

    Griffin, H G; Gasson, M J

    1995-04-01

    Purification of DNA fragments from acrylamide or agarose gels is a commonly used technique in the molecular biology laboratory. This article describes a rapid, efficient, and inexpensive method of purifying DNA fractions from an agarose gel. The purified DNA is suitable for use in a wide range of applications including ligation using DNA ligase. The procedure uses standard high-melting-temperature agarose and normal TBE electrophoresis buffer. In addition, the protocol does not involve the use of highly toxic organic solvents such as phenol.

  7. Modified Classical Graph Algorithms for the DNA Fragment Assembly Problem

    Directory of Open Access Journals (Sweden)

    Guillermo M. Mallén-Fullerton

    2015-09-01

    Full Text Available DNA fragment assembly represents an important challenge to the development of efficient and practical algorithms due to the large number of elements to be assembled. In this study, we present some graph theoretical linear time algorithms to solve the problem. To achieve linear time complexity, a heap with constant time operations was developed, for the special case where the edge weights are integers and do not depend on the problem size. The experiments presented show that modified classical graph theoretical algorithms can solve the DNA fragment assembly problem efficiently.

  8. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    . The degrading DNA is fragmented and damaged, often to less than one hundred base pairs. Such DNA is only recognized as microbial nutrients and is not considered as direct contributors to bacterial evolutionary processes. The main study shows natural transformation by very short DNA (≥20bp). Further we also show...... it by damaged short DNA with abasic sites, crosslinks, and miscoding lesions, which are the most common damages in environmental DNA. This is emphasized by successful natural transformation by 43,000-year-old DNA. We find that the process is a simple variant of natural transformation. On top, we illustrate...... with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...

  9. Sperm DNA fragmentation and oxidation are independent of malondialdheyde

    Science.gov (United States)

    2011-01-01

    Background There is clinical evidence to show that sperm DNA damage could be a marker of sperm quality and extensive data exist on the relationship between DNA damage and male fertility status. Detecting such damage in sperm could provide new elements besides semen parameters in diagnosing male infertility. We aimed to assess sperm DNA fragmentation and oxidation and to study the association between these two markers, routine semen parameters and malondialdehyde formation. Methods Semen samples from 55 men attending the Histology-Embryology Laboratory of Sfax Faculty of Medicine, Tunisia, for semen investigations were analysed for sperm DNA fragmentation and oxidation using flow cytometry. The Sperm was also assessed spectrophotometrically for malondialdehyde formation. Results Within the studied group, 21 patients were nonasthenozoospermic (sperm motility ≥ 50%) and 34 patients were considered asthenozoospermic (sperm motility < 50%). A positive correlation was found between sperm DNA fragmentation and oxidation (p = 0.01; r = 0.33). We also found a negative correlation between sperm DNA fragmentation and some sperm parameters: total motility (p = 0.001; r = -0.43), rapid progressive motility (type a motility) (p = 0.04; r = -0.27), slow progressive motility (type b motility) (p = 0.03; r = -0.28), and vitality (p < 0.001; r = -0.65). Sperm DNA fragmentation was positively correlated with coiled tail (p = 0.01; r = 0.34). The two parameters that were found to be correlated with oxidative DNA damage were leucocytes concentrations (p = 0.01; r = 0.38) and broken neck (p = 0.02; r = 0.29). Sperm MDA levels were negatively correlated with sperm concentration (p < 0.001; r = -0.57), total motility (p = 0.01; r = -0.35) and type a motility (p = 0.03; r = -0.32); but not correlated with DNA fragmentation and DNA oxidation. Conclusions Our results support the evidence that oxidative stress plays a key role in inducing DNA damage; but nuclear alterations and

  10. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  11. Combination probes with intercalating anchors and proximal fluorophores for DNA and RNA detection.

    Science.gov (United States)

    Qiu, Jieqiong; Wilson, Adam; El-Sagheer, Afaf H; Brown, Tom

    2016-09-30

    A new class of modified oligonucleotides (combination probes) has been designed and synthesised for use in genetic analysis and RNA detection. Their chemical structure combines an intercalating anchor with a reporter fluorophore on the same thymine nucleobase. The intercalator (thiazole orange or benzothiazole orange) provides an anchor, which upon hybridisation of the probe to its target becomes fluorescent and simultaneously stabilizes the duplex. The anchor is able to communicate via FRET to a proximal reporter dye (e.g. ROX, HEX, ATTO647N, FAM) whose fluorescence signal can be monitored on a range of analytical devices. Direct excitation of the reporter dye provides an alternative signalling mechanism. In both signalling modes, fluorescence in the unhybridised probe is switched off by collisional quenching between adjacent intercalator and reporter dyes. Single nucleotide polymorphisms in DNA and RNA targets are identified by differences in the duplex melting temperature, and the use of short hybridization probes, made possible by the stabilisation provided by the intercalator, enhances mismatch discrimination. Unlike other fluorogenic probe systems, placing the fluorophore and quencher on the same nucleobase facilitates the design of short probes containing multiple modifications. The ability to detect both DNA and RNA sequences suggests applications in cellular imaging and diagnostics. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Clinical aspects of sperm DNA fragmentation detection and male infertility.

    Science.gov (United States)

    Evenson, Donald P; Wixon, Regina

    2006-03-15

    Over the past 25 years, various methods have been developed to measure sperm DNA strand breaks in situ. Currently, there are four major tests of sperm DNA fragmentation, including the Comet, Tunel, sperm chromatin structure assay (SCSA) and the acridine orange test (AOT). The Comet assay is a light microscope technique where the sperm cells are mixed with melted agarose and then placed on a glass slide. The cells are lysed and then subjected to horizontal electrophoresis. The Tunel assay, another light microscope technique, transfers labeled nucleotide to the 3'OH group of a broken DNA strand with the use of terminal deoxynucleotidyl transferase. The fluorescence intensity of each scored sperm is determined as a "yes" or "no" for sperm on a light microscope slide or by channels of fluorescent intensity in a flow cytometer. The light microscope-based AOT, uses the metachromatic properties of acridine orange to stain sperm cells. The SCSA treats sperm with low pH to denature DNA at the sites of DNA strand breaks, followed by acridine orange (AO) staining of green for native DNA and red for denatured DNA as measured by flow cytometry (FCM) as well as % sperm with high DNA stainability (HDS: immature sperm with intact DNA related to decreased fertilization rates). The SCSA method has defined a 27-30% DNA fragmentation index (DFI) as the point in which a man is placed into a statistical category of taking a longer time to in vivo pregnancy, intra uterine insemination (IUI) and more routine in vitro fertilization (IVF) cycles or no pregnancy. Current data suggest that intracytoplasmic sperm injection (ICSI) may help overcome the diminished pregnancy prognosis with high DFI over the other ART or natural methods.

  13. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  14. Small DNA pieces in C. elegans are intermediates of DNA fragmentation during apoptosis.

    Directory of Open Access Journals (Sweden)

    P Joseph Aruscavage

    2010-06-01

    Full Text Available While studying small noncoding RNA in C. elegans, we discovered that protocols used for isolation of RNA are contaminated with small DNA pieces. After electrophoresis on a denaturing gel, the DNA fragments appear as a ladder of bands, approximately 10 nucleotides apart, mimicking the pattern of nuclease digestion of DNA wrapped around a nucleosome. Here we show that the small DNA pieces are products of the DNA fragmentation that occurs during apoptosis, and correspondingly, are absent in mutant strains incapable of apoptosis. In contrast, the small DNA pieces are present in strains defective for the engulfment process of apoptosis, suggesting they are produced in the dying cell prior to engulfment. While the small DNA pieces are also present in a number of strains with mutations in predicted nucleases, they are undetectable in strains containing mutations in nuc-1, which encodes a DNase II endonuclease. We find that the small DNA pieces can be labeled with terminal deoxynucleotidyltransferase only after phosphatase treatment, as expected if they are products of DNase II cleavage, which generates a 3' phosphate. Our studies reveal a previously unknown intermediate in the process of apoptotic DNA fragmentation and thus bring us closer to defining this important pathway.

  15. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  16. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  17. Role of DNA Methylation in Type 2 Diabetes Etiology: Using Genotype as a Causal Anchor.

    Science.gov (United States)

    Elliott, Hannah R; Shihab, Hashem A; Lockett, Gabrielle A; Holloway, John W; McRae, Allan F; Smith, George Davey; Ring, Susan M; Gaunt, Tom R; Relton, Caroline L

    2017-06-01

    Several studies have investigated the relationship between genetic variation and DNA methylation with respect to type 2 diabetes, but it is unknown if DNA methylation is a mediator in the disease pathway or if it is altered in response to disease state. This study uses genotypic information as a causal anchor to help decipher the likely role of DNA methylation measured in peripheral blood in the etiology of type 2 diabetes. Illumina HumanMethylation450 BeadChip data were generated on 1,018 young individuals from the Avon Longitudinal Study of Parents and Children (ALSPAC) cohort. In stage 1, 118 unique associations between published type 2 diabetes single nucleotide polymorphisms (SNPs) and genome-wide methylation (methylation quantitative trait loci [mQTLs]) were identified. In stage 2, a further 226 mQTLs were identified between 202 additional independent non-type 2 diabetes SNPs and CpGs identified in stage 1. Where possible, associations were replicated in independent cohorts of similar age. We discovered that around half of known type 2 diabetes SNPs are associated with variation in DNA methylation and postulated that methylation could either be on a causal pathway to future disease or could be a noncausal biomarker. For one locus ( KCNQ1 ), we were able to provide further evidence that methylation is likely to be on the causal pathway to disease in later life. © 2017 by the American Diabetes Association.

  18. Effect of anchor positioning on binding and diffusion of elongated 3D DNA nanostructures on lipid membranes

    International Nuclear Information System (INIS)

    Khmelinskaia, Alena; Franquelim, Henri G; Petrov, Eugene P; Schwille, Petra

    2016-01-01

    DNA origami is a state-of-the-art technology that enables the fabrication of nano-objects with defined shapes, to which functional moieties, such as lipophilic anchors, can be attached with a nanometre scale precision. Although binding of DNA origami to lipid membranes has been extensively demonstrated, the specific requirements necessary for membrane attachment are greatly overlooked. Here, we designed a set of amphipathic rectangular-shaped DNA origami structures with varying placement and number of chol-TEG anchors used for membrane attachment. Single- and multiple-cholesteryl-modified origami nanostructures were produced and studied in terms of their membrane localization, density and dynamics. We show that the positioning of at least two chol-TEG moieties near the corners is essential to ensure efficient membrane binding of large DNA nanostructures. Quantitative fluorescence correlation spectroscopy data further confirm that increasing the number of corner-positioned chol-TEG anchors lowers the dynamics of flat DNA origami structures on freestanding membranes. Taken together, our approach provides the first evidence of the importance of the location in addition to the number of hydrophobic moieties when rationally designing minimal DNA nanostructures with controlled membrane binding. (paper)

  19. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  20. Revealing large metagenomic regions through long DNA fragment hybridization capture.

    Science.gov (United States)

    Gasc, Cyrielle; Peyret, Pierre

    2017-03-14

    High-throughput DNA sequencing technologies have revolutionized genomic analysis, including the de novo assembly of whole genomes from single organisms or metagenomic samples. However, due to the limited capacity of short-read sequence data to assemble complex or low coverage regions, genomes are typically fragmented, leading to draft genomes with numerous underexplored large genomic regions. Revealing these missing sequences is a major goal to resolve concerns in numerous biological studies. To overcome these limitations, we developed an innovative target enrichment method for the reconstruction of large unknown genomic regions. Based on a hybridization capture strategy, this approach enables the enrichment of large genomic regions allowing the reconstruction of tens of kilobase pairs flanking a short, targeted DNA sequence. Applied to a metagenomic soil sample targeting the linA gene, the biomarker of hexachlorocyclohexane (HCH) degradation, our method permitted the enrichment of the gene and its flanking regions leading to the reconstruction of several contigs and complete plasmids exceeding tens of kilobase pairs surrounding linA. Thus, through gene association and genome reconstruction, we identified microbial species involved in HCH degradation which constitute targets to improve biostimulation treatments. This new hybridization capture strategy makes surveying and deconvoluting complex genomic regions possible through large genomic regions enrichment and allows the efficient exploration of metagenomic diversity. Indeed, this approach enables to assign identity and function to microorganisms in natural environments, one of the ultimate goals of microbial ecology.

  1. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  2. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  3. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    Science.gov (United States)

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  4. Spatial and temporal regulation of DNA fragmentation in the aleurone of germinating barley

    NARCIS (Netherlands)

    Wang, M.; Oppedijk, B.J.; Caspers, M.P.M.; Lamers, G.E.M.; Boot, M.J.; Geerlings, D.N.G.; Bakhuizen, B.; Meijer, A.H.; Duijn, B. van

    1998-01-01

    During germination of barley grains, the appearance of DNA fragmentation started in aleurone cells near the embryo and extended to the distal end in a time-dependent manner. DNA fragmentation was demonstrated to occur only after the expression of α-amylase mRNA in the aleurone layer. In addition,

  5. Nanopore-based assay for detection of methylation in double-stranded DNA fragments.

    Science.gov (United States)

    Shim, Jiwook; Kim, Younghoon; Humphreys, Gwendolyn I; Nardulli, Ann M; Kosari, Farhad; Vasmatzis, George; Taylor, William R; Ahlquist, David A; Myong, Sua; Bashir, Rashid

    2015-01-27

    DNA methylation is an epigenetic modification of DNA in which methyl groups are added at the 5-carbon position of cytosine. Aberrant DNA methylation, which has been associated with carcinogenesis, can be assessed in various biological fluids and potentially can be used as markers for detection of cancer. Analytically sensitive and specific assays for methylation targeting low-abundance and fragmented DNA are needed for optimal clinical diagnosis and prognosis. We present a nanopore-based direct methylation detection assay that circumvents bisulfite conversion and polymerase chain reaction amplification. Building on our prior work, we used methyl-binding proteins (MBPs), which selectively label the methylated DNA. The nanopore-based assay selectively detects methylated DNA/MBP complexes through a 19 nm nanopore with significantly deeper and prolonged nanopore ionic current blocking, while unmethylated DNA molecules were not detectable due to their smaller diameter. Discrimination of hypermethylated and unmethylated DNA on 90, 60, and 30 bp DNA fragments was demonstrated using sub-10 nm nanopores. Hypermethylated DNA fragments fully bound with MBPs are differentiated from unmethylated DNA at 2.1- to 6.5-fold current blockades and 4.5- to 23.3-fold transport durations. Furthermore, these nanopore assays can detect the CpG dyad in DNA fragments and could someday profile the position of methylated CpG sites on DNA fragments.

  6. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  7. Relative stability of transgene DNA fragments from GM rapeseed in mixed ruminal cultures.

    Science.gov (United States)

    Sharma, Ranjana; Alexander, Trevor W; John, S Jacob; Forster, Robert J; McAllister, Tim A

    2004-05-01

    The use of transgenic crops as feeds for ruminant animals has prompted study of the possible uptake of transgene fragments by ruminal micro-organisms and/or intestinal absorption of fragments surviving passage through the rumen. The persistence in buffered ruminal contents of seven different recombinant DNA fragments from GM rapeseed expressing the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) transgene was tracked using PCR. Parental and transgenic (i.e. glyphosphate-tolerant; Roundup Ready, Monsanto Company, St Louis, MO, USA) rapeseed were incubated for 0, 2, 4, 8, 12, 24 and 48 h as whole seeds, cracked seeds, rapeseed meal, and as pelleted, barley-based diets containing 65 g rapeseed meal/kg. The seven transgene fragments ranged from 179 to 527 bp and spanned the entire 1363 bp EPSPS transgene. A 180 bp ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) small subunit fragment and a 466 bp 16S rDNA fragment were used as controls for endogenous rapeseed DNA and bacterial DNA respectively. The limit of detection of the PCR assay, established using negative controls spiked with known quantities of DNA, was 12.5 pg. Production of gas and NH3 was monitored throughout the incubation and confirmed active in vitro fermentation. Bacterial DNA was detected in all sample types at all time points. Persistence patterns of endogenous (Rubisco) and recombinant (EPSPS) rapeseed DNA were inversely related to substrate digestibility (amplifiable for 48, 8 and 4 h in whole or cracked seeds, meal and diets respectively), but did not differ between parental and GM rapeseed, nor among fragments. Detection of fragments was representative of persistence of the whole transgene. No EPSPS fragments were amplifiable in microbial DNA, suggesting that transformation had not occurred during the 48 h incubation. Uptake of transgenic DNA fragments by ruminal bacteria is probably precluded or time-limited by rapid degradation of plant DNA upon plant cell lysis.

  8. Capture and detection of DNA hybrids on paper via the anchoring of antibodies with fusions of carbohydrate binding modules and ZZ-domains.

    Science.gov (United States)

    Rosa, Ana M M; Louro, A Filipa; Martins, Sofia A M; Inácio, João; Azevedo, Ana M; Prazeres, D Miguel F

    2014-05-06

    Microfluidic paper-based analytical devices (μPADs) fabricated by wax-printing are suitable platforms for the development of simple and affordable molecular diagnostic assays for infectious diseases, especially in resource-limited settings. Paper devices can be modified for biological assays by adding appropriate reagents to the test areas. For this purpose, the use of affinity immobilization strategies can be a good solution for bioactive paper fabrication. This paper describes a methodology to capture labeled-DNA strands and hybrids on paper via the anchoring of antibodies with a fusion protein that combines a family 3 carbohydrate binding module (CBM) from Clostridium thermocellum, with high affinity to cellulose, and the ZZ fragment of the staphyloccocal protein A, which recognizes IgG antibodies via their Fc portion. Antibodies immobilized via CBM-ZZ were able to capture appropriately labeled (biotin, fluorescein) DNA strands and DNA hybrids. The ability of an antibody specific to biotin to discriminate complementary from noncomplementary, biotin-labeled targets was demonstrated in both spot and microchannel assays. Hybridization was detected by fluorescence emission of the fluorescein-labeled DNA probe. The efficiency of the capture of labeled-DNA by antibodies immobilized on paper via the CBM-ZZ construct was significantly higher when compared with a physical adsorption method where antibodies were simply spotted on paper without the intermediation of other molecules. The experimental proof of concept of wax-printed μPADs functionalized with CBM-ZZ for DNA detection at room temperature presented in this study constitutes an important step toward the development of easy to use and affordable molecular diagnostic tests.

  9. Oligo-dT anchored cDNA-SCoT: a novel differential display method for analyzing differential gene expression in response to several stress treatments in mango (Mangifera indica L.).

    Science.gov (United States)

    Luo, Cong; He, Xin-Hua; Hu, Ying; Yu, Hai-xia; Ou, Shi-Jin; Fang, Zhong-Bin

    2014-09-15

    Differential display is a powerful technique for analyzing differences in gene expression. Oligo-dT cDNAstart codon targeted marker (cDNA-SCoT) technique is a novel, simple, cheap, rapid, and efficient method for differential gene expression research. In the present study, the oligo-dT anchored cDNA-SCoT technique was exploited to identify differentially expressed genes during several stress treatments in mango. A total of 37 primers combined with oligo-dT anchor primers 3side amplified approximately 150 fragments of 150 bp to 1500 bp in length. Up to 100 fragments were differentially expressed among the stress treatments and control samples, among which 92 were obtained and sequenced. Out of the 92 transcript derived fragments (TDFs), 70% were highly homologous to known genes, and 30% encoded unclassified proteins with unknown functions. The expression pattern of nine genes with known functions involved in several abiotic stresses in other species was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) under cold (4 °C), salinity (NaCl), polyethylene glycol (PEG, MW 6000), and heavy metal treatments in leaves and stems at different time points (0, 24, 48, and 72 h). The expression patterns of the genes (TDF4, TDF7, TDF23, TDF45, TDF49, TDF50, TDF57, TDF91 and TDF92) that had direct or indirect relationships with cold, salinity, drought and heavy metal stress response were analyzed through qRT-PCR. The possible roles of these genes are discussed. This study suggests that the oligo-dT anchored cDNA-SCoT differential display method is a useful tool to serve as an initial step for characterizing transcriptional changes induced by abiotic stresses and provide gene information for further study and application in genetic improvement and breeding in mango. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Microfluidic chip for stacking, separation and extraction of multiple DNA fragments.

    Science.gov (United States)

    Wu, Ruige; Seah, Y P; Wang, Zhiping

    2016-03-11

    A disposable integrated microfluidic device was developed for rapid sample stacking, separation and extraction of multiple DNA fragments from a relatively large amount of sample. Isotachophoresis hyphenated gel electrophoresis (ITP-GE) was used to pre-concentrate and separate DNA fragments, followed by extraction of pure DNA fragments with electroelution on-chip. DNA fragments of 200bp, 500bp and 1kbp were successfully separated and collected in the extraction chamber within 25min. The extraction efficiency obtained from the chip was 49.9%, 52.1% and 53.7% for 200bp, 500bp and 1kbp DNA fragments, respectively. The extracted DNA fragments exhibited compatibility with downstream enzymatic reactions, for example PCR. The chip was also used to extract DNA fragments with specific size range from sheared genomic DNA and demonstrated similar performance to that using traditional gel cutting method. The whole assay can finish in 32min, 6 times faster than traditional method. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Influence of the electrokinetic injection conditions on the separation of DNA fragments in capillary electrophoresis

    OpenAIRE

    Catai Jonatan Ricardo; Carrilho Emanuel

    2004-01-01

    In genetic analysis by capillary electrophoresis with polymer solutions there are many variables that affect separation of the DNA fragments. A very critical one is the sample injection process, which can considerably affect the peak efficiency and the resolution. In this work, we have studied the influence of the DNA sample composition and the electrokinetic injection conditions in the separation of DNA fragments by capillary electrophoresis using replaceable polymer solutions. The studies w...

  12. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  14. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  15. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    Organisms release DNA both when they live and die. Eventually the DNA disintegrates entirely or it is re-metabolized. There is a constant deposition and decomposition that maintains an environmental pool with large quantities of extracellular DNA, some of which can be thousands of years old. The ...... in chemistry. In addition to qualitative DNA sequencing, statistical analysis of the numerous sequencing reads yields quantitative measurements of DNA modifying reactions....

  16. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium fredii RT19].

    Science.gov (United States)

    Bian, X L; Ge, S C; Yang, S S

    2000-01-01

    A 23 kb DNA fragment related to salt tolerance was obtained from the gene library of S. fredii strain RT19. In this study, BamH I was selected to digest 23 kb DNA fragment into different length of DNA fragments. The resulting fragments were ligated with plasmid pML122, then the recombinant plasmids were transformed to competent cells of E. coli S17-1 on selective medium and three transformants TR were obtained. Two-parental mating experiments were carried out with these transformants as donor and salt sensitive S. fredii strain RC3-3 as recipient, and the transconjugant BR2 was selected on FY plates containing gentamycin and 0.4 mol/L NaCl. Thus, a 4.4 kb DNA fragment related to salt tolerance was obtained. Based on its physical map, six restriction fragments were subcloned into plasmid pUC18 for DNA sequencing. Subsequently, sequencing and analysis of 4.4 kb DNA fragment showed that fixO, fixN genes and three ORFs were obtained.

  17. New approach to assess sperm DNA fragmentation dynamics: Fine-tuning mathematical models.

    Science.gov (United States)

    Ortiz, Isabel; Dorado, Jesús; Morrell, Jane; Gosálvez, Jaime; Crespo, Francisco; Jiménez, Juan M; Hidalgo, Manuel

    2017-01-01

    Sperm DNA fragmentation (sDF) has been proved to be an important parameter in order to predict in vitro the potential fertility of a semen sample. Colloid centrifugation could be a suitable technique to select those donkey sperm more resistant to DNA fragmentation after thawing. Previous studies have shown that to elucidate the latent damage of the DNA molecule, sDF should be assessed dynamically, where the rate of fragmentation between treatments indicates how resistant the DNA is to iatrogenic damage. The rate of fragmentation is calculated using the slope of a linear regression equation. However, it has not been studied if sDF dynamics fit this model. The objectives of this study were to evaluate the effect of different after-thawing centrifugation protocols on sperm DNA fragmentation and elucidate the most accurate mathematical model (linear regression, exponential or polynomial) for DNA fragmentation over time in frozen-thawed donkey semen. After submitting post-thaw semen samples to no centrifugation (UDC), sperm washing (SW) or single layer centrifugation (SLC) protocols, sDF values after 6 h of incubation were significantly lower in SLC samples than in SW or UDC. Coefficient of determination (R 2 ) values were significantly higher for a second order polynomial model than for linear or exponential. The highest values for acceleration of fragmentation (aSDF) were obtained for SW, followed by SLC and UDC. SLC after thawing seems to preserve longer DNA longevity in comparison to UDC and SW. Moreover, the fine-tuning of models has shown that sDF dynamics in frozen-thawed donkey semen fit a second order polynomial model, which implies that fragmentation rate is not constant and fragmentation acceleration must be taken into account to elucidate hidden damage in the DNA molecule.

  18. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  19. Efficient double fragmentation ChIP-seq provides nucleotide resolution protein-DNA binding profiles

    NARCIS (Netherlands)

    Mokry, M.; Hatzis, P.; de Bruijn, E.; Koster, J.; Versteeg, R.; Schuijers, J.; van de Wetering, M.L.; Guryev, V.; Clevers, H.; Cuppen, E.

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  20. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  1. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  2. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  3. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  4. The Restriction Fragment Map of Rat-Liver Mitochondrial DNA : A Reconsideration

    NARCIS (Netherlands)

    Pepe, G.; Bakker, H.; Holtrop, M.; Bollen, J.E.; Bruggen, E.F.J. van; Cantatore, P.; Terpstra, P.; Saccone, C.

    1977-01-01

    1. Rat-liver mitochondrial DNA (mtDNA) contains at least 8 cleavage sites for the restriction endonuclease Eco RI, 6 for the restriction endonuclease Hind III, 2 for the restriction endonuclease Bam HI and 11 for the restriction endonuclease Hap II. 2. The physical map of the restriction fragments

  5. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona Berger Håkonsen; Fedder, J

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR...

  6. [Subcloning and sequencing of DNA fragment related to salt tolerance in Sinorhizobium meliloti 042B].

    Science.gov (United States)

    Ge, S; Fan, Z; Chen, X; Yang, S

    2001-02-01

    A 4 kb ClaI DNA fragment related to salt tolerance from S. meliloti 042B was digested by HindIII down 2.4 kb fragment, and a 1.6 kb ClaII-HindIII fragment was retained on plasmid pML122. Then, the 2.4 kb DNA fragment was ligated with plasmid pBBR1-MCS2, and the recombinant plasmid was transformed to E. coli DH5 alpha, and transformant GS2 was obtained. Three-parental mating experiments were carried out with transformant GS2 as donor, salt sensitive strains GZ17 as recipient and pRK2013 as helper plasmid, then the transconjugant GG2 was selected on FY plates containing kanamycin and 0.4 mol/L NaCl. The remaining DNA fragment was self ligated with pML122 and then transformed into E. coli S17-1 and transformat GS0 was obtained. Two-parental mating experiment was carried out with transformant GS0 as donor and salt sensitive strain GZ17 as recipient, but no transconjugant was obtained on the FY plates. Then, the 2.4 kb HindIII DNA fragment was ligated into sequencing vector pGEM-7Zf(+) for sequencing. The result of sequencing and analysis showed that the 2.4 kb DNA fragment contained three ORFs. According to the result of sequencing, further subcloning was conducted and 1.9 kb HindIII-Sac II DNA fragment related to salt tolerance was obtained.

  7. Analysis of parental strain DNA fragments existing in GEMs-Fhhh.

    Science.gov (United States)

    Hao, Chun-Bo; Yan, Jun; Qu, Meng-Meng; Wang, Dong; Cheng, Shu-Pei; Gu, Ji-Dong; Qiu, Wan-Fei; Wang, Yin-Yin

    2003-09-01

    There were 6 target DNA fragments of the three parental strains existing in the cell of GEMs (genetically engineered microorganism strain) Fhhh measured in this research by PCR(polymerase chain reaction). The determination showed that GEMs Fhhh contained all the 6 target DNA fragments, mnp1, mnp2, lip1, lip2, FLO1 and 16S rDNA, and had the molecular genetic stability. Meanwhile the PCR production of each parental strain could only had its target DNA fragments and was different from each other. It may illustrate that the technique of the inter-kingdom protoplast fusion for the construction of GEMs Fhhh through the process of intercellular gene recombination could be used as a reliable bioengineering technique to create the specific functional stain for the pollution control.

  8. Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

    Directory of Open Access Journals (Sweden)

    Ma G

    2013-03-01

    Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

  9. Hyperbolic SOM-based clustering of DNA fragment features for taxonomic visualization and classification.

    Science.gov (United States)

    Martin, Christian; Diaz, Naryttza N; Ontrup, Jörg; Nattkemper, Tim W

    2008-07-15

    Modern high-throughput sequencing technologies enable the simultaneous analysis of organisms in an environment. The analysis of species diversity and the binning of DNA fragments of non-sequenced species for assembly are two major challenges in sequence analysis. To achieve reasonable binnings and classifications, DNA fragment structure has to be represented appropriately, so it can be processed by machine learning algorithms. Hierarchically growing hyperbolic Self-Organizing maps (H(2)SOMs) are trained to cluster small variable-length DNA fragments (0.2-50 kb) of 350 prokaryotic organisms at six taxonomic ranks Superkingdom, Phylum, Class, Order, Genus and Species in the Tree of Life. DNA fragments are mapped to three different types of feature vectors based on the genomic signature: basic features, features considering the importance of oligonucleotide patterns as well as contrast enhanced features. The H (2)SOM classifier achieves high classification rates while at the same time its visualization allows further insights into the projected data and has the potential to support binning of short sequence reads, because DNA fragments can be grouped into phylogenetic groups. An implementation of the H(2)HSOM classifier in Matlab is provided at www.techfak.uni-bielefeld.de/ags/ani/projects/HHSOMSeqData.

  10. Effect of different gravity environments on DNA fragmentation and cell death in Kalanchoe leaves.

    Science.gov (United States)

    Pedroso, M C; Durzan, D J

    2000-11-01

    Different gravity environments have been shown to significantly affect leaf-plantlet formation and asexual reproduction in Kalanchoë daigremontiana Ham. and Perr. In the present work, we investigated the effect of gravity at tissue and cell levels. Leaves and leaf-plantlets were cultured for different periods of time (min to 15 d) in different levels of gravity stimulation: simulated hypogravity (1 rpm clinostats; 2 x 10(-4) g), 1 g (control) and hypergravity (centrifugation; 20 and 150 g). Both simulated hypogravity and hypergravity affected cell death (apoptosis) in this species, and variations in the number of cells showing DNA fragmentation directly correlated with nitric oxide (NO) formation. Apoptosis in leaves was more common as gravity increased. Apoptotic cells were localized in the epidermis, mainly guard cells, in leaf parenchyma, and in tracheary elements undergoing terminal differentiation. Exposures to acute hypergravity (up to 60 min) showed that chloroplast DNA fragmentation occurred prior to nuclear DNA fragmentation, marginalization of chromatin, nuclear condensation, and nuclear blebbing. Addition of sodium nitroprusside (NO donor) mimicked centrifugation. NO and DNA fragmentation decreased with N(G)-monomethyl-L-arginine (NO-synthase inhibitor). The variations in NO levels, nucleoid DNA fragmentation, and cell death show how chloroplasts, cells and leaves may respond (and adapt) to gravity changes. c 2000 Annals of Botany Company.

  11. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  12. Simulating Molecular Interactions of Carbon Nanoparticles with a Double-Stranded DNA Fragment

    Directory of Open Access Journals (Sweden)

    Zhuang Wang

    2015-01-01

    Full Text Available Molecular interactions between carbon nanoparticles (CNPs and a double-stranded deoxyribonucleic acid (dsDNA fragment were investigated using molecular dynamics (MD simulations. Six types of CNPs including fullerenes (C60 and C70, (8,0 single-walled carbon nanotube (SWNT, (8,0 double-walled carbon nanotube (DWNT, graphene quantum dot (GQD, and graphene oxide quantum dot (GOQD were studied. Analysis of the best geometry indicates that the dsDNA fragment can bind to CNPs through pi-stacking and T-shape. Moreover, C60, DWNT, and GOQD bind to the dsDNA molecules at the minor groove of the nucleotide, and C70, SWNT, and GQD bind to the dsDNA molecules at the hydrophobic ends. Estimated interaction energy implies that van der Waals force may mainly contribute to the mechanisms for the dsDNA-C60, dsDNA-C70, and dsDNA-SWNT interactions and electrostatic force may contribute considerably to the dsDNA-DWNT, dsDNA-GQD, and dsDNA-GOQD interactions. On the basis of the results from large-scale MD simulations, it was found that the presence of the dsDNA enhances the dispersion of C60, C70, and SWNT in water and has a slight impact on DWNT, GQD, and GOQD.

  13. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... interest by PCR using proof reading DNA polymerase, such as Pfu, KOD and Primerstar, is preferred since the. PCR products with a higher degree of fidelity are required in many investigations. However, traditional blunt-end cloning method for direct cloning of blunt-end PCR products is not efficient since ...

  14. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  15. The Flp double cross system a simple efficient procedure for cloning DNA fragments

    Directory of Open Access Journals (Sweden)

    Sadowski Paul D

    2003-07-01

    Full Text Available Abstract Background While conventional cloning methods using restriction enzymes and polynucleotide ligase are adequate for most DNAs, fragments made by the polymerase chain reaction are difficult to clone because the amplifying DNA polymerase tends to add untemplated nucleotides to the 3'-termini of the amplified strands. Conservative site-specific recombinases offer an efficient alternative to conventional cloning methods. Results In this paper I describe the use of the Flp site-specific recombinase for cloning PCR-amplified fragments. A DNA fragment is amplified with primers that contain at their ends inverted target sequences for Flp. Flp readily recombines these fragments in vitro into a vector that also contains two inverted Flp target sequences surrounding the α-complementing region of the lacZ gene of E. coli. The recombinants are conveniently detected as white colonies by the familiar blue/white screening test for lacZ activity. A useful feature of the system is that both orientations of the inserted DNA are usually obtained. If the recipient vector is cut between the two inverted Flp targets, Flp "heals" the double-strand break by inserting a linear fragment flanked by Flp targets. Conclusion This system ("The Flp Double Cross System" should be useful for cloning multiple PCR fragments into many sites in several vectors. It has certain advantages over other available recombinase-based cloning procedures.

  16. Glycosyl-Phosphatidylinositol-Anchored Anti-HIV Env Single-Chain Variable Fragments Interfere with HIV-1 Env Processing and Viral Infectivity.

    Science.gov (United States)

    Misra, Anisha; Gleeson, Emile; Wang, Weiming; Ye, Chaobaihui; Zhou, Paul; Kimata, Jason T

    2018-04-01

    In previous studies, we demonstrated that single-chain variable fragments (scFvs) from anti-human immunodeficiency virus (HIV) Env monoclonal antibodies act as entry inhibitors when tethered to the surface of target cells by a glycosyl-phosphatidylinositol (GPI) anchor. Interestingly, even if a virus escapes inhibition at entry, its replication is ultimately controlled. We hypothesized that in addition to functioning as entry inhibitors, anti-HIV GPI-scFvs may also interact with Env in an infected cell, thereby interfering with the infectivity of newly produced virions. Here, we show that expression of the anti-HIV Env GPI-scFvs in virus-producing cells reduced the release of HIV from cells 5- to 22-fold, and infectivity of the virions that were released was inhibited by 74% to 99%. Additionally, anti-HIV Env GPI-scFv X5 inhibited virion production and infectivity after latency reactivation and blocked transmitter/founder virus production and infectivity in primary CD4 + T cells. In contrast, simian immunodeficiency virus (SIV) production and infectivity were not affected by the anti-HIV Env GPI-scFvs. Loss of infectivity of HIV was associated with a reduction in the amount of virion-associated Env gp120. Interestingly, an analysis of Env expression in cell lysates demonstrated that the anti-Env GPI-scFvs interfered with processing of Env gp160 precursors in cells. These data indicate that GPI-scFvs can inhibit Env processing and function, thereby restricting production and infectivity of newly synthesized HIV. Anti-Env GPI-scFvs therefore appear to be unique anti-HIV molecules as they derive their potent inhibitory activity by interfering with both early (receptor binding/entry) and late (Env processing and incorporation into virions) stages of the HIV life cycle. IMPORTANCE The restoration of immune function and persistence of CD4 + T cells in HIV-1-infected individuals without antiretroviral therapy requires a way to increase resistance of CD4 + T cells to

  17. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  18. Sperm DNA fragmentation: An early and reliable marker of air pollution.

    Science.gov (United States)

    Bosco, Liana; Notari, Tiziana; Ruvolo, Giovanni; Roccheri, Maria C; Martino, Chiara; Chiappetta, Rosanna; Carone, Domenico; Lo Bosco, Giosuè; Carrillo, Laura; Raimondo, Salvatore; Guglielmino, Antonino; Montano, Luigi

    2018-03-01

    Environmental factors could have a key role in the continuous and remarkable decline of sperm quality observed in the last decades. This study compared the seminal parameters and sperm DFI in men living in areas with different levels of air pollution. Results demonstrate that both steel plants workers and patients living in a high polluted area show a mean percentage of sperm DNA fragmentation above 30%, highlighting a clear sperm damage. In this work, two different techniques were used to measure sperm DNA damage in patients' groups, finding in both cases a high sperm DFI in patients living in polluted areas. We candidate sperm DNA fragmentation as a valuable early marker of the presence and harmful effects of pollution. We suggest that sperm DNA evaluation could be both an indicator of individual health and reproductive capacity, and a suitable datum to connect the surrounding environment with its effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  20. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  1. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  2. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  3. FragMatch--a program for the analysis of DNA fragment data.

    Science.gov (United States)

    Saari, T A; Saari, S K; Campbell, C D; Alexander, I J; Anderson, I C

    2007-03-01

    FragMatch is a user-friendly Java-supported program that automates the identification of taxa present in mixed samples by comparing community DNA fragment data against a database of reference patterns for known species. The program has a user-friendly Windows interface and was primarily designed for the analysis of fragment data derived from terminal restriction fragment length polymorphism analysis of ectomycorrhizal fungal communities, but may be adapted for other applications such as microsatellite analyses. The program uses a simple algorithm to check for the presence of reference fragments within sample files that can be directly imported, and the results appear in a clear summary table that also details the parameters that were used for the analysis. This program is significantly more flexible than earlier programs designed for matching RFLP patterns as it allows default or user-defined parameters to be used in the analysis and has an unlimited database size in terms of both the number of reference species/individuals and the number of diagnostic fragments per database entry. Although the program has been developed with mycorrhizal fungi in mind, it can be used to analyse any DNA fragment data regardless of biological origin. FragMatch, along with a full description and users guide, is freely available to download from the Aberdeen Mycorrhiza Group web page (http://www.aberdeenmycorrhizas.com).

  4. A general method to modify BACs to generate large recombinant DNA fragments.

    Science.gov (United States)

    Shen, Wei; Huang, Yue; Tang, Yi; Liu, De-Pei; Liang, Chih-Chuan

    2005-11-01

    Bacterial artificial chromosome (BAC) has the capacity to clone DNA fragments in excess of 300 kb. It also has the considerable advantages of stable propagation and ease of purification. These features make BAC suitable in genetic research, such as library construction, transgenic mice production, and gene targeting constructs. Homologous recombination in Escherichia coli, a process named recombineering, has made the modification of BACs easy and reliable. We report here a modified recombineering method that can efficiently mediate the fusion of large DNA fragments from two or more different BACs. With the introduction of kanamycin-resistant gene and proposed rare-cutting restriction endonuclease (RCRE) sites into two BACs, a 82.6-kb DNA fragment containing the inverted human alpha-globin genes (theta, alpha1, alpha2, and zeta) from BAC191K2 and the locus control region (LCR) of human beta-globin gene locus (from the BAC186D7) was reconstructed. This approach for combining different BAC DNA fragments should facilitate many kinds of genomic experiments.

  5. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  6. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  7. Generation of longer 3' cDNA fragments from massively parallel signature sequencing tags.

    Science.gov (United States)

    Silva, Ana Paula M; Chen, Jianjun; Carraro, Dirce M; Wang, San Ming; Camargo, Anamaria A

    2004-07-06

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3'end of transcripts. A single MPSS experiment can generate over 10(7) tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (approximately 1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3' cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts.

  8. Generation of longer 3′ cDNA fragments from massively parallel signature sequencing tags

    Science.gov (United States)

    Silva, Ana Paula M.; Chen, Jianjun; Carraro, Dirce M.; Wang, San Ming; Camargo, Anamaria A.

    2004-01-01

    Massively Parallel Signature Sequencing (MPSS) is a powerful technique for genome-wide gene expression analysis, which, similar to SAGE, relies on the production of short tags proximal to the 3′end of transcripts. A single MPSS experiment can generate over 107 tags, providing a 10-fold coverage of the transcripts expressed in a human cell. A significant fraction of MPSS tags cannot be assigned to known transcripts (orphan tags) and are likely to be derived from transcripts expressed at very low levels (∼1 copy per cell). In order to explore the potential of MPSS for the characterization of the human transcriptome, we have adapted the GLGI protocol (Generation of Longer cDNA fragments from SAGE tags for Gene Identification) to convert MPSS tags into their corresponding 3′ cDNA fragments. GLGI-MPSS was applied to 83 orphan tags and 41 cDNA fragments were obtained. The analysis of these 41 fragments allowed the identification of novel transcripts, alternative tags generated from polymorphic and alternatively spliced transcripts, as well as the detection of artefactual MPSS tags. A systematic large-scale analysis of the genome by MPSS, in combination with the use of GLGI-MPSS protocol, will certainly provide a complementary approach to generate the complete catalog of human transcripts. PMID:15247327

  9. Combination of native and denaturing PAGE for the detection of protein binding regions in long fragments of genomic DNA

    Directory of Open Access Journals (Sweden)

    Metsis Madis

    2008-06-01

    Full Text Available Abstract Background In a traditional electrophoresis mobility shift assay (EMSA a 32P-labeled double-stranded DNA oligonucleotide or a restriction fragment bound to a protein is separated from the unbound DNA by polyacrylamide gel electrophoresis (PAGE in nondenaturing conditions. An extension of this method uses the large population of fragments derived from long genomic regions (approximately 600 kb for the identification of fragments containing protein binding regions. With this method, genomic DNA is fragmented by restriction enzymes, fragments are amplified by PCR, radiolabeled, incubated with nuclear proteins and the resulting DNA-protein complexes are separated by two-dimensional PAGE. Shifted DNA fragments containing protein binding sites are identified by using additional procedures, i. e. gel elution, PCR amplification, cloning and sequencing. Although the method allows simultaneous analysis of a large population of fragments, it is relatively laborious and can be used to detect only high affinity protein binding sites. Here we propose an alternative and straightforward strategy which is based on a combination of native and denaturing PAGE. This strategy allows the identification of DNA fragments containing low as well as high affinity protein binding regions, derived from genomic DNA ( Results We have combined an EMSA-based selection step with subsequent denaturing PAGE for the localization of protein binding regions in long (up to10 kb fragments of genomic DNA. Our strategy consists of the following steps: digestion of genomic DNA with a 4-cutter restriction enzyme (AluI, BsuRI, TruI, etc, separation of low and high molecular weight fractions of resultant DNA fragments, 32P-labeling with Klenow polymerase, traditional EMSA, gel elution and identification of the shifted bands (or smear by denaturing PAGE. The identification of DNA fragments containing protein binding sites is carried out by running the gel-eluted fragments alongside

  10. Polyethyleneimine anchored copper(II) complexes: synthesis, characterization, in vitro DNA binding studies and cytotoxicity studies.

    Science.gov (United States)

    Lakshmipraba, Jagadeesan; Arunachalam, Sankaralingam; Riyasdeen, Anvarbatcha; Dhivya, Rajakumar; Akbarsha, Mohammad Abdulkader

    2015-01-01

    The water soluble polyethyleneimine-copper(II) complexes, [Cu(phen)(L-tyr)BPEI]ClO4 (where phen=1,10-phenanthroline, L-tyr=L-tyrosine and BPEI=branched polyethyleneimine) with various degree of copper(II) complex units in the polymer chain were synthesized and characterized by elemental analysis and electronic, FT-IR, EPR spectroscopic techniques. The binding of these complexes with CT-DNA was studied using UV-visible absorption titration, thermal denaturation, emission, circular dichroism spectroscopy and cyclic voltammetric methods. The changes observed in the physicochemcial properties indicated that the binding between the polymer-copper complexes and DNA was mostly through electrostatic mode of binding. Among these complexes, the polymer-copper(II) complex with the highest degrees of copper(II) complex units (higher degrees of coordination) showed higher binding constant than those with lower copper(II) complex units (lower degrees of coordination) complexes. The complex with the highest number of metal centre bound strongly due to the cooperative binding effect. Therefore, anticancer study was carried out using this complex. The cytotoxic activity for this complex on MCF-7 breast cancer cell line was determined adopting MTT assay, acridine orange/ethidium bromide (AO/EB) staining and comet assay techniques, which revealed that the cells were committed to specific mode of cell death either apoptosis or necrosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  12. Molecular definition of high-resolution multicolor banding probes: first within the human DNA sequence anchored FISH banding probe set.

    Science.gov (United States)

    Weise, Anja; Mrasek, Kristin; Fickelscher, Ina; Claussen, Uwe; Cheung, Sau Wai; Cai, Wei Wen; Liehr, Thomas; Kosyakova, Nadezda

    2008-05-01

    Fluorescence in situ hybridization (FISH) banding approaches are standard for the exact characterization of simple, complex, and even cryptic chromosomal aberrations within the human genome. The most frequently applied FISH banding technique is the multicolor banding approach, also abbreviated as m-band, MCB, or in its whole genomic variant multitude MCB (mMCB). MCB allows the differentiation of chromosome region-specific areas at the GTG band and sub-band level and is based on region-specific microdissection libraries, producing changing fluorescence intensity ratios along the chromosomes. The latter are used to assign different pseudocolors to specific chromosomal regions. Here we present the first bacterial artificial chromosome (BAC) array comparative genomic hybridization (aCGH) mapped, comprehensive, genome-wide human MCB probe set. All 169 region-specific microdissection libraries were characterized in detail for their size and the regions of overlap. In summary, the unique possibilities of the MCB technique to characterize chromosomal breakpoints in one FISH experiment are now complemented by the feature of being anchored within the human DNA sequence at the BAC level.

  13. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  14. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  15. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  16. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  17. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  18. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  19. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  20. Cell-free DNA fragmentation patterns in amniotic fluid identify genetic abnormalities and changes due to storage.

    Science.gov (United States)

    Peter, Inga; Tighiouart, Hocine; Lapaire, Olav; Johnson, Kirby L; Bianchi, Diana W; Terrin, Norma

    2008-09-01

    Circulating cell-free DNA (cfDNA) has become a promising biomarker in prenatal diagnosis. However, despite extensive studies in different body fluids, cfDNA predictive value is uncertain owing to the confounding factors that can affect its levels, such as gestational age, maternal weight, smoking status, and medications. Residual fresh and archived amniotic fluid (AF) supernatants were obtained from gravid women (mean gestational age 17 wk) carrying euploid (N=36) and aneuploid (N=29) fetuses, to characterize cfDNA-fragmentation patterns with regard to aneuploidy and storage time (-80 degrees C). AF cfDNA was characterized by the real-time quantitative polymerase chain reaction amplification of glyceraldehyde-3-phosphate dehydrogenase, gel electrophoresis, and pattern recognition of the DNA fragmentation. The distributions of cfDNA fragment lengths were compared using 6 measures that defined the locations and slopes for the first and last peaks, after elimination of the confounding variables. This method allowed for the unique classification of euploid and aneuploid cfDNA samples in AF, which had been matched for storage time. In addition, we showed that archived euploid AF samples gradually lose long cfDNA fragments: this loss accurately distinguishes them from the fresh samples. We present preliminary data using cfDNA-fragmentation patterns, to uniquely distinguish between AF samples of pregnant women with regard to aneuploidy and storage time, independent of gestational age and initial DNA amount. In addition to potential applications in prenatal diagnosis, these data suggest that archived AF samples consist of large amounts of short cfDNA fragments, which are undetectable using standard real-time polymerase chain reaction amplification.

  1. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  2. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  3. Dimerization of the Klenow fragment of Escherichia coli DNA polymerase I is linked to its mode of DNA binding.

    Science.gov (United States)

    Bailey, Michael F; Van der Schans, Edwin J C; Millar, David P

    2007-07-10

    Upon associating with a proofreading polymerase, the nascent 3' end of a DNA primer/template has two possible fates. Depending upon its suitability as a substrate for template-directed extension or postsynthetic repair, it will bind either to the 5'-3' polymerase active site, yielding a polymerizing complex, or to the 3'-5' exonuclease site, yielding an editing complex. In this investigation, we use a combination of biochemical and biophysical techniques to probe the stoichiometry, thermodynamic, and kinetic stability of the polymerizing and editing complexes. We use the Klenow fragment of Escherichia coli DNA polymerase I (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA substrates. Polymerizing complexes are produced by mixing KF with correctly base paired (matched) primer/templates, whereas editing complexes are produced by mixing KF with multiply mismatched primer/templates. Electrophoretic mobility shift titrations carried out with matched and multiply mismatched primer/templates give rise to markedly different electrophoretic patterns. In the case of the matched primer/template, the KF.DNA complex is represented by a slow moving band. However, in the case of the multiply mismatched primer/template, the complex is predominantly represented by a fast moving band. Analytical ultracentrifugation measurements indicate that the fast and slow moving bands correspond to 1:1 and 2:1 KF.DNA complexes, respectively. Fluorescence anisotropy titrations reveal that KF binds with a higher degree of cooperativity to the matched primer/template. Taken together, these results indicate that KF is able to dimerize on a DNA primer/template and that dimerization is favored when the first molecule is bound in the polymerizing mode, but disfavored when it is bound in the editing mode. We suggest that self-association of the polymerase may play an important and as yet unexplored role in coordinating high-fidelity DNA replication.

  4. Fragmentation of bacteriophage S13 replicative from DNA by restriction endonucleases from Hemophilus influenzae and Hemophilus aegyptius.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); K.M. Ojamaa; J.H. Spencer

    1976-01-01

    textabstractThe restriction enzymes Hind from Hemophilus influenzae and HaeIII from Hemophilus aegyptius cleave bacteriophage S13 replicative form (RF) DNA into 13 and 10 specific fragments, respectively. The sizes of these fragments were estimated by gel electrophoresis, electron microscopy, and

  5. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  6. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  7. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  8. Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells

    Directory of Open Access Journals (Sweden)

    Sharma Shikhar

    2012-01-01

    Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.

  9. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  10. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  11. Melting profiles may affect detection of residual HPV L1 gene DNA fragments in Gardasil®.

    Science.gov (United States)

    Lee, Sin Hang

    2014-03-01

    Gardasil® is a quadrivalent human papillomavirus (HPV) protein-based vaccine containing genotype-specific L1 capsid proteins of HPV-16, HPV-18, HPV-6 and HPV-11 in the form of virus-like-particles (VLPs) as the active ingredient. The VLPs are produced by a DNA recombinant technology. It is uncertain if the residual HPV L1 gene DNA fragments in the vaccine products are considered contaminants or excipients of the Gardasil® vaccine. Because naked viral DNA fragments, if present in the vaccine, may bind to the insoluble amorphous aluminum hydroxyphosphate sulfate (AAHS) adjuvant which may help deliver the foreign DNA into macrophages, causing unintended pathophysiologic effects, experiments were undertaken to develop tests for HPV L1 gene DNA fragments in the final products of Gardasil® by polymerase chain reaction (PCR) and direct DNA sequencing. The results showed that while the HPV-11 and HPV-18 L1 gene DNA fragments in Gardasil® were readily amplified by the common GP6/MY11 degenerate consensus primers, the HPV-16 L1 gene DNA may need specially designed non-degenerate PCR primers for amplification at different regions of the L1 gene and different stringency conditions for detection. These variable melting profiles of HPV DNA in the insoluble fraction of the Gardasil® vaccine suggest that the HPV DNA fragments are firmly bound to the aluminum AAHS adjuvant. All methods developed for detecting residual HPV DNA in the vaccine Gardasil® for quality assurance must take into consideration the variable melting profiles of the DNA to avoid false negative results.

  12. Analysis of DNA from post-blast pipe bomb fragments for identification and determination of ancestry.

    Science.gov (United States)

    Tasker, Esiri; LaRue, Bobby; Beherec, Charity; Gangitano, David; Hughes-Stamm, Sheree

    2017-05-01

    Improvised explosive devices (IEDs) such as pipe bombs are weapons used to detrimentally affect people and communities. A readily accessible brand of exploding targets called Tannerite® has been identified as a potential material for abuse as an explosive in pipe bombs. The ability to recover and genotype DNA from such weapons may be vital in the effort to identify suspects associated with these devices. While it is possible to recover DNA from post-blast fragments using short tandem repeat markers (STRs), genotyping success can be negatively affected by low quantities of DNA, degradation, and/or PCR inhibitors. Alternative markers such as insertion/null (INNULs) and single nucleotide polymorphisms (SNPs) are bi-allelic genetic markers that are shorter genomic targets than STRs for amplification, which are more likely to resist degradation. In this study, we constructed pipe bombs that were spiked with known amounts of biological material to: 1) recover "touch" DNA from the surface of the device, and 2) recover traces of blood from the ends of wires (simulated finger prick). The bombs were detonated with the binary explosive Tannerite® using double-base smokeless powder to initiate the reaction. DNA extracted from the post-blast fragments was quantified with the Quantifiler® Trio DNA Quantification Kit. STR analysis was conducted using the GlobalFiler® Amplification Kit, INNULs were amplified using an early-access version of the InnoTyper™ 21 Kit, and SNP analysis via massively parallel sequencing (MPS) was performed using the HID-Ion Ampliseq™ Identity and Ancestry panels using the Ion Chef and Ion PGM sequencing system. The results of this study showed that INNUL markers resulted in the most complete genetic profiles when compared to STR and SNP profiles. The random match probabilities calculated for samples using INNULs were lower than with STRs when less than 14 STR alleles were reported. These results suggest that INNUL analysis may be well suited for

  13. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  14. Novel extraction method of genomic DNA suitable for long-fragment amplification from small amounts of milk.

    Science.gov (United States)

    Liu, Y F; Gao, J L; Yang, Y F; Ku, T; Zan, L S

    2014-11-01

    Isolation of genomic DNA is a prerequisite for assessment of milk quality. As a source of genomic DNA, milk somatic cells from milking ruminants are practical, animal friendly, and cost-effective sources. Extracting DNA from milk can avoid the stress response caused by blood and tissue sampling of cows. In this study, we optimized a novel DNA extraction method for amplifying long (>1,000 bp) DNA fragments and used it to evaluate the isolation of DNA from small amounts of milk. The techniques used for the separation of milk somatic cell were explored and combined with a sodium dodecyl sulfate (SDS)-phenol method for optimizing DNA extraction from milk. Spectrophotometry was used to determine the concentration and purity of the extracted DNA. Gel electrophoresis and DNA amplification technologies were used for to determine DNA size and quality. The DNA of 112 cows was obtained from milk (samples of 13 ± 1 mL) and the corresponding optical density ratios at 260:280 nm were between 1.65 and 1.75. Concentrations were between 12 and 45 μg/μL and DNA size and quality were acceptable. The specific PCR amplification of 1,019- and 729-bp bovine DNA fragments was successfully carried out. This novel method can be used as a practical, fast, and economical mean for long genomic DNA extraction from a small amount of milk. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  15. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  16. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. In vivo assembly of DNA-fragments in the moss, Physcomitrella patens

    DEFF Research Database (Denmark)

    King, Brian Christopher; Vavitsas, Konstantinos; Ikram, Nur Kusaira Binti Khairul

    2016-01-01

    enabled the complete replacement of eukaryotic chromosomes with heterologous DNA. The moss Physcomitrella patens, a non-vascular and spore producing land plant (Bryophyte), has a well-established capacity for homologous recombination. Here, we demonstrate the in vivo assembly of multiple DNA fragments...

  18. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  19. Sperm DNA fragmentation and mitochondrial membrane potential combined are better for predicting natural conception than standard sperm parameters.

    Science.gov (United States)

    Malić Vončina, Slađana; Golob, Barbara; Ihan, Alojz; Kopitar, Andreja Nataša; Kolbezen, Mojca; Zorn, Branko

    2016-03-01

    To evaluate whether DNA fragmentation and/or mitochondrial membrane potential (MMP) predict natural conception better than standard sperm parameters. Prospective cross-sectional study. University medical center. Eighty-five infertile and 51 fertile men. Assessment of sperm DNA fragmentation, MMP, and standard semen parameters over a 6- to 12-month observation period. Comparison between the results of DNA fragmentation, MMP, and standard sperm parameters alone or combined and achievement of natural conception. Twenty-six of the 85 (31%) men from infertile couples conceived naturally. The median values of DNA fragmentation and MMP in the men who conceived within the observation period were similar to those in the fertile controls. Optimal threshold values of DNA fragmentation and MMP were 25% as determined by receiver operating characteristic analysis (area under the curve [AUC], 0.70; 95% confidence interval (CI) 0.58-0.82) and 62.5% (AUC, 0.68, 95% CI 0.56-0.80), respectively. The men in the infertile group with values of DNA fragmentation ≤25% and with MMP values ≥62.5% had significantly higher odds for conception (odds ratio [OR], 5.22; 95% CI 1.82-14.93] and OR, 4.67; 95% CI 1.74-12.5, respectively). Normal semen analysis alone had no predictive value for natural conception (OR, 1.84; 95% CI 0.67-5.07]). Both sperm function tests combined had significant odds for natural conception (OR, 8.24; 95% CI 2.91-23.33]), with a probability of 0.607 (60.7%) for both normal values and 0.158 (15.8%) for abnormal values. Sperm DNA fragmentation and MMP combined may be superior to standard semen parameters for the prediction of natural conception. Copyright © 2016. Published by Elsevier Inc.

  20. Sex determination in highly fragmented human DNA by high-resolution melting (HRM analysis.

    Directory of Open Access Journals (Sweden)

    Brenda A Álvarez-Sandoval

    Full Text Available Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM. HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  1. Sex determination in highly fragmented human DNA by high-resolution melting (HRM) analysis.

    Science.gov (United States)

    Álvarez-Sandoval, Brenda A; Manzanilla, Linda R; Montiel, Rafael

    2014-01-01

    Sex identification in ancient human remains is a common problem especially if the skeletons are sub-adult, incomplete or damaged. In this paper we propose a new method to identify sex, based on real-time PCR amplification of small fragments (61 and 64 bp) of the third exon within the amelogenin gene covering a 3-bp deletion on the AMELX-allele, followed by a High Resolution Melting analysis (HRM). HRM is based on the melting curves of amplified fragments. The amelogenin gene is located on both chromosomes X and Y, showing dimorphism in length. This molecular tool is rapid, sensitive and reduces the risk of contamination from exogenous genetic material when used for ancient DNA studies. The accuracy of the new method described here has been corroborated by using control samples of known sex and by contrasting our results with those obtained with other methods. Our method has proven to be useful even in heavily degraded samples, where other previously published methods failed. Stochastic problems such as the random allele drop-out phenomenon are expected to occur in a less severe form, due to the smaller fragment size to be amplified. Thus, their negative effect could be easier to overcome by a proper experimental design.

  2. Correlation between sperm DNA fragmentation index and CMA3 positive spermatozoa in globozoospermic patients.

    Science.gov (United States)

    Hosseinifar, H; Yazdanikhah, S; Modarresi, T; Totonchi, M; Sadighi Gilani, M A; Sabbaghian, M

    2015-05-01

    The absence of the acrosome causes the situation which is called globozoospermia. There are a few studies, mostly as case reports, about correlation between levels of sperm DNA damage in patients with total round-headed spermatozoa. We investigated this correlation as well as CMA3 positive spermatozoa in 20 globozoospermic men (with more than 90% round-headed spermatozoa) attending to Royan Institute. Semen samples divided into three parts to semen analysis, to measure DNA fragmentation index (DFI) using sperm chromatin structure assay (SCSA) and to detect CMA3(+) sperm cells by chromomycin A3 staining and fluorescent microscopy. Our results showed that there were significant differences in sperm concentration, total sperm motility, and normal morphology between patients and controls group (p spermatozoa in patients group significantly increases compared with control group (p spermatozoa with round head sperm cells in total globozoospermic men. It seems that the increase in DNA damage may be because of defective sperm DNA compaction, as we detected CMA3 positive sperm cells in these patients. © 2015 American Society of Andrology and European Academy of Andrology.

  3. Quantitative retrotransposon anchored PCR confirms transduction efficiency of transgenes in adult Schistosoma mansoni.

    Science.gov (United States)

    Rinaldi, Gabriel; Suttiprapa, Sutas; Brindley, Paul J

    2011-05-01

    A quantitative retrotransposon anchored PCR (qRAP) that utilizes endogenous retrotransposons as a chromosomal anchor was developed to investigate integration of transgenes in Schistosoma mansoni. The qRAP technique, which builds on earlier techniques, (i) Alu-PCR which has been used to quantify lentiviral (HIV-1) proviral insertions in human chromosomes and (ii) a non-quantitative retrotransposon anchored PCR known to detect the presence of transgenes in the S. mansoni genome, was tested here in a model comparison of retrovirus-transduced adult schistosomes in which one group included intact worms, the other included fragments of adult worms. At the outset, after transducing intact and viable fragments of schistosomes with reporter RNAs, we observed more reporter activity in fragments of worms than in intact worms. We considered this simply reflects the increased surface area in fragments compared to intact worms exposed to the exogenous reporter genes. Subsequently, intact worms and worm fragments were transduced with pseudotyped virions. Transgene integration events in genomic DNA extracted from the virion-exposed worms and worm fragments were quantified by the qRAP, which revealed that fragmenting adult schistosomes resulted in increased density of proviral integrations. The qRAP findings confirmed the likely value of this qRAP technique for quantification of transgenes integrated in schistosome chromosomes. Last, considering the absence of schistosome cell or tissue lines, primary culture of fragmented worms offers an opportunity to optimize transgenesis, and other functional genomic approaches. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  5. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  6. Single-cell pulsed-field gel electrophoresis to detect the early stage of DNA fragmentation in human sperm nuclei.

    Directory of Open Access Journals (Sweden)

    Satoru Kaneko

    Full Text Available Single-cell pulsed-field gel electrophoresis (SCPFGE with dual electrode pairs was developed to detect the early stage of DNA fragmentation in human sperm. The motile sperm were purified by the commonly used density-gradient centrifugation technique and subsequent swim-up. The sperm were embedded in a thin film of agarose containing bovine trypsin (20 µg/mL and were then lysed. Prior to SCPFGE, proteolysis of DNA-binding components, such as protamine and the nuclear matrix was essential to separate the long chain fibers from the fibrous and granular fragments derived from a single nucleus. The overall electrophoretic profiles elucidated the course of DNA fragmentation. A few large fibrous fragments were observed at the beginning of the process, however, as the fragmentation advanced, the long chain fibers decreased and shortened, and, conversely, the granular fragments increased until finally almost all the DNA was shredded. Although the ejaculate contained sperm with heterogeneous stages, the purified motile sperm exhibited several dozens of uniformly elongated fibers arising from the tangled DNA at the origin, whereas a part of these fibers gave rise to fibrous fragments beyond the tip of the elongated fibers, and their numbers and sizes varied among the sperm. Conventional intra-cytoplasmic sperm injection (ICSI usually depends on intra-operative light microscopic observation to select a sperm for injection. The present results revealed that sperm motility could not give full assurance of DNA integrity. SCPFGE is likely to serve an important role in the preoperative differential diagnosis to determine the competence of the sperm population provided for injection.

  7. Phenotypic changes in Cyprinus carpiovar var. Jian introduced by sperm-mediated transgenesis of rearranged homologous DNA fragments.

    Science.gov (United States)

    Cao, Zheming; Ding, Weidong; Ren, Hongtao

    2013-09-01

    Common carp, specifically the Jian variety (Cyprinus carpiovar var. Jian), is an important Chinese and global aquatic stock for commercial foodstuff. Homologous recombination of carp gene sequences has been widely used in population genetics to broadly screen for beneficial phenotypical variations, thus optimizing artificially engineered carp stocks with Jian variety and native stock varieties. Random rearrangement of homologous DNA fragments from parent specimens of C. carpiovar var. Jian were attained by digestion of genomic DNA with MspI followed by religation and redigestion with EcoR I to specifically rearrange homologous DNA fragments of myostatin and microsatellite genes. Based on known characteristics of myostatin gene function, growth pattern changes in resultant carp mutant varieties was expected. DNA fragments were introduced into metaphase-II oocytes, resulting in one to several dozen insertions of homologous fragments into the host genome by sperm-mediated transgenesis. Introduction of rearranged homologous DNA fragments often resulted in phenotypic changes in C. carpiovar var. Jian, including significant phenotypic changes linked to growth rate at 4 months.

  8. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  9. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  10. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  11. Colloidal centrifugation of stallion semen results in a reduced rate of sperm DNA fragmentation.

    Science.gov (United States)

    Crespo, F; Gosalvez, J; Gutiérrez-Cepeda, L; Serres, C; Johnston, S D

    2013-04-01

    Stallion spermatozoa recovered and examined immediately after colloidal centrifugation resulted in a higher straight-line velocity (VSL) than sperm processed using direct conventional centrifugation (p = 0.000), but there was no differences in the progressive motility or sperm DNA fragmentation (SDF) as determined by the sperm chromatin dispersion assay. However, when centrifuged spermatozoa were incubated at 37 °C for 24 h to determine the rate of SDF (r-SDF), a lower r-SDF (p = 0.0011) was observed in those sperm recovered after colloidal separation (0.5 ± 0.1%/h) compared to direct (1.2 ± 0.4%/h) or no centrifugation (r-SDF = 1.2 ± 0.3%/h). These results confirm that colloidal separation of stallion spermatozoa results in prolonged sperm DNA longevity, but these differences were only apparent following a period of incubation and dynamic assessment. Consequently, we strongly recommend the use of the dynamic form of the SDF assay for evaluating centrifugation and/or other ex vivo procedures, as a single basal assessment of SDF may inadvertently result in a false-positive evaluation of DNA quality. © 2012 Blackwell Verlag GmbH.

  12. Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

    Science.gov (United States)

    Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

    2014-01-01

    Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

  13. Fluorescent SSCP of overlapping fragments (FSSCP-OF): a highly sensitive method for the screening of mitochondrial DNA variation

    DEFF Research Database (Denmark)

    Salas, A; Rasmussen, Erik Michael; Lareu, M V

    2001-01-01

    The mtDNA analysis (mtDNA) is increasingly being demanded for forensic purposes due to the fact that many times the use of standard nuclear marker fails to analyze degraded samples (such as bones) and specially for the analysis of hair shafts (a common sample in the crime scene). However, analysis...... conformation polymorphism (SSCP) of overlapping fragments (FSSCP-OF). FSSCP-OF is based on the basic theory of SSCP analysis and combines two complementary strategies: the use of PCR amplified overlapping fragments and fluorescent detection technology. The overlap region contains a high percentage (50...... fragments. The use of multicolor fluorescent technology allows also the multiplex amplification of overlapping fragment and its subsequent analysis in an automatic sequencer. We have analyzed 50 samples of unrelated individuals through the FSSCP-OF technique and we have found that using this methodology...

  14. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  15. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  17. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  18. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  19. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  20. The Society for Translational Medicine: clinical practice guidelines for sperm DNA fragmentation testing in male infertility

    Science.gov (United States)

    Cho, Chak-Lam; Majzoub, Ahmad; Esteves, Sandro C.

    2017-01-01

    Sperm DNA fragmentation (SDF) testing has been emerging as a valuable tool for male fertility evaluation. While the essential role of sperm DNA integrity in human reproduction was extensively studied, the clinical indication of SDF testing is less clear. This clinical practice guideline provides recommendations of clinical utility of the test supported by evidence. It is intended to serve as a reference for fertility specialists in identifying the circumstances in which SDF testing should be of greatest clinical value. SDF testing is recommended in patients with clinical varicocele and borderline to normal semen parameters as it can better select varicocelectomy candidates. Outcomes of natural pregnancy and assisted reproductive techniques (ART) can be predicted by result of SDF tests. High SDF is also linked with recurrent pregnancy loss (RPL) and failure of ART. Result of SDF testing may change the management decision by selecting the most appropriate ART with the highest success rate for infertile couples. Several studies have demonstrated the benefit in using testicular instead of ejaculated sperm in men with high SDF, oligozoospermia or recurrent in vitro fertilization (IVF) failure. Infertile men with modifiable lifestyle factor may benefit from SDF testing by reinforcing risk factor modification and monitoring patient’s progress to intervention. PMID:29082206

  1. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  3. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  4. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  5. Rapid assembly of multiple DNA fragments through direct transformation of PCR products into E. coli and Lactobacillus.

    Science.gov (United States)

    Cao, Pinghua; Wang, Lei; Zhou, Guangxian; Wang, Yaoyue; Chen, Yulin

    2014-11-01

    This article describes a rapid, highly efficient and versatile method for seamlessly assembling multiple DNA fragments into a vector at any desired position. The inserted fragments and vector backbone were amplified by high-fidelity PCR containing 20 bp to 50 bp overlapping regions at 3' and/or 5' termini. These linearised fragments were equimolarly mixed, and then cyclised in a prolonged overlap extension PCR without adding primers. The resulting PCR products were DNA multimers that could be directly transformed into host strains, yielding the desired chimeric plasmid. The proposed method was illustrated by constructing an Escherichia coli co-expression vector. The feasibility of the method in Lactobacillus was further validated by assembling an E. coli-Lactobacillus shuttle vector. Results showed that three to four fragments could be simultaneously and precisely inserted in a vector in only 2-3 days using the proposed method. The acceptable transformation efficiency was determined through the tested host strains; more than 95% of the colonies were positive transformants. Therefore, the proposed method is sufficiently competent for high-efficiency insertion of multiple DNA fragments into a plasmid and has theoretically good application potential for gene cloning and protein expression because it is simple, easy to implement, flexible and yields highly positive clones. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Anchor Modeling

    Science.gov (United States)

    Regardt, Olle; Rönnbäck, Lars; Bergholtz, Maria; Johannesson, Paul; Wohed, Petia

    Maintaining and evolving data warehouses is a complex, error prone, and time consuming activity. The main reason for this state of affairs is that the environment of a data warehouse is in constant change, while the warehouse itself needs to provide a stable and consistent interface to information spanning extended periods of time. In this paper, we propose a modeling technique for data warehousing, called anchor modeling, that offers non-destructive extensibility mechanisms, thereby enabling robust and flexible management of changes in source systems. A key benefit of anchor modeling is that changes in a data warehouse environment only require extensions, not modifications, to the data warehouse. This ensures that existing data warehouse applications will remain unaffected by the evolution of the data warehouse, i.e. existing views and functions will not have to be modified as a result of changes in the warehouse model.

  7. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Autophagic degradation of dBruce controls DNA fragmentation in nurse cells during late Drosophila melanogaster oogenesis

    Science.gov (United States)

    Shravage, Bhupendra V.; Sagona, Antonia P.; Lamark, Trond; Bjørkøy, Geir; Johansen, Terje; Rusten, Tor Erik; Brech, Andreas; Baehrecke, Eric H.

    2010-01-01

    Autophagy is an evolutionarily conserved pathway responsible for degradation of cytoplasmic material via the lysosome. Although autophagy has been reported to contribute to cell death, the underlying mechanisms remain largely unknown. In this study, we show that autophagy controls DNA fragmentation during late oogenesis in Drosophila melanogaster. Inhibition of autophagy by genetically removing the function of the autophagy genes atg1, atg13, and vps34 resulted in late stage egg chambers that contained persisting nurse cell nuclei without fragmented DNA and attenuation of caspase-3 cleavage. The Drosophila inhibitor of apoptosis (IAP) dBruce was found to colocalize with the autophagic marker GFP-Atg8a and accumulated in autophagy mutants. Nurse cells lacking Atg1 or Vps34 in addition to dBruce contained persisting nurse cell nuclei with fragmented DNA. This indicates that autophagic degradation of dBruce controls DNA fragmentation in nurse cells. Our results reveal autophagic degradation of an IAP as a novel mechanism of triggering cell death and thereby provide a mechanistic link between autophagy and cell death. PMID:20713604

  9. Optimized quantification of fragmented, free circulating DNA in human blood plasma using a calibrated duplex real-time PCR.

    Directory of Open Access Journals (Sweden)

    Martin Horlitz

    Full Text Available BACKGROUND: Duplex real-time PCR assays have been widely used to determine amounts and concentrations of free circulating DNA in human blood plasma samples. Circulatory plasma DNA is highly fragmented and hence a PCR-based determination of DNA concentration may be affected by the limited availability of full-length targets in the DNA sample. This leads to inaccuracies when counting PCR target copy numbers as whole genome equivalents. METHODOLOGY/PRINCIPAL FINDINGS: A model system was designed allowing for assessment of bias in a duplex real-time PCR research assay. We collected blood plasma samples from male donors in pools of 6 to 8 individuals. Circulatory plasma DNA was extracted and separated by agarose gel electrophoresis. Separated DNA was recovered from the gel in discrete size fractions and analyzed with different duplex real-time PCR Taqman assays detecting a Y chromosome-specific target and an autosomal target. The real-time PCR research assays used differed significantly in their ability to determine the correct copy number ratio of 0.5 between Y chromosome and autosome targets in DNA of male origin. Longer PCR targets did not amplify quantitatively in circulatory DNA, due to limited presence of full-length target sequence in the sample. CONCLUSIONS: PCR targets of the same small size are preferred over longer targets when comparing fractional circulatory DNA concentrations by real-time PCR. As an example, a DYS14/18S duplex real-time PCR research assay is presented that correctly measures the fractional concentration of male DNA in a male/female mixture of circulatory, fragmented DNA.

  10. Mitochondrial DNA diversity and population structure of a forest-dependent rodent, Praomys taitae (Rodentia: Muridae) Heller 1911, in the fragmented forest patches of Taita Hills, Kenya

    DEFF Research Database (Denmark)

    Nyakaana, S.; Tumusiime, C.; Oguge, N.

    2008-01-01

    The population genetic structure of the forest-dependent rodent, Praomys taitae, sampled from nine indigenous forest fragments sampled from nine indigenous forest fragments distributed over three ranges of the Taita Hills in Kenya, was determined using mitochondrial DNA (mtDNA) control region seq...

  11. RADOM, an efficient in vivo method for assembling designed DNA fragments up to 10 kb long in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lin, Qiuhui; Jia, Bin; Mitchell, Leslie A; Luo, Jingchuan; Yang, Kun; Zeller, Karen I; Zhang, Wenqian; Xu, Zhuwei; Stracquadanio, Giovanni; Bader, Joel S; Boeke, Jef D; Yuan, Ying-Jin

    2015-03-20

    We describe rapid assembly of DNA overlapping multifragments (RADOM), an improved assembly method via homologous recombination in Saccharomyces cerevisiae, which combines assembly in yeasto with blue/white screening in Escherichia coli. We show that RADOM can successfully assemble ∼3 and ∼10 kb DNA fragments that are highly similar to the yeast genome rapidly and accurately. This method was tested in the Build-A-Genome course by undergraduate students, where 125 ∼3 kb "minichunks" from the synthetic yeast genome project Sc2.0 were assembled. Here, 122 out of 125 minichunks achieved insertions with correct sizes, and 102 minichunks were sequenced verified. As this method reduces the time-consuming and labor-intensive efforts of yeast assembly by improving the screening efficiency for correct assemblies, it may find routine applications in the construction of DNA fragments, especially in hierarchical assembly projects.

  12. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  13. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  14. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  15. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  16. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  17. Rice pseudomolecule-anchored cross-species DNA sequence alignments indicate regional genomic variation in expressed sequence conservation

    Directory of Open Access Journals (Sweden)

    Thomas Howard

    2007-08-01

    Full Text Available Abstract Background Various methods have been developed to explore inter-genomic relationships among plant species. Here, we present a sequence similarity analysis based upon comparison of transcript-assembly and methylation-filtered databases from five plant species and physically anchored rice coding sequences. Results A comparison of the frequency of sequence alignments, determined by MegaBLAST, between rice coding sequences in TIGR pseudomolecules and annotations vs 4.0 and comprehensive transcript-assembly and methylation-filtered databases from Lolium perenne (ryegrass, Zea mays (maize, Hordeum vulgare (barley, Glycine max (soybean and Arabidopsis thaliana (thale cress was undertaken. Each rice pseudomolecule was divided into 10 segments, each containing 10% of the functionally annotated, expressed genes. This indicated a correlation between relative segment position in the rice genome and numbers of alignments with all the queried monocot and dicot plant databases. Colour-coded moving windows of 100 functionally annotated, expressed genes along each pseudomolecule were used to generate 'heat-maps'. These revealed consistent intra- and inter-pseudomolecule variation in the relative concentrations of significant alignments with the tested plant databases. Analysis of the annotations and derived putative expression patterns of rice genes from 'hot-spots' and 'cold-spots' within the heat maps indicated possible functional differences. A similar comparison relating to ancestral duplications of the rice genome indicated that duplications were often associated with 'hot-spots'. Conclusion Physical positions of expressed genes in the rice genome are correlated with the degree of conservation of similar sequences in the transcriptomes of other plant species. This relative conservation is associated with the distribution of different sized gene families and segmentally duplicated loci and may have functional and evolutionary implications.

  18. Genotyping the hepatitis B virus with a fragment of the HBV DNA polymerase gene in Shenyang, China

    Directory of Open Access Journals (Sweden)

    Juan Feng

    2011-06-01

    Full Text Available Abstract The hepatitis B virus (HBV has been classified into eight genotypes (A-H based on intergenotypic divergence of at least 8% in the complete nucleotide sequence or more than 4% in the S gene. To facilitate the investigation of the relationship between the efficacy of drug treatment and the mutation with specific genotype of HBV, we have established a new genotyping strategy based on a fragment of the HBV DNA polymerase gene. Pairwise sequence and phylogenetic analyses were performed using CLUSTAL V (DNASTAR on the eight (A-H standard full-length nucleotide sequences of HBV DNA from GenBank (NCBI and the corresponding semi-nested PCR products from the HBV DNA polymerase gene. The differences in the semi-nested PCR fragments of the polymerase genes among genotypes A through F were greater than 4%, which is consistent with the intergenotypic divergence of at least 4% in HBV DNA S gene sequences. Genotyping using the semi-nested PCR products of the DNA polymerase genes revealed that only genotypes B, C, and D were present in the 50 cases, from Shenyang, China, with a distribution of 11 cases (22%, 25 cases (50%, and 14 cases (28% respectively. These results demonstrate that our new genotyping method utilizing a fragment of the HBV DNA polymerase gene is valid and can be employed as a general genotyping strategy in areas with prevalent HBV genotypes A through F. In Shenyang, China, genotypes C, B, and D were identified with this new genotyping method, and genotype C was demonstrated to be the dominant genotype.

  19. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  20. ABNORMAL CHROMATIN CONDENSATION IN SPERMATOZOA AND DNA FRAGMENTATION IN SPERMATOZOA: IS THERE A CORRELATION?

    Directory of Open Access Journals (Sweden)

    E. E. Bragina

    2017-01-01

    Full Text Available Introduction. In the last decade, an understanding of the two-fold nature of genetic apparatus damage in spermatozoa has emerged: abnormal chromatin condensation (“immature” chromatin, ICH related to defective protaminization and leading to altered epigenetic regulation of the early embryogenesis, and disruption of DNA integrity, i. e. DNA fragmentation (DFS.Objective. Study of the correlation between abnormal chromatin condensation in spermatozoa and DFS.Materials and methods. The study included spermatozoa of 54 fertile males (1st group, control, 46 patients with primary infertility (2nd group, and 111 patients whose wives had a history of pregnancy abnormalities or failures of the assisted reproductive technology (ART, i. e. arrested embryonic development (3rd group. Presence of ICH was identified by quantitative electron microscopy, presence of DFS by TUNEL. Study of ICH and DFS in the same spermatozoon was conducted using correlation microscopy (TUNEL with subsequent ultrastructural analysis of the labeled cells.Results. The number of ICH spermatozoa significantly differed in the 3rd group from the control group (29.26 ± 13.49 vs. 22.43 ± 9.54; p = 0.006. The number of ICH spermatozoa in the 2nd group was higher than in the control group, but the difference wasn’t statistically significant (p = 0.061. A significant difference in the number of spermatozoa with residual cytoplasm on the head was observed between the fertile group and 2nd and 3rd groups (p = 0.0001 and p = 0.0006, respectively and on the neck (p = 0.0002 and p = 0.0003, respectively. Number of DFS spermatozoa in the second group significantly differed from the control (21.40 ± 11.88 vs. 13.70 ± 7.00, p = 0.03, but this difference wasn’t observed for the 3rd group. A very weak correlation between the number of DFS and ICH spermatozoa was observed in all three groups (r = 0.18, r = 0.33, and r = 0.01, respectively. Forty-six (46 spermatozoa were studied using

  1. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  2. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  3. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  4. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  5. Effects of chronic buproprion and nicotine administration on cell genesis and DNA fragmentation in adult rat dentate gyrus

    OpenAIRE

    Scerri, Charles;

    2006-01-01

    Previous experiments have shown that chronic subcutaneous administration of nicotine dose-dependently inhibits the acquisition and retention of a spatial task in the Morris water maze and reduces cell genesis in the dentate gyrus (DG) of adult rats.1 In the present study, the effects of nicotine and buproprion, an atypical antidepressant used in smoking cessation, on dentate gyrus cell genesis and DNA fragmentation were investigated. The results show that nicotine, chronically infused for 21 ...

  6. Use of laptop computers connected to internet through Wi-Fi decreases human sperm motility and increases sperm DNA fragmentation.

    Science.gov (United States)

    Avendaño, Conrado; Mata, Ariela; Sanchez Sarmiento, César A; Doncel, Gustavo F

    2012-01-01

    To evaluate the effects of laptop computers connected to local area networks wirelessly (Wi-Fi) on human spermatozoa. Prospective in vitro study. Center for reproductive medicine. Semen samples from 29 healthy donors. Motile sperm were selected by swim up. Each sperm suspension was divided into two aliquots. One sperm aliquot (experimental) from each patient was exposed to an internet-connected laptop by Wi-Fi for 4 hours, whereas the second aliquot (unexposed) was used as control, incubated under identical conditions without being exposed to the laptop. Evaluation of sperm motility, viability, and DNA fragmentation. Donor sperm samples, mostly normozoospermic, exposed ex vivo during 4 hours to a wireless internet-connected laptop showed a significant decrease in progressive sperm motility and an increase in sperm DNA fragmentation. Levels of dead sperm showed no significant differences between the two groups. To our knowledge, this is the first study to evaluate the direct impact of laptop use on human spermatozoa. Ex vivo exposure of human spermatozoa to a wireless internet-connected laptop decreased motility and induced DNA fragmentation by a nonthermal effect. We speculate that keeping a laptop connected wirelessly to the internet on the lap near the testes may result in decreased male fertility. Further in vitro and in vivo studies are needed to prove this contention. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  7. In Vitro Effect of Cell Phone Radiation on Motility, DNA Fragmentation and Clusterin Gene Expression in Human Sperm

    Directory of Open Access Journals (Sweden)

    Adel Zalata

    2015-04-01

    Full Text Available Background: Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU gene expression. Materials and Methods: In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26, ii. asthenozoospermia (A, n=32, iii. asthenoteratozoospermia (AT, n=31 and iv. oligoasthenoteratozoospermia (OAT, n=35. The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where pAT>A>N groups, respectively (p<0.05. Conclusion: Cell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  8. In vitro effect of cell phone radiation on motility, DNA fragmentation and clusterin gene expression in human sperm.

    Science.gov (United States)

    Zalata, Adel; El-Samanoudy, Ayman Z; Shaalan, Dalia; El-Baiomy, Youssef; Mostafa, Taymour

    2015-01-01

    Use of cellular phones emitting radiofrequency electromagnetic field (RF-EMF) has been increased exponentially and become a part of everyday life. This study aimed to investigate the effects of in vitro RF-EMF exposure emitted from cellular phones on sperm motility index, sperm DNA fragmentation and seminal clusterin (CLU) gene expression. In this prospective study, a total of 124 semen samples were grouped into the following main categories: i. normozoospermia (N, n=26), ii. asthenozoospermia (A, n=32), iii. asthenoteratozoospermia (AT, n=31) and iv. oligoasthenoteratozoospermia (OAT, n=35). The same semen samples were then divided into two portions non-exposed and exposed samples to cell phone radiation for 1 hour. Before and immediately after exposure, both aliquots were subjected to different assessments for sperm motility, acrosin activity, sperm DNA fragmentation and CLU gene expression. Statistical differences were analyzed using paired t student test for comparisons between two sub-groups where pAT>A>N groups, respectively (pCell phone emissions have a negative impact on exposed sperm motility index, sperm acrosin activity, sperm DNA fragmentation and seminal CLU gene expression, especially in OAT cases.

  9. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  10. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Influence of thickness of alkyl-silane coupling agent coating on separation of small DNA fragments in capillary gel electrophoresis

    Science.gov (United States)

    Nakazumi, T.; Hara, Y.

    2017-09-01

    To simplify the process of coating capillaries with fused silica, we herein set out to develop a one-step procedure for coating capillaries to prevent electro-osmotic flow (EOF) during the separation of small DNA fragments. We selected a short capillary (total length = 15 cm; effective length = 7.5 cm) for use in a compact capillary gel electrophoresis (CGE) system. To develop a one-step coating procedure, we employed alkyltrimethoxysilane agents because they are cheap and can be easily acquired, in contrast to polyethylene glycol (PEG) silane coupling agents. We examined a 100-bp DNA Ladder sample using fused silica capillaries, which were coated with alkyltrimethoxysilane agents of five different molecular lengths (C4, C6, C8, C12, and C16). We found that a fused-silica capillary with C8 alkyltrimethoxysilane is optimal for separating small DNA samples.

  12. Phosphorylation regulates proteasomal-mediated degradation and solubility of TAR DNA binding protein-43 C-terminal fragments

    Directory of Open Access Journals (Sweden)

    Zhang Yong-Jie

    2010-08-01

    Full Text Available Abstract Background Inclusions of TAR DNA binding protein-43 (TDP-43 are the defining histopathological feature of several neurodegenerative diseases collectively referred to as TDP-43 proteinopathies. These diseases are characterized by the presence of cellular aggregates composed of abnormally phosphorylated, N-terminally truncated and ubiquitinated TDP-43 in the spinal cord and/or brain. Recent studies indicate that C-terminal fragments of TDP-43 are aggregation-prone and induce cytotoxicity. However, little is known regarding the pathways responsible for the degradation of these fragments and how their phosphorylation contributes to the pathogenesis of disease. Results Herein, we established a human neuroblastoma cell line (M17D3 that conditionally expresses an enhanced green fluorescent protein (GFP-tagged caspase-cleaved C-terminal TDP-43 fragment (GFP-TDP220-414. We report that expression of this fragment within cells leads to a time-dependent formation of inclusions that are immunoreactive for both ubiquitin and phosphorylated TDP-43, thus recapitulating pathological hallmarks of TDP-43 proteinopathies. Phosphorylation of GFP-TDP220-414 renders it resistant to degradation and enhances its accumulation into insoluble aggregates. Nonetheless, GFP-TDP220-414 inclusions are reversible and can be cleared through the ubiquitin proteasome system. Moreover, both Hsp70 and Hsp90 bind to GFP-TDP220-414 and regulate its degradation. Conclusions Our data indicates that inclusions formed from TDP-43 C-terminal fragments are reversible. Given that TDP-43 inclusions have been shown to confer toxicity, our findings have important therapeutic implications and suggest that modulating the phosphorylation state of TDP-43 C-terminal fragments may be a promising therapeutic strategy to clear TDP-43 inclusions.

  13. Assessment of sperm DNA fragmentation in stallion (Equus caballus) and donkey (Equus asinus) using the sperm chromatin dispersion test.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Crespo, F; Serres-Dalmau, C; Gutiérrez de las Rozas, A L; Dávila-Rodríguez, M I; López-Fernández, C; Gósalvez, J

    2009-10-01

    Sperm DNA fragmentation (sDF) is an important parameter to assessing sperm quality. Information about sperm quality is not available for donkeys, especially in some breeds at risk of extinction. The objectives of this research were to test the four commercial variants of sperm chromatin dispersion test (SCD; sperm Halomax test), originally developed to assess sDF in boars, bulls, rams and stallions, in order to scrutinize their applicability in the study of sDF in a donkey breed at risk of extinction (Zamorano-Leonesa), for which there is no specific test available to analyze sperm at present. Only the SCD test, originally developed for stallions, produced stable and consistent results, and was deemed suitable to assess DNA fragmentation in sperm samples from donkeys. Image analysis was used to compare differences between the SCD methodology applied to stallion and donkey semen samples processed under the same experimental conditions. The extent of SCD in the SCD test was approximately 20% lower in donkey sperm than in stallion sperm. Yet, the ratio of chromatin sperm dispersion achieved in fragmented and unfragmented nuclei did not differ significantly between species. These data suggest that a similar protein depletion treatment can cause differences in protein removal in equivalent cells from different species and that sperm chromatin may be organized differently in stallions and donkeys.

  14. [Large-scale fragmentation of dna and the death of tumor cells by the action of the binary system ascorbic acid-metallocomplexes of cobalt in vitro].

    Science.gov (United States)

    Medvedev, A I; Leshchenko, V V

    2012-01-01

    High-molecular-weight DNA fragments are the markers of the early stage of apoptosis induced in eukaryotic cells by cytotoxins of different nature. The dynamics of the development of large-scale DNA fragmentation in K-562 leukemia cells by the action of the antitumor drug, the binary system ascorbic acid--cobalt phthalocyanine within 48 h of incubation, which correspond to two periods of the doubling of cell number in growing control cultures, have been studied. It was shown that, within the first hours of incubation, hydrogen peroxide generated by the system induces the formation of DNA fragments from 2200 to 50 kbp long. Later on the cell death accompanied by a decrease in the content of fragmented DNA is observed. Within 24 h of incubation, part of fragmented DNA remains unrepaired; after 48 h of incubation, a delay or a slowed down proliferation of K-562 cells, which differ from control cells also by a high level of death and a higher content of high-molecular-weight DNA fragments, is observed.

  15. Solid Lipid Curcumin Particles Induce More DNA Fragmentation and Cell Death in Cultured Human Glioblastoma Cells than Does Natural Curcumin

    Directory of Open Access Journals (Sweden)

    Panchanan Maiti

    2017-01-01

    Full Text Available Despite recent advancements in cancer therapies, glioblastoma multiforme (GBM remains largely incurable. Curcumin (Cur, a natural polyphenol, has potent anticancer effects against several malignancies, including metastatic brain tumors. However, its limited bioavailability reduces its efficiency for treating GBM. Recently, we have shown that solid lipid Cur particles (SLCPs have greater bioavailability and brain tissue penetration. The present study compares the efficiency of cell death by Cur and/or SLCPs in cultured GBM cells derived from human (U-87MG and mouse (GL261 tissues. Several cell viability and cell death assays and marker proteins (MTT assay, annexin-V staining, TUNEL staining, comet assay, DNA gel electrophoresis, and Western blot were investigated following the treatment of Cur and/or SLCP (25 μM for 24–72 h. Relative to Cur, the use of SLCP increased cell death and DNA fragmentation, produced longer DNA tails, and induced more fragmented nuclear lobes. In addition, cultured GBM cells had increased levels of caspase-3, Bax, and p53, with decreases in Bcl2, c-Myc, and both total Akt, as well as phosphorylated Akt, when SLCP, rather Cur, was used. Our in vitro work suggests that the use of SLCP may be a promising strategy for reversing or preventing GBM growth, as compared to using Cur.

  16. DNA fragmentation in frozen sperm of Equus asinus: Zamorano-Leonés, a breed at risk of extinction.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Crespo, F; Gosálvez, A; Dávila-Rodríguez, M I; López-Fernández, C; Gósalvez, J

    2008-05-01

    The dynamics of sperm DNA fragmentation (sDF) and sperm viability were analyzed in frozen-thawed sperm samples of Equus asinus (Zamorano-Leonés), a breed at risk of extinction. Sperm DNA fragmentation was assessed using an adaptation of the sperm chromatin dispersion test developed for stallions in five different frozen samples. Sperm were thawed and incubated at different temperatures (37 degrees C, 25 degrees C, and 4 degrees C) and sDF was assessed at different times and compared. The mean sDF after thawing at the beginning of the experiment was 18.20+/-14.77% and did not differ significantly from the results of a neutral comet assay (22.0+/-19.34%). The tendency in the sDF of all donkeys indicated that sperm DNA is more sensitive to breakage when incubated at 37 degrees C than when incubated at 25 degrees C or 4 degrees C. Interestingly, the tendency was not the same when different animals were compared, and differences in sDF dynamics were established among individuals. sDF correlated negatively with sperm viability in some individuals but not in others. From a conservation perspective, sDF analysis may offer a new way to assess sperm quality in endangered breeds in order to identify and select the best semen samples for artificial reproduction purposes. In particular, we recommend for artificial insemination the use of semen samples with a slow increase in sDF with time after thawing.

  17. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval. PMID:28440264

  18. Effect of Incubation Time and Vitamin E Supplementation on Sperm Motility, Viability and DNA Fragmentation in Asthenoteratozoospermic Samples

    Directory of Open Access Journals (Sweden)

    Ali Asghar Ghafarizadeh

    2017-09-01

    Full Text Available Abstract Background: In Asthenoteratozoospermic‎ men, low motility, defected DNA and highly oxidative stress in ‎sperm ‎‎cause ‎poor‎ assisted reproductive techniques (ART outcomes. The aim of this study was to determine the effect of Vitamin E (Vit E, as a potent antioxidant, on sperm motility, viability and DNA integrity at different times of in vitro incubation (after 2, 4 and 6-h to improve asthenoteratozoospermic semen samples for ART. Materials and Methods: Asthenoteratozoospermic semen samples of 50 volunteers were collected and examined. Each sample was divided into two groups of control and vitamin E (2mM and kept in the 37 °C and 6 % CO2 for 2, 4 and 6 hours. After this incubation, sperm motility, viability and sperm DNA fragmentation (SCD were evaluated in each group. Data were analyzed using repeated measurement of ANOVA and T-test. The means were considered significantly different at p<0.05. Results:Significant decrease in total and progressive motility and viability as well as significant increase in sperm DNA damage (after 6h of incubation were found in control group vs. the control group before incubation (p<0.05. The sperm motility and viability was significantly higher in vitamin E group compared to untreated control group (p<0.05. Our results also showed that DNA fragmentation significantly was lower after 6h of vitamin E treatment (p<0.05. Conclusion: In vitro supplementation of vitamin E in asthenoteratozoospermia semen samples may protect spermatozoa from maltreatment effect of ROS during sperm sampling via keeping enzymatic and antioxidant process in optimum condition.

  19. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  20. Monolayer Assemblies of a De Novo Designed 4-alpha-Helix Bundle Carboprotein and Its Sulfur Anchor Fragment on Au(111) Surfaces Addressed by Voltammetry and In Situ Scanning Tunneling Microscopy

    DEFF Research Database (Denmark)

    Brask, Jesper; Wackerbarth, Hainer; Jensen, Knud J.

    2003-01-01

    carboprotein without thiol anchor have been prepared and investigated for comparison. Cyclic and differential pulse voltammetry (DPV) of the proteins show desorption peaks around -750 mV (SCE), whereas the thiol anchor desorption peak is at -685 mV. The peaks are by far the highest for thiol monomeric 4-R...

  1. Direct Visualization of RNA-DNA Primer Removal from Okazaki Fragments Provides Support for Flap Cleavage and Exonucleolytic Pathways in Eukaryotic Cells.

    Science.gov (United States)

    Liu, Bochao; Hu, Jiazhi; Wang, Jingna; Kong, Daochun

    2017-03-24

    During DNA replication in eukaryotic cells, short single-stranded DNA segments known as Okazaki fragments are first synthesized on the lagging strand. The Okazaki fragments originate from ∼35-nucleotide-long RNA-DNA primers. After Okazaki fragment synthesis, these primers must be removed to allow fragment joining into a continuous lagging strand. To date, the models of enzymatic machinery that removes the RNA-DNA primers have come almost exclusively from biochemical reconstitution studies and some genetic interaction assays, and there is little direct evidence to confirm these models. One obstacle to elucidating Okazaki fragment processing has been the lack of methods that can directly examine primer removal in vivo In this study, we developed an electron microscopy assay that can visualize nucleotide flap structures on DNA replication forks in fission yeast ( Schizosaccharomyces pombe ). With this assay, we first demonstrated the generation of flap structures during Okazaki fragment processing in vivo The mean and median lengths of the flaps in wild-type cells were ∼51 and ∼41 nucleotides, respectively. We also used yeast mutants to investigate the impact of deleting key DNA replication nucleases on these flap structures. Our results provided direct in vivo evidence for a previously proposed flap cleavage pathway and the critical function of Dna2 and Fen1 in cleaving these flaps. In addition, we found evidence for another previously proposed exonucleolytic pathway involving RNA-DNA primer digestion by exonucleases RNase H2 and Exo1. Taken together, our observations suggest a dual mechanism for Okazaki fragment maturation in lagging strand synthesis and establish a new strategy for interrogation of this fascinating process. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  3. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  4. Restarting and recentering genetic algorithm variations for DNA fragment assembly: The necessity of a multi-strategy approach.

    Science.gov (United States)

    Hughes, James Alexander; Houghten, Sheridan; Ashlock, Daniel

    2016-12-01

    DNA Fragment assembly - an NP-Hard problem - is one of the major steps in of DNA sequencing. Multiple strategies have been used for this problem, including greedy graph-based algorithms, deBruijn graphs, and the overlap-layout-consensus approach. This study focuses on the overlap-layout-consensus approach. Heuristics and computational intelligence methods are combined to exploit their respective benefits. These algorithm combinations were able to produce high quality results surpassing the best results obtained by a number of competitive algorithms specially designed and tuned for this problem on thirteen of sixteen popular benchmarks. This work also reinforces the necessity of using multiple search strategies as it is clearly observed that algorithm performance is dependent on problem instance; without a deeper look into many searches, top solutions could be missed entirely. Copyright © 2016. Published by Elsevier Ireland Ltd.

  5. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    Forensic Science Research and Training Center (FSRTC), Quantico, and at the Institut für Rechtsmedizin, Münster, Germany. Concordant HUMTH01 types were found in 39 out of 40 individuals. The allele which led to discrepant typing results was assigned type 9.3 in two laboratories and type 10 in one......DNA from the short tandem repeat (STR) system HUMTH01 was amplified by the polymerase chain reaction (PCR) and analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 100 unrelated Danes, 147 unrelated Greenland Eskimos, and 89 Danish mother....../child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  6. [Subcloning and sequencing of promoter active DNA fragment from Streptomyces lividans].

    Science.gov (United States)

    Jiang, H; Dong, K; Huan, L

    1994-12-01

    Random subfragments with strong promoter activities were isolated from 2. 1 kb fragment of pMG50-25 using a promoter-probe vector pIJ4083. One of the promoter-active region was narrowed down to a 220bp sequence. Putative promoter regions, SD sequence and start codons were found.

  7. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  8. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  9. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  10. Fragmentation and plasmid strand breaks in pure and gold-doped DNA irradiated by beams of fast hydrogen atoms

    Energy Technology Data Exchange (ETDEWEB)

    Wyer, J A; Latimer, C J; Shah, M B; Currell, F J [Centre for Plasma Physics, IRCEP, Queen' s University Belfast, BT7 1NN (United Kingdom); Butterworth, K T; Hirst, D G [Experimental Therapeutics Research Group, School of Pharmacy, Queen' s University Belfast, BT9 7BL (United Kingdom); Montenegro, E C [Instituto de Fisica, Universidade Federal do Rio de Janeiro, Cx. Postal 68528, Rio de Janeiro, RJ 21941-972 (Brazil)], E-mail: jeanwyer@phys.au.dk

    2009-08-07

    The results of an investigation into the damage caused to dry plasmid DNA after irradiation by fast (keV) hydrogen atoms are presented. Agarose gel electrophoresis was used to assess single and double strand break yields as a function of dose in dry DNA samples deposited on a mica substrate. Damage levels were observed to increase with beam energy. Strand break yields demonstrated a considerable dependence on sample structure and the method of sample preparation. Additionally, the effect of high-Z nanoparticles on damage levels was investigated by irradiating DNA samples containing controlled amounts of gold nanoparticles. In contrast to previous (photonic) studies, no enhancement of strand break yields was observed with the particles showing a slight radioprotective effect. A model of DNA damage as a function of dose has been constructed in terms of the probability for the creation of single and double strand breaks, per unit ion flux. This model provides quantitative conclusions about the effects of both gold nanoparticles and the different buffers used in performing the assays and, in addition, infers the proportion of multiply damaged fragments.

  11. The Effects of Melatonin on Oxidative Stress Parameters and DNA Fragmentation in Testicular Tissue of Rats Exposed to Microwave Radiation.

    Science.gov (United States)

    Sokolovic, Dusan; Djordjevic, Branka; Kocic, Gordana; Stoimenov, Tatjana J; Stanojkovic, Zoran; Sokolovic, Danka M; Veljkovic, Andrej; Ristic, Goran; Despotovic, Milena; Milisavljevic, Dusan; Jankovic, Radmilo; Binic, Ivana

    2015-01-01

    Microwaves from mobile phones are one of the environmental toxicants that are capable of compromising male fertility by inducing oxidative stress and apoptosis in the testes. Melatonin is a lipophilic tryptophan indole amine and a potent antioxidant. The aim of the study was to evaluate the effect of melatonin treatment on oxidative stress parameters and DNA fragmentation in the testicular tissue of rats exposed to microwave radiation (4 h/day). Adult Wistar rats were divided in 4 groups: I--treated with saline; II--treated with melatonin; III--exposed to microwaves; IV--exposed to microwaves and treated with melatonin. The melatonin (2 mg/kg ip) was administered daily. The animals were sacrificed after 20, 40 and 60 days. Melatonin treatment prevented previously registered increases in malondialdehyde after only 20 days. Furthermore, it reversed the effects of microwave exposure on xanthine oxidase (after 40 days) and acid-DNase activity (after 20 days). However, neither protein carbonyl content nor catalase and alkaline Dnase activity were changed due to melatonin treatment. Melatonin exerts potent antioxidant effects in the testes of rats exposed to microwaves by decreasing the intensity of oxidative stress; it also reduces DNA fragmentation.

  12. Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods.

    Science.gov (United States)

    Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc

    2004-03-01

    Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.

  13. Unusual Structures Are Present in DNA Fragments Containing Super-Long Huntingtin CAG Repeats

    Science.gov (United States)

    Duzdevich, Daniel; Li, Jinliang; Whang, Jhoon; Takahashi, Hirohide; Takeyasu, Kunio; Dryden, David T. F.; Morton, A. Jennifer; Edwardson, J. Michael

    2011-01-01

    Background In the R6/2 mouse model of Huntington's disease (HD), expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene. Methodology/Principal Findings We analysed the structure of polymerase chain reaction (PCR)-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM). As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I. Conclusions/Significance “Super-long” CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD. PMID:21347256

  14. A baculovirus alkaline nuclease knockout construct produces fragmented DNA and aberrant capsids

    International Nuclear Information System (INIS)

    Okano, Kazuhiro; Vanarsdall, Adam L.; Rohrmann, George F.

    2007-01-01

    DNA replication of bacmid-derived constructs of the Autographa californica multiple nucleocapsid nucleopolyhedrovirus (AcMNPV) was analyzed by field inversion gel electrophoresis (FIGE) in combination with digestion at a unique Eco81I restriction enzyme site. Three constructs were characterized: a parental bacmid, a bacmid deleted for the alkaline nuclease gene, and a bacmid from which the gp64 gene had been deleted. The latter was employed as a control for comparison with the alkaline nuclease knockout because neither yields infectious virus and their replication is limited to the initially transfected cells. The major difference between DNA replicated by the different constructs was the presence in the alkaline nuclease knockout of high concentrations of relatively small, subgenome length DNA in preparations not treated with Eco81I. Furthermore, upon Eco81I digestion, the alkaline nuclease knockout bacmid also yielded substantially more subgenome size DNA than the other constructs. Electron microscopic examination of cells transfected with the alkaline nuclease knockout indicated that, in addition to a limited number of normal-appearing electron-dense nucleocapsids, numerous aberrant capsid-like structures were observed indicating a defect in nucleocapsid maturation or in a DNA processing step that is necessary for encapsidation. Because of the documented role of the baculovirus alkaline nuclease and its homologs from other viruses in homologous recombination, these data suggest that DNA recombination may play a major role in the production of baculovirus genomes

  15. Pulsed field gel electrophoresis techniques for separating 1- to 50-kilobase DNA fragments.

    Science.gov (United States)

    Birren, B W; Lai, E; Hood, L; Simon, M I

    1989-03-01

    Conventional agarose gel electrophoresis separates DNA using a static electric field. The maximum size limit for separation of DNA by this method is about 20 kilobase pairs (kb). A number of new electrophoretic techniques which employ periodic reorientation of electric fields permit separation of DNA well beyond this size limit. We sought to determine whether the use of very fast (millisecond) field switching could improve separation of DNA in the size range of 1 to 50 kb. Additionally, we have compared the resolution obtained with each of the different field switching regimens for DNA in this size range. Switching intervals of from 0.2 to 900 ms were used with unidirectional pulsing of a single electric field, with pulsed field gels, and with field inversion gel electrophoresis. Plotting the mobility of DNA as a function of size demonstrates that under the conditions used, each of these techniques offers comparable resolution. We also have examined the separation obtained when field inversion gels are run with forward and reverse fields of equal voltage and different durations, versus using fields of equal duration and different voltages. Field inversion which uses forward and reverse fields of different voltages yields resolution which is superior to the other methods examined.

  16. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  17. Linker-mediated recombinational subcloning of large DNA fragments using yeast.

    Science.gov (United States)

    Raymond, Christopher K; Sims, Elizabeth H; Olson, Maynard V

    2002-01-01

    The homologous recombination pathway in yeast is an ideal tool for the sequence-specific assembly of plasmids. Complementary 80-nucleotide oligonucleotides that overlap a vector and a target fragment were found to serve as efficient recombination linkers for fragment subcloning. Using electroporation, single-stranded 80-mers were adequate for routine plasmid construction. A cycloheximide-based counterselection was introduced to increase the specificity of cloning by homologous recombination relative to nonspecific vector background. Reconstruction experiments suggest this counterselection increased cloning specificity by 100-fold. Cycloheximide counterselection was used in conjunction with 80-bp linkers to subclone targeted regions from bacterial artificial chromosomes. This technology may find broad application in the final stages of completing the Human Genome Sequencing Project and in applications of BAC clones to the functional analysis of complex genomes.

  18. The effect of two pre-cryopreservation single layer colloidal centrifugation protocols in combination with different freezing extenders on the fragmentation dynamics of thawed equine sperm DNA.

    Science.gov (United States)

    Gutiérrez-Cepeda, Luna; Fernández, Alvaro; Crespo, Francisco; Ramírez, Miguel Ángel; Gosálvez, Jaime; Serres, Consuelo

    2012-12-05

    Variability among stallions in terms of semen cryopreservation quality renders it difficult to arrive at a standardized cryopreservation method. Different extenders and processing techniques (such us colloidal centrifugation) are used in order to optimize post-thaw sperm quality. Sperm chromatin integrity analysis is an effective tool for assessing such quality. The aim of the present study was to compare the effect of two single layer colloidal centrifugation protocols (prior to cryopreservation) in combination with three commercial freezing extenders on the post-thaw chromatin integrity of equine sperm samples at different post-thaw incubation (37°C) times (i.e., their DNA fragmentation dynamics). Post-thaw DNA fragmentation levels in semen samples subjected to either of the colloidal centrifugation protocols were significantly lower (pcentrifugation. The use of InraFreeze® extender was associated with significantly less DNA fragmentation than the use of Botu-Crio® extender at 6 h of incubation, and than the use of either Botu-Crio® or Gent® extender at 24 h of incubation (pcentrifugation performed with extended or raw semen prior to cryopreservation reduces DNA fragmentation during the first four hours after thawing. Further studies are needed to determine the influence of freezing extenders on equine sperm DNA fragmentation dynamics.

  19. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases. Conclusions/Significance This study demonstrates that DNA barcoding principles can be applied...... by plant health services and researchers for online phytoplasma identification....

  20. Isolation of rye-specific DNA fragment and genetic diversity analysis ...

    Indian Academy of Sciences (India)

    PCR-based markers are useful and convenient tools for de- tecting alien chromosome segments incorporated into wheat genomes. Some rye-specific PCR-based markers have been successfully developed by random amplified polymorphic. DNA (RAPD) analysis (Iqbal and Rayburn 1995; Katto et al. 2004; Liu et al. 2008 ...

  1. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  2. An investigation of the potential effect of sperm nuclear vacuoles in human spermatozoa on DNA fragmentation using a neutral and alkaline Comet assay.

    Science.gov (United States)

    Pastuszek, E; Kiewisz, J; Skowronska, P; Liss, J; Lukaszuk, M; Bruszczynska, A; Jakiel, G; Lukaszuk, K

    2017-03-01

    Presence of vacuoles and degree of sperm DNA damage are considered to be the basic factors used for the assessment of sperm fertilization capacity. We aimed to investigate the link between these two parameters. According to our knowledge, this is the first study where the Comet assay was used to assess the degree of DNA fragmentation of sperm categorized by Motile Sperm Organelle Morphology Examination (MSOME) Grades. Semen samples from 10 patients were assessed. Spermatozoa were graded into four MSOME groups according to the Vanderzwalmen's criteria. A total of 3930 motile spermatozoa were selected one-by-one using an inverted microscope and transferred onto two different slides. The degree of DNA fragmentation was analyzed by alkaline and neutral Comet assay. Results of the neutral Comet assay showed that Grade I spermatozoa (absence of vacuoles) presented significantly lower dsDNA fragmentation level (mean: 3.13 ± 1.17%) than Grade II (maximum of two small vacuoles; mean: 10.34 ± 2.65%), Grade III (more than two small vacuoles or at least one large vacuole; mean: 23.88 ± 8.37%), and Grade IV (large vacuoles associated with abnormal head shapes or other abnormalities; mean: 36.94 ± 7.78%; p  0.05). Probably, the vacuoles may be responsible for double strand DNA breaks rather than single strand DNA breaks (only 2.39% spermatozoa in MSOME Grade II, 1.76% in III, and 3.16% in IV has single strand breaks). The results demonstrate that lower MSOME grading correlates with lower sperm DNA fragmentation. Therefore, the observation of sperm nuclear vacuoles using real-time optical microscopy without precise DNA fragmentation examination is not sufficient for optimal sperm selection for intracytoplasmic sperm injection. © 2017 American Society of Andrology and European Academy of Andrology.

  3. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  4. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  5. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  6. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    the Eskimo and Danish populations. Significant differences were observed between the distribution of fragments ('alleles') in Greenland Eskimos and in Danes. The allele MBP-A7 was considerably more frequent in Eskimos (0.2214) than in Danes (0.0775) and also the allele MBP-B9 was considerably more frequent......DNA from the double short tandem repeat (STR) system MBP (locus 18q23-pter) was amplified by the polymerase chain reaction (PCR) and the two polymorphic repeat systems were separated by cutting with the restriction enzyme NlaIII. The lengths of the DNA fragments of the two MBP STR systems MBP...

  8. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  9. Historic cycles of fragmentation and expansion in Parnassius smintheus (papilionidae) inferred using mitochondrial DNA.

    Science.gov (United States)

    DeChaine, Eric G; Martini, Andrew P

    2004-01-01

    Climate oscillations of the Quaternary drove the repeated expansion and contraction of ecosystems. Alpine organisms were probably isolated in sky island refugia during warm interglacials, such as now, and expanded their range by migrating down-slope during glacial periods. We used population genetic and phylogenetic approaches to infer how paleoclimatic events influenced the distribution of genetic variation in the predominantly alpine butterfly Parnassius smintheus. We sequenced a 789 bp region of cytochrome oxidase I for 385 individuals from 20 locations throughout the Rocky Mountains, ranging from southern Colorado to northern Montana. Analyses revealed at lease two centers of diversity in the northern and southern Rocky Mountains and strong population structure. Nested clade analysis suggested that the species experienced repeated cycles of population expansion and fragmentation. The estimated ages of these events, assuming a molecular clock, corresponded with paleoclimatic data on habitat expansion and contraction over the past 400,000 years. We propose that alpine butterflies persisted in an archipelago of isolated sky islands during interglacials and that populations expanded and became more connected during cold glacial periods. An archipelago model implies that the effects of genetic drift and selection varied among populations, depending on their latitude, area, and local environment. Alpine organisms are sensitive indicators of climate change and their history can be used to predict how high-elevation ecosystems might respond to further climate warming.

  10. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  11. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  12. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  13. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  14. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  15. Intervention improves assisted conception intracytoplasmic sperm injection outcomes for patients with high levels of sperm DNA fragmentation: a retrospective analysis.

    Science.gov (United States)

    Bradley, C K; McArthur, S J; Gee, A J; Weiss, K A; Schmidt, U; Toogood, L

    2016-09-01

    Sperm DNA fragmentation (SDF) is used in assisted reproductive technology (ART) programs as an indicator for sperm quality, although there is still a lack of consensus as to its clinical utility. In this retrospective study, we examined intracytoplasmic sperm injection (ICSI) outcomes of 1924 infertile patients who underwent SDF analysis using the sperm chromatin integrity test. ART patients were classified as having low [DNA fragmentation index (DFI) <29%] or high SDF (DFI ≥29%) and by whether or not an intervention [physiological intracytoplasmic sperm injection (PICSI), intracytoplasmic morphologically selected sperm injection (IMSI), testicular sperm extraction (TESE)/testicular sperm aspiration (TESA), frequent ejaculation] was performed. High SDF patients who did not have an intervention had a lower fertilization rate and poorer clinical outcomes from blastocyst transfers as compared with low SDF patients; the fertilization rate was 66.0% vs. 70.2% (p = 0.042), single embryo transfer (SET) fetal heart pregnancy rate was 28.5% vs. 45.2% (p = 0.042), and SET live birth rate was 24.9% vs. 40.6% (p = 0.060), respectively. Furthermore, high SDF patients who had an intervention had significantly improved blastocyst transfer outcomes, similar to those of low SDF patients; the SET live birth rate for high SDF intervention patients was 43.8% as compared with 24.9% for high SDF no intervention patients (p = 0.037) and 40.6% for low SDF patients (p = 0.446). Analysis of the three main intervention subgroups for high SDF patients revealed that TESE/TESA patients had the highest SET live birth rate; in comparison with 24.2% for high SDF patients who did not have an intervention, PICSI patients had 38.3% (p = 0.151), IMSI patients had 28.7% (p = 0.680), and TESE/TESA patients had 49.8% (p = 0.020). Our data suggest that SDF results indicate ICSI outcomes and that patients who have high SDF benefit from an intervention. © 2016 American Society of

  16. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  17. An amphioxus RAG1-like DNA fragment encodes a functional central domain of vertebrate core RAG1.

    Science.gov (United States)

    Zhang, Yanni; Xu, Ke; Deng, Anqi; Fu, Xing; Xu, Anlong; Liu, Xiaolong

    2014-01-07

    The highly diversified repertoire of antigen receptors in the vertebrate immune system is generated via proteins encoded by the recombination activating genes (RAGs) RAG1 and RAG2 by a process known as variable, diversity, and joining [V(D)J] gene recombination. Based on the study of vertebrate RAG proteins, many hypotheses have been proposed regarding the origin and evolution of RAG. This issue remains unresolved, leaving a significant gap in our understanding of the evolution of adaptive immunity. Here, we show that the amphioxus genome contains an ancient RAG1-like DNA fragment (bfRAG1L) that encodes a virus-related protein that is much shorter than vertebrate RAG1 and harbors a region homologous to the central domain of core RAG1 (cRAG1). bfRAG1L also contains an unexpected retroviral type II nuclease active site motif, DXN(D/E)XK, and is capable of degrading both DNA and RNA. Moreover, bfRAG1L shares important functional properties with the central domain of cRAG1, including interaction with RAG2 and localization to the nucleus. Remarkably, the reconstitution of bfRAG1L into a cRAG1-like protein yielded an enzyme capable of recognizing recombination signal sequences and performing V(D)J recombination in the presence of mouse RAG2. Moreover, this reconstituted cRAG1-like protein could mediate the assembly of antigen receptor genes in RAG1-deficient mice. Together, our results demonstrate that amphioxus bfRAG1L encodes a protein that is functionally equivalent to the central domain of cRAG1 and is well prepared for further evolution to mediate V(D)J recombination. Thus, our findings provide unique insights into the evolutionary origin of RAG1.

  18. Susceptibility to anchoring effects

    Directory of Open Access Journals (Sweden)

    Todd McElroy

    2007-02-01

    Full Text Available Previous research on anchoring has shown this heuristic to be a very robust psychological phenomenon ubiquitous across many domains of human judgment and decision-making. Despite the prevalence of anchoring effects, researchers have only recently begun to investigate the underlying factors responsible for how and in what ways a person is susceptible to them. This paper examines how one such factor, the Big-Five personality trait of openness-to-experience, influences the effect of previously presented anchors on participants' judgments. Our findings indicate that participants high in openness-to-experience were significantly more influenced by anchoring cues relative to participants low in this trait. These findings were consistent across two different types of anchoring tasks providing convergent evidence for our hypothesis.

  19. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning

    OpenAIRE

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the ta...

  20. The mutT defect does not elevate chromosomal fragmentation in Escherichia coli because of the surprisingly low levels of MutM/MutY-recognized DNA modifications.

    Science.gov (United States)

    Rotman, Ella; Kuzminov, Andrei

    2007-10-01

    Nucleotide pool sanitizing enzymes Dut (dUTPase), RdgB (dITPase), and MutT (8-oxo-dGTPase) of Escherichia coli hydrolyze noncanonical DNA precursors to prevent incorporation of base analogs into DNA. Previous studies reported dramatic AT-->CG mutagenesis in mutT mutants, suggesting a considerable density of 8-oxo-G in DNA that should cause frequent excision and chromosomal fragmentation, irreparable in the absence of RecBCD-catalyzed repair and similar to the lethality of dut recBC and rdgB recBC double mutants. In contrast, we found mutT recBC double mutants viable with no signs of chromosomal fragmentation. Overproduction of the MutM and MutY DNA glycosylases, both acting on DNA containing 8-oxo-G, still yields no lethality in mutT recBC double mutants. Plasmid DNA, extracted from mutT mutM double mutant cells and treated with MutM in vitro, shows no increased relaxation, indicating no additional 8-oxo-G modifications. Our DeltamutT allele elevates the AT-->CG transversion rate 27,000-fold, consistent with published reports. However, the rate of AT-->CG transversions in our mutT(+) progenitor strain is some two orders of magnitude lower than in previous studies, which lowers the absolute rate of mutagenesis in DeltamutT derivatives, translating into less than four 8-oxo-G modifications per genome equivalent, which is too low to cause the expected effects. Introduction of various additional mutations in the DeltamutT strain or treatment with oxidative agents failed to increase the mutagenesis even twofold. We conclude that, in contrast to the previous studies, there is not enough 8-oxo-G in the DNA of mutT mutants to cause elevated excision repair that would trigger chromosomal fragmentation.

  1. The mutT Defect Does Not Elevate Chromosomal Fragmentation in Escherichia coli Because of the Surprisingly Low Levels of MutM/MutY-Recognized DNA Modifications▿

    Science.gov (United States)

    Rotman, Ella; Kuzminov, Andrei

    2007-01-01

    Nucleotide pool sanitizing enzymes Dut (dUTPase), RdgB (dITPase), and MutT (8-oxo-dGTPase) of Escherichia coli hydrolyze noncanonical DNA precursors to prevent incorporation of base analogs into DNA. Previous studies reported dramatic AT→CG mutagenesis in mutT mutants, suggesting a considerable density of 8-oxo-G in DNA that should cause frequent excision and chromosomal fragmentation, irreparable in the absence of RecBCD-catalyzed repair and similar to the lethality of dut recBC and rdgB recBC double mutants. In contrast, we found mutT recBC double mutants viable with no signs of chromosomal fragmentation. Overproduction of the MutM and MutY DNA glycosylases, both acting on DNA containing 8-oxo-G, still yields no lethality in mutT recBC double mutants. Plasmid DNA, extracted from mutT mutM double mutant cells and treated with MutM in vitro, shows no increased relaxation, indicating no additional 8-oxo-G modifications. Our ΔmutT allele elevates the AT→CG transversion rate 27,000-fold, consistent with published reports. However, the rate of AT→CG transversions in our mutT+ progenitor strain is some two orders of magnitude lower than in previous studies, which lowers the absolute rate of mutagenesis in ΔmutT derivatives, translating into less than four 8-oxo-G modifications per genome equivalent, which is too low to cause the expected effects. Introduction of various additional mutations in the ΔmutT strain or treatment with oxidative agents failed to increase the mutagenesis even twofold. We conclude that, in contrast to the previous studies, there is not enough 8-oxo-G in the DNA of mutT mutants to cause elevated excision repair that would trigger chromosomal fragmentation. PMID:17616589

  2. cDNA-amplified fragment length polymorphism to study the transcriptional responses of Lactobacillus rhamnosus growing in cheese-like medium.

    Science.gov (United States)

    Bove, C G; Lazzi, C; Bernini, V; Bottari, B; Neviani, E; Gatti, M

    2011-10-01

    Lactobacillus rhamnosus is a dominant species during Parmigiano Reggiano cheese ripening and exhibits a great adaptability to unfavourable growth conditions. Gene expression of a Lact. rhamnosus, isolated from Parmigiano Reggiano cheese, grown in a rich medium (MRS) and in a cheese-like medium (CB) has been compared by a novel cDNA-amplified fragment length polymorphism (cDNA-AFLP) protocol. Two techniques, capillary and gel electrophoresis cDNA-AFLP, were applied to generate unique transcript tags from reverse-transcribed messenger RNA using the immobilization of biotinylated 3'-terminal cDNA fragments on streptavidin-coated Dynabeads. The use of three pairs of primers allowed detecting 64 genes expressed in MRS and 96 in CB. Different transcripts were observed when Lact. rhamnosus was cultured on CB and MRS. The cDNA-AFLP approach proved to be able to show that Lact. rhamnosus modifies the expression of a large part of genes when cultivated in CB compared with growth under optimal conditions (MRS). In particular, the profiles of the strain grown in CB were more complex probably because the cells activate different metabolic pathways to generate energy and to respond to the environmental changes. This is the first research on Lact. rhamnosus isolated from cheese and represents one of the few concerning bacterial transcriptomic analysis towards cDNA-AFLP approaches. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.

  3. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  4. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  5. Molecular characterization of a DNA fragment harboring the replicon of pBMB165 from Bacillus thuringiensis subsp. tenebrionis

    Directory of Open Access Journals (Sweden)

    Yu Ziniu

    2006-10-01

    Full Text Available Abstract Background Bacillus thuringiensis belongs to the Bacillus cereus sensu lato group of Gram-positive and spore-forming bacteria. Most isolates of B. thuringiensis can bear many endogenous plasmids, and the number and size of these plasmids can vary widely among strains or subspecies. As far as we know, the replicon of the plasmid pBMB165 is the first instance of a plasmid replicon being isolated from subsp. tenebrionis and characterized. Results A 20 kb DNA fragment containing a plasmid replicon was isolated from B. thuringiensis subsp. tenebrionis YBT-1765 and characterized. By Southern blot analysis, this replicon region was determined to be located on pBMB165, the largest detected plasmid (about 82 kb of strain YBT-1765. Deletion analysis revealed that a replication initiation protein (Rep165, an origin of replication (ori165 and an iteron region were required for replication. In addition, two overlapping ORFs (orf6 and orf10 were found to be involved in stability control of plasmid. Sequence comparison showed that the replicon of pBMB165 was homologous to the pAMβ1 family replicons, indicating that the pBMB165 replicon belongs to this family. The presence of five transposable elements or remnants thereof in close proximity to and within the replicon control region led us to speculate that genetic exchange and recombination are potentially responsible for the divergence among the replicons of this plasmid family. Conclusion The replication and stability features of the pBMB165 from B. thuringiensis subsp. tenebrionis YBT-1765 were identified. Of particular interest is the homology and divergence shared between the pBMB165 replicon and other pAMβ1 family replicons.

  6. Assessment of sperm function parameters and DNA fragmentation in ejaculated alpaca sperm (Lama pacos) by flow cytometry.

    Science.gov (United States)

    Cheuquemán, C; Merino, O; Giojalas, L; Von Baer, A; Sánchez, R; Risopatrón, J

    2013-06-01

    Flow cytometry has been shown to be an accurate and highly reproducible tool for the analysis of sperm function. The main objective of this study was to assess sperm function parameters in ejaculated alpaca sperm by flow cytometry. Semen samples were collected from six alpaca males and processed for flow cytometric analysis of sperm viability and plasma membrane integrity using SYBR-14⁄PI staining; acrosomal membrane integrity using FITC-conjugated Pisum Sativum Agglutinin⁄PI labelling; mitochondrial membrane potential (Δψm) by staining with JC-1 and DNA Fragmentation Index (DFI) by TUNEL. The results indicate that the mean value for sperm viability was 57 ± 8 %. Spermatozoa with intact acrosome membrane was 87.9 ± 5%, and viable sperm with intact acrosomal membrane was 46.8 ± 9%, high mitochondrial membrane potential (Δψm) was detected in 66.32 ± 9.51% of spermatozoa and mean DFI value was 0.91 ± 0.9%. The DFI was inversely correlated with high Δψm (p = 0.04; r = -0.41) and with plasma membrane integrity (p = 0.01; r = -0.47). To our knowledge, this is the first report of the assessment on the same sample of several parameters of sperm function in ejaculated alpaca sperm by flow cytometry. © 2012 Blackwell Verlag GmbH.

  7. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  8. Differences in Electrostatic Potential Around DNA Fragments Containing Adenine and 8-oxo-Adenine. An Analysis Based on Regular Cylindrical Projection

    Energy Technology Data Exchange (ETDEWEB)

    Haranczyk, Maciej; Miller, John H; Gutowski, Maciej S

    2007-07-01

    Changes of electrostatic potential (EP) around the DNA molecule resulting from chemical modifications of nucleotides may play a role in enzymatic recognition of damaged sites. Effects of chemical modifications of nucleotides on the structure of DNA have been characterized through large scale density functional theory computations. Quantum mechanical structural optimizations of DNA fragments with three pairs of nucleotides and accompanying counteractions were performed with a B3LYP exchange-correlation functional and 6-31G** basis sets. The “intact” DNA fragment contained adenine in the middle layer, while the “damaged” fragment had the adenine replaced with 8-oxo-adenine. The electrostatic potential around these DNA fragments was projected on a cylindrical surface around the double helix. The two-dimensional maps of EP of the intact and damaged DNA fragments were analyzed to identify these modifications of EP that result from the occurrence of 8-oxo-adenine (8oA). It was found that distortions of a phosphate group neighboring 8oA and displacements of the accompanying countercation are clearly reflected in the EP maps. Helpful discussions Michel Dupuis are gratefully acknowledged. Authors wish to thank Marcel Swart for directing us to a compilation of van der Waals radii. This work was supported by the: (i) US DOE Office of Biological and Environmental Research, Low Dose Radiation Research Program (M.G. and M.H.), (ii) the Office of Science (BER), U. S. Department of Energy, Grant No. DE-FG03-02ER63470 (JHM), (iii) Polish State Committee for Scientific Research (KBN) Grant DS/8221-4-0140-6 (MG), (iv) European Social Funds (EFS) ZPORR/2.22/II/2.6/ARP/U/2/05 (M.H.). M.H. holds the Foundation for Polish Science (FNP) award for young scientists. The calculations were performed at the Academic Computer Center in Gdansk (TASK) and at the Molecular Science Computing Facility (MSCF) in the William R. Wiley Environmental Molecular Sciences Laboratory, a national

  9. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  10. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652 ......, but not in the highly exposed Inuit men. Additional issues (genetic background, lifestyle habits and characterization of total xeno-hormonal activities) need to be investigated in order to fully assess the population variations observed........ Sperm DNA fragmentation was measured by using the TUNEL assay, whereas immunofluorescence methods were utilized for detecting pro-apoptotic (Fas) and anti-apoptotic (Bcl-xL) markers. Both TUNEL assay and apoptotic markers were statistically differed across the four populations. No correlation between...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  11. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  12. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  13. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    International Nuclear Information System (INIS)

    Santiso, Rebeca; Tamayo, María; Gosálvez, Jaime; Johnston, Steve; Mariño, Alfonso; Fernández, Carlos; Losada, Carlos; Fernández, José Luis

    2012-01-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 °C and 45 °C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 °C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan–Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  14. The anchor integration model: A descriptive model of anchoring effects.

    Science.gov (United States)

    Turner, Brandon M; Schley, Dan R

    2016-11-01

    Few experimental effects in the psychology of judgment and decision making have been studied as meticulously as the anchoring effect. Although the existing literature provides considerable insight into the psychological processes underlying anchoring effects, extant theories up to this point have only generated qualitative predictions. While these theories have been productive in advancing our understanding of the underlying anchoring process, they leave much to be desired in the interpretation of specific anchoring effects. In this article, we introduce the Anchor Integration Model (AIM) as a descriptive tool for the measurement and quantification of anchoring effects. We develop two versions the model: one suitable for assessing between-participant anchoring effects, and another for assessing individual differences in anchoring effects. We then fit each model to data from two experiments, and demonstrate the model's utility in describing anchoring effects. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Construction and characterization of three yeast-Escherichia coli shuttle vectors designed for rapid subcloning of yeast genes on small DNA fragments.

    Science.gov (United States)

    Ferguson, J; Groppe, J C; Reed, S I

    1981-12-01

    We have constructed three new subcloning plasmid vectors, pRC1, pRC2, and pRC3, derived from pKC7, which allow the rapid, single-step subcloning of yeast genes. Subcloning with these vectors utilizes a partial digestion with Sau3A to generate a quasi-random set of DNA fragments from the original plasmid. All three vectors contain a kanamycin resistance gene. Therefore, if the original cloned yeast DNA fragment is present in a vector that does not specify kanamycin resistance, the subclone pool can be propagated in Escherichia coli in the presence of kanamycin to select against parent plasmids that escaped restriction by Sau3A. Selection by complementation in yeast yields a collection of plasmids with smaller yeast DNA inserts containing the gene of interest. In the vectors pRC2 and pRC3, constructed from pRC1, the unique BamHI site is located within an intact tetracycline resistance gene, thus making it possible to screen bacterial transformants for those containing recombinant plasmid molecules. Vectors pRC2 and pRC3 also contain the yeast 2 micrometers DNA replication origin, and thus are more stable than plasmids carrying only the TRP1-associated replicator (ars1).

  16. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  18. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  19. Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

    Science.gov (United States)

    Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

    1993-01-01

    Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss

  20. Restriction-based Multiple-fragment Assembly Strategy to Avoid Random Mutation during Long cDNA Cloning.

    Science.gov (United States)

    Wang, Shang; Chen, Wen; Zhang, Kai; Jiao, Peng; Mo, Lihua; Yang, Xiaoxu; Hu, Xiang; Zhang, Jian; Wei, Chenxi; Xiang, Shuanglin

    2015-01-01

    Long fragment cloning is a challenge for its difficulty in accurate amplifying and tendency to get unwanted mutation. Here we discuss Restriction-based Multiple-fragment Assembly Strategy's advantages and limitations. In this strategy, rather than PCR amplifying the entire coding sequence (CDS) at one time, we amplified and sequenced smaller fragments which are shorter than 1.5kb spanning the CDS. After that, the sequence-proved fragments were assembled by digestion-ligation cloning to the target vector. We test its universality in our script programmed in Python. Our data shows that, among the entire human and mouse CDS, at least 70% of long CDS cloning will benefit from this strategy.

  1. PCR-based detection of a rare linear DNA in cell culture

    Directory of Open Access Journals (Sweden)

    Saveliev Sergei V.

    2002-01-01

    Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  2. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  3. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  4. Ambivalent incorporation of the fluorescent cytosine analogues tC and tCo by human DNA polymerase alpha and Klenow fragment.

    Science.gov (United States)

    Stengel, Gudrun; Purse, Byron W; Wilhelmsson, L Marcus; Urban, Milan; Kuchta, Robert D

    2009-08-11

    We studied the incorporation of the fluorescent cytidine analogues 1,3-diaza-2-oxophenothiazine (tC) and 1,3-diaza-2-oxophenoxazine (tCo) by human DNA polymerase alpha and Klenow fragment of DNA polymerase I (Escherichia coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly expanded in size toward the major groove. Despite the size alteration, both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only approximately 4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs and can incorporate at least four consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. Klenow fragment inserts dGTP with a 4-9-fold higher probability than dATP, while polymerase alpha favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as a templating base and as an incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o).

  5. The Anchoring Concept

    DEFF Research Database (Denmark)

    Simonsen, Jesper

    1998-01-01

    This paper introduces the term 'anchoring' within systems development: Visions, developed through early systems design within an organization, need to be deeply rooted in the organization. A vision's rationale needs to be understood by those who decide if the vision should be implemented as well ...

  6. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  7. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  8. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  9. Profiles of fragments after pulsed-field gel electrophoresis of cleaved genomic DNA from strains of Taylorella equigenitalis isolated from horses in Norway.

    Science.gov (United States)

    Matsuda, M; Miyazawa, T; Ishida, Y; Moore, J E

    1997-07-01

    The genomic DNA of eight strains of Taylorella equigenitalis, isolated from seven Norwegian Trotters and a Norwegian pony with contagious equine metritis in Norway, was examined by pulsed-field gel electrophoresis after separate digestions with two restriction enzymes, namely, ApaI and NotI. The respective electrophoretic profiles of the fragments were essentially identical but differed from those of T. equigenitalis NCTC11184T and Kentucky 188. They also exhibited slight differences from profiles obtained from Japanese isolates. These results may possibly suggest a common genotype and a common source of infection for all these eight isolates in Norway.

  10. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...... potential for the differentiation of M. hyosynoviae isolates. Concordant results obtained with the two whole-genome fingerprinting techniques evidence the considerable intraspecies genetic heterogeneity of M. hyosynoviae . Sixteen field strains of M. hyosynoviae and the type strain S16(T) were further...

  11. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  12. Fluorescent SSCP of overlapping fragments (FSSCP-OF): a highly sensitive method for the screening of mitochondrial DNA variation

    DEFF Research Database (Denmark)

    Salas, A; Rasmussen, Erik Michael; Lareu, M V

    2001-01-01

    The mtDNA analysis (mtDNA) is increasingly being demanded for forensic purposes due to the fact that many times the use of standard nuclear marker fails to analyze degraded samples (such as bones) and specially for the analysis of hair shafts (a common sample in the crime scene). However, analysi...

  13. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  14. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  15. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  16. Mitochondrial DNA Fragmentation as a Molecular Tool to Monitor Thermal Processing of Plant-Derived, Low-Acid Foods, and Biomaterials.

    Science.gov (United States)

    Caldwell, Jane M; Pérez-Díaz, Ilenys M; Sandeep, K P; Simunovic, Josip; Harris, Keith; Osborne, Jason A; Hassan, Hosni M

    2015-08-01

    Cycle threshold (Ct) increase, quantifying plant-derived DNA fragmentation, was evaluated for its utility as a time-temperature integrator. This novel approach to monitoring thermal processing of fresh, plant-based foods represents a paradigm shift. Instead of using quantitative polymerase chain reaction (qPCR) to detect pathogens, identify adulterants, or authenticate ingredients, this rapid technique was used to quantify the fragmentation of an intrinsic plant mitochondrial DNA (mtDNA) gene over time-temperature treatments. Universal primers were developed which amplified a mitochondrial gene common to plants (atp1). These consensus primers produced a robust qPCR signal in 10 vegetables, 6 fruits, 3 types of nuts, and a biofuel precursor. Using sweet potato (Ipomoea batatas) puree as a model low-acid product and simple linear regression, Ct value was highly correlated to time-temperature treatment (R(2) = 0.87); the logarithmic reduction (log CFU/mL) of the spore-forming Clostridium botulinum surrogate, Geobacillus stearothermophilus (R(2) = 0.87); and cumulative F-value (min) in a canned retort process (R(2) = 0.88), all comparisons conducted at 121 °C. D121 and z-values were determined for G. stearothermophilus ATCC 7953 and were 2.71 min and 11.0 °C, respectively. D121 and z-values for a 174-bp universal plant amplicon were 11.3 min and 9.17 °C, respectively, for mtDNA from sweet potato puree. We present these data as proof-of-concept for a molecular tool that can be used as a rapid, presumptive method for monitoring thermal processing in low-acid plant products. © 2015 Institute of Food Technologists®

  17. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  18. Nuclear status and DNA fragmentation of oocytes from porcine, bovine and feline ovaries stored at 4 degrees C for 5 days.

    Science.gov (United States)

    Luu, Vien Viet; Namula, Zhao; Do, Lanh Thi Kim; Sato, Yoko; Taniguchi, Masayasu; Karja, Ni Wayan Kurniani; Otoi, Takeshige

    2014-01-01

    The cooling of mammalian oocytes to sub-physiological temperatures is widely known to affect their viability through the induction of various abnormalities at all stages of meiosis. This study was to compare the kinetics of nuclear status and oocyte damage in porcine, bovine and feline ovaries stored at 4 degrees C for 5 days. The nuclear status and oocyte quality during storage were evaluated before and after maturation culture. The cold storage of ovaries decreased the proportions of porcine and bovine oocytes that remained at the germinal vesicle stage before maturation culture. The maturation rates of oocytes decreased with increasing storage time, independent of species. None of the porcine oocytes reached metaphase II (MII) after 1 day of storage. In contrast, bovine and feline oocytes from ovaries that were stored for 2 days and 3 days reached MII. DNA fragmentation in porcine oocytes from ovaries stored for 1 day was significantly higher than that in bovine and feline oocytes. The maturation competency of oocytes after the cold storage of ovaries could be related to the meiotic resumption of oocytes during storage and the occurrence of DNA fragmentation in oocytes during maturation culture.

  19. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  20. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  1. Anchored paired comparisons

    Science.gov (United States)

    Dalal, E. N.; Handley, J. C.; Wu, W.; Wang, J.

    2008-01-01

    The method of paired comparisons is often used in image quality evaluations. Psychometric scale values for quality judgments are modeled using Thurstone's Law of Comparative Judgment in which distance in a psychometric scale space is a function of the probability of preference. The transformation from psychometric space to probability is a cumulative probability distribution. The major drawback of a complete paired comparison experiment is that every treatment is compared to every other, thus the number of comparisons grows quadratically. We ameliorate this difficulty by performing paired comparisons in two stages, by precisely estimating anchors in the psychometric scale space which are spaced apart to cover the range of scale values and comparing treatments against those anchors. In this model, we employ a generalized linear model where the regression equation has a constant offset vector determined by the anchors. The result of this formulation is a straightforward statistical model easily analyzed using any modern statistics package. This enables model fitting and diagnostics. This method was applied to overall preference evaluations of color pictorial hardcopy images. The results were found to be compatible with complete paired comparison experiments, but with significantly less effort.

  2. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  3. Novel telomere-anchored PCR approach for studying sexual stage telomeres in Aspergillus nidulans.

    Directory of Open Access Journals (Sweden)

    Nengding Wang

    Full Text Available Telomere length varies between germline and somatic cells of the same organism, leading to the hypothesis that telomeres are lengthened during meiosis. However, little is known about the meiotic telomere length in many organisms. In the filamentous fungus Aspergillus nidulans, the telomere lengths in hyphae and asexual spores are invariant. No study using existing techniques has determined the telomere length of the sexual ascospores due to the relatively low abundance of pure meiotic cells in A. nidulans and the small quantity of DNA present. To address this, we developed a simple and sensitive PCR strategy to measure the telomere length of A. nidulans meiotic cells. This novel technique, termed "telomere-anchored PCR," measures the length of the telomere on chromosome II-L using a small fraction of the DNA required for the traditional terminal restriction fragment (TRF Southern analysis. Using this approach, we determined that the A. nidulans ascospore telomere length is virtually identical to telomeres of other cell types from this organism, approximately 110 bp, indicating that a surprisingly strict telomere length regulation exists in the major cell types of A. nidulans. When the hyphal telomeres were measured in a telomerase reverse transcriptase (TERT knockout strain, small decreases in length were readily detected. Thus, this technique can detect telomeres in relatively rare cell types and is particularly sensitive in measuring exceptionally short telomeres. This rapid and inexpensive telomere-anchored PCR method potentially can be utilized in other filamentous fungi and types of organisms.

  4. Ambivalent Incorporation of the Fluorescent Cytosine Analogues tC and tCo by Human DNA Polymerase α and Klenow Fragment #

    Science.gov (United States)

    Stengel, Gudrun; Purse, Byron W.; Wilhelmsson, L. Marcus; Urban, Milan; Kuchta, Robert D.

    2009-01-01

    We studied the incorporation of the fluorescent cytidine analogues 1, 3-diaza-2-oxo-phenothiazine (tC) and 1, 3-diaza-2-oxo-phenoxazine (tCo) by human DNA polymerase α and Klenow fragment of DNA polymerase I (E. coli). These tricyclic nucleobases possess the regular hydrogen bonding interface of cytosine but are significantly size expanded toward the major groove. Despite the size alteration both DNA polymerases insert dtCTP and dtCoTP with remarkable catalytic efficiency. Polymerization opposite guanine is comparable to the insertion of dCTP, while the insertion opposite adenine is only ∼4-11 times less efficient than the formation of a T-A base pair. Both enzymes readily extend the formed tC(o)-G and tC(o)-A base pairs, and can incorporate at least 4 consecutive nucleotide analogues. Consistent with these results, both DNA polymerases efficiently polymerize dGTP and dATP when tC and tCo are in the template strand. KF inserts dGTP with a 4- to 9-fold higher probability than dATP, while pol α favors dGTP over dATP by a factor of 30-65. Overall, the properties of tC(o) as templating base and as incoming nucleotide are surprisingly symmetrical and may be universal for A and B family DNA polymerases. This finding suggests that the aptitude for ambivalent base pairing is a consequence of the electronic properties of tC(o). PMID:19580325

  5. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  6. An analysis on DNA fingerprints of thirty papaya cultivars (Carica papaya L.), grown in Thailand with the use of amplified fragment length polymorphisms technique.

    Science.gov (United States)

    Ratchadaporn, Janthasri; Sureeporn, Katengam; Khumcha, U

    2007-09-15

    The experiment was carried out at the Department of Horticulture, Ubon Ratchathani University, Ubon Ratchathani province, Northeast Thailand during June 2002 to May 2003 aims to identify DNA fingerprints of thirty papaya cultivars with the use of Amplified Fragment Length Polymorphisms (AFLP) technique. Papaya cultivars were collected from six different research centers in Thailand. Papaya plants of each cultivar were grown under field conditions up to four months then leaf numbers 2 and 3 of each cultivar (counted from top) were chosen for DNA extraction and the samples were used for AFLP analysis. Out of 64 random primers being used, 55 pairs gave an increase in DNA bands but only 12 pairs of random primers were randomly chosen for the final analysis of the experiment. The results showed that AFLP markers gave Polymorphic Information Contents (PIC) of three ranges i.e., AFLP markers of 235 lied on a PIC range of 0.003-0.05, 47 for a PIC range of 0.15-0.20 and 12 for a PIC range of 0.35-0.40. The results on dendrogram cluster analysis revealed that the thirty papaya cultivars were classified into six groups i.e., (1) Kaeg Dum and Malador (2) Kaeg Nuan (3) Pakchong and Solo (4) Taiwan (5) Co Coa Hai Nan and (6) Sitong. Nevertheless, in spite of the six papaya groups all papaya cultivars were genetically related to each other where diversity among the cultivars was not significantly found.

  7. Quality, oxidative markers and DNA damage (DNA) fragmentation of red deer thawed spermatozoa after incubation at 37 °C in presence of several antioxidants.

    Science.gov (United States)

    Mata-Campuzano, M; Alvarez-Rodríguez, M; del Olmo, E; Fernández-Santos, M R; Garde, J J; Martínez-Pastor, F

    2012-09-15

    Antioxidants may be useful for supplementing sperm extenders. We have tested dehydroascorbic acid (DHA), TEMPOL, N-acetyl-cysteine (NAC) and rutin on epididymal spermatozoa from red deer, during incubation at 37 °C. Cryopreserved spermatozoa were thawed, washed and incubated with 1 mM or 0.1 mM of each antioxidant, including oxidative stress (Fe(2+)/ascorbate). Motility (CASA and clustering of subpopulations), viability, mitochondrial membrane potential, and acrosomal status were assessed at 2 and 4 h. Lipoperoxidation, intracellular reactive oxygen species (ROS) and DNA damage (DNA) status (TUNEL) were checked at 4 h. Oxidative stress increased ROS, lipoperoxidation and DNA damage. Overall, antioxidants negatively affected motility and physiological parameters. Only DHA 1 mm protected motility, increasing the fast and progressive subpopulation. However, it had a detrimental effect on acrosomal and DNA status, in absence of oxidative stress. Tempol and rutin efficiently reduced lipoperoxidation, ROS, and DNA damage in presence of oxidative stress. NAC was not as efficient as TEMPOL or rutin reducing lipoperoxidation or protecting DNA, and did not reduce ROS, but its negative effects were lower than the other antioxidants when used at 1 mm, increasing the subpopulation of hyperactivated-like spermatozoa at 2 h. Our results show that these antioxidants have mixed effects when spermatozoa are incubated at physiological temperatures. DHA may not be suitable because of prooxidant effects, but TEMPOL, NAC and rutin may be considered for cryopreservation trials. In general, exposure of red deer spermatozoa to these antioxidants should be limited to low temperatures, when only protective effects may develop. Copyright © 2012 Elsevier Inc. All rights reserved.

  8. Anchoring visions in organizations

    DEFF Research Database (Denmark)

    Simonsen, Jesper

    1999-01-01

    This paper introduces the term 'anchoring' within systems development: Visions, developed through early systems design within an organization, need to be deeply rooted in the organization. A vision's rationale needs to be understood by those who decide if the vision should be implemented as well...... as by those involved in the actual implementation. A model depicting a recent trend within systems development is presented: Organizations rely on purchasing generic software products and/or software development outsourced to external contractors. A contemporary method for participatory design, where...

  9. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  10. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Science.gov (United States)

    Després, V. R.; Nowoisky, J. F.; Klose, M.; Conrad, R.; Andreae, M. O.; Pöschl, U.

    2007-12-01

    This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA) particles in the atmosphere. Samples of fine particulate matter (PM2.5) and total suspended particulates (TSP) have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze). From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP) were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses. Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m-3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively). Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42) and some from Actinobacteria (10) and Firmicutes (1). The fungal sequences were characteristic for Ascomycota (3) and Basidiomycota (1), which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2) and moss spores (2), while animal DNA was found only for one unicellular eukaryote (protist). Over 80% of the 53 bacterial sequences could be matched to one of the 19 T-RF peaks found in the PM2.5 samples, but only 40% of the T-RF peaks

  11. Career anchors of dentist leaders.

    Science.gov (United States)

    Tuononen, Tiina; Lammintakanen, Johanna; Suominen, Anna Liisa

    2016-08-01

    The work of a health care leader is demanding; in order to cope, leaders need motivation and support. The occurrence of intrinsic factors called career anchors (combination of one's competence, motives and values) could be a contributing factor in dentist leaders' career decisions. The aim of our study was to identify dentist leaders' career anchors and their association to dentist leaders' retention or turnover of the leadership position. Materials were gathered in 2014 via an electronic questionnaire from 156 current (Leaders) or former (Leavers) Finnish dentist leaders. Career anchor evaluation was conducted by the questionnaire and scoring-table taken from Edgar Schein's Career Anchors Self-Assessment. Both the most and the least important career anchors were detected by the highest and lowest scores and their occurrence reported as percentages. Associations between career anchor scores and tendency to stay were analyzed with logistic regression. 'Technical/Functional Competence' and 'Lifestyle' were most frequently reported as the most important and 'Entrepreneurial Creativity' and 'General Managerial Competence' as the least important career anchors. However, a higher level of 'General Managerial Competence' anchor was most significantly associated with staying in a leadership position. Instead, 'Pure Challenge' and 'Lifestyle' decreased the odds to stay. The knowledge of the important and essential career anchors of dentist leaders' and individuals' could perform crucial part in career choices and also in planning education, work opportunities and human resource policies promoting retention of dentist leaders and probably also other health care leaders.

  12. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Czech Academy of Sciences Publication Activity Database

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  13. Guanine quadruplex formation by RNA/DNA hybrid analogs of Oxytricha telomere G4T4G4 fragment

    Czech Academy of Sciences Publication Activity Database

    Vondrušková, Jitka; Kypr, Jaroslav; Kejnovská, Iva; Fialová, Markéta; Vorlíčková, Michaela

    2008-01-01

    Roč. 89, č. 10 (2008), s. 797-806 ISSN 0006-3525 R&D Projects: GA ČR(CZ) GA204/07/0057; GA AV ČR(CZ) IAA100040701 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : RNA/DNA hybrids * guanine quadruplex * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 2.823, year: 2008

  14. Identity of victims from fragmented and decomposed remnants by DNA profiling in a case of serial killings.

    Science.gov (United States)

    Raina, Anupuma; Dogra, T D; Leenaars, Antoon A; Yadav, Bhuvnesh; Bhera, C; Lalwani, Sanjeev; Leenaars, Lindsey

    2010-10-01

    A 28-year-old man, Surinder Koli, from a Nithari village adjoining Delhi, India committed serial murder. This case was of paramount importance in medico-legal investigations, as it was a landmark case of a serial killer reported from India. The skeletal remains (627 pieces) including skull/skull portions (19) were recovered from the nearby sewer drain, sump and the backyard of the house in which this man was residing. In addition, soft tissues (51) were also recovered from the same sewer drain. The victims were killed over a two-year period. The establishment of identity of the victims was crucial to prove the case in the court of law as well as for the claimants. Nineteen sets were prepared by radiology/anatomical examination from the exhibits recovered. DNA profiling confirmed the correctness of these sets and also short tandem repeat typing of nuclear DNA successfully identified eight individuals. Both DNA profiling and radiography/anatomical examination played an important role in solving this complicated case.

  15. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  16. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  17. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  18. [Values of the sperm deformity index, acrosome abnormity rate, and sperm DNA fragmentation index of optimized sperm in predicting IVF fertilization failure].

    Science.gov (United States)

    Jiang, Wei-jie; Jin, Fan; Zhou, Li-ming

    2016-02-01

    To investigate the values of the sperm deformity index (SDI), acrosome abnormity rate (AAR), and DNA fragmentation index (DFI) of optimized sperm in the prediction of fertilization failure (fertilization rate fertilization (IVF). We selected 695 cycles of conventional IVF for pure oviductal infertility in this study, including 603 cycles of normal fertilization and 92 cycles of fertilization failure. On the day of oocyte retrieval, we examined sperm morphology, acrosome morphology, and DNA fragmentation using the Diff-Quik, PSA-FITC and SCD methods. We established the joint predictor (JP) by logistic equation and analyzed the values of different parameters in predicting fertilization failure with the receiver operating characteristic (ROC) curve. The fertilization rate was negatively correlated with SDI (r = - 0.07; P = 0.03), AAR (r = -0.49; P fertilization group were 1.24 ± 0.20, (7.75 ± 2.28)%, and (7.87 ± 3.15)%, and those in the fertilization failure group were 1.42 ± 0.15, (12.02 ± 3.06)%, and (13.32 ± 4.13)%, respectively, all with statistically significant differences between the two groups (P fertilization failure ( OR = 2.68, 14.11, and 3.85; P = 0.01, fertilization failure were approximately 1.45, 10%, and 12%. The SDI, AAR and DFI of optimized sperm are closely associated with the fertilization rate, and all have the value for predicting fertilization failure in IVF. The AAR is more valuable than the other single predictors, but JP is more effective than the AAR.

  19. The Holding Power of Anchors

    Indian Academy of Sciences (India)

    ton cutter Frolic. One thing is certain, however, the new anchor has no stock to foul the jib sheets when coming about, so that one continuously acting source of blasphemy will be removed. For the benefit of people who like to try new things, it is proposed to put this anchor on the market at the beginning of the coming season ...

  20. Nested PCRs and sequencing of nuclear ITS-rDNA fragments detect three Leishmania species of gerbils in sandflies from Iranian foci of zoonotic cutaneous leishmaniasis.

    Science.gov (United States)

    Parvizi, P; Ready, P D

    2008-09-01

    To identify and understand the natural transmission cycles of Leishmania in Iranian sandflies. Nested PCR protocols were developed to amplify two regions of the ribosomal RNA amplicon of Leishmania (ITS1-5.8S rRNA gene, and a microsatellite DNA region of ITS2), which were species-specific by DNA sequence or fragment size. The PCR assays detected in Iranian sandflies not only Leishmania major but also for the first time L. turanica and L. gerbilli sensu lato, two other parasites of the great gerbil. All three parasites were found in the northeast and centre of Iran, in two foci of rural Zoonotic Cutaneous Leishmaniasis (ZCL) caused by L. major. Fifty infections were detected in common sandfly species: at least six geographically differentiated haplotypes of L. major in four to five sandfly species; one strain of L. gerbilli s.l. in five to six sandfly species and one strain of L. turanica in one sandfly species. Past conclusions about the transmission cycles of L. major in Iran should be treated with caution. Careful molecular eco-epidemiological investigations are essential for modelling the roles of different sandfly species in maintaining and spreading ZCL foci. Even if non-pathogenic to humans, frequent inoculations of L. turanica by sandflies might alter the efficacy of vaccines against L. major. Phlebotomus papatasi is probably the key vector in many ZCL foci because of its abundance and high infection rates with both L. major and L. turanica.

  1. The virome of the arbuscular mycorrhizal fungus Gigaspora margarita reveals the first report of DNA fragments corresponding to replicating non-retroviral RNA viruses in fungi.

    Science.gov (United States)

    Turina, Massimo; Ghignone, Stefano; Astolfi, Nausicaa; Silvestri, Alessandro; Bonfante, Paola; Lanfranco, Luisa

    2018-02-02

    Arbuscular Mycorrhizal Fungi (AMF) are key components of the plant microbiota. AMF genetic complexity is increased by the presence of endobacteria, which live inside many species. A further component of such complexity is the virome associated to AMF, whose knowledge is still very limited. Here, by exploiting transcriptomic data we describe the virome of Gigaspora margarita. A BLAST search for viral RNA-dependent RNA polymerases sequences allowed the identification of four mitoviruses, one Ourmia-like narnavirus, one Giardia-like virus, and two sequences related to Fusarium graminearum mycoviruses. Northern blot and RT-PCR confirmed the authenticity of all the sequences with the exception of the F. graminearum-related ones. All the mitoviruses are replicative and functional since both positive strand and negative strand RNA are present. The abundance of the viral RNA molecules is not regulated by the presence or absence of Candidatus Glomeribacter gigasporarum, the endobacterium hosted by G. margarita, with the exception of the Ourmia-like sequence which is absent in bacteria-cured spores. In addition, we report, for the first time, DNA fragments corresponding to mitovirus sequences associated to the presence of viral RNA. These sequences are not integrated in the mitochondrial DNA and preliminary evidence seems to exclude integration in the nuclear genome. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Not all Anchors Weigh Equally.

    Science.gov (United States)

    Greenstein, Michael; Velazquez, Alexandra

    2017-11-01

    The anchoring bias is a reliable effect wherein a person's judgments are affected by initially presented information, but it is unknown specifically why this effect occurs. Research examining this bias suggests that elements of both numeric and semantic priming may be involved. To examine this, the present research used a phenomenon wherein people treat numeric information presented differently in Arabic numeral or verbal formats. We presented participants with one of many forms of an anchor that represented the same value (e.g., twelve hundred or 1,200). Thus, we could examine how a concept's meaning and its absolute numeric value affect anchoring. Experiments 1 and 2 showed that people respond to Arabic and verbal anchors differently. Experiment 3 showed that these differences occurred largely because people tend to think of numbers in digit format. This suggests that one's conceptual understanding of the anchored information matters more than its strict numeric value.

  4. Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus.

    Science.gov (United States)

    Passinho-Soares, Helna; Felix, Durvalina; Kaplan, Maria Auxiliadora; Margis-Pinheiro, Marcia; Margis, Rogério

    2006-08-01

    In Brazil, Plectranthus species are known as "boldo" and have been used in popular medicine for analgesic and dyspeptic purposes. Plectranthus need to be well identified in order to be used as commercially genuine medicinal plants. Here we describe AFLP DNA patterns able to distinguish among different Pectranthus species. The genetic variability of P. grandis Cramer, P. barbatus Andr. and P. ornatus Codd was analyzed with two sets of AFLP primers allowing detection of 241 loci. A total of 22 monomorphic loci were identified in P. barbatus, 15 in P. grandis and 30 in P. ornatus. Among these, 5 loci were informative and species-specific to P. barbatus, 3 to P. grandis and 2 loci were unique to P. ornatus. The AFLP pattern analyzed by different clustering methods assembled individuals according to their species. So far, AFLP represents a genuine and strong method to certify medicinal plant materials.

  5. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  6. Can DNA fragmentation of neat or swim-up spermatozoa be used to predict pregnancy following ICSI of fertile oocyte donors?

    Science.gov (United States)

    Gosálvez, Jaime; Caballero, Pedro; López-Fernández, Carmen; Ortega, Leonor; Guijarro, José Andrés; Fernández, José Luís; Johnston, Stephen D; Nuñez-Calonge, Rocío

    2013-11-01

    This study compared the potential of assessing sperm DNA fragmentation (SDF) from neat semen and the subsequent swim-up (SU) procedure to predict pregnancy when conducting ICSI of fertile donor oocytes. Infertile females (n=81) were transferred embryos resulting from intracytoplasmic sperm injection (ICSI) of their partner's spermatozoa and proven donor oocytes. This model normalized the impact of female factor in putative sperm DNA repair. Semen was blindly assessed for SDF using Halosperm immediately following ejaculation (NS) and after swim-up at the time of ICSI fertilisation. There was a decrease in SDF values of the ejaculated semen sample following the swim-up protocol (P=0.000). Interestingly, pregnancy could be equally predicted from SDF values derived from either neat or swim-up semen samples. Receiver operator curves and the derived Youden's indices determined SDF cutoff values for NS and SU of 24.8% and 17.5%, respectively. Prediction of pregnancy from NS SDF had a sensitivity of 75% and a specificity of 69%, whereas for SU SDF was 78% and 73%, respectively. While increased levels of SDF negatively impact reproductive outcome, we have shown that a reduction in SDF following sperm selection using ICSI with proven donor oocytes is not mandatory for achieving pregnancy. This suggests that a certain level of DNA damage that is not detectable using current technologies could be impacting on the relative success of assisted reproductive technology (ART) procedures. Consequently, we propose a modification of the so called 'iceberg model' as a possible rationale for understanding the role of SDF in reproductive outcome.

  7. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Directory of Open Access Journals (Sweden)

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  8. Forebrain Ischemia-Reperfusion Simulating Cardiac Arrest in Mice Induces Edema and DNA Fragmentation in the Brain

    Directory of Open Access Journals (Sweden)

    Christina H. Liu

    2007-05-01

    Full Text Available Brain injury affects one-third of persons who survive after heart attack, even with restoration of spontaneous circulation by cardiopulmonary resuscitation. We studied brain injury resulting from transient bilateral carotid artery occlusion (BCAO and reperfusion by simulating heart attack and restoration of circulation, respectively, in live C57Black6 mice. This model is known to induce neuronal death in the hippocampus, striatum, and cortex. We report the appearance of edema after transient BCAO of 60 minutes and 1 day of reperfusion. Hyperintensity in diffusion-weighted magnetic resonance imaging (MRI was detectable in the striatum, thalamus, and cortex but not in the hippocampus. To determine whether damage to the hippocampus can be detected in live animals, we infused a T2 susceptibility magnetic resonance contrast agent (superparamagnetic iron oxide nanoparticles [SPIONs] that was linked to single-stranded deoxyribonucleic acid (DNA complementary in sequence to c-fos messenger ribonucleic acid (SPION-cfos; we acquired in vivo T2*-weighted MRI 3 days later. SPION retention was measured as T2* (milliseconds signal reduction or R2* value (s−1 elevation. We found that animals treated with 60-minute BCAO and 7-day reperfusion exhibited significantly less SPION retention in the hippocampus and cortex than sham-operated animals. These findings suggest that brain injury induced by cardiac arrest can be detected in live animals.

  9. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  10. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Science.gov (United States)

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  11. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios

    Science.gov (United States)

    Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-01-01

    Background Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. Methods A search of papers published in response to the CPG entitled “Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios” was performed within the Translational Andrology and Urology (TAU) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as “supportive without reservation”, “supportive with reservation”, “not supportive” or “neutral”. We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the ‘Strengths-Weaknesses-Opportunities-Threats’ (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Results Fifty-eight fertility experts from six

  12. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Science.gov (United States)

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  13. A Luminex-based single DNA fragment amplification assay as a practical tool for detecting and serotyping dengue virus.

    Science.gov (United States)

    Cabral-Castro, Mauro Jorge; Peralta, Regina Helena Saramago; Cavalcanti, Marta Guimarães; Puccioni-Sohler, Marzia; Carvalho, Valéria Lima; da Costa Vasconcelos, Pedro Fernando; Peralta, José Mauro

    2016-10-01

    Dengue is a mosquito-borne viral infection that can evolve from subclinical to severe forms of disease. Early recognition during initial primary and secondary infections correlates with a reduced case-fatality rate in susceptible groups. The aim of this study was to standardize a DNA hybridization assay based on the Luminex technology for detecting and serotyping dengue virus (DENV). Reference DENVs representing the four different serotypes were used as controls to standardize the test. For validation, 16 DENV isolates obtained from a reference laboratory were analyzed in a double-blind manner to validate the test. Sixty blood samples from patients suspected of having dengue fever were used to evaluate the methodology after the validation step, and the results were compared with the reference semi-nested RT-PCR. Additionally, five human samples of each Zika and Chikungunya confirmed patients were used for specificity analysis. The Luminex-based assay correctly identified all 16 DENV isolates. In the evaluation step, the results of the RT-PCR/Luminex assay showed a concordance of 86.7% with those of the semi-nested RT-PCR. None of other virus infection samples was amplified. This is the first description of a hybridization assay that can discriminate the four DENV serotypes using probes against a single DENV sequence. The results indicated that the RT-PCR/Luminex DENV assay designed and evaluated in this study is a valuable additional tool for the early and rapid detection and serotyping of DENV, which could, in the future, be applied to new targets such as the Zika and Chikungunya viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  15. DNA stretching on functionalized gold surfaces.

    OpenAIRE

    Zimmermann, R M; Cox, E C

    1994-01-01

    We describe a method for anchoring bacteriophage lambda DNA by one end to gold by Au-biotin-streptavidin-biotin-DNA bonds. DNA anchored to a microfabricated Au line could be aligned and stretched in flow and electric fields. The anchor was shown to resist a force of at least 11 pN, a linkage strong enough to allow DNA molecules of chromosome size to be stretched and aligned.

  16. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  17. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  18. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Polymer fragmentation in extensional flow

    International Nuclear Information System (INIS)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-01-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments

  20. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  1. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  2. Bone Anchored Hearing Aid

    Science.gov (United States)

    2002-01-01

    Executive Summary Objective The objective of this health technology policy assessment was to determine the effectiveness and cost-effectiveness of bone-anchored hearing aid (BAHA) in improving the hearing of people with conduction or mixed hearing loss. The Technology The (BAHA) is a bone conduction hearing device that includes a titanium fixture permanently implanted into the mastoid bone of the skull and an external percutaneous sound processor. The sound processor is attached to the fixture by means of a skin penetrating abutment. Because the device bypasses the middle ear and directly stimulates the cochlea, it has been recommended for individuals with conduction hearing loss or discharging middle ear infection. The titanium implant is expected to last a lifetime while the external sound processor is expected to last 5 years. The total initial device cost is approximately $5,300 and the external sound processor costs approximately $3,500. Review of BAHA by the Medical Advisory Secretariat The Medical Advisory Secretariat’s review is a descriptive synthesis of findings from 36 research articles published between January 1990 and May 2002. Summary of Findings No randomized controlled studies were found. The evidence was derived from level 4 case series with relative small sample sizes (ranging from 30-188). The majority of the studies have follow-up periods of eight years or longer. All except one study were based on monaural BAHA implant on the side with the best bone conduction threshold. Safety Level 4 evidence showed that BAHA has been be implanted safely in adults and children with success rates of 90% or higher in most studies. No mortality or life threatening morbidity has been reported. Revision rates for tissue reduction or resiting were generally under 10% for adults but have been reported to be as high as 25% in pediatric studies. Adverse skin reaction around the skin penetration site was the most common complication reported. Most of these

  3. The impact of coexisting sperm DNA fragmentation and seminal oxidative stress on the outcome of varicocelectomy in infertile patients: A prospective controlled study.

    Science.gov (United States)

    Abdelbaki, Shabieb A; Sabry, Jehan H; Al-Adl, Ahmed M; Sabry, Hanan H

    2017-06-01

    To study the relationship between sperm DNA fragmentation (SDF) and reactive oxygen species (ROS) levels in infertile patients with varicocele, and to examine the beneficial effect of varicocelectomy and elucidate predictors of improvement after repair. We prospectively studied 60 patients with varicocele and abnormal semen variables who attended the outpatient clinic complaining of infertility for ≥12 months. In all, 25 patients (41.7%) had bilateral varicoceles and 35 (58.3%) had left varicoceles. The DNA fragmentation index (DFI%, percentage of sperm with denatured nuclei), ROS and total non-enzymatic antioxidant capacity (TAC) were measured. Inguinal varicocelectomy was performed in all patients. At 3-6 months postoperatively, all measurements were repeated. A control group, comprised of 20 normozoospermic fertile men, was included. Regression analysis was used to examine predictors of improvement. The mean (SD) DFI% in the 60 infertile patients with varicocele was 29.9 (8.3) and 7.56 (2.84)% in the controls; ROS levels were 4.49 (0.9) in patients and 2.62 (0.8) photons/min in controls; and the TAC was 0.97 (0.4) in patients and 1.5 (0.5) mM in controls; with highly significant differences between the patients and controls. The DFI% showed a positive correlation with ROS levels, whilst the total motile sperm count (TMSC) had a significant negative correlation with DFI%, ROS levels and grade of varicocele, whilst there was significant positive correlation with TAC. The grade of varicocele and duration of infertility were related to the presence of higher levels of ROS and increased of DFI%. Postoperatively, improvement (measured as a >50% increase in TMSC) occurred in 40 of 55 (73%) patients available at follow-up, with a significant reduction in the mean (SD) DFI% from 29.49 (8.58) to 18.78 (7.23)%, ROS levels from 4.49 (0.88) to 3.27 (1.3) photons/min (both P  < 0.001), and a significant increase in the mean (SD) TAC from 1.01 (0.44) to 2.05 (0.51)

  4. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  5. Identification of human papillomavirus type 156, the prototype of a new human gammapapillomavirus species, by a generic and highly sensitive PCR strategy for long DNA fragments.

    Science.gov (United States)

    Chouhy, Diego; Bolatti, Elisa M; Piccirilli, Gustavo; Sánchez, Adriana; Fernandez Bussy, Ramón; Giri, Adriana A

    2013-03-01

    This study developed a hanging-droplet long PCR, a generic and highly sensitive strategy to facilitate the identification of new human papillomavirus (HPV) genomes. This novel procedure used for the first time the hanging-droplet PCR technique for the amplification of long DNA fragments with generic primers targeting the L1 and E1 regions. It was first applied to the amplification of types belonging to the highly divergent genus Gammapapillovirus (γ-PV). The hanging-droplet long PCR was 100-fold more sensitive than a simple long PCR procedure, detecting as few as ten copies of HPV-4. Nineteen skin samples, potentially containing putative HPV types from the γ-PV genus, were also screened. The method identified four γ-PV genomic halves from new and previously described putative types, and made the full characterization of HPV-156 possible. This novel virus meets the criteria for a new species within the γ-PV genus, with nucleotide identities in the L1 ORF ranging from 58.3 to 67.3 % compared with representative types of the current γ-PV species. HPV-156 showed the highest identity to HPV-60 (67.3 %) from species γ-4, and was consistently closely related to it in both late- and early-gene-derived phylogenies. In conclusion, this report provides a versatile and highly sensitive approach that allowed identification of the prototype of a new species within the γ-PV genus. Its application with primers targeting the different genera in which both human and non-human PVs are distributed may facilitate characterization of the missing members of the family Papillomaviridae.

  6. Simulation study of natural UV-B radiation on Catla catla and its impact on physiology, oxidative stress, Hsp 70 and DNA fragmentation.

    Science.gov (United States)

    Singh, Moirangthem Kameshwor; Sharma, Jai Gopal; Chakrabarti, Rina

    2015-08-01

    UV-B radiation is a potential stressor to the aquacultural species. Catla catla, catla larvae (1.08±0.065g) were exposed to different doses of UV-B radiation, 0 (control), 504, 1008, 1512 and 2016mJ/cm(2) at a mean radiant energy of 80μW/cm(2) for 21days. The dose of UV-B radiation was selected on the basis of the field study conducted in Lake Naini, Delhi, India (Latitude: 28°41'26″N and Longitude: 77°12″37″E). Significantly (PUV-B irradiated larvae compared to the control one. Food conversion ratio was 1.5-4-fold higher in UV-B treated larvae compared to the control one. The carbonyl protein (CP), thiobarbituric acid reactive substances (TBARS), superoxide dismutase (SOD) levels were significantly (P UV-B irradiated larvae compared to the control group. Among the treated larvae, CP and SOD were significantly (P UV-B. A correlation was found between the CP and SOD (R(2)=0.834). Highest TBARS level was found in 2016mJ/cm(2) UV-B exposed catla. Nitric oxide synthase level was significantly (P UV-B exposed larvae compared to the control one. A 3-fold increased Hsp 70 level was recorded in UV-B irradiated catla compared to the control larvae. Comet assay analysis indicated that UV-B irradiation enhanced DNA fragmentation. Tail extent moment and the olive tail moment were significantly (P UV-B exposed catla compared to others. The tail length was significantly (P UV-B exposed larvae compared to the other doses. The present study suggests that the catla is a useful species for the biomonitoring of stress in the aquatic environment. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Science.gov (United States)

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  9. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  10. A generalized method of subcloning DNA fragments by restriction site reconstruction: application to sequencing the amino-terminal coding region of the transforming gene of Gazdar murine sarcoma virus.

    Science.gov (United States)

    Donoghue, D J; Hunter, T

    1982-01-01

    The technique of restriction site reconstruction was generalized so as to allow the subcloning of any DNA fragment and its subsequent reexcision with EcoRI, XbaI, XhoI or HindIII. After excision, the 3' terminus of each strand will be derived from the starting nucleic acid, permitting the use of such fragments as primers for nucleotide sequencing by primer extension methods. The technique was used to subclone a 56 base pair BstNI-DdeI fragment of Moloney murine sarcoma virus (Mo-MSV) as a unique HindIII-HindIII fragment. This fragment then served as a primer to sequence a portion of the RNA genome of Gazdar murine sarcoma virus (Gz-MSV). The nucleotide sequence which was obtained indicated that the transforming gene of Gz-MSV arose by at least two recombination events involving murine leukemia virus (MLV) and the cellular homologue c-mos. This analysis suggests that a virus indistinguishable from Mo-MSV was an intermediate in the formation of Gz-MSV. Images PMID:6281735

  11. The Holding Power of Anchors

    Indian Academy of Sciences (India)

    as the chain begins to drag along the ground; and it also serves, by lying flat on the ground, to keep the palm set at the correct angle as it buries itself. In stockless anchors there are two digging blades set on opposite sides of the shank, and hinged to it by a horizontal hinge which allows them to set themselves at the correct.

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  13. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  14. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  15. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  16. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  17. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  18. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    ‘Engaging Through Architecture’ in 2015 by Aarhus School of Architecture as a part of the Ventura Lambrate Milan Design Week, where it was exhibited under the name Concrete. The fundamental pool of techniques and knowledge that set the agenda for the fragment was established before the intentions...

  19. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    to create architectural meaning and give character to an architecture of fragmentation. Layers are both seen as conceptual as well as material frames which define certain strong properties or meanings in the architectural work. Defining layers is a way of separating and organizing; it both defines...

  20. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  1. Nominal Anchors in the CIS

    OpenAIRE

    Peter M Keller; Thomas J Richardson

    2003-01-01

    Monetary policy has become increasingly important in the countries of the Commonwealth of Independent States (CIS) as fiscal adjustment and structural reforms have taken root. Inflation has been brought down to relatively low levels in almost all of these countries, raising the question of what should be the appropriate nominal anchor at this stage. Formally, almost all CIS countries have floating exchange rate regimes, yet in practice they manage their exchange rates very heavily, perhaps be...

  2. [Bone-anchored auricular prosthesis].

    Science.gov (United States)

    Bille, M; Homøe, P; Vesterhauge, S; Rixen, M; Bretlau, P

    1994-10-03

    During the period February 1989-September 1991, 15 patients with absent or defective pinna were treated with a bone-anchored auricular prosthesis at the ENT-department, Rigshospitalet, Copenhagen. These patients were followed up from the hospital records and by means of a questionnaire. Altogether 40 titanium implants have been inserted, of which one implant was found not to be integrated at the time of the second-stage surgery. Five patients underwent additional surgery, one patient because of non-integration of a screw, and four patients on account of soft-tissue reactions. From the questionnaire replies it appears that all patients found the cosmetic result and the technique concerning mounting of the prosthesis very satisfactory. Nearly half the patients found that the care of the skin around the abutments caused considerable problems. Three patients had experienced unintended losses of the prosthesis. In conclusion, treatment with a bone anchored auricular prosthesis has considerable advantages compared to treatment with a prosthesis attached by adhesive. Furthermore the use of a bone-anchored prosthesis should be considered a viable alternative to surgical reconstruction because of the outstanding aesthetic result and because the surgical procedure puts less strain on the patient. The disadvantage of the method is the lifelong daily care of the skin and the dependence on the health services.

  3. Genetic investigations in immigration cases and frequencies of DNA fragments of the VNTR systems D2S44, D5S43, D7S21, D7S22, and D12S11 in Turks

    DEFF Research Database (Denmark)

    Hansen, Hanna Elsebeth; Morling, N

    1993-01-01

    We have included investigations of the DNA polymorphism of variable numbers of tandem repeat (VNTR) regions with restriction fragment length polymorphism (RFLP) in the genetic evaluations in immigrant cases. HinfI-digested DNA was separated by electrophoresis in agarose gels and hybridized...... with radiolabelled probes detecting the VNTR systems D2S44 (YNH24), D5S43 (MS8), D7S21 (MS31), D7S22 (g3), and D12S11 (MS43a). We used the matching criterion for paternity testing for the parent/child comparisons, i.e. non-match if the intra gel difference exceeded 1.25 mm. A total of 43 immigration cases involving...... putative father/child pairs. In a putative father/child combination with non-exclusion in 18 genetic systems, a single genetic inconsistency ('exclusion') in D7S21 (MS31) was observed. The frequency distributions of HinfI digested DNA fragments of the five VNTR systems in 105 Turks are presented....

  4. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    or from a position as business leader to a position in the state apparatus or in the Party and vice versa. To conceptualize the coexistence of the contradicting forces for further enterprise autonomy and continued central control that characterizes the evolving relationship between business groups...... and the Party-state, I suggest the notion of integrated fragmentation....

  5. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...... the development of lupus nephritis at an early stage....

  6. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  7. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  8. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    the photographs as a starting point for a series of paintings. This way of creating representations of something that already exists is for me to see a way forward in the "decoding" of my own models into other depictions. The models are analyzed through a series of representations in different types of drawings....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...

  9. [Enrichment of extracellular DNA from the cultivation medium of human peripheral blood mononuclears with genomic CpG rich fragments results in increased cell production of IL-6 and TNF-a via activation of the NF-kB signaling pathway].

    Science.gov (United States)

    Speranskii, A I; Kostyuk, S V; Kalashnikova, E A; Veiko, N N

    2016-03-01

    Previously, it was found that blood plasma extracellular DNA (ecDNA) of patients with rheumatoid arthritis (RA) is enriched with CpG-rich genomic DNA fragments, which contain TLR9 ligands (Veiko et al., 2006). In this study we have demonstrated that ecDNA of a RA patient and model fragments added to a cultivation medium of peripheral blood mononuclear cells (PBMC) of healthy donors stimulate expression of genes for the TLR9-MyD88-NF-kB signaling pathway; this leads to a significant increase in concentrations of the proinflammatory cytokines IL-6 and TNF-a in the cultivation medium. Human genomic DNA non-enriched with the CpG sequences did not stimulate IL-6 and TNF-a synthesis in PBMC. A scheme explaining the potential role ecDNA in the induction and maintenance of increased levels of the proinflammatory cytokines under conditions damaging the human cells has been proposed.

  10. [Treatment of calcaneal avulsion fractures with twinfix suture anchors fixation].

    Science.gov (United States)

    Zhao, Bin-xiu; Wang, Kun-zheng; Wang, Chun-sheng; Xie, Yue; Dai, Zhi-tang; Liu, Gang; Liu, Wei-dong

    2011-06-01

    For the calcaneal avulsion fracture, the current method is more commonly used screws or Kirschner wire to fix fracture fragment. This article intended to explore the feasibility and clinical efficacy for the treatment of avulsion fractures with TwinFix suture anchors. From July 2007 to November 2010, 21 patients were reviewed, including 15 males and 6 females, ranging in age from 49 to 65 years,with a mean of 58.7 years. Twelve patients had nodules in the right heel and 9 patients had nodules in the left heel. All the patients had closed fractures. The typical preoperative symptoms of the patients included pain in the upper heel and weak in heel lift. Body examination results: palpable sense of bone rubbing in the back of the heel, and swelling in the heel. Surgery treatment with TwinFix suture anchors performed as follows : to fix TwinFix suture anchors into the calcaneal body, then to drill the fracture block, to make the double strand suture through the fracture holes, to knot the suture eachother to fix the block, and to use stitch to fix the remaining suture in the Achilles tendon in order to improve the block fixation. The criteria of the AOFAS Foot and Ankle Surgery by the United States Association of ankle-rear foot functional recovery was used to evaluate the Achilles tendon. Total average score was (95.5 +/- 3.12) points, including pain items of(38.5 +/- 2.18) points,the average score of functional items of (49.5 +/- 3.09) points,and power lines of 10 points in all patients. Twenty-one patients got an excellent result, 16 good and 5 poor. The methods of treatment for the calcaneal avulsion fractures with TwinFix suture anchors is a simple operation, and have excellent clinical effect, which is worthy of promotion.

  11. Assessment of nucleic acid modification induced by amotosalen and ultraviolet A light treatment of platelets and plasma using real-time polymerase chain reaction amplification of variable length fragments of mitochondrial DNA.

    Science.gov (United States)

    Bakkour, Sonia; Chafets, Daniel M; Wen, Li; Dupuis, Kent; Castro, Grace; Green, Jennifer M; Stassinopoulos, Adonis; Busch, Michael P; Lee, Tzong-Hae

    2016-02-01

    Pathogen inactivation methods are increasingly used to reduce the risk of infections after transfusion of blood products. Photochemical treatment (PCT) of platelets (PLTs) and plasma with amotosalen and ultraviolet A (UVA) light inactivates pathogens and white blood cells through formation of adducts between amotosalen and nucleic acid that block replication, transcription, and translation. The same adducts block the amplification of nucleic acids using polymerase chain reaction (PCR) in a manner that correlates with the number of adducts formed, providing a direct quality control (QC). Current QC measures for PCT rely on indirect methods that measure the delivered UVA dose or percent residual amotosalen after illumination, rather than directly measuring nucleic acid modification. Endogenous mitochondrial DNA (mtDNA), which is detectable in PLT and plasma units, was chosen as a target for the quantification of photochemically induced modifications. DNA was extracted from untreated or amotosalen and UVA-treated PLTs or plasma, and mtDNA fragments of variable lengths were quantified using a real-time PCR inhibition assay. PCT induced increasing real-time PCR inhibition of mtDNA amplification for larger amplicon sizes. Amplification was unaffected by treatment with amotosalen or UVA alone, whereas up to 3 log inhibition was observed after PCT. Blinded PCR testing of a panel of 110 samples each, from PLT or plasma components prepared for routine use within a blood center, allowed 100% discrimination between untreated and treated units. Our initial findings indicate that an adequately sensitive, quantitative real-time PCR inhibition assay targeting mtDNA could provide a valuable tool to confirm and monitor PCT. © 2015 The Authors. Transfusion published by Wiley Periodicals, Inc. on behalf of AABB.

  12. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  14. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  15. Suction anchors for floating production systems

    Energy Technology Data Exchange (ETDEWEB)

    Tjelta, T.I.; Rusas, P. [Statoil a.s. (Norway); Edvardsen, G. [HEX a.s. (Norway)

    1996-12-31

    Since the suction anchor is a recent development in its current use, this work provides a brief historical background. It is shown that the suction anchor throughout evolution today is a competitive foundation solution for many applications. Examples from these categories are included in this paper. Also several installation methods are discussed. 3 refs., 7 figs., 2 tabs.

  16. Anchors of Religious Commitment in Adolescents

    Science.gov (United States)

    Layton, Emily; Dollahite, David C.; Hardy, Sam A.

    2011-01-01

    This study explores adolescent religious commitment using qualitative data from a religiously diverse (Jewish, Christian, Muslim) sample of 80 adolescents. A new construct, "anchors of religious commitment," grounded in interview data, is proposed to describe what adolescents commit to as a part of their religious identity. Seven anchors of…

  17. 21 CFR 872.3130 - Preformed anchor.

    Science.gov (United States)

    2010-04-01

    ... DEVICES DENTAL DEVICES Prosthetic Devices § 872.3130 Preformed anchor. (a) Identification. A preformed anchor is a device made of austenitic alloys or alloys containing 75 percent or greater gold or metals of the platinum group intended to be incorporated into a dental appliance, such as a denture, to help...

  18. Fragmented Authoritarianism or Integrated Fragmentation

    DEFF Research Database (Denmark)

    Brødsgaard, Kjeld Erik

    proved their influence by obstructing the creation of new ministries and regulatory commissions that would limit their powers. The heads of these business groups often outrank their counterparts in state administrative organs and bureaus that are supposed to regulate their activities. The increased role...... of these business leaders prompts the question of whether we are seeing the development of distinct interest groups that could challenge Party and state authority and create a fragmented polity. However, through the nomenklatura system the Party has an important instrument of control to wield over business groups....... Through this system the Party controls the appointment and promotion of the heads of the most important state-owned enterprises. The nomenklatura system also enables the Party to rotate leaders in big business from a position as CEO in one company to a similar position in another state-owned company...

  19. The potential of platinum-DNA adduct determination in ex vivo treated tumor fragments for the prediction of sensitivity to cisplatin chemotherapy

    NARCIS (Netherlands)

    Welters, M.J.P.; Braakhuis, B.J.M.; Jacobs-Bergmans, A.J.; Kegel, A.; Baan, R.A.; Vijgh, W.J.F. van der; Fichtinger-Schepman, A.M.J.

    1999-01-01

    Background: Response to cisplatin-therapy is assumed to be related to the formation of platinum (Pt)-DNA adducts. Measurement of these adducts prior to therapy could be of value to improve cisplatin based cancer therapy. Materials and methods: We determined Pt-GG and Pt-AG adduct levels by use of

  20. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  1. Analysis of endophytic bacterial communities of potato by plating and denaturing gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments

    NARCIS (Netherlands)

    Garbeva, P.; Overbeek, van L.S.; Vuurde, van J.W.L.; Elsas, van J.D.

    2001-01-01

    The diversity of endophytic bacterial populations of potato (Solanum tuberosum cv Desiree) was assessed using a combination of dilution plating of plant macerates followed by isolation and characterization of isolates, and direct PCR-DGGE on the basis of DNA extracted from plants. The culturable

  2. Method to Assemble Genomic DNA Fragments or Genes on Human Artificial Chromosome with Regulated Kinetochore Using a Multi-Integrase System.

    Science.gov (United States)

    Lee, Nicholas C O; Kim, Jung-Hyun; Petrov, Nikolai S; Lee, Hee-Sheung; Masumoto, Hiroshi; Earnshaw, William C; Larionov, Vladimir; Kouprina, Natalay

    2018-01-19

    The production of cells capable of carrying multiple transgenes to Mb-size genomic loci has multiple applications in biomedicine and biotechnology. In order to achieve this goal, three key steps are required: (i) cloning of large genomic segments; (ii) insertion of multiple DNA blocks at a precise location and (iii) the capability to eliminate the assembled region from cells. In this study, we designed the iterative integration system (IIS) that utilizes recombinases Cre, ΦC31 and ΦBT1, and combined it with a human artificial chromosome (HAC) possessing a regulated kinetochore (alphoid tetO -HAC). We have demonstrated that the IIS-alphoid tetO -HAC system is a valuable genetic tool by reassembling a functional gene from multiple segments on the HAC. IIS-alphoid tetO -HAC has several notable advantages over other artificial chromosome-based systems. This includes the potential to assemble an unlimited number of genomic DNA segments; a DNA assembly process that leaves only a small insertion (system that also changes cell color, and counter-selection markers at each DNA insertion step, simplifying selection of correct clones; and presence of an error proofing mechanism to remove cells with misincorporated DNA segments, which improves the integrity of assembly. In addition, the IIS-alphoid tetO -HAC carrying a locus of interest is removable, offering the unique possibility to revert the cell line to its pretransformed state and compare the phenotypes of human cells with and without a functional copy of a gene(s). Thus, IIS-alphoid tetO -HAC allows investigation of complex biomedical pathways, gene(s) regulation, and has the potential to engineer synthetic chromosomes with a predetermined set of genes.

  3. Development of PCR primers based on a fragment from randomly amplified polymorphic DNA for the detection of Escherichia coli O157:H7/NM.

    Science.gov (United States)

    Lin, Chien-Ku; Lin, Jia-Chi

    2007-06-01

    Serotype O157:H7 of EHEC is by far the most prevalent serotype associated with haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS). Although PCR methods aimed on the detection of genes associated with the pathogenicity of Escherichia coli O157:H7 have been reported, tests allowing the direct identification of this serotype are rare. In this study, we used RAPD-PCR tests to analyze strains of E. coli O157:H7 serotype, strains of non-pathogenic E. coli, and strains of other pathotypes, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), and enteroaggregation E. coli (EAggEC). One RAPD fragment co-shared by serotype O157:H7 strains was observed when 10-mer primer termed as OPQ3 was used. After sequencing this fragment, three primers were designed and combined to form two PCR primer pairs. These two primer pairs were highly specific to the strains belonging to E. coli O157:H7/NM (non-motile).

  4. Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.

    Science.gov (United States)

    Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

    1993-02-01

    Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM.

  5. A mouse variable gene fragment binds to DNA independently of the BCR context: a possible role for immature B-cell repertoire establishment.

    Directory of Open Access Journals (Sweden)

    Andrea Queiroz Maranhão

    Full Text Available B-cell maturation occurs in several steps and requires constant stimulus for its continuing development. From the emergence of the pre-B-cell receptor, signal transduction stimulates and supports B-cell development. Current viewpoints indicate that both positive selection pressure for autoantigens and tonic signaling constitutively stimulate B-cell maturation. In this work, we tested for the presence of a putative DNA binding site in a variable gene segment in a germline configuration, independently of VDJ recombination. After a survey of the public antibody databases, we chose a single mouse heavy variable gene segment that is highly represented in anti-nucleic acid antibodies and tested it for ssDNA binding. A phage display approach was used to search for intrinsic binding to oligo deoxythymidine. The results revealed that binding to an antigen can be influenced by the use of a specific DNA binding V[Formula: see text] gene segment. Our data support the idea that some variable genes have intrinsic reactivity towards specific types of endogenous autoantigens, and this property may contribute to the establishment of the immature B-cell repertoire.

  6. An Intrabody Drug (rAAV6-INT41 Reduces the Binding of N-Terminal Huntingtin Fragment(s to DNA to Basal Levels in PC12 Cells and Delays Cognitive Loss in the R6/2 Animal Model

    Directory of Open Access Journals (Sweden)

    I. Alexandra Amaro

    2016-01-01

    Full Text Available Huntington’s disease (HD is a fatal progressive disease linked to expansion of glutamine repeats in the huntingtin protein and characterized by the progressive loss of cognitive and motor function. We show that expression of a mutant human huntingtin exon-1-GFP fusion construct results in nonspecific gene dysregulation that is significantly reduced by 50% due to coexpression of INT41, an intrabody specific for the proline-rich region of the huntingtin protein. Using stable PC12 cell lines expressing either inducible human mutant huntingtin (mHtt, Q73 or normal huntingtin (nHtt, Q23, we investigated the effect of rAAV6-INT41, an adeno-associated virus vector with the INT41 coding sequence, on the subcellular distribution of Htt. Compartmental fractionation 8 days after induction of Htt showed a 6-fold increased association of a dominate N-terminal mHtt fragment with DNA compared to N-terminal nHtt. Transduction with rAAV6-INT41 reduced DNA binding of N-terminal mHtt 6.5-fold in the nucleus and reduced nuclear translocation of the detected fragments. Subsequently, when rAAV6-INT41 is delivered to the striatum in the R6/2 mouse model, treated female mice exhibited executive function statistically indistinguishable from wild type, accompanied by reductions in Htt aggregates in the striatum, suggesting that rAAV6-INT41 is promising as a gene therapy for Huntington’s disease.

  7. Binary and ternary binding affinities between exonuclease-deficient Klenow fragment (Kf-exo(-)) and various arylamine DNA lesions characterized by surface plasmon resonance.

    Science.gov (United States)

    Vaidyanathan, V G; Xu, Lifang; Cho, Bongsup P

    2012-08-20

    We used surface plasmon resonance (SPR) to characterize the binding interactions between the exonulease-free Klenow fragment (Kf-exo(-)) and unmodified and modified dG adducts derived from arylamine carcinogens: fluorinated 2-aminofluorene (FAF), 2-acetylaminofluorene (FAAF), and 4-aminobiphenyl (FABP). Tight polymerase binding was detected with unmodified dG and the correct dCTP. The discrimination of correct versus incorrect nucleotides was pronounced with K(D) values in the order of dCTP ≪ dTTP Kf-exo(-) binding tighter to the FAAF (k(off): 0.02 s(-1)) and FABP (k(off): 0.01 s(-1)) lesions than to FAF (k(off): 0.04 s(-1)).

  8. Evidence of impurities in thiolated single-stranded DNA oligomers and their effect on DNA self-assembly on gold.

    Science.gov (United States)

    Lee, Chi-Ying; Canavan, Heather E; Gamble, Lara J; Castner, David G

    2005-05-24

    The diversity of techniques used in the synthesis, treatment, and purification of the single-stranded DNA oligomers containing a thiol anchor group (SH-ssDNA) has led to a significant variation in the purity of commercially available SH-ssDNA. In this work, we use X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) to study how the impurities present in commercially synthesized SH-ssDNA oligomers affected the structure of the resulting DNA films on Au. XPS results indicate that two of the purchased SH-ssDNA oligomers contain excess carbon and sulfur. The molecular fragmentation patterns obtained with ToF-SIMS were used to determine the identity of several contaminants in the DNA films, including poly(dimethylsiloxane) (PDMS), lipid molecules, and sulfur-containing molecules. In particular, the ToF-SIMS results determined that the excess sulfur detected by XPS was due to the presence of dithiothreitol, a reductant often used to cleave disulfide precursors. Furthermore, we found that the SH-ssDNA self-assembly process is affected by the presence of these contaminants. When relatively pure SH-ssDNA is used to prepare the DNA films, the P, N, O, and C atomic percentages were observed by XPS to increase over a 24-h time period. In contrast, surfaces prepared using SH-ssDNA containing higher levels of contaminants did not follow this trend. XPS result indicates that, after the initial SH-ssDNA adsorption, the remaining material incorporated into these films was due to contamination.

  9. RAPD Profiling, DNA Fragmentation, and Histomorphometric Examination in Brains of Wistar Rats Exposed to Indoor 2.5 Ghz Wi-Fi Devices Radiation.

    Science.gov (United States)

    Ibitayo, A O; Afolabi, O B; Akinyemi, A J; Ojiezeh, T I; Adekoya, K O; Ojewunmi, O O

    2017-01-01

    The advent of Wi-Fi connected high technology devices in executing day-to-day activities is fast evolving especially in developing countries of the world and hence the need to assess its safety among others. The present study was conducted to investigate the injurious effect of radiofrequency emissions from installed Wi-Fi devices in brains of young male rats. Animals were divided into four equal groups; group 1 served as control while groups 2, 3, and 4 were exposed to 2.5 Ghz at intervals of 30, 45, and 60 consecutive days with free access to food and water ad libitum. Alterations in harvested brain tissues were confirmed by histopathological analyses which showed vascular congestion and DNA damage in the brain was assayed using agarose gel electrophoresis. Histomorphometry analyses of their brain tissues showed perivascular congestion and tissue damage as well.

  10. Anchoring effects on early autobiographical memories.

    Science.gov (United States)

    Greenberg, Daniel L; Bishara, Anthony J; Mugayar-Baldocchi, Marino A

    2017-10-01

    Studies of childhood memory typically show that our earliest memories come from between three and four years of age. This finding is not universal, however. The age estimate varies across cultures and is affected by social influences. Research from the judgments and decision-making literature suggests that these estimates might also involve a judgment under uncertainty. Therefore, they might be susceptible to less social influences such as heuristics and biases. To investigate this possibility, we conducted two experiments that used anchoring paradigms to influence participants' estimates of their age during early autobiographical memories. In Experiment 1, participants answered either a high-anchor or a low-anchor question, and were warned that the anchor was uninformative; they went on to estimate their age during their earliest autobiographical memory. In Experiment 2, we replicated Experiment 1 and extended the design to examine additional early autobiographical memories. In both experiments, participants in the low-anchor condition gave earlier age estimates than those in the high-anchor condition. These results provide new insights into the methods used to investigate autobiographical memory. Moreover, they show that reports of early autobiographical memories can be influenced by a relatively light touch - a change to a single digit in a single question.

  11. The Use of Comics-Based Cases in Anchored Instruction

    Science.gov (United States)

    Kneller, Matthew F.

    2009-01-01

    The primary purpose of this research was to understand how comics fulfill the role of anchor in an anchored instruction learning environment. Anchored instruction addresses the inert knowledge problem through the use of realistic multimedia stories, or "anchors," that embed a problem and the necessary data to solve it within the narrative. In the…

  12. Theoretical performance of non-invasive prenatal testing for chromosome imbalances using counting of cell-free DNA fragments in maternal plasma.

    Science.gov (United States)

    Benn, Peter; Cuckle, Howard

    2014-08-01

    The aim of this study was to calculate the theoretical performance of non-invasive prenatal testing based on counting methods. The calculations were based on Gaussian distributions of the percent cell-free DNA from selected chromosome regions in affected and normal pregnancies. The means were derived from the relative genomic size of the chromosome region and the fetal fraction. The standard deviations were derived from the bivariate distributions of proportional counts. Depth of sequencing was varied from 50,000,000 to 100,000 and fetal fraction from 20% to 3%. Detection rate was estimated for a fixed 0.13% false-positive rate. When either depth or fetal fraction is high, expected Down syndrome screening detection rates are high. However, when fetal fraction is low, deeper sequencing is required to obtain high detection rates. For microdeletion and microduplication screening, deeper sequencing is routinely required to consistently achieve high detection rates. There are small differences in the ability to detect a microdeletion compared with a duplication of the same size. While the theoretical calculations do not necessarily reflect the performance of currently available non-invasive prenatal testing tests, it confirms that fetal fraction is a key factor. Efficacy can be substantially altered depending on the abnormality under investigation and the depth of sequencing. © 2014 John Wiley & Sons, Ltd.

  13. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

    Science.gov (United States)

    Li, Lin-Feng; Häkkinen, Markku; Yuan, Yong-Ming; Hao, Gang; Ge, Xue-Jun

    2010-10-01

    Musaceae is a small paleotropical family. Three genera have been recognised within this family although the generic delimitations remain controversial. Most species of the family (around 65 species) have been placed under the genus Musa and its infrageneric classification has long been disputed. In this study, we obtained nuclear ribosomal ITS and chloroplast (atpB-rbcL, rps16, and trnL-F) DNA sequences of 36 species (42 accessions of ingroups representing three genera) together with 10 accessions of ingroups retrieved from GenBank database and 4 accessions of outgroups, to construct the phylogeny of the family, with a special reference to the infrageneric classification of the genus Musa. Our phylogenetic analyses elaborated previous results in supporting the monophyly of the family and suggested that Musella and Ensete may be congeneric or at least closely related, but refuted the previous infrageneric classification of Musa. None of the five sections of Musa previously defined based on morphology was recovered as monophyletic group in the molecular phylogeny. Two infrageneric clades were identified, which corresponded well to the basic chromosome numbers of x=11 and 10/9/7, respectively: the former clade comprises species from the sections Musa and Rhodochlamys while the latter contains sections of Callimusa, Australimusa, and Ingentimusa. Copyright 2010 Elsevier Inc. All rights reserved.

  14. Diphtheria toxin- and Pseudomonas A toxin-mediated apoptosis. ADP ribosylation of elongation factor-2 is required for DNA fragmentation and cell lysis and synergy with tumor necrosis factor-alpha.

    Science.gov (United States)

    Morimoto, H; Bonavida, B

    1992-09-15

    We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings

  15. A tail-anchored myotonic dystrophy protein kinase isoform induces perinuclear clustering of mitochondria, autophagy, and apoptosis.

    Directory of Open Access Journals (Sweden)

    Ralph J A Oude Ophuis

    Full Text Available BACKGROUND: Studies on the myotonic dystrophy protein kinase (DMPK gene and gene products have thus far mainly concentrated on the fate of length mutation in the (CTGn repeat at the DNA level and consequences of repeat expansion at the RNA level in DM1 patients and disease models. Surprisingly little is known about the function of DMPK protein products. METHODOLOGY/PRINCIPAL FINDINGS: We demonstrate here that transient expression of one major protein product of the human gene, the hDMPK A isoform with a long tail anchor, results in mitochondrial fragmentation and clustering in the perinuclear region. Clustering occurred in a variety of cell types and was enhanced by an intact tubulin cytoskeleton. In addition to morphomechanical changes, hDMPK A expression induces physiological changes like loss of mitochondrial membrane potential, increased autophagy activity, and leakage of cytochrome c from the mitochondrial intermembrane space accompanied by apoptosis. Truncation analysis using YFP-hDMPK A fusion constructs revealed that the protein's tail domain was necessary and sufficient to evoke mitochondrial clustering behavior. CONCLUSION/SIGNIFICANCE: Our data suggest that the expression level of the DMPK A isoform needs to be tightly controlled in cells where the hDMPK gene is expressed. We speculate that aberrant splice isoform expression might be a codetermining factor in manifestation of specific DM1 features in patients.

  16. Career anchors and learning plan (part one

    Directory of Open Access Journals (Sweden)

    Daniela Brečko

    2006-12-01

    Full Text Available The article is divided into three parts. The first part concentrates on how important career is for an individual, organization and society. The author establishes that understanding of career has changed dramatically and does not only refer to climbing up the career ladder, but also moving off or even down the career ladder. The notion of career, as a lifelong and professional path, encompasses all aspects of human personality and their roles acquired through one's life. On basis of vast and longitudinal research, where the author has studied career anchors of individuals, it is the objective of the author to find out on basis of what grounds do the individuals decide to take certain directions in their careers and how learning contributes to such decisions. As a source the author has used Shein's theory of career anchors. Part one describes in greater detail 8 different career anchors and introduces their main features with the findings of the research, which refer to the analysis of professions (work positions and established career anchors. The author thus verifies the hypothesis that career anchors do exist in our area.

  17. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  18. Ultimate load capacities of expansion anchor bolts

    International Nuclear Information System (INIS)

    Czarnecki, R.M.; Manrique, M.A.; Samaddar, S.K.

    1993-01-01

    A summary of available experimental expansion anchor bolt test data is presented. These data were collected as part of programs by the nuclear industry to address generic issues related to verification of seismic adequacy of equipment in nuclear power plants. Some of the data presented are suitable for use in seismic probabilistic risk assessments. For example, mean values of ultimate strength, along with their standard deviation and coefficients of variation, for a range of most typical expansion anchor bolt sizes are presented. Effects of interaction between shear and tension, edge distance, spacing, and cracking of the concrete are presented in a manner that is more suitable for use in deterministic evaluations. Related industry programs to derive anchor bolt capacities are briefly discussed. Recommendations for areas of further investigation are also presented

  19. SNP discovery and chromosome anchoring provide the first physically-anchored hexaploid oat map and reveal synteny with model species.

    Directory of Open Access Journals (Sweden)

    Rebekah E Oliver

    Full Text Available A physically anchored consensus map is foundational to modern genomics research; however, construction of such a map in oat (Avena sativa L., 2n = 6x = 42 has been hindered by the size and complexity of the genome, the scarcity of robust molecular markers, and the lack of aneuploid stocks. Resources developed in this study include a modified SNP discovery method for complex genomes, a diverse set of oat SNP markers, and a novel chromosome-deficient SNP anchoring strategy. These resources were applied to build the first complete, physically-anchored consensus map of hexaploid oat. Approximately 11,000 high-confidence in silico SNPs were discovered based on nine million inter-varietal sequence reads of genomic and cDNA origin. GoldenGate genotyping of 3,072 SNP assays yielded 1,311 robust markers, of which 985 were mapped in 390 recombinant-inbred lines from six bi-parental mapping populations ranging in size from 49 to 97 progeny. The consensus map included 985 SNPs and 68 previously-published markers, resolving 21 linkage groups with a total map distance of 1,838.8 cM. Consensus linkage groups were assigned to 21 chromosomes using SNP deletion analysis of chromosome-deficient monosomic hybrid stocks. Alignments with sequenced genomes of rice and Brachypodium provide evidence for extensive conservation of genomic regions, and renewed encouragement for orthology-based genomic discovery in this important hexaploid species. These results also provide a framework for high-resolution genetic analysis in oat, and a model for marker development and map construction in other species with complex genomes and limited resources.

  20. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  1. Distribution of two DNA restriction fragment length polymorphisms (RFLPs) corresponding to Ag(c/g) and Ag(al/d) of the apo B gene in the Orang Asli (aborigines) of West Malaysia

    Energy Technology Data Exchange (ETDEWEB)

    Candlish, J.K.; Gajra, B; Saha, N. [National Univ. of Singapore, Kuala Lumpur (Malaysia)] [and others

    1994-09-01

    One hundred and ninety five subjects of the Semai group of Orang Asli in peninsular Malaysia were examined for the distribution of Ag(c/g) and Ag(al/d) RFLPs of the apoB gene. Regions of apoB gene corresponding to nt 421 and 1981 representing these two Ags were amplified by polymerase chain reaction using primers of published sequences. Thr{sub 71} to Ile (Ag c/g) was detected as an ApaL I RFLP and Val{sub 591} to Ala (Ag al/d) by Alu I RFLP. DNA fragments were separated by 4% agarose gel electrophoresis and photographed over a UV transilluminator. The frequencies of Ag(d) (absence of ApaL I site) and Ag(d) (presence of Alu I site) were found to be 0.13 and 0.14, respectively, in the Orang Asli compared to frequencies of 0.30 and 0.45 in the Caucasian population. Distribution of the genotypes of these two polymorphisms was at Hardy-Weinberg equiilibrium.

  2. Rapid expression cloning of human immunoglobulin Fab fragments for the analysis of antigen specificity of B cell lymphomas and anti-idiotype lymphoma vaccination.

    Science.gov (United States)

    Osterroth, F; Alkan, O; Mackensen, A; Lindemann, A; Fisch, P; Skerra, A; Veelken, H

    1999-10-29

    An expression system for rapid and standardized production of human recombinant immunoglobulin Fab fragments in E. coli was developed. Functional folding of the Fab fragments was accomplished by the dicistronic expression vector pFab.gammakappa containing specialized leader sequences to direct the immunoglobulin heavy and light chains to the periplasmic bacterial space. A C-terminal hexahistidine tag of the Fd chain facilitated metal affinity chromatography and purification to homogeneity as assessed by SDS PAGE and silver staining. Specific antigen recognition by a hybridoma-derived Fab fragment was indistinguishable from that of the corresponding monoclonal antibody. This protocol may be useful for analysis of the antigen specificity of human B cells and for convenient production of lymphoma-derived idiotype protein for vaccination strategies. To obtain unmodified immunoglobulin cDNA sequences from small human biopsies for insertion into pFab.gammakappa, oligo(dG)-tailed cDNA was amplified with an oligo(dC)- and nested mu or kappa constant region-specific primers. Using single sets of primers for each class of immunoglobulin transcripts, the products of this anchored PCR reflected the relative abundance of the starting cell population and permitted reliable identification of clonal, lymphoma-derived sequences for subsequent expression cloning.

  3. Progressing single biomolecule force spectroscopy measurements for the screening of DNA binding agents

    Science.gov (United States)

    Zhang, Wenke; Barbagallo, Romina; Madden, Claire; Roberts, Clive J.; Woolford, Alison; Allen, Stephanie

    2005-10-01

    Recent studies have indicated that the force-extension properties of single molecules of double stranded (ds) DNA are sensitive to the presence of small molecule DNA binding agents, and also to their mode of binding. These observations raise the possibility of using this approach as a highly sensitive tool for the screening of such agents. However, particularly for studies employing the atomic force microscope (AFM), several non-trivial barriers hinder the progress of this approach to the non-specialist arena and hence also the full realization of this possibility. In this paper, we therefore address a series of key reproducibility and metrological issues associated with this type of measurement. Specifically, we present an improved immobilization method that covalently anchors one end (5' end) of a dual labelled (5'-thiol, 3'-biotin) p53 DNA molecule onto a gold substrate via gold-thiol chemistry, whilst the biotinylated 3' end is available for 'pick-up' using a streptavidin modified AFM tip. We also show that co-surface immobilization of DNA with 6-mercapto-1-hexanol (MCH) can also lead to a further increase the measured contour length. We demonstrate the impact of these improved protocols through the observation of the cooperative transition plateau in a DNA fragment of approximately 118 bp, a significantly smaller fragment than previously investigated. The results of a comparative study of the effects of a model minor groove binder (Hoechst 33258) and an intercalating drug (proflavine), alone, as a mixture and under different buffer conditions, are also presented.

  4. Arthroscopic double-row suture anchor fixation of minimally displaced greater tuberosity fractures.

    Science.gov (United States)

    Ji, Jong-Hun; Kim, Weon-Yoo; Ra, Ki-Hang

    2007-10-01

    In cases of displaced greater tuberosity fractures, treatments by arthroscopic-assisted reduction and percutaneous screw fixation have been reported. However, in cases in which there is a comminuted fracture or a minimally displaced fracture combined with concomitant lesions such as rotator cuff tear or labral pathology, it is difficult to reduce the fracture and to treat other pathologies by use of a percutaneous screw. Recently, many surgeons have used the double-row repair method in rotator cuff repair, which provides a tendon-bone interface better suited for biologic healing and restoring normal anatomy. In accordance with this method, we used the arthroscopic technique of double-row suture anchor fixation for a minimally displaced greater tuberosity fracture without additional incision. Initially, debridement was performed on the fracture surface by use of a shaver, and the medial-row anchor was inserted through the anterior portal or the intact cuff. Two lateral-row anchors were inserted just anterior and posterior to the lower margin of the fractured fragment under C-arm guidance. The medial-row sutures and lateral-row sutures were then placed. Arthroscopic double-row suture anchor fixation of a displaced greater tuberosity fracture restores the original footprint of the rotator cuff and normal tendon-bone interface of the displaced greater tuberosity fracture.

  5. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  6. Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution

    Directory of Open Access Journals (Sweden)

    Tsung Fei Khang

    2016-02-01

    Full Text Available Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae species infecting two marine mugilid (Teleostei: Mugilidae fish hosts: Moolgarda buchanani (Bleeker and Liza subviridis (Valenciennes from Malaysia. Anchor shape and size data (n = 530 were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams’s Kmult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogenean anchor geometric morphometric data with morphological and phylogenetic data. Results. We discriminated 12 of the 13 Ligophorus species using anchor shape data. Significant phylogenetic signal was detected in anchor shape. Thus, we discovered new morphological characters based on anchor shaft shape, the length between the inner root point and the

  7. Monogenean anchor morphometry: systematic value, phylogenetic signal, and evolution.

    Science.gov (United States)

    Khang, Tsung Fei; Soo, Oi Yoon Michelle; Tan, Wooi Boon; Lim, Lee Hong Susan

    2016-01-01

    Background. Anchors are one of the important attachment appendages for monogenean parasites. Common descent and evolutionary processes have left their mark on anchor morphometry, in the form of patterns of shape and size variation useful for systematic and evolutionary studies. When combined with morphological and molecular data, analysis of anchor morphometry can potentially answer a wide range of biological questions. Materials and Methods. We used data from anchor morphometry, body size and morphology of 13 Ligophorus (Monogenea: Ancyrocephalidae) species infecting two marine mugilid (Teleostei: Mugilidae) fish hosts: Moolgarda buchanani (Bleeker) and Liza subviridis (Valenciennes) from Malaysia. Anchor shape and size data (n = 530) were generated using methods of geometric morphometrics. We used 28S rRNA, 18S rRNA, and ITS1 sequence data to infer a maximum likelihood phylogeny. We discriminated species using principal component and cluster analysis of shape data. Adams's K mult was used to detect phylogenetic signal in anchor shape. Phylogeny-correlated size and shape changes were investigated using continuous character mapping and directional statistics, respectively. We assessed morphological constraints in anchor morphometry using phylogenetic regression of anchor shape against body size and anchor size. Anchor morphological integration was studied using partial least squares method. The association between copulatory organ morphology and anchor shape and size in phylomorphospace was used to test the Rohde-Hobbs hypothesis. We created monogeneaGM, a new R package that integrates analyses of monogenean anchor geometric morphometric data with morphological and phylogenetic data. Results. We discriminated 12 of the 13 Ligophorus species using anchor shape data. Significant phylogenetic signal was detected in anchor shape. Thus, we discovered new morphological characters based on anchor shaft shape, the length between the inner root point and the outer root

  8. Heat-Conducting Anchors for Thermocouples

    Science.gov (United States)

    Macdavid, Kenton S.

    1987-01-01

    Metal particles in adhesive aid heat transfer. Aluminum caps containing silver-filled epoxy used as high-thermal-conductance anchors for thermocouples, epoxy providing thermal path between mounting surfaces and thermocouple measuring junctions. Normally, epoxy-filled aluminum caps used when measuring steady-state temperatures. Silver-filled epoxy used when thermocouple not isolated electrically from surface measured.

  9. Anchoring Singapore Philanthropy in Southeast Asia | CRDI ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Anchoring Singapore Philanthropy in Southeast Asia. Philanthropy in Singapore has traditionally had a charitable and local orientation. However, given the country's growing wealth and strong ties (trade, investment, migration) with its less advantaged neighbours, it is expected that considerable philanthropic capital will ...

  10. Anchoring Singapore Philanthropy in Southeast Asia | IDRC ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Anchoring Singapore Philanthropy in Southeast Asia. Philanthropy in Singapore has traditionally had a charitable and local orientation. However, given the country's growing wealth and strong ties (trade, investment, migration) with its less advantaged neighbours, it is expected that considerable philanthropic capital will ...

  11. The bone-anchored hearing aid

    DEFF Research Database (Denmark)

    Foghsgaard, Søren

    2014-01-01

    The bone-anchored hearing aid (Baha) was introduced in 1977 by Tjellström and colleagues and has now been used clinically for over 30 years. Generally, the outcomes are good, and several studies have shown improved audiological- and quality of life outcomes. The principle of the Baha is, that sound...

  12. Anchoring the Panic Disorder Severity Scale

    Science.gov (United States)

    Keough, Meghan E.; Porter, Eliora; Kredlow, M. Alexandra; Worthington, John J.; Hoge, Elizabeth A.; Pollack, Mark H.; Shear, M. Katherine; Simon, Naomi M.

    2012-01-01

    The Panic Disorder Severity Scale (PDSS) is a clinician-administered measure of panic disorder symptom severity widely used in clinical research. This investigation sought to provide clinically meaningful anchor points for the PDSS both in terms of clinical severity as measured by the Clinical Global Impression-Severity Scale (CGI-S) and to extend…

  13. Chemical biology of Glycosylphosphatidylinositol (GPI) anchors

    Indian Academy of Sciences (India)

    Admin

    CSIR-IIIM. Chemical biology of. Glycosylphosphatidylinositol (GPI) anchors. Ram Vishwakarma. CSIR-Indian Institute of Integrative Medicine, Jammu. N ti l I tit t f I l. N. D lhi. National Institute of Immunology, New Delhi. Piramal Life Sciences Ltd, Mumbai ...

  14. The nucleotide sequence of two restriction fragments located in the gene AB region of bacteriophage S13.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); J.H. Spencer

    1977-01-01

    textabstractThe nucleotide sequence of a double stranded DNA fragment from the gene AB region of bacteriophage S13 DNA has been determined. The fragment was isolated as two adjacent shorter fragments by cleavage of S13 replicative form (RF) DNA with restriction endonuclease III from Hemophilus

  15. Influence of Anchoring on Burial Depth of Submarine Pipelines.

    Science.gov (United States)

    Zhuang, Yuan; Li, Yang; Su, Wei

    2016-01-01

    Since the beginning of the twenty-first century, there has been widespread construction of submarine oil-gas transmission pipelines due to an increase in offshore oil exploration. Vessel anchoring operations are causing more damage to submarine pipelines due to shipping transportation also increasing. Therefore, it is essential that the influence of anchoring on the required burial depth of submarine pipelines is determined. In this paper, mathematical models for ordinary anchoring and emergency anchoring have been established to derive an anchor impact energy equation for each condition. The required effective burial depth for submarine pipelines has then been calculated via an energy absorption equation for the protection layer covering the submarine pipelines. Finally, the results of the model calculation have been verified by accident case analysis, and the impact of the anchoring height, anchoring water depth and the anchor weight on the required burial depth of submarine pipelines has been further analyzed.

  16. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  17. Experimental Research on Destruction Mode and Anchoring Performance of Carbon Fiber Phyllostachys pubescens Anchor Rod with Different Forms

    Directory of Open Access Journals (Sweden)

    Wang Yulan

    2018-01-01

    Full Text Available The anchoring technology is extensively applied in reinforcing protection of the earth relics. Now that no specification is available for different new anchor rods in earth relics protection due to diversified destruction modes of earth relics and complexity of engineering technology conditions, it is urgent to guide reinforcing design and construction with a complete detailed anchor rod research document. With the new carbon fiber Phyllostachys pubescens anchor rod as the research object, six lots of in situ tests are designed to, respectively, study the destruction mode and anchoring performance of the carbon fiber Phyllostachys pubescens anchor rod under different anchor length L, anchor rod diameter D, bore diameter H, grouting material S, rib spacing R, and inclination angle A in this paper. By studying load shift curve experiment in drawing of the anchor rod, the destruction mode and ultimate bearing capacity of the carbon fiber Phyllostachys pubescens anchor rod in different experiment lots are obtained, and the concept of permitted application value N in anchor rod design is proposed. By studying strain distribution characteristics of anchor rods in experimental lots along the length direction under action of the permitted application value N and combining the existing destruction mode and ultimate bearing capacity, this paper analyzes influences of L, D, H, S, R, and A on anchoring effect of the carbon fiber Phyllostachys pubescens anchor rod; gives the reasonable value range of L, D, H, and R when the carbon fiber Phyllostachys pubescens anchor rod is used for reinforcing design of the earth relics; and provides favorable experiment basis for reinforcing design of the earth relics based on the carbon fiber Phyllostachys pubescens anchor rod.

  18. Decay accelerating factor (DAF) is anchored to membranes by a C-terminal glycolipid

    International Nuclear Information System (INIS)

    Medof, M.E.; Haas, R.; Walter, E.I.; Rosenberry, T.L.

    1986-01-01

    Purified 70 kDa membrane (m) DAF incorporates into cells when added in vitro. A 2 kDa smaller DAF form which functions extrinsically like C4bp but is unable to incorporate can be isolated from urine (u). Because of common deficits of mDAF and acetylcholinesterase (AChE) in erythrocytes (E) of patients with paroxysmal nocturnal hemoglobinuria (PNH), mDAF was analyzed for a O-terminal glycolipid membrane anchor similar to that in E AChE. Incubation of E with phosphatidylinositol-specific phospholipase C, an enzyme which cleaves a similar glycolipid anchor in trypanosome variant surface glycoproteins (mfVSGs), released 20% of the DAF antigen. The released DAF species resembled uDAF in size, extrinsic model of C4b2a decay, and lack of hydrophobicity. Reductive radiomethylation of mDAF with [ 14 C]HCHO and NaCNBH 3 revealed ethanolamine and glucosamine in proportions similar to those in the E AChE glycolipid anchor. Papain cleavage of radiomethylated mDAF released the labeled ethanolamine and glucosamine in small O-terminal fragments from the residual DAF that retained N-terminal Asp. Following labeling of the anchors of mDAF and E AChE with the lipophilic photoreagent 3-trifluoromethyl-3-(m-[ 125 I]iodophenyl)diazirine, cleavage at the glucosamine residue by deamination quantitatively released the label from both proteins. Biosynthetic labeling of Hela cells with [ 3 H]ethanolamine resulted in rapid 3 H incorporation into both 48 kDa proDAF and 70 kDa mDAF. These data indicate that mDAF is anchored by a glycolipid similar to that in E AChE, mfVSGs and Thy-1 antigen and raise the possibility that a defect in the assembly or attachment of this structure could account for the deficits of mDAF and E AChE in PNH

  19. Measures for the Safe Operation of Anchoring in a Storm

    Science.gov (United States)

    Han, Tianding; Ai, Wanzheng

    2018-01-01

    The collision and stranding of ship other shipwreck accidents are mainly caused by the ship dragging. As the water is less in coastal areas, anchoring has less influence on cementing ship, so strong wind is the most important factor for ship anchoring. Therefore, it is very important to study the safety evaluation of mooring in strong wind. In this paper, the measures taken after the ship anchoring is come up with from the analysis on the typical accidents and causes of anchoring security. The safety measures at the time of anchoring are also studied.

  20. Comparative Study on Different Slot Forms of Prestressed Anchor Blocks

    Science.gov (United States)

    Fan, Rong; Si, Jianhui; Jian, Zheng

    2018-03-01

    In this paper, two models of prestressed pier, rectangular cavity anchor block and arch hollow anchor block are established. The ABAQUS software was used to calculate the stress of the surface of the neck of the pier and the cavity of the anchor block, through comparative analysis. The results show that compared with the rectangular cavity anchor block, the stress of the pier and the cavity can be effectively reduced when the arch hole is used, and the amount of prestressed anchor can be reduced, so as to obtain obvious economic benefits.

  1. Composite materials formed with anchored nanostructures

    Science.gov (United States)

    Seals, Roland D; Menchhofer, Paul A; Howe, Jane Y; Wang, Wei

    2015-03-10

    A method of forming nano-structure composite materials that have a binder material and a nanostructure fiber material is described. A precursor material may be formed using a mixture of at least one metal powder and anchored nanostructure materials. The metal powder mixture may be (a) Ni powder and (b) NiAl powder. The anchored nanostructure materials may comprise (i) NiAl powder as a support material and (ii) carbon nanotubes attached to nanoparticles adjacent to a surface of the support material. The process of forming nano-structure composite materials typically involves sintering the mixture under vacuum in a die. When Ni and NiAl are used in the metal powder mixture Ni.sub.3Al may form as the binder material after sintering. The mixture is sintered until it consolidates to form the nano-structure composite material.

  2. Chemical biology of Glycosylphosphatidylinositol (GPI) anchors

    Indian Academy of Sciences (India)

    Admin

    CSIR-IIIM. Chemical biology of GPI anchors. • Organic synthesis, biosynthesis and cell biology of PI/GPI molecules. • Design and synthesis of structural and functional mimics of. PI/GPI t b bi l i l ti. PI/GPIs to probe biological questions. • Targeting PI3K/AKT/mTOR pathway for anticancer drug discovery. • Role of PI3K isoforms ...

  3. Electropermanent magnetic anchoring for surgery and endoscopy.

    Science.gov (United States)

    Tugwell, Josef; Brennan, Philip; O'Shea, Conor; O'Donoghue, Kilian; Power, Timothy; O'Shea, Michael; Griffiths, James; Cahill, Ronan; Cantillon-Murphy, Padraig

    2015-03-01

    The use of magnets for anchoring of instrumentation in minimally invasive surgery and endoscopy has become of increased interest in recent years. Permanent magnets have significant advantages over electromagnets for these applications; larger anchoring and retraction force for comparable size and volume without the need for any external power supply. However, permanent magnets represent a potential hazard in the operating field where inadvertent attraction to surgical instrumentation is often undesirable. The current work proposes an interesting hybrid approach which marries the high forces of permanent magnets with the control of electromagnetic technology including the ability to turn the magnet OFF when necessary. This is achieved through the use of an electropermanent magnet, which is designed for surgical retraction across the abdominal and gastric walls. Our electropermanent magnet, which is hand-held and does not require continuous power, is designed with a center lumen which may be used for trocar or needle insertion. The device in this application has been demonstrated successfully in the porcine model where coupling between an intraluminal ring magnet and our electropermanent magnet facilitated guided insertion of an 18 Fr Tuohy needle for guidewire placement. Subsequent investigations have demonstrated the ability to control the coupling distance of the system alleviating shortcomings with current methods of magnetic coupling due to variation in transabdominal wall thicknesses. With further refinement, the magnet may find application in the anchoring of endoscopic and surgical instrumentation for minimally invasive interventions in the gastrointestinal tract.

  4. Anchored design of protein-protein interfaces.

    Directory of Open Access Journals (Sweden)

    Steven M Lewis

    Full Text Available Few existing protein-protein interface design methods allow for extensive backbone rearrangements during the design process. There is also a dichotomy between redesign methods, which take advantage of the native interface, and de novo methods, which produce novel binders.Here, we propose a new method for designing novel protein reagents that combines advantages of redesign and de novo methods and allows for extensive backbone motion. This method requires a bound structure of a target and one of its natural binding partners. A key interaction in this interface, the anchor, is computationally grafted out of the partner and into a surface loop on the design scaffold. The design scaffold's surface is then redesigned with backbone flexibility to create a new binding partner for the target. Careful choice of a scaffold will bring experimentally desirable characteristics into the new complex. The use of an anchor both expedites the design process and ensures that binding proceeds against a known location on the target. The use of surface loops on the scaffold allows for flexible-backbone redesign to properly search conformational space.This protocol was implemented within the Rosetta3 software suite. To demonstrate and evaluate this protocol, we have developed a benchmarking set of structures from the PDB with loop-mediated interfaces. This protocol can recover the correct loop-mediated interface in 15 out of 16 tested structures, using only a single residue as an anchor.

  5. Resisting anchoring effects: The roles of metric and mapping knowledge.

    Science.gov (United States)

    Smith, Andrew R; Windschitl, Paul D

    2015-10-01

    The biasing influence of anchors on numerical estimates is well established, but the relationship between knowledge level and the susceptibility to anchoring effects is less clear. In two studies, we addressed the potential mitigating effects of having knowledge in a domain on vulnerability to anchoring effects in that domain. Of critical interest was a distinction between two forms of knowledge-metric and mapping knowledge. In Study 1, participants who had studied question-relevant information-that is, high-knowledge participants-were less influenced by anchors than were participants who had studied irrelevant information. The results from knowledge measures suggested that the reduction in anchoring was tied to increases in metric rather than mapping knowledge. In Study 2, participants studied information specifically designed to influence different types of knowledge. As we predicted, increases in metric knowledge-and not mapping knowledge-led to reduced anchoring effects. Implications for debiasing anchoring effects are discussed.

  6. New restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus.

    Science.gov (United States)

    Semighini, C P; Delmas, G; Park, S; Amstrong, D; Perlin, D; Goldman, G H

    2001-07-01

    In this study, we isolated and tested restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus based on PCR products amplified by the random amplified polymorphic DNA (RAPD) primer R108. Four DNA fragments, Afd, Af5, Af4, and Af4A, were amplified. Fragments Afd and Af5 were 85% and 88% identical at the DNA level to part of the Afut1 retrotransposon from A. fumigatus. Fragment Af4A is a duplication of fragment Af4 and both showed similarity at the amino acid level with endonucleases from other fungal retrotransposons. We used both RAPD with primer R108 and RFLP assays with Afut1, Afd, and Af4A, to determine the genetic relatedness of clinical isolates of A. fumigatus isolated sequentially from four patients colonized with A. fumigatus. The combination of these different methods suggested that the isolates infecting the four patients were not identical.

  7. Robotic Ankle for Omnidirectional Rock Anchors

    Science.gov (United States)

    Parness, Aaron; Frost, Matthew; Thatte, Nitish

    2013-01-01

    Future robotic exploration of near-Earth asteroids and the vertical and inverted rock walls of lava caves and cliff faces on Mars and other planetary bodies would require a method of gripping their rocky surfaces to allow mobility without gravitational assistance. In order to successfully navigate this terrain and drill for samples, the grippers must be able to produce anchoring forces in excess of 100 N. Additionally, the grippers must be able to support the inertial forces of a moving robot, as well gravitational forces for demonstrations on Earth. One possible solution would be to use microspine arrays to anchor to rock surfaces and provide the necessary load-bearing abilities for robotic exploration of asteroids. Microspine arrays comprise dozens of small steel hooks supported on individual suspensions. When these arrays are dragged along a rock surface, the steel hooks engage with asperities and holes on the surface. The suspensions allow for individual hooks to engage with asperities while the remaining hooks continue to drag along the surface. This ensures that the maximum possible number of hooks engage with the surface, thereby increasing the load-bearing abilities of the gripper. Using the microspine array grippers described above as the end-effectors of a robot would allow it to traverse terrain previously unreachable by traditional wheeled robots. Furthermore, microspine-gripping robots that can perch on cliffs or rocky walls could enable a new class of persistent surveillance devices for military applications. In order to interface these microspine grippers with a legged robot, an ankle is needed that can robotically actuate the gripper, as well as allow it to conform to the large-scale irregularities in the rock. The anchor serves three main purposes: deploy and release the anchor, conform to roughness or misalignment with the surface, and cancel out any moments about the anchor that could cause unintentional detachment. The ankle design contains a

  8. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  9. A Study on Campylobacter jejuni and Campylobacter coli through Commercial Broiler Production Chains in Thailand: Antimicrobial Resistance, the Characterization of DNA Gyrase Subunit A Mutation, and Genetic Diversity by Flagellin A Gene Restriction Fragment Length Polymorphism.

    Science.gov (United States)

    Thomrongsuwannakij, Thotsapol; Blackall, Patrick J; Chansiripornchai, Niwat

    2017-06-01

    Contaminated poultry meat is regarded as the main source of human campylobacteriosis. During September 2014 and February 2015, breeder flocks, hatcheries, and broiler farms from two chicken production chains were investigated chronologically. Five commercial breeder flocks (Breeder Flocks 1-5), two hatcheries (Hatcheries A and B), and five broiler flocks (Broiler Flocks 1-5) were sampled in this study. Campylobacter colonization of both breeder and broiler flocks was determined from cloacal swabs and environmental samples (pan feeders, footwear, darkling beetles, flies, feed, and water). The eggs from the breeder flocks were followed to hatcheries. At the hatcheries, early embryonic deaths, egg trays, eggshells, hatchers, and water were investigated. Cloacal swabs were taken from broilers at Days 1, 14, and 28 (all broiler flocks), and either 35 (Broiler Flocks 1 and 2) or 43 (Broiler Flocks 3-5). Thirty-six Campylobacter jejuni and 94 Campylobacter coli isolates collected through two broiler production chains were tested by twofold agar dilution for their susceptibility to antimicrobial agents. Most Campylobacter isolates were multidrug resistant (MDR), defined as being resistant to three or more antimicrobial classes ( C. jejuni : 100%; C. coli : 98.9%), and exhibited high resistance to enrofloxacin ( C. jejuni : 100%; C. coli : 98.9%). The vast majority of C. coli were resistant to tetracycline (97.9%), trimethoprim-sulfamethoxazole (81.9%), and doxycycline (79.8%), but only 55.6%, 36.1%, and 50% of C. jejuni isolates revealed resistance to these antimicrobial agents, respectively. A selected subset of 24 C. jejuni and 24 C. coli were characterized for their mutations in the quinolone resistance determining region of the DNA gyrase subunit A gene by nucleotide sequence analysis. The Thr-86-Ile substitution (ACA-ATA in C. jejuni or ACT-ATT in C. coli ) was found in all isolates. Moreover, a total of 130 Campylobacter isolates were typed with the use of polymerase

  10. Microelectrophoresis devices with integrated fluorescence detectors and reactors for high-throughput DNA sequencing

    Science.gov (United States)

    Soper, Steven A.; Ford, Sean M.; Davies, Jack; Williams, Daryl C.; Cheng, Benxu; Klopf, J. Michael; Calderon, Gina M.; Saile, Volker

    1997-05-01

    This work describes the development of micro-devices for high-throughput DNA sequencing applications. Basically, two research efforts will be discussed; (1) fabrication and characterization of micro-reactors to prepare Sanger chain terminated DNA sequencing fragments on a nanoliter scale and; (2) x-ray photolithography of PMMA substrates for the high aspect ratio preparation of electrophoresis devices. The micro-reactor consisted of a 5'-biotinylated catfish olfactory gene, which was amplified by PCR, and attached to the interior wall of an aminoalkylisilane derivatized fused- silica capillary tube via a streptavidin/biotin linkage. Coverage of the interior capillary wall with biotinylated DNA averaged 77 percent. Stability of the anchored template under pressure and electroosmotic rinsing was favorable, requiring approximately 150 h of continuous rinsing to reduce the coverage by only 50 percent. The capillary micro- reactor was placed inside an air thermocycler to control temperature during Sanger ddNTP chain extension and directly coupled to a capillary separation column filled with a LPA solution via low dead volume capillary interlocks. The complimentary DNA fragments generated in the reactor were heat denatured from the immobilized template and directly injected onto a gel-filled capillary using electropumping for size fractionation and detection using NIR-LIF analysis. The total amount of termination fragments in the 31 nL reactor volume was estimated to be 5.2 X 1013 moles and sequencing was shown to produce read lengths on the order to 400 bases. Work will also be described concerning the development of micro-electrophoresis devices in x-ray sensitive photoresists using LIGA techniques. An electrophoresis device with an integrated fluorescence detector was constructed for the high resolution separation of DNA oligonucleotides. The choice of substrate for the electrophoresis was PMMA, due to its intrinsic low electroosmotic flow. Using x-ray lithography in

  11. ANCHORING IN THE POLITICAL AND ECONOMIC MARKETING

    Directory of Open Access Journals (Sweden)

    Tatyana L. Shklyar

    2015-01-01

    Full Text Available The main purpose of marketing, both ineconomy and in politics is to attract themaximum number of customers or voters, maximizing customer satisfaction and ,ideally, improve the quality of life.The author, in various aspects, thetechnology of anchoring used in NLP, to attract customers and voters, both in the economy and in politics.In different examples demonstrate theoverall impact on the psychology of the consumer. Separating policy and the economy, marketers are missing something. The author proposes to look at how psychologicalanchors affect these two, at fi rst glance, different vector.

  12. Stone anchors from Minicoy Island, Lakshadweep, India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    and Ali Rajas of Kerala. It appears that the mainland had contact with these islands during the early centuries of the Christian era, if not earlier (Sila Tripati, 1999). Though Islam came to Lakshadweep after the 11th and 12th centuries AD... by fishermen. In Divehi, the local language, ring-stone anchors are known as fanaa. Of 40–50 cm diameter, they are made of coral fashioned in the form of a slightly concave disc. The width of the hole in which the wooden stock is inserted is 6–10 cm...

  13. BAHA: Bone-Anchored Hearing Aid

    Science.gov (United States)

    Hagr, Abdulrahman

    2007-01-01

    Bone-Anchored Hearing Aid (BAHA) has proven performance and advantages for patients with aural atresia or chronic ear drainage who cannot wear air-conduction hearing aids. The BAHA has both cosmetic and acoustic advantages over most conventional hearing aids and hence is becoming increasingly popular. Moreover, BAHA improves the quality of life and has also significantly reduces ear discharge. This extensive review of the literature pertaining to BAHA discus the history, the indications, the advantages, the prediction of the outcome and the complications of this device as well as comparing it to the conventional hearing aids. PMID:21475438

  14. [The bone-anchored hearing aid].

    Science.gov (United States)

    Foghsgaard, Søren

    2014-08-11

    The bone-anchored hearing aid (Baha) was introduced in 1977 by Tjellström and colleagues and has now been used clinically for over 30 years. Generally, the outcomes are good, and several studies have shown improved audiological- and quality of life outcomes. The principle of the Baha is, that sound vibrations are led directly to the inner ear via the mastoid bone, bypassing the middle ear. This is achieved via an osseointegrated implant and a skin-penetrating abutment. Studies report high success rates and a majority of complications as typically minor in nature.

  15. Adsorption phenomena and anchoring energy in nematic liquid crystals

    CERN Document Server

    Barbero, Giovanni

    2005-01-01

    Despite the large quantity of phenomenological information concerning the bulk properties of nematic phase liquid crystals, little is understood about the origin of the surface energy, particularly the surface, interfacial, and anchoring properties of liquid crystals that affect the performance of liquid crystal devices. Self-contained and unique, Adsorption Phenomena and Anchoring Energy in Nematic Liquid Crystals provides an account of new and established results spanning three decades of research into the problems of anchoring energy and adsorption phenomena in liquid crystals.The book contains a detailed discussion of the origin and possible sources of anchoring energy in nematic liquid crystals, emphasizing the dielectric contribution to the anchoring energy in particular. Beginning with fundamental surface and anchoring properties of liquid crystals and the definition of the nematic phase, the authors explain how selective ion adsorption, dielectric energy density, thickness dependence, and bias voltage...

  16. 24 CFR 3285.402 - Ground anchor installations.

    Science.gov (United States)

    2010-04-01

    ... anchor head from edge of floor or wall. 3. Table is based on main rail (I-beam) spacing per given column... ground anchor head from edge of floor or wall. 3. Tables are based on main rail (I-beam) spacing per... anchor head from edge of floor or wall. 3. Table is based on main rail (I-beam) spacing per given column...

  17. Investigation of suction anchor pullout capacity under undrained conditions

    OpenAIRE

    Jarand, Pollestad

    2015-01-01

    Master's thesis in Offshore technology Floating units are dependent on reliable mooring systems to ensure safety during marine operations. Suction anchors have proved to be a technologically viable and cost-effective concept. They are capable of precision installation, re-use, and provide large resistive capacity. This thesis investigates load capacity and failure modes of suction anchors subjected to vertical, horizontal (lateral), and incline loading. Suction anchor design co...

  18. Moody experts --- How mood and expertise influence judgmental anchoring

    Directory of Open Access Journals (Sweden)

    Birte Englich

    2009-02-01

    Full Text Available Anchoring effects, the assimilation of numerical estimates to previously considered standards, are highly robust. Two studies examined whether mood and expertise jointly moderate the magnitude of anchoring. Previous research has demonstrated that happy mood induces judges to process information in a less thorough manner than sad mood, which means that happy judges tend to be more susceptible to unwanted influences. However, this may not be true for anchoring effects. Because anchoring results from an elaborate process of selective knowledge activation, more thorough processing should lead to more anchoring; as a result, sad judges should show stronger anchoring effects than happy judges and happy judges may even remain uninfluenced by the given anchors. Because information processing of experts may be relatively independent of their mood, however, mood may influence anchoring only in non-experts. Results of two studies on legal decision-making (Study 1 and numeric estimates (Study 2 are consistent with these expectations. These findings suggest that, at least for non-experts, positive mood may eliminate the otherwise robust anchoring effect.

  19. Testing methods of steel wi re ropes at the anchor

    Directory of Open Access Journals (Sweden)

    Stanislav Kropuch

    2012-12-01

    Full Text Available The present paper introduces an application of the acoustic andthermographic method in the defectoscopic testing of immobilesteel wire ropes at the most critical point, the anchor. Firstmeasurements and their results by these new defectoscopic methodsare shown. In defectoscopic tests at the anchor, the widelyused magnetic method gives unreliable results, and therefore presentsa problem for steel wire defectoscopy. Application of the two new methods in the steel wire defectoscopy at the anchor point will enableincreased safety measures at the anchor of steel wire ropes in bridge, roof, tower and aerial cable lift constructions.

  20. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  1. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  2. Fragmented Work Stories

    DEFF Research Database (Denmark)

    Humle, Didde Maria; Reff Pedersen, Anne

    2015-01-01

    , edited and performed by the storyteller in an ongoing process allowing tensions, discontinuities and editing between failures and achievements, between dreams and work realities and between home and work life. We argue that by including different types of fragmentation, we offer a new type......Following a strand of narrative studies pointing to the living conditions of storytelling and the micro-level implications of working within fragmented narrative perspectives, this article contributes to narrative research on work stories by focusing on how meaning is created from fragmented...... stories. We argue that meaning by story making is not always created by coherence and causality; meaning is created by different types of fragmentation: discontinuities, tensions and editing. The objective of this article is to develop and advance antenarrative practice analysis of work stories...

  3. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  4. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  5. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  6. Fragment Length Distributions and Collision Probabilities for AFLP Markers

    NARCIS (Netherlands)

    Gort, G.; Koopman, W.J.M.; Stein, A.

    2006-01-01

    AFLP is a DNA fingerprinting technique frequently used in plant and animal sciences. A drawback of the technique is the occurrence of multiple DNA fragments of the same length in a single AFLP lane, which we name a collision. In this article we quantify the problem. The well-known birthday problem

  7. Testing and modeling of cyclically loaded rock anchors

    Directory of Open Access Journals (Sweden)

    Joar Tistel

    2017-12-01

    Full Text Available The Norwegian Public Roads Administration (NPRA is planning for an upgrade of the E39 highway route at the westcoast of Norway. Fixed links shall replace ferries at seven fjord crossings. Wide spans and large depths at the crossings combined with challenging subsea topography and environmental loads call for an extension of existing practice. A variety of bridge concepts are evaluated in the feasibility study. The structures will experience significant loads from deadweight, traffic and environment. Anchoring of these forces is thus one of the challenges met in the project. Large-size subsea rock anchors are considered a viable alternative. These can be used for anchoring of floating structures but also with the purpose of increasing capacity of fixed structures. This paper presents first a thorough study of factors affecting rock anchor bond capacity. Laboratory testing of rock anchors subjected to cyclic loading is thereafter presented. Finally, the paper presents a model predicting the capacity of a rock anchor segment, in terms of a ribbed bar, subjected to a cyclic load history. The research assumes a failure mode occurring in the interface between the rock anchor and the surrounding grout. The constitutive behavior of the bonding interface is investigated for anchors subjected to cyclic one-way tensile loads. The model utilizes the static bond capacity curve as a basis, defining the ultimate bond τbu and the slip s1 at τbu. A limited number of input parameters are required to apply the model. The model defines the bond-slip behavior with the belonging rock anchor capacity depending on the cyclic load level (τmax cy/τbu, the cyclic load ratio (R = τmin cy/τmax cy, and the number of load cycles (N. The constitutive model is intended to model short anchor lengths representing an incremental length of a complete rock anchor.

  8. Molecular beacon anchored onto a graphene oxide substrate

    Science.gov (United States)

    Darbandi, Arash; Datta, Debopam; Patel, Krunal; Lin, Gary; Stroscio, Michael A.; Dutta, Mitra

    2017-09-01

    In this article, we report a graphene oxide-based nanosensor incorporating semiconductor quantum dots linked to DNA-aptamers that functions as a ‘turn-off’ fluorescent nanosensor for detection of low concentrations of analytes. A specific demonstration of this turn-off aptasensor is presented for the case of the detection of mercury (II) ions. In this system, ensembles of aptamer-based quantum-dot sensors are anchored onto graphene oxide (GO) flakes which provide a platform for analyte detection in the vicinity of GO. Herein, the operation of this ensemble-based nanosensor is demonstrated for mercury ions, which upon addition of mercury, quenching of the emission intensity from the quantum dots is observed due to resonance energy transfer between quantum dots and the gold nanoparticle connected via a mercury target aptamer. A key result is that the usually dominant effect of quenching of the quantum dot due to close proximity to the GO can be reduced to negligible levels by using a linker molecule in conjunctions with the aptamer-based nanosensor. The effect of ionic concentration of the background matrix on the emission intensity was also investigated. The sensor system is found to be highly selective towards mercury and exhibits a linear behavior (r 2 > 0.99) in the nanomolar concentration range. The detection limit of the sensor towards mercury with no GO present was found to be 16.5 nM. With GO attached to molecular beacon via 14 base, 35 base, and 51 base long linker DNA, the detection limit was found to be 38.4 nM, 9.45 nM, and 11.38 nM; respectively.

  9. Equating Subscores under the Nonequivalent Anchor Test (NEAT) Design

    Science.gov (United States)

    Puhan, Gautam; Liang, Longjuan

    2011-01-01

    The study examined two approaches for equating subscores. They are (1) equating subscores using internal common items as the anchor to conduct the equating, and (2) equating subscores using equated and scaled total scores as the anchor to conduct the equating. Since equated total scores are comparable across the new and old forms, they can be used…

  10. Career anchors and values from different career management perspectives

    Directory of Open Access Journals (Sweden)

    Rodrigo Cunha da Silva

    2016-06-01

    Full Text Available Purpose – To analyze the relationships between career anchors and young Generation Y professionals’ values, from the career concept perspective. Design/methodology/approach – Research concerning the proposed objective was carried out through quantitative research involving 189 Business Administration majors from a Catholic university in São Paulo, Brazil. We used two instruments to identify the career anchors and values of respondents: Schein (1990 and Schwartz (1994, respectively. We used statistical techniques to explore the relationships between career anchors and values. Findings – Among the results, mention should be made to the statistical relationships found between analyzed career anchors and values. It is also important to stress that, although the Lifestyle career anchor was predominantly present in the conglomerate division, this anchor was the predominant characteristic in the differentiation of the smaller group of respondents, the new career group. The General Management Career Anchor, which presents a lower incidence, is the predominant characteristic of the larger group, referring to organizational careers. As well as the Lifestyle career anchor, the Hedonism value was predominant among respondents. Originality/value – The need to consider the following was found: Generation Y presents generational characteristics that drive people management to propose work structures that offer activities to generate learning, pleasure, self-fulfillment and conciliation between work and personal life.

  11. Software Note: Using BILOG for Fixed-Anchor Item Calibration

    Science.gov (United States)

    DeMars, Christine E.; Jurich, Daniel P.

    2012-01-01

    The nonequivalent groups anchor test (NEAT) design is often used to scale item parameters from two different test forms. A subset of items, called the anchor items or common items, are administered as part of both test forms. These items are used to adjust the item calibrations for any differences in the ability distributions of the groups taking…

  12. Robust conductance of dumbbell molecular junctions with fullerene anchoring groups

    DEFF Research Database (Denmark)

    Markussen, Troels; Settnes, Mikkel; Thygesen, Kristian Sommer

    2011-01-01

    that a dumbbell construction with C60 molecules acting as anchors yields more well-defined conductances as compared to the widely used thiol anchoring groups. Here, we use density functional theory to investigate the electronic properties of this dumbbell construction. The conductance is found to be stable...

  13. Geological significance of stone anchors from Dwarka waters, Gujarat, India

    Digital Repository Service at National Institute of Oceanography (India)

    Iyer, S.D.; Vora, K.H.; Gaur, A.S.

    of the anchors in terms of the rock type and their availability are presented. Four anchors were sampled for petrological investigations of which one is basalt, one is sandstone, and two are limestone. The latter two rock types are abundant in the vicinity...

  14. [Construction of large fragment metagenome library of natural mangrove soil].

    Science.gov (United States)

    Jiang, Yun-Xia; Zheng, Tian-Ling

    2007-11-01

    Applying our optimized direct extraction method, the percentage of large fragment DNA in the total extracted mangrove soil DNA was significant increased. The large fragment metagenome library derived from natural mangrove soil over four seasons was successfully constructed by the optimized DNA extraction and electro elution purification method. All of the clones had recombinant Cosmids and each differed in their fragment profiles when Cosmid DNA was extracted from 12 randomly picked colonies and digested with BamHI. The average insert size for this library was larger than 35 kbp. This culturing-independent library at least encompassed 335 Mbp valuable genetic information of mangrove soil microbes. It allowed mining of valuable intertidal microbial resource to become a reality. It is a recommended method for those researchers who have still not circumvented the large insert environmental libraries or for those beginning research in this field, so as to avoid them attempting repetitive, fussy work.

  15. Use of Jackknifing to Evaluate Effects of Anchor Item Selection on Equating with the Nonequivalent Groups with Anchor Test (NEAT) Design. Research Report. ETS RR-15-10

    Science.gov (United States)

    Lu, Ru; Haberman, Shelby; Guo, Hongwen; Liu, Jinghua

    2015-01-01

    In this study, we apply jackknifing to anchor items to evaluate the impact of anchor selection on equating stability. In an ideal world, the choice of anchor items should have little impact on equating results. When this ideal does not correspond to reality, selection of anchor items can strongly influence equating results. This influence does not…

  16. Biased calculations: Numeric anchors influence answers to math equations

    Directory of Open Access Journals (Sweden)

    Andrew R. Smith

    2011-02-01

    Full Text Available People must often perform calculations in order to produce a numeric estimate (e.g., a grocery-store shopper estimating the total price of his or her shopping cart contents. The current studies were designed to test whether estimates based on calculations are influenced by comparisons with irrelevant anchors. Previous research has demonstrated that estimates across a wide range of contexts assimilate toward anchors, but none has examined estimates based on calculations. In two studies, we had participants compare the answers to math problems with anchors. In both studies, participants' estimates assimilated toward the anchor values. This effect was moderated by time limit such that the anchoring effects were larger when the participants' ability to engage in calculations was limited by a restrictive time limit.

  17. Anchoring submersible ultrasonic receivers in river channels with stable substrate

    Science.gov (United States)

    Bettoli, Phillip William; Scholten, G.D.; Hubbs, D.

    2010-01-01

    We developed an anchoring system for submersible ultrasonic receivers (SURs) that we placed on the bottom of the riverine reaches of three main-stem reservoirs in the upper Tennessee River. Each anchor consisted of a steel tube (8.9 x 35.6 cm) welded vertically to a round plate of steel (5.1 x 40.6 cm). All seven SURs and their 57-kg anchors were successfully deployed and retrieved three times over 547 d by a dive team employing surface air-breathing equipment and a davit-equipped boat. All of the anchors and their SURs remained stationary over two consecutive winters on the hard-bottom, thalweg sites where they were deployed. The SUR and its anchor at the most downriver site experienced flows that exceeded 2,100 m(3)/s and mean water column velocities of about 0.9 m/s.

  18. Grapnel stone anchors from Saurashtra: Remnants of Indo-Arab trade on the Indian coast

    Digital Repository Service at National Institute of Oceanography (India)

    Gaur, A.S.; Sundaresh; Tripati, S.

    Stone anchors have been used as a primary source of information on ancient navigation by marine archaeologists since long. These anchors used by ancient mariners are often noticed underwater at various places across the world. Stone anchors are also...

  19. The Use of Two Anchors in Nonequivalent Groups with Anchor Test (NEAT) Equating. Research Report. ETS RR-10-23

    Science.gov (United States)

    Moses, Tim; Deng, Weiling; Zhang, Yu-Li

    2010-01-01

    In the equating literature, a recurring concern is that equating functions that utilize a single anchor to account for examinee groups' nonequivalence are biased when the groups are extremely different and/or when the anchor only weakly measures what the tests measure. Several proposals have been made to address this equating bias by incorporating…

  20. Convenient synthesis and application of versatile nucleic acid lipid membrane anchors in the assembly and fusion of liposomes

    DEFF Research Database (Denmark)

    Ries, Oliver; Löffler, Philipp M. G.; Vogel, Stefan

    2015-01-01

    or the construction of DNA origami structures. We herein present the synthesis and applications of versatile lipid membrane anchor building blocks suitable for solid phase oligonucleotide synthesis. These are readily synthesized in bulk in five to seven steps from commercially available precursors and can...... be incorporated at any position within an oligonucleotide without significantly altering duplex stability and structure as proven by thermal denaturation experiments and circular dichroism. Furthermore, applicability could be demonstrated by assembly and fusion of liposomes mediated by lipid...

  1. Fragmentation of kidney stones

    International Nuclear Information System (INIS)

    Kovacs, K.; Kun, F.; Vertse, T.

    2005-01-01

    Complete text of publication follows. Fragmentation, i.e. the breaking of particulate materials into smaller pieces is abundant in nature and underlies several industrial processes, which attracted a continuous interest in scientific and engineering research over the past decades. In industrial applications, fragmentation processes are mostly used for the comminution of ores in various types of mills. Kidney stone is a well known human dis- ease which embitters the life of many people (in a country like the USA about 10 6 cases are registered yearly). In order to extract large kidney stones (diameter ≥ 1 cm) from the human body without operation, one of the most efficient treatment is the fragmentation of kidney stones by the so-called extracorporal shock wave lithography method: a shock wave penetrating the human body is generated by an electric pulse. The repeated application of the shock wave gradually fragments the stones into pieces of size ≤ 2 mm which then leave the body through the urine system. Recently, a novel type of lithographic method has been suggested by using widely focused shock waves which fragment the stones by a squeezing mechanism. Laboratory experiments showed that the widely focused squeezing waves achieve a higher fragmentation efficiency than the frequently used shock waves of sharp focus. Based on this method a novel medical treatment can be introduced which is less demanding for the patients. Before the application of the method in the clinical practice a detailed understanding of the fragmentation mechanism of kidney stones due to shock waves is required. Since analytic theoretical methods have serious limitations in this field, we develop a realistic model of the mechanical behavior of kidney stones and a simulation code which makes possible to study the mechanism of breakup under various external conditions. Computer simulations in two dimensions have revealed a peculiar way of crack formation, i.e. the crack which finally breaks

  2. A magnetically actuated anchoring system for a wireless endoscopic capsule.

    Science.gov (United States)

    Zhou, Hao; Alici, Gursel; Munoz, Fredy

    2016-12-01

    In this study, we propose a new magnetically actuated anchoring system for wireless capsule endoscopes (WCE) by employing the principle of a switchable magnetic spring. A force model is derived to predict the magnetic force needed to support the interaction between the anchors and the intestinal lumen. The theoretical and experimental analysis conducted shows that the magnetic spring is capable of providing the force needed to activate the anchoring mechanism, which consists of four foldable legs. A prototype capsule with a size comparable with the size of a commercial WCE was designed, fabricated, and tested. The in-vitro tests with a real small intestine show that the proposed anchoring mechanism is able to raise the friction force between the anchoring legs and inner wall of the intestine by more than two times after its activation using an external magnetic field. Experimental results presented demonstrate that the proposed anchoring system, which has a low foot-print not taking up too much space on the capsule, can provide a reliable anchoring capability with the capsule inside the intestinal lumen.

  3. A tailored biocatalyst achieved by the rational anchoring of imidazole groups on a natural polymer: furnishing a potential artificial nuclease by sustainable materials engineering.

    Science.gov (United States)

    Ferreira, José G L; Grein-Iankovski, Aline; Oliveira, Marco A S; Simas-Tosin, Fernanda F; Riegel-Vidotti, Izabel C; Orth, Elisa S

    2015-04-11

    Foreseeing the development of artificial enzymes by sustainable materials engineering, we rationally anchored reactive imidazole groups on gum arabic, a natural biocompatible polymer. The tailored biocatalyst GAIMZ demonstrated catalytic activity (>10(5)-fold) in dephosphorylation reactions with recyclable features and was effective in cleaving plasmid DNA, comprising a potential artificial nuclease.

  4. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  5. Quantifying Heuristic Bias: Anchoring, Availability, and Representativeness.

    Science.gov (United States)

    Richie, Megan; Josephson, S Andrew

    2018-01-01

    Construct: Authors examined whether a new vignette-based instrument could isolate and quantify heuristic bias. Heuristics are cognitive shortcuts that may introduce bias and contribute to error. There is no standardized instrument available to quantify heuristic bias in clinical decision making, limiting future study of educational interventions designed to improve calibration of medical decisions. This study presents validity data to support a vignette-based instrument quantifying bias due to the anchoring, availability, and representativeness heuristics. Participants completed questionnaires requiring assignment of probabilities to potential outcomes of medical and nonmedical scenarios. The instrument randomly presented scenarios in one of two versions: Version A, encouraging heuristic bias, and Version B, worded neutrally. The primary outcome was the difference in probability judgments for Version A versus Version B scenario options. Of 167 participants recruited, 139 enrolled. Participants assigned significantly higher mean probability values to Version A scenario options (M = 9.56, SD = 3.75) than Version B (M = 8.98, SD = 3.76), t(1801) = 3.27, p = .001. This result remained significant analyzing medical scenarios alone (Version A, M = 9.41, SD = 3.92; Version B, M = 8.86, SD = 4.09), t(1204) = 2.36, p = .02. Analyzing medical scenarios by heuristic revealed a significant difference between Version A and B for availability (Version A, M = 6.52, SD = 3.32; Version B, M = 5.52, SD = 3.05), t(404) = 3.04, p = .003, and representativeness (Version A, M = 11.45, SD = 3.12; Version B, M = 10.67, SD = 3.71), t(396) = 2.28, p = .02, but not anchoring. Stratifying by training level, students maintained a significant difference between Version A and B medical scenarios (Version A, M = 9.83, SD = 3.75; Version B, M = 9.00, SD = 3.98), t(465) = 2.29, p = .02, but not residents or attendings. Stratifying by heuristic and training level, availability maintained

  6. Fragments of the Past

    OpenAIRE

    Peter Szende; Annie Holcombe

    2016-01-01

    With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  7. Picking Up (On) Fragments

    NARCIS (Netherlands)

    Ellis, Phil

    2015-01-01

    abstractThis article discusses the implications for archival and media archaeological research and reenactment artwork relating to a recent arts practice project: reenacttv: 30 lines / 60 seconds. It proposes that archival material is unstable but has traces and fragments that are full of creative

  8. Fragments of Time

    DEFF Research Database (Denmark)

    Christiansen, Steen Ledet

    Time travel films necessarily fragment linear narratives, as scenes are revisited with differences from the first time we saw it. Popular films such as Back to the Future mine comedy from these visitations, but there are many different approaches. One extreme is Chris Marker's La Jetée - a film...

  9. Wildlife habitat fragmentation.

    Science.gov (United States)

    John. Lehmkuhl

    2005-01-01

    A primary issue in forest wildlife management is habitat fragmentation and its effects on viability, which is the "bottom line" for plant and animal species of conservation concern. Population viability is the likelihood that a population will be able to maintain itself (remain viable) over a long period of time-usually 100 years or more. Though it is true...

  10. Fragments of the Past

    Directory of Open Access Journals (Sweden)

    Peter Szende

    2016-10-01

    Full Text Available With travel being made more accessible throughout the decades, the hospitality industry constantly evolved their practices as society and technology progressed. Hotels looked for news ways up service their customers, which led to the invention of the Servidor in 1918. Once revolutionary innovations have gone extinct, merely becoming fragments of the past.

  11. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Some delicate nerves and fibres in the surrounding areas of the stones present in the kidney are also damaged by high ultrasonic intensity used in such systems. In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavitation bubbles are found to implode faster, with more ...

  12. Synthesis of arabinoxylan fragments

    DEFF Research Database (Denmark)

    Underlin, Emilie Nørmølle; Böhm, Maximilian F.; Madsen, Robert

    , or production of commercial chemicals which are mainly obtained from fossil fuels today.The arbinoxylan fragments have a backbone of β-1,4-linked xylans with α-L-arabinose units attached at specific positions. The synthesis ultilises an efficient synthetic route, where all the xylan units can be derived from D...

  13. Anchored multi-DOF MEMS gyroscope having robust drive mode

    Science.gov (United States)

    Verma, Payal; Khonina, S. N.; Pavelyev, V. S.; Fomchenkov, S. A.; Uma, B. V.

    2016-12-01

    This paper presents the new architecture of 2-DOF (degree-of-freedom) drive mode and 1-DOF sense mode gyroscope with the concept of additional anchoring that retains all the advantages of the Dynamic Vibration Absorber (DVA) concept while being operated at high frequencies. These concepts allow reduction of the bandwidth by varying the coupling parameter during the design, thereby increasing the mechanical sensitivity. In the present design, the anchoring concept has been implemented by adding a central anchor for the sense mass. The steady state response and design concept have been devised using analytical modeling.

  14. Wave propagation in damage assessment of ground anchors

    Science.gov (United States)

    Zima, B.; Rucka, M.

    2015-07-01

    The inspection possibilities of ground anchors are limited to destructive test such as pull-out test. Guided wave propagation gives an opportunity to develop an inspection system dedicated to determine the condition of inspected element without violation of their integrity. In this paper the experimental study on wave propagation in laboratory models of ground anchors are presented. Experiments were conducted for different bonding lengths and different frequencies of excitation. Waves were generated by a piezoelectric actuator and the laser vibrometry technique was used to register velocity signals. For all tested anchors it was possible to identify the boundary between steel and concrete based on the registered reflections in wave propagation signals.

  15. Organizing signal transduction through A-kinase anchoring proteins (AKAPs).

    Science.gov (United States)

    Logue, Jeremy S; Scott, John D

    2010-11-01

    A fundamental role for protein-protein interactions in the organization of signal transduction pathways is evident. Anchoring, scaffolding and adapter proteins function to enhance the precision and directionality of these signaling events by bringing enzymes together. The cAMP signaling pathway is organized by A-kinase anchoring proteins. This family of proteins assembles enzyme complexes containing the cAMP-dependent protein kinase, phosphoprotein phosphatases, phosphodiesterases and other signaling effectors to optimize cellular responses to cAMP and other second messengers. Selected A-kinase anchoring protein signaling complexes are highlighted in this minireview. © 2010 The Authors Journal compilation © 2010 FEBS.

  16. Configuration of an inelastic flexible anchored cable

    Directory of Open Access Journals (Sweden)

    T. P. Dreyer

    1992-07-01

    Full Text Available Consider an inelastic, perfectly flexible cable with given external forces acting on the total length of the cable. The one end-point is fixed in the origin and the other end-point is anchored at a given point (a;b;c in space. The resulting configuration of the cable in space can be modelled by a system of non-linear differential equations. In this article it is shown that this continuous model of the cable can always be solved in terms of an integral. In the special case of a constant (i.e. independent of the position on the cable external force per unit length the solution is given explicitly in terms of three constants that describe the tension at the origin. These three constants are determined by the boundary values a, b and c at the other end-point, and must be calculated in general by a numerical procedure from the three resulting simultaneous non-linear equations. A few applications of this method are shown.

  17. Material Testing for Robotic Omnidirectional Anchor

    Science.gov (United States)

    Witkoe, Kevin S.

    2012-01-01

    To successfully explore near-Earth Asteroids the question of mobility emerges as the key issue for any robotic mission. When small bodies have extremely low escape velocities, traditional methods, such as wheels, would send the robot hurtling off of the asteroid's surface. To solve this problem, JPL has developed an omni-directional anchoring mechanism for use in microgravity that utilizes microspine technology. These microspines are placed in circular arrays with 16 independent carriages biasing the surface of the rock. The asperities in the surface allow the gripper to hold nearly 150N in all directions. While the gripper has been proven successful on consolidated rocks, it had yet to be tested on a variety of other surfaces that are suspected to separate the large boulders on an asteroid. Since asteroid surfaces vary widely, from friable rocks to lose ponds of regolith, the gripper was tested in a large variety of materials such as, bonded pumice, sand, gravel, and loose rocks. The forces are applied tangent, at 45 degrees, and normal to the surface of the material. The immediate results from this experiment will give insight into the gripper's effectiveness across the wide spectrum of materials found on asteroids.

  18. User's Guide for Tactical Thinking Behaviorally Anchored Rating Scales

    National Research Council Canada - National Science Library

    Phillips, Jennifer K; Ross, Karol G; Shadrick, Scott B

    2006-01-01

    .... In conjunction, measurement techniques must be developed to assess tactical thinking skills. This research product is a user's guide for the Tactical Thinking Behaviorally Anchored Rating Scales (T-BARS...

  19. New Mathematical Modelling of Stabilizing Pile with Prestressed Tieback Anchors

    Directory of Open Access Journals (Sweden)

    Cheng Huang

    2013-01-01

    Full Text Available This paper presents a novel mathematical modelling for analyzing stabilizing piles with prestressed tieback anchors. The new differential equations governing the mechanical response of the stabilizing pile are formulated and the boundary conditions considering the tie-back anchors are mathematically specified. Then, the system of differential equations is numerically solved by the high-accuracy Runge-Kutta finite difference method. A simple computer program has been written on the platform of MATLAB to run the procedure of the proposed algorithm. This approach is entirely different from the traditional finite element method used to design the anchored piles. The FEM is employed to verify the feasibility of the developed method. The comparative case study indicates that the proposed method has more higher modeling and computing efficiency than the FEM and can be an alternative method for designing the anchored pile used for slope stabilization.

  20. The anchoring bias reflects rational use of cognitive resources.

    Science.gov (United States)

    Lieder, Falk; Griffiths, Thomas L; M Huys, Quentin J; Goodman, Noah D

    2017-05-08

    Cognitive biases, such as the anchoring bias, pose a serious challenge to rational accounts of human cognition. We investigate whether rational theories can meet this challenge by taking into account the mind's bounded cognitive resources. We asked what reasoning under uncertainty would look like if people made rational use of their finite time and limited cognitive resources. To answer this question, we applied a mathematical theory of bounded rationality to the problem of numerical estimation. Our analysis led to a rational process model that can be interpreted in terms of anchoring-and-adjustment. This model provided a unifying explanation for ten anchoring phenomena including the differential effect of accuracy motivation on the bias towards provided versus self-generated anchors. Our results illustrate the potential of resource-rational analysis to provide formal theories that can unify a wide range of empirical results and reconcile the impressive capacities of the human mind with its apparently irrational cognitive biases.

  1. Anchored but not internalized: shape dependent endocytosis of nanodiamond

    Science.gov (United States)

    Zhang, Bokai; Feng, Xi; Yin, Hang; Ge, Zhenpeng; Wang, Yanhuan; Chu, Zhiqin; Raabova, Helena; Vavra, Jan; Cigler, Petr; Liu, Renbao; Wang, Yi; Li, Quan

    2017-04-01

    Nanoparticle-cell interactions begin with the cellular uptake of the nanoparticles, a process that eventually determines their cellular fate. In the present work, we show that the morphological features of nanodiamonds (NDs) affect both the anchoring and internalization stages of their endocytosis. While a prickly ND (with sharp edges/corners) has no trouble of anchoring onto the plasma membrane, it suffers from difficult internalization afterwards. In comparison, the internalization of a round ND (obtained by selective etching of the prickly ND) is not limited by its lower anchoring amount and presents a much higher endocytosis amount. Molecular dynamics simulation and continuum modelling results suggest that the observed difference in the anchoring of round and prickly NDs likely results from the reduced contact surface area with the cell membrane of the former, while the energy penalty associated with membrane curvature generation, which is lower for a round ND, may explain its higher probability of the subsequent internalization.

  2. Correlation of Persistence, Initiative and Career Anchors Categories of Students

    Directory of Open Access Journals (Sweden)

    I A Novikova

    2008-03-01

    Full Text Available The article is devoted to the analysis of the results of comparative empirical study of persistence, initiative and Career Anchors categories of the students on the basis of the systemic-functional approach.

  3. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    , it was the central government’s task to coordinate, steer and control the newly emerged decentralized organizations. This raises questions about the overall design of the public sector at present. Our paper engages with the prevalent public governance phenomenon of fragmentation from a design perspective in order......Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  4. [Development and application of bone-anchored hearing aid].

    Science.gov (United States)

    Liu, Yupeng; Yang, Jun

    2013-01-01

    Bone-anchored hearing aid is a hearing assisting technology that raise the hearing level via bone conduct and is also the only implantable hearing assisting device working by bone conduct. Because of the superior performance and simple process of implantation, it brings gospel to the patients who are not fitting the air conducting hearing devices. This article is a review of bone-anchored hearing aid from 6 aspects, including history, principle, indication, consulting, surgery and complication.

  5. Peptide-Mediated Liposome Fusion: The Effect of Anchor Positioning

    Directory of Open Access Journals (Sweden)

    Niek S. A. Crone

    2018-01-01

    Full Text Available A minimal model system for membrane fusion, comprising two complementary peptides dubbed “E” and “K” joined to a cholesterol anchor via a polyethyleneglycol spacer, has previously been developed in our group. This system promotes the fusion of large unilamellar vesicles and facilitates liposome-cell fusion both in vitro and in vivo. Whilst several aspects of the system have previously been investigated to provide an insight as to how fusion is facilitated, anchor positioning has not yet been considered. In this study, the effects of placing the anchor at either the N-terminus or in the center of the peptide are investigated using a combination of circular dichroism spectroscopy, dynamic light scattering, and fluorescence assays. It was discovered that anchoring the “K” peptide in the center of the sequence had no effect on its structure, its ability to interact with membranes, or its ability to promote fusion, whereas anchoring the ‘E’ peptide in the middle of the sequence dramatically decreases fusion efficiency. We postulate that anchoring the ‘E’ peptide in the middle of the sequence disrupts its ability to form homodimers with peptides on the same membrane, leading to aggregation and content leakage.

  6. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  7. Two Approaches for Using Multiple Anchors in NEAT Equating: A Description and Demonstration

    Science.gov (United States)

    Moses, Tim; Deng, Weiling; Zhang, Yu-Li

    2011-01-01

    Nonequivalent groups with anchor test (NEAT) equating functions that use a single anchor can have accuracy problems when the groups are extremely different and/or when the anchor weakly correlates with the tests being equated. Proposals have been made to address these issues by incorporating more than one anchor into NEAT equating functions. These…

  8. Pyramidal anchor stone from Baga waters of Goa, west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    . Pyramidal anchor stones have an apex hole which goes up to the round hole, however Goa anchor stone has no such perforation, but, instead has a rectangular cutting on the apex. The anchor stone is compared with Greek pyramidal anchor stones, and probably...

  9. On the Robustness of Anchoring Effects in WTP and WTA Experiments

    OpenAIRE

    Drew Fudenberg; David K Levine; Zacharias Maniadis

    2010-01-01

    We reexamine the effects of the anchoring manipulation of Ariely, Loewenstein, and Prelec (2003) on the evaluation of common market goods and find very weak anchoring effects. We perform the same manipulation on the evaluation of binary lotteries, and find no anchoring effects at all. This suggests limits on the robustness of anchoring effects. (JEL C91, D12, D44)

  10. Fragment-fragment correlations in near-binary fragmentation of C60

    International Nuclear Information System (INIS)

    Vandenbosch, R.; Henry, B.; Cooper, C.H.; Liang, J.F.; Will, D.I.

    1997-01-01

    The collision dynamics of C 60 with H 2 and He gas has been studied using reverse kinematics. A beam of C 60 - is obtained by electron attachment to neutral molecules exiting an oven and then accelerated to energies between 75 and 150 keV. The collisions take place in a windowless gas cell. We energy analyze the products in a pair of electrostatic analyzers which are oriented so that coincidences between light and heavy fragments can be observed. Our energy, and hence mass, resolution is sufficient to uniquely identify all C n clusters between n=1 and 60. The principal question we are addressing is whether heavy products in the mass range C 34 to C 56 are produced solely by sequential emission of C 2 fragments, or whether longer chains (and possibly rings) compete with C 2 emission. From our coincidence studies we have conclusive evidence that fragments such as C 8 are fragmentation partners to heavy fragments. In general we find that the products of a binary fragmentation are sufficiently excited that sequential decay follows the initial fragmentation. Although only even-n heavy fragments are observed, the coincident light fragments include both odd and even-n fragments due to subsequent fragmentation of the excited lighter partner of the initial binary fragmentation. This scenario has been confirmed by studying coincidences between two light fragments. copyright 1997 American Institute of Physics

  11. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  12. SCALING AND 4-QUARK FRAGMENTATION

    NARCIS (Netherlands)

    SCHOLTEN, O; BOSVELD, GD

    1991-01-01

    The conditions for a scaling behaviour from the fragmentation process leading to slow protons are discussed- The scaling referred to implies that the fragmentation functions depend on the light-cone momentum fraction only. It is shown that differences in the fragmentation functions for valence- and

  13. Analysis of Bacterial Communities in the Rhizosphere of Chrysanthemum via Denaturing Gradient Gel Electrophoresis of PCR-Amplified 16S rRNA as Well as DNA Fragments Coding for 16S rRNA†

    Science.gov (United States)

    Duineveld, Bernadette M.; Kowalchuk, George A.; Keijzer, Anneke; van Elsas, Jan Dirk; van Veen, Johannes A.

    2001-01-01

    The effect of developing chrysanthemum roots on the presence and activity of bacterial populations in the rhizosphere was examined by using culture-independent methods. Nucleic acids were extracted from rhizosphere soil samples associated with the bases of roots or root tips of plants harvested at different stages of development. PCR and reverse transcriptase (RT) PCR were used to amplify 16S ribosomal DNA (rDNA) and 16S rRNA, respectively, and the products were subjected to denaturing gradient gel electrophoresis (DGGE). Prominent DGGE bands were excised and sequenced to gain insight into the identities of predominantly present (PCR) and predominantly active (RT-PCR) bacterial populations. The majority of DGGE band sequences were related to bacterial genera previously associated with the rhizosphere, such as Pseudomonas, Comamonas, Variovorax, and Acetobacter, or typical of root-free soil environments, such as Bacillus and Arthrobacter. The PCR-DGGE patterns observed for bulk soil were somewhat more complex than those obtained from rhizosphere samples, and the latter contained a subset of the bands present in bulk soil. DGGE analysis of RT-PCR products detected a subset of bands visible in the rDNA-based analysis, indicating that some dominantly detected bacterial populations did not have high levels of metabolic activity. The sequences detected by the RT-PCR approach were, however, derived from a wide taxonomic range, suggesting that activity in the rhizosphere was not determined at broad taxonomic levels but rather was a strain- or species-specific phenomenon. Comparative analysis of DGGE profiles grouped all DNA-derived root tip samples together in a cluster, and within this cluster the root tip samples from young plants formed a separate subcluster. Comparison of rRNA-derived bacterial profiles showed no grouping of root tip samples versus root base samples. Rather, all profiles derived from 2-week-old plant rhizosphere soils grouped together regardless of

  14. Sequence analysis of mitochondrial DNA hypervariable region III of ...

    African Journals Online (AJOL)

    The aims of this research were to study mitochondrial DNA hypervariable region III and establish the degree of variation characteristic of a fragment. The mitochondrial DNA (mtDNA) is a small circular genome located within the mitochondria in the cytoplasm of the cell and a smaller 1.2 kb pair fragment, called the control ...

  15. The Serendipity of Fragmentation

    DEFF Research Database (Denmark)

    Leixnering, Stephan; Meyer, Renate E.

    Reform approaches in the public sector led to significant changes in the sector’s design. Especially NPM-inspired reform measures which had largely aimed at organizational disaggregation created pluriform landscapes of public sector organizations (PSOs). Following a core public governance principle...... form of organizing between networks and formal organization: lacking a single center and featuring multiplex and multifaceted relations within the politico-administrative apparatus and between government and PSOs, high fragmentation, local and robust action, but latent structures of significant formal...

  16. New approach towards imaging λ-DNA using scanning tunneling ...

    Indian Academy of Sciences (India)

    Wintec

    Abstract. A new methodology to anchor λ-DNA to silanized n-Si(111) surface using Langmuir Blodget trough was developed. The n-Si (111) was silanized by treating it with low molecular weight octyltrichlorosi- lane in toluene. Scanning tunneling microscopy (STM) image of λ-DNA on octyltrichlorosilane deposited Si.

  17. Generic behaviours in impact fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Sator, N.; Mechkov, S.; Sausset, F. [Paris-6 Univ. Pierre et Marie Curie, Lab. de Physique Theorique de la Matiere Condensee, UMR CNRS 7600, 75 - Paris (France); Mechkov, S. [Ecole Normale Superieure, Lab. de Physique Statistique, 75 - Paris (France)

    2008-02-15

    From atomic nuclei to supernovae, including plates and rocks, every cohesive system can be broken into fragments, provided that the deposited energy is sufficiently large compared to its cohesive energy. We present a simple numerical model for investigating the general properties of fragmentation. By use of molecular dynamics simulations, we study the impact fragmentation of a solid disk of interacting particles with a wall. Regardless of the particular form of the interaction potential, the fragment size distribution exhibits a power law behaviour with an exponent that increases logarithmically with the energy deposited in the system, in agreement with experiments. We expect this behaviour to be generic in fragmentation phenomena. (authors)

  18. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  19. Two potential Petunia hybrida mitochondrial DNA replication origins show structural and in vitro functional homology with the animal mitochondrial DNA heavy and light strand replication origins

    NARCIS (Netherlands)

    Haas, Jan M. de; Hille, Jacques; Kors, Frank; Meer, Bert van der; Kool, Ad J.; Folkerts, Otto; Nijkamp, H. John J.

    1991-01-01

    Four Petunia hybrida mitochondrial (mt) DNA fragments have been isolated, sequenced, localized on the physical map and analyzed for their ability to initiate specific DNA synthesis. When all four mtDNA fragments were tested as templates in an in vitro DNA synthesizing lysate system, developed from

  20. Fragmentation of Chitosan by Acids

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Kasaai

    2013-01-01

    Full Text Available Fragmentation of chitosan in aqueous solution by hydrochloric acid was investigated. The kinetics of fragmentation, the number of chain scissions, and polydispersity of the fragments were followed by viscometry and size exclusion chromatography. The chemical structure and the degree of N-acetylation (DA of the original chitosan and its fragments were examined by 1H NMR spectroscopy and elemental analysis. The kinetic data indicates that the reaction was of first order. The results of polydispersity and the DA suggest that the selected experimental conditions (temperature and concentration of acid were appropriate to obtain the fragments having the polydispersity and the DA similar to or slightly different from those of the original one. A procedure to estimate molecular weight of fragments as well as the number of chain scissions of the fragments under the experimental conditions was also proposed.

  1. Assessing tether anchor labeling and usability in pickup trucks.

    Science.gov (United States)

    Klinich, Kathleen D; Manary, Miriam A; Malik, Laura A; Flannagan, Carol A; Jermakian, Jessica S

    2018-04-03

    The objective of this study was to investigate vehicle factors associated with child restraint tether use and misuse in pickup trucks and evaluate 4 labeling interventions designed to educate consumers on proper tether use. Volunteer testing was performed with 24 subjects and 4 different pickup trucks. Each subject performed 8 child restraint installations among the 4 pickups using 2 forward-facing restraints: a Britax Marathon G4.1 and an Evenflo Triumph. Vehicles were selected to represent 4 different implementations of tether anchors among pickups: plastic loop routers (Chevrolet Silverado), webbing routers (Ram), back wall anchors (Nissan Frontier), and webbing routers plus metal anchors (Toyota Tundra). Interventions included a diagram label, Quick Response (QR) Code linked to video instruction, coordinating text label, and contrasting text tag. Subjects used the child restraint tether in 93% of trials. However, tether use was completely correct in only 9% of trials. An installation was considered functional if the subject attached the tether to a tether anchor and had a tight installation (ignoring routing and head restraint position); 28% of subjects achieved a functional installation. The most common installation error was attaching the tether hook to the anchor/router directly behind the child restraint (near the top of the seatback) rather than placing the tether through the router and attaching it to the anchor in the adjacent seating position. The Nissan Frontier, with the anchor located on the back wall of the cab, had the highest rate of correct installations but also had the highest rate of attaching the tether to components other than the tether anchor (seat adjustor, child restraint storage hook, around head restraint). None of the labeling interventions had a significant effect on correct installation; not a single subject scanned the QR Code to access the video instruction. Subjects with the most successful installations spent extensive time

  2. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2008-10-01

    Full Text Available Abstract Background cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. Results With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation was written in Perl. cDNA-AFLP protocols described in the literatur and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Conclusion Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each

  3. DNA sequencing using fluorescence background electroblotting membrane

    Science.gov (United States)

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  4. DNA sequencing using fluorescence background electroblotting membrane

    Science.gov (United States)

    Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  5. Intermediate mass fragments emission in binary fragmentation model

    International Nuclear Information System (INIS)

    Bhattacharya, C.; Bhattacharya, S.

    1991-01-01

    Intermediate mass fragments emission in intermediate-energy nucleus-nucleus collisions has been studied in the framework of a generalized model where the fragments are assumed to be emitted from binary fissionlike decay of the fully equilibrated compound nucleus. The present formulation, with a schematic exit channel shape configuration and simple rotating liquid-drop nuclear potential, has been found to explain most of the intermediate mass fragments emission cross sections reasonably well without incorporating any free parameters in the calculation

  6. Binding Affinities among DNA Helicase-Primase, DNA Polymerase, and Replication Intermediates in the Replisome of Bacteriophage T7*

    Science.gov (United States)

    Zhang, Huidong; Tang, Yong; Lee, Seung-Joo; Wei, Zeliang; Cao, Jia; Richardson, Charles C.

    2016-01-01

    The formation of a replication loop on the lagging strand facilitates coordinated synthesis of the leading- and lagging-DNA strands and provides a mechanism for recycling of the lagging-strand DNA polymerase. As an Okazaki fragment is completed, the loop is released, and a new loop is formed as the synthesis of a new Okazaki fragment is initiated. Loop release requires the dissociation of the complex formed by the interactions among helicase, DNA polymerase, and DNA. The completion of the Okazaki fragment may result in either a nick or a single-stranded DNA region. In the replication system of bacteriophage T7, the dissociation of the polymerase from either DNA region is faster than that observed for the dissociation of the helicase from DNA polymerase, implying that the replication loop is released more likely through the dissociation of the lagging-strand DNA from polymerase, retaining the polymerase at replication fork. Both dissociation of DNA polymerase from DNA and that of helicase from a DNA polymerase·DNA complex are much faster at a nick DNA region than the release from a ssDNA region. These results suggest that the replication loop is released as a result of the nick formed when the lagging-strand DNA polymerase encounters the previously synthesized Okazaki fragment, releasing lagging-strand DNA and retaining DNA polymerase at the replication fork for the synthesis of next Okazaki fragment. PMID:26620561

  7. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  8. How curved membranes recruit amphipathic helices and protein anchoring motifs.

    Science.gov (United States)

    Hatzakis, Nikos S; Bhatia, Vikram K; Larsen, Jannik; Madsen, Kenneth L; Bolinger, Pierre-Yves; Kunding, Andreas H; Castillo, John; Gether, Ulrik; Hedegård, Per; Stamou, Dimitrios

    2009-11-01

    Lipids and several specialized proteins are thought to be able to sense the curvature of membranes (MC). Here we used quantitative fluorescence microscopy to measure curvature-selective binding of amphipathic motifs on single liposomes 50-700 nm in diameter. Our results revealed that sensing is predominantly mediated by a higher density of binding sites on curved membranes instead of higher affinity. We proposed a model based on curvature-induced defects in lipid packing that related these findings to lipid sorting and accurately predicted the existence of a new ubiquitous class of curvature sensors: membrane-anchored proteins. The fact that unrelated structural motifs such as alpha-helices and alkyl chains sense MC led us to propose that MC sensing is a generic property of curved membranes rather than a property of the anchoring molecules. We therefore anticipate that MC will promote the redistribution of proteins that are anchored in membranes through other types of hydrophobic moieties.

  9. Anchoring effect on first passage process in Taiwan financial market

    Science.gov (United States)

    Liu, Hsing; Liao, Chi-Yo; Ko, Jing-Yuan; Lih, Jiann-Shing

    2017-07-01

    Empirical analysis of the price fluctuations of financial markets has received extensive attention because a substantial amount of financial market data has been collected and because of advances in data-mining techniques. Price fluctuation trends can help investors to make informed trading decisions, but such decisions may also be affected by a psychological factors-the anchoring effect. This study explores the intraday price time series of Taiwan futures, and applies diffusion model and quantitative methods to analyze the relationship between the anchoring effect and price fluctuations during first passage process. Our results indicate that power-law scaling and anomalous diffusion for stock price fluctuations are related to the anchoring effect. Moreover, microscopic price fluctuations before switching point in first passage process correspond with long-term price fluctuations of Taiwan's stock market. We find that microscopic trends could provide useful information for understanding macroscopic trends in stock markets.

  10. Fragmented medial coronoid process

    International Nuclear Information System (INIS)

    Juhasz, Cs.; Juhasz, T.

    1997-01-01

    Fragmented medial coronoid process: (FCP) is often considered to be part of the osteochondrosis dissecans complex, but trauma and growth discrepancies between the radius and ulna are proposed as causes. There is little to clinically differentiate FCP, from osteochondrosis dissecans (OCD) of the elbow. Pain on, flexion-extension of the elbow and lateral rotation of the paw is a little more consistent in FCP. Radiographic examination of the elbow is important despite the, fact that radiographic signs of the FCP are often nonspecific. Excessive osteoarthrosis and superimposition of the radial head and coronoid process make identification of the FCP difficult. Craniocaudal, flexed mediolateral and 25 degree craniocaudal-lateromedial views are necessary for diagnosis. Osteophyte production is more dramatic with FCP than with OCD and suggests therefore the occurrence of OCP in many cases. Although the detached process may be seen on any view, the oblique projection offers the least obstructed view. Exposure of the joint is identical to that for OCD, that means a medial approach with osteotomy of the epicondyle. In most cases the process is loose enough to be readily apparent, but in some it is necessary to exert force on the process in order to find the cleavage plane. It is necessary to remove the osteophytes as well and to inspect and irrigate the joint carefully to remove cartilage fragments before closure. Confinement is advisable for 4 weeks before returning the dog to normal activity. The outlook for function is good if the FCP is removed before secondary degenerative joint disease is well established

  11. A reusable suture anchor for arthroscopy psychomotor skills training.

    Science.gov (United States)

    Tillett, Edward D; Rogers, Rainie; Nyland, John

    2003-03-01

    For residents to adequately develop the early arthroscopy psychomotor skills required to better learn how to manage the improvisational situations they will encounter during actual patient cases, they need to experience sufficient practice repetitions within a contextually relevant environment. Unfortunately, the cost of suture anchors can be a practice repetition-limiting factor in learning arthroscopic knot-tying techniques. We describe a technique for creating inexpensive reusable suture anchors and provide an example of their application to repair the anterior glenoid labrum during an arthroscopy psychomotor skills laboratory training session.

  12. Fullerene-based Anchoring Groups for Molecular Electronics

    DEFF Research Database (Denmark)

    Martin, Christian A.; Ding, Dapeng; Sørensen, Jakob Kryger

    2008-01-01

    We present results on a new fullerene-based anchoring group for molecular electronics. Using lithographic mechanically controllable break junctions in vacuum we have determined the conductance and stability of single-molecule junctions of 1,4-bis(fullero[c]pyrrolidin-1-yl)benzene. The compound can...... be self-assembled from solution and has a low-bias conductance of 3 × 10-4 G0. Compared to 1,4-benzenedithiol the fullerene-anchored molecule exhibits a considerably lower conductance spread. In addition, the signature of the new compound in histograms is more significant than that of 1,4-benzenediamine...

  13. Experience-based, body-anchored qualitative research interviewing

    DEFF Research Database (Denmark)

    Stelter, Reinhard

    2010-01-01

    -anchored interviewing, and second, by an interview guide that explores a research participant's personal experience with mindfulness meditation. An excerpt from an interview is discussed to illustrate the advantages of this interview form, namely its value as a methodological instrument for qualitative research......Two theoretical constructs that lay the foundation for experience-based, body-anchored interviewing are presented: the first-person perspective and the concept of meaning. These theoretical concepts are concretized, first, by means of a methodological framework for experience-based, body...

  14. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  15. Atomic Force Microscopy of Biochemically Tagged DNA

    Science.gov (United States)

    Murray, Matthew N.; Hansma, Helen G.; Bezanilla, Magdalena; Sano, Takeshi; Ogletree, D. Frank; Kolbe, William; Smith, Casandra L.; Cantor, Charles R.; Spengler, Sylvia; Hansma, Paul K.; Salmeron, Miquel

    1993-05-01

    Small fragments of DNA of known length were made with the polymerase chain reaction. These fragments had biotin molecules covalently attached at their ends. They were subsequently labeled with a chimeric protein fusion between streptavidin and two immunoglobulin G-binding domains of staphyloccocal protein A. This tetrameric species was expected to bind up to four DNA molecules via their attached biotin moieties. The DNA-protein complex was deposited on mica and imaged with an atomic force microscope. The images revealed the protein chimera at the expected location at the ends of the strands of DNA as well as the expected dimers, trimers, and tetramers of DNA bound to a single protein.

  16. Fluctuations in the fragmentation process

    International Nuclear Information System (INIS)

    Botet, R.; Ploszajczak, M.

    1993-01-01

    Some general framework of sequential fragmentation is presented, as provided by the newly proposed Fragmentation - Inactivation - Binary model, and to study briefly its basic and universal features. This model includes as particular cases most of the previous kinetic fragmentation models. In particular it is discussed how one arrives in this framework to the critical behaviour, called the shattering transition. This model is then compared to recent data on gold multifragmentation at 600 MeV/nucl. (authors) 20 refs., 5 figs

  17. An Algebra for Program Fragments

    DEFF Research Database (Denmark)

    Kristensen, Bent Bruun; Madsen, Ole Lehrmann; Møller-Pedersen, Birger

    1985-01-01

    Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar and by variab......Program fragments are described either by strings in the concrete syntax or by constructor applications in the abstract syntax. By defining conversions between these forms, both may be intermixed. Program fragments are constructed by terminal and nonterminal symbols from the grammar...... and by variables having program fragments as values. Basic operations such as valuetransfer, composition and decomposition are defined for program fragments allowing more complicated operations to be implemented. Usual operations such as testing for equality are defined, and in addition more specialized operations...... such as testing that a program fragment is derivable from another and converting program fragments in concrete form to abstract form are defined. By introducing regular expressions in the grammar these may be used in program fragments in concrete form. By defining constructors for regular expressions these may...

  18. MRI of displaced meniscal fragments

    International Nuclear Information System (INIS)

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  19. Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination

    Energy Technology Data Exchange (ETDEWEB)

    Nogueira, Patricia [CESAM and Departamento de Biologia, Universidade de Aveiro, Campus de Santiago, 3810-193 Aveiro (Portugal); Department of Biology and Environmental Science, University of Sussex, Falmer, Brighton BN1 9QJ (United Kingdom); Pacheco, Mario [CESAM and Departamento de Biologia, Universidade de Aveiro, Campus de Santiago, 3810-193 Aveiro (Portugal); Lourdes Pereira, M. [CICECO and Departamento de Biologia, Universidade de Aveiro, Campus de Santiago, 3810-193 Aveiro (Portugal); Mendo, Sonia [CESAM and Departamento de Biologia, Universidade de Aveiro, Campus de Santiago, 3810-193 Aveiro (Portugal); Rotchell, Jeanette M., E-mail: J.Rotchell@sussex.ac.u [Department of Biology and Environmental Science, University of Sussex, Falmer, Brighton BN1 9QJ (United Kingdom)

    2010-05-15

    The responses of Dicentrarchus labrax and Liza aurata to aquatic pollution were assessed in a contaminated coastal lagoon, using both traditional and novel biomarkers combined. DNA damage, assessed by comet assay, was higher in both fish species from the contaminated sites, whereas levels of cytochrome P450 1A1 gene expression were not significantly altered. The liver histopathological analysis also revealed significant lesions in fish from contaminated sites. Alterations in ras and xpf genes were analysed and additional pollutant-responsive genes were identified. While no alterations were found in ras gene, a downregulation of xpf gene was observed in D. labrax from a contaminated site. Suppression subtractive hybridization applied to D. labrax collected at a contaminated site, revealed altered expression in genes involved in energy metabolism, immune system activity and antioxidant response. The approach and results reported herein demonstrate the utility of anchoring traditional biomarker responses alongside novel biomarker responses. - Novel molecular biomarkers of aquatic environmental contamination in fish.

  20. Anchoring novel molecular biomarker responses to traditional responses in fish exposed to environmental contamination

    International Nuclear Information System (INIS)

    Nogueira, Patricia; Pacheco, Mario; Lourdes Pereira, M.; Mendo, Sonia; Rotchell, Jeanette M.

    2010-01-01

    The responses of Dicentrarchus labrax and Liza aurata to aquatic pollution were assessed in a contaminated coastal lagoon, using both traditional and novel biomarkers combined. DNA damage, assessed by comet assay, was higher in both fish species from the contaminated sites, whereas levels of cytochrome P450 1A1 gene expression were not significantly altered. The liver histopathological analysis also revealed significant lesions in fish from contaminated sites. Alterations in ras and xpf genes were analysed and additional pollutant-responsive genes were identified. While no alterations were found in ras gene, a downregulation of xpf gene was observed in D. labrax from a contaminated site. Suppression subtractive hybridization applied to D. labrax collected at a contaminated site, revealed altered expression in genes involved in energy metabolism, immune system activity and antioxidant response. The approach and results reported herein demonstrate the utility of anchoring traditional biomarker responses alongside novel biomarker responses. - Novel molecular biomarkers of aquatic environmental contamination in fish.

  1. The nucleoplasmin homolog NLP mediates centromere clustering and anchoring to the nucleolus.

    Science.gov (United States)

    Padeken, Jan; Mendiburo, María José; Chlamydas, Sarantis; Schwarz, Hans-Jürgen; Kremmer, Elisabeth; Heun, Patrick

    2013-04-25

    Centromere clustering during interphase is a phenomenon known to occur in many different organisms and cell types, yet neither the factors involved nor their physiological relevance is well understood. Using Drosophila tissue culture cells and flies, we identified a network of proteins, including the nucleoplasmin-like protein (NLP), the insulator protein CTCF, and the nucleolus protein Modulo, to be essential for the positioning of centromeres. Artificial targeting further demonstrated that NLP and CTCF are sufficient for clustering, while Modulo serves as the anchor to the nucleolus. Centromere clustering was found to depend on centric chromatin rather than specific DNA sequences. Moreover, unclustering of centromeres results in the spatial destabilization of pericentric heterochromatin organization, leading to partial defects in the silencing of repetitive elements, defects during chromosome segregation, and genome instability. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. The importance of anchor text for ad hoc search revisited

    NARCIS (Netherlands)

    Koolen, M.; Kamps, J.; Chen, H.-H.; Efthimiadis, E.N.; Savoy, J.; Crestani, F.; Marchand-Maillet, S.

    2010-01-01

    It is generally believed that propagated anchor text is very important for effective Web search as offered by the commercial search engines. "Google Bombs" are a notable illustration of this. However, many years of TREC Web retrieval research failed to establish the effectiveness of link evidence

  3. Comparative study of retentive anchor systems for overdentures.

    Science.gov (United States)

    Svetlize, Carlos A; Bodereau, Enrique Fernández

    2004-06-01

    This study aimed to evaluate the retention on two or four implants of eight resilient and nonresilient retentive anchors used in overdentures. Eight groups of retentive anchors were used: Dyna and Shiner (magnets); Dalla Bona and O-Ring (balls); Ceka Revax and Zaag attachments (studs); the cast bar (Dolder type) system with plastic clips; and the milled bars system. These specimens with their respective overdentures were prepared on two similar acrylic resin models with four implants (3.75 x 13 mm). Ten tensile strength tests (Instron) were performed on each group at a speed of 3 mm per minute. The statistical analysis (one-way analysis of variance, Tukey's HSD test) was considered significant. The pull force values ranged between 0.400 and 3.800 daN (International System of Units). There was a significant difference in retention in favor of the milled bars in comparison with the Ceka Revax, Hader bars, Zaag attachments, O-Ring, and Dyna groups, and a marginally significant difference compared with the Dalla Bona group. There was a highly significant difference with the Shiner magnets. The milled bar system was the most retentive anchor, with the Dalla Bona, Ceka Revax, Hader Bar, Zaag attachment, and O-Ring groups being the second most retentive. The least retentive groups were the Shiner and Dyna magnets. Proper abutment placement in the mandible and the correct selection of the retentive anchor will improve overdenture retention.

  4. Testing the specifications of parametric models using anchoring vignettes

    NARCIS (Netherlands)

    van Soest, A.H.O.; Vonkova, H.

    Comparing assessments on a subjective scale across countries or socio-economic groups is often hampered by differences in response scales across groups. Anchoring vignettes help to correct for such differences, either in parametric models (the compound hierarchical ordered probit (CHOPIT) model and

  5. Local ecological knowledge (LEK) on fish behavior around anchored FADs

    NARCIS (Netherlands)

    Macusi, Edison D.; Abreo, Neil A.S.; Babaran, Ricardo P.

    2017-01-01

    The Fishing Industry in the Philippines plays an important role in the food and employment need of Filipino fishers. By using anchored Fish Aggregating Devices (FADs or payao), the Philippine tuna fisheries was transformed into a million-dollar industry. Minimal studies on exploitation rates and

  6. Isolation by the 5 anchored PCR technique and characterization of ...

    Indian Academy of Sciences (India)

    Isolation by the 5 anchored PCR technique and characterization of eighteen microsatellite loci in horseshoe crab (Tachypleus gigas). LIEW PUI LING, ABU BAKAR ADIBAH, SOON GUAN TAN. ∗. , ANNIE CHRISTIANUS and QAMARUZ ZAMAN FARIDAH. Universiti Putra Malaysia, UPM Serdang, Selangor, 43400, Malaysia.

  7. The role of personal protective factors in anchoring psychological ...

    African Journals Online (AJOL)

    Erna Kinsey

    In this article I report on a study that focused on the concept of resilience, in order to determine the nature of personal attributes in adoles cents with ... nine key personal attributes which anchored resilience and promoted self actualisation, despite obstacle ridden circumstances. Introduction ... and result in vulnerability.

  8. The relation between career anchors, emotional intelligence and ...

    African Journals Online (AJOL)

    satisfaction. Prof. M. Coetzee and Prof. D. Schreuder are in the Department of Industrial and Organisational Psychology,. University of South Africa. E-mail: ... People's career anchors influence their career choices, life satisfaction, and job and ... employees' subjective work experiences, and job and career satisfaction.

  9. Ten Anchor Points for Teaching Principles of Marketing

    Science.gov (United States)

    Tomkovick, Chuck

    2004-01-01

    Effective marketing instructors commonly share a love for their students, an affinity for the subject matter, and a devotion to continuous quality improvement. The purpose of this article is to highlight 10 anchor points for teaching Principles of Marketing, which are designed to better engage students in the learning process. These anchor…

  10. Stable Pt clusters anchored to monovacancies on graphene sheets

    Energy Technology Data Exchange (ETDEWEB)

    Medasani, Bharat K.; Liu, Jun; Sushko, Maria L.

    2017-10-09

    Abstract

    anchor'>

  11. Analytical Model for Hook Anchor Pull-Out

    DEFF Research Database (Denmark)

    Brincker, Rune; Ulfkjær, Jens Peder; Adamsen, Peter

    1995-01-01

    A simple analytical model for the pull-out of a hook anchor is presented. The model is based on a simplified version of the fictitious crack model. It is assumed that the fracture process is the pull-off of a cone shaped concrete part, simplifying the problem by assuming pure rigid body motions...

  12. Analytical Model for Hook Anchor Pull-out

    DEFF Research Database (Denmark)

    Brincker, Rune; Ulfkjær, J. P.; Adamsen, P.

    A simple analytical model for the pull-out of a hook anchor is presented. The model is based on a simplified version of the fictitious crack model. It is assumed that the fracture process is the pull-off of a cone shaped concrete part, simplifying the problem by assuming pure rigid body motions...

  13. Culturally-Anchored Values and University Education Experience Perception

    Science.gov (United States)

    Mitsis, Ann; Foley, Patrick

    2009-01-01

    Purpose: The purpose of this paper is to examine whether business students' gender, age and culturally-anchored values affect their perceptions of their university course experience. Design/methodology/approach: Culturally diverse business students (n 1/4 548) studying at an Australian university were surveyed using previously established scales.…

  14. Empirical evidence for resource-rational anchoring and adjustment.

    Science.gov (United States)

    Lieder, Falk; Griffiths, Thomas L; M Huys, Quentin J; Goodman, Noah D

    2017-05-08

    People's estimates of numerical quantities are systematically biased towards their initial guess. This anchoring bias is usually interpreted as sign of human irrationality, but it has recently been suggested that the anchoring bias instead results from people's rational use of their finite time and limited cognitive resources. If this were true, then adjustment should decrease with the relative cost of time. To test this hypothesis, we designed a new numerical estimation paradigm that controls people's knowledge and varies the cost of time and error independently while allowing people to invest as much or as little time and effort into refining their estimate as they wish. Two experiments confirmed the prediction that adjustment decreases with time cost but increases with error cost regardless of whether the anchor was self-generated or provided. These results support the hypothesis that people rationally adapt their number of adjustments to achieve a near-optimal speed-accuracy tradeoff. This suggests that the anchoring bias might be a signature of the rational use of finite time and limited cognitive resources rather than a sign of human irrationality.

  15. Anchoring return: the role of the Solutions Strategy

    Directory of Open Access Journals (Sweden)

    Pierfrancesco Maria Natta

    2014-05-01

    Full Text Available Providing a minimum standard of living and livelihood opportunities to help anchor those who have returned is critical for the future stability and security of Afghanistan. This is one of the three main objectives of the 2012 Solutions Strategy for Afghan Refugees.

  16. A Proteomics Investigation of Anchored PKA-RI Signaling

    NARCIS (Netherlands)

    Kovanich, D.

    2013-01-01

    Compartmentalization of kinases and phosphatases plays an important role in the specificity of second messenger mediated signaling events. Localization of the cAMP-dependent protein kinase is mediated by interaction of its regulatory subunit (PKA-R) with the versatile family of A-kinase anchoring

  17. Fullerene-based Anchoring Groups for Molecular Electronics

    DEFF Research Database (Denmark)

    Martin, Christian A.; Ding, Dapeng; Sørensen, Jakob Kryger

    2008-01-01

    We present results on a new fullerene-based anchoring group for molecular electronics. Using lithographic mechanically controllable break junctions in vacuum we have determined the conductance and stability of single-molecule junctions of 1,4-bis(fullero[c]pyrrolidin-1-yl)benzene. The compound can...

  18. Modified Anchor Shaped Post Core Design for Primary Anterior Teeth

    Directory of Open Access Journals (Sweden)

    R. Rajesh

    2014-01-01

    Full Text Available Restoring severely damaged primary anterior teeth is challenging to pedodontist. Many materials are tried as a post core but each one of them has its own drawbacks. This a case report describing a technique to restore severely damaged primary anterior teeth with a modified anchor shaped post. This technique is not only simple and inexpensive but also produces better retention.

  19. Poor Anchoring Limits Dyslexics' Perceptual, Memory, and Reading Skills

    Science.gov (United States)

    Oganian, Yulia; Ahissar, Merav

    2012-01-01

    The basic deficits underlying the severe and persistent reading difficulties in dyslexia are still highly debated. One of the major topics of debate is whether these deficits are language specific, or affect both verbal and non-verbal stimuli. Recently, Ahissar and colleagues proposed the "anchoring-deficit hypothesis" (Ahissar, Lubin,…

  20. Stone anchors from the Okhamandal region, Gujarat Coast, India

    Digital Repository Service at National Institute of Oceanography (India)

    Sundaresh; Gaur, A.S.; Gudigar, P.; Tripati, S.; Vora, K.H.; Bandodkar, S.N.

    period particularly on south-western coast of the island while stone anchors were noticed on the eastern coast of the island where medieval period remains can be noticed in the form of pottery, cannons and a few stone structures. Similar type of stone...