Multifragment alleles in DNA fingerprints of the parrot, Amazona ventralis

Science.gov (United States)

Brock, M.K.; White, B.N.

1991-01-01

Human DNA probes that identify variable numbers of tandem repeat loci are being used to generate DNA fingerprints in many animal and plant species. In most species the majority of the sc rable autoradiographic bands of the DNA fingerprint represent alleles from numerous unlinked loci. This study was initiated to use DNA fingerprints to determine the amount of band-sharing among captive Hispaniolan parrots (Amazona ventralis) with known genetic relationships. This would form the data base to examine DNA fingerprints of the closely related and endangered Puerto Rican parrot (A. vittata) and to estimate the degree of inbreeding in the relic population. We found by segregation analysis of the bands scored in the DNA fingerprints of the Hispaniolan parrots that there may be as few as two to five loci identified by the human 33.15 probe. Furthermore, at one locus we identified seven alleles, one of which is represented by as many as 19 cosegregating bands. It is unknown how common multiband alleles might be in natural populations, and their existence will cause problems in the assessment of relatedness by band-sharing analysis. We believe, therefore, that a pedigree analysis should be included in all DNA fingerprinting studies, where possible, in order to estimate the number of loci identified by a minisatellite DNA probe and to examine the nature of their alleles.

Application of DNA fingerprints for cell-line individualization.

OpenAIRE

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-01-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

Beware of the possibility of fingerprinting techniques transferring DNA.

Science.gov (United States)

van Oorschot, Roland A H; Treadwell, Sally; Beaurepaire, James; Holding, Nicole L; Mitchell, Robert J

2005-11-01

Fingerprinting brushes have the potential to collect and transfer DNA during powdering. Squirrel-hair fingerprint brushes exposed to specific sets of saliva stains and brushes used in routine casework were tested for their ability to collect and transfer DNA containing material using standard DNA extraction procedures and AmpFlSTR Profiler Plus amplification and typing procedures. The tests found that the risk of transferring DNA during powdering and having a detrimental impact on the analysis increases if the examiner powders over either biological stains (such as blood or saliva) or very fresh prints and uses more sensitive PCR amplification and typing procedures. We advocate caution when powdering prints from which DNA may also be collected and provide options for consideration to limit the risk of transferred DNA contamination while fingerprinting.

Diversity of DNA fingerprints in Cryptococcus neoformans.

Science.gov (United States)

Varma, A; Swinne, D; Staib, F; Bennett, J E; Kwon-Chung, K J

1995-07-01

DNA fingerprint patterns of 156 Cryptococcus neoformans isolates (26 AIDS patients, 46 non-AIDS patients, and 40 environmental sources) from both varieties (126 C. neoformans var. neoformans and 30 C. neoformans var. gattii isolates) and from seven countries were analyzed by using the DNA probe UT-4p. Nine and twelve distinct DNA fingerprint patterns were observed for isolates of the C. neoformans var. neoformans and var. gattii, respectively. No pattern was unique to AIDS patients, non-AIDS patients, or the environment. Pattern II was observed more often in non-AIDS patients (8 of 23) than in AIDS patients (0 of 25). Pattern V was the most prevalent pattern (42 of 82) in clinical and environmental isolates. Isolates from three AIDS patients in Burundi and Zaire exhibited patterns identical to each other but different from those of isolates collected from their houses (i.e., dust of floors, walls, etc.) or a nearby pigeon coop. DNA fingerprint stability was determined for 53 isolates from nine non-AIDS patients at different time intervals during 5 to 128 weeks of antifungal therapy. For eight patients, the fingerprint pattern was stable while the ninth may have had a mixed infection. Pattern II was observed in 4 of 9 patients, which is similar to 4 of 14 in other non-AIDS patients as reported here. In spite of the extensive pattern heterogeneity among 15 C. neoformans var. gattii isolates in Australia, the patterns observed in seven California isolates were quite different from those in Australia. Among isolates of C. neoformans var. gattii, one fingerprint pattern (designated b) was observed in several countries of the Far East. The fingerprint patterns of two of three environmental isolates from Eucalyptus camaldulensis trees in Australia were identical to those of 2 of the 12 clinical isolates from the country.

Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD

Directory of Open Access Journals (Sweden)

Silva L.M.

2001-01-01

Full Text Available The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA, developed by Heath et al. [Nucleic Acids Research (1993 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

DNA fingerprinting of the NCI-60 cell line panel.

Science.gov (United States)

Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

2009-04-01

The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

DNA fingerprinting in botany: past, present, future

OpenAIRE

Nybom, Hilde; Weising, Kurt; Rotter, Björn

2014-01-01

Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the n...

A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

Science.gov (United States)

Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

2015-01-01

A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

Directory of Open Access Journals (Sweden)

Chi-Jim Chen

2015-03-01

Full Text Available A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS, successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM, based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates.

Recovery of DNA and fingerprints from touched documents.

Science.gov (United States)

Sewell, Jonathan; Quinones, Ignacio; Ames, Carole; Multaney, Bryan; Curtis, Stuart; Seeboruth, Haj; Moore, Stephen; Daniel, Barbara

2008-09-01

This study investigated the various factors affecting DNA profiling from DNA recovered from fingerprints deposited on paper before and after fingerprint enhancement treatments. The DNeasy plant mini kit (QIAGEN) was found to improve DNA recovery from paper by over 150% compared with the QIAamp mini kit. A significant decrease in the amount of DNA recovered was observed following treatment with DFO and/or Ninhydrin. This decrease in yield did not have a comparably significant effect on the quality of the SGM Plus profiles. Furthermore, this study found that whilst certain paper types, such as newspaper, magazine and filter paper allowed for the good recovery of DNA, common office paper and white card, strongly interfered with the recovery of DNA resulting in poor quality profiles.

Laser mass spectrometry for DNA fingerprinting for forensic applications

Science.gov (United States)

Chen, C. H. Winston; Tang, Kai; Taranenko, N. I.; Allman, S. L.; Ch'ang, L. Y.

1994-10-01

The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual's DNA structure is identical within all tissues oftheir body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et aL2 found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. Take the Huntington gene as an example, there are CAG trinucleotide repeats. For normal people, the number of CAG repeats is usually between 10 and 40. Since people have chromosomes in pairs, the possibility oftwo individuals having the same VNTR in the Huntington gene is less than one percent, ifwe assume equal distribution for various repeats. When several allels containing VNTR are analyzed for the number of repeats, the possibility of two individuals being exactly identical becomes very unlikely. Thus, DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endornuclease sites can provide the basis for identification.

Typing DNA profiles from previously enhanced fingerprints using direct PCR.

Science.gov (United States)

Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian

2017-07-01

Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold ® DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017

An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

Science.gov (United States)

Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

2018-01-01

DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

Teaching DNA Fingerprinting using a Hands-on Simulation.

Science.gov (United States)

Schug, Thatcher

1998-01-01

Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

Science.gov (United States)

Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

2004-11-01

Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

Integrated DNA and fingerprint analyses in the identification of 60-year-old mummified human remains discovered in an Alaskan glacier.

Science.gov (United States)

Loreille, Odile M; Parr, Ryan L; McGregor, Kevin A; Fitzpatrick, Colleen M; Lyon, Chriss; Yang, Dongya Y; Speller, Camilla F; Grimm, Michael R; Grimm, Michael J; Irwin, Jodi A; Robinson, Edward M

2010-05-01

This report describes the identification of a merchant mariner who perished in 1948 when Northwest Airlines Flight 4422, a DC-4 carrying 24 seamen and six crew members crashed into Mount Sanford, Alaska. Fifty-one years later, a human forearm and hand were found close by the wreckage of the plane, prompting identification efforts using DNA and fingerprints. There were significant challenges to both the fingerprint and DNA analyses. The hand was badly desiccated, making fingerprint friction-ridge detail almost invisible and the remains had been embalmed upon discovery, making DNA amplification difficult. We present the results of an interdisciplinary approach that successfully addressed these challenges and ultimately led to the identification of the remains. These efforts relied on efficient fingerprint rejuvenation and imaging techniques that improved print resolution, as well as new DNA extraction techniques optimized for aggressively embalmed remains.

Cluster analysis of Helicobacter pylori genomic DNA fingerprints suggests gastroduodenal disease-specific associations.

Science.gov (United States)

Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R

1995-07-01

Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.

Cloning and Characterization of a Complex DNA Fingerprinting Probe for Candida parapsilosis

Science.gov (United States)

Enger, Lee; Joly, Sophie; Pujol, Claude; Simonson, Patricia; Pfaller, Michael; Soll, David R.

2001-01-01

Candida parapsilosis accounts for a significant number of nosocomial fungemias, but in fact, no effective and verified genetic fingerprinting method has emerged for assessing the relatedness of independent isolates for epidemiological studies. A complex 15-kb DNA fingerprinting probe, Cp3-13, was therefore isolated from a library of C. parapsilosis genomic DNA fragments. The efficacy of Cp3-13 for DNA fingerprinting was verified by a comparison of its clustering capacity with those of randomly amplified polymorphic DNA analysis and internally transcribed spacer region sequencing, by testing species specificity, and by assessing its capacity to identify microevolutionary changes both in vitro and in vivo. Southern blot hybridization of EcoRI/SalI-digested DNA with Cp3-13 provides a fingerprinting system that (i) identifies the same strain in independent isolates, (ii) discriminates between unrelated isolates, (iii) separates independent isolates into valid groups in a dendrogram, (iv) identifies microevolution in infecting populations, and (v) is amenable to automatic computer-assisted DNA fingerprint analysis. This probe is now available for epidemiological studies. PMID:11158125

Acetone facilitated DNA sampling from electrical tapes improves DNA recovery and enables latent fingerprints development.

Science.gov (United States)

Feine, Ilan; Shpitzen, Moshe; Geller, Boris; Salmon, Eran; Peleg, Tsach; Roth, Jonathan; Gafny, Ron

2017-07-01

Electrical tapes (ETs) are a common component of improvised explosive devices (IEDs) used by terrorists or criminal organizations and represent a valuable forensic resource for DNA and latent fingerprints recovery. However, DNA recovery rates are typically low and usually below the minimal amount required for amplification. In addition, most DNA extraction methods are destructive and do not allow further latent fingerprints development. In the present study a cell culture based touch DNA model was used to demonstrate a two-step acetone-water DNA recovery protocol from ETs. This protocol involves only the adhesive side of the ET and increases DNA recovery rates by up to 70%. In addition, we demonstrated partially successful latent fingerprints development from the non-sticky side of the ETs. Taken together, this protocol maximizes the forensic examination of ETs and is recommended for routine casework processing. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA fingerprints come to court

International Nuclear Information System (INIS)

Anon.

1988-01-01

DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person

Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

Science.gov (United States)

Bowden, G; Johnson, J; Schachtele, C

1993-08-01

Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

Touch DNA collection versus firearm fingerprinting: comparing evidence production and identification outcomes.

Science.gov (United States)

Nunn, Samuel

2013-05-01

A project by a metropolitan police agency in 2008-2009 had police use touch DNA kits to collect cell samples from seized firearms. To assess outcomes, results of touch DNA swabbing of firearms were compared to fingerprinting firearm evidence. The rationale was that fingerprinting, as the older technology, was the baseline against which to compare touch DNA. But little is known about ways to measure touch DNA productivity compared to fingerprinting. To examine differences between the two requires comparable measurements. Two measures were used: quantity of probative or investigative evidence produced and identification outcomes. When applied to firearms seized within an Indianapolis, IN police district, touch DNA produced a larger volume of evidence than fingerprinting, but identification outcomes for the two methods were equal. Because touch DNA was deployed by police patrol officers, there are implications for firearm forensics and the choice of forensic approaches used by police. © 2013 American Academy of Forensic Sciences.

Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes.

Science.gov (United States)

Tims, Sebastian; van Wamel, Willem; Endtz, Hubert P; van Belkum, Alex; Kayser, Manfred

2010-09-01

Human fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically restricted DNA diversity. We tested the suitability of physical fingerprints for revealing human host information, with geographic inference as example, via microbial DNA fingerprinting. We showed that the transient exogenous fingertip microflora is frequently different from the resident endogenous bacteria of the same individuals. In only 54% of the experiments, the DNA analysis of the transient fingertip microflora allowed the detection of defined, but often not the major, elements of the resident microflora. Although we found microbial persistency in certain individuals, time-wise variation of transient and resident microflora within individuals was also observed when resampling fingerprints after 3 weeks. While microbial species differed considerably in their frequency spectrum between fingerprint samples from volunteers in Europe and southern Asia, there was no clear geographic distinction between Staphylococcus strains in a cluster analysis, although bacterial genotypes did not overlap between both continental regions. Our results, though limited in quantity, clearly demonstrate that the dynamic fingerprint microflora challenges human host inferences for forensic purposes including geographic ones. Overall, our results suggest that human fingerprint microflora is too dynamic to allow for forensic marker developments for retrieving human information.

[An analysis of the DNA fingerprinting of intestinal flora in inflammatory bowel disease].

Science.gov (United States)

Li, Run-mei; Han, Ying; Wang, Ji-heng; Wang, Zhi-hong

2007-02-01

DNA fingerprinting for inflammatory bowel disease (IBD) patients and healthy subjects was carried out to compare the difference of intestinal flora between the two groups. DNA fingerprinting for IBD patients and healthy persons was set up with enterobacterial repetitive intergenic consensus (ERIC-PCR) technology and the difference of intestinal flora between the two groups compared. DNA fingerprinting of the IBD patients and healthy subjects was identified and a significant difference was noticed between them. There were lots of bands in the DNA fingerprinting of the healthy subjects but few in that of the IBD patients. Strikingly, same distribution of the principal band of DNA fingerprinting was noticed in IBD patients. The variety of intestinal flora in healthy subjects is more apparent than that in IBD patients. An unique principal band might be the sequence of the presence of specific etiopathogenetic bacterium, or it might be the combined sequence of mixed bacterial flora.

An overview of DNA fingerprinting with 32P nucleotides

International Nuclear Information System (INIS)

Pappas, G.G.

1992-01-01

The DNA probes radiolabeled with 32 P, a primary tool employed by researchers in the life sciences for > 20 yr, are used by private companies, state-run laboratories, and the FBI to generate autoradiographs displaying the unique banding patterns that constitute the DNA fingerprint. The ability to identify an individual or animal from a biological sample has profound implications. Unidentified bodies, unrecognizable remains, and missing children can be tested and the DNA fingerprint compared to those of family members for positive identification. Paternity can be established before a child's birth. Immigration disputes can easily be resolved. Other uses include pedigree determination and testing for cell-line cross-contamination. Using a DNA fingerprint to determine the guilt or innocence of an individual allegedly involved in a violent crime is very controversial and has great legal and moral implications for society. Forensic laboratories have been challenged to ensure a level of quality control and quality assurance consistent with the weight given to these tests when used as evidence in a court of law

Efficient Filtering of Noisy Fingerprint Images

Directory of Open Access Journals (Sweden)

Maria Liliana Costin

2016-01-01

Full Text Available Fingerprint identification is an important field in the wide domain of biometrics with many applications, in different areas such: judicial, mobile phones, access systems, airports. There are many elaborated algorithms for fingerprint identification, but none of them can guarantee that the results of identification are always 100 % accurate. A first step in a fingerprint image analysing process consists in the pre-processing or filtering. If the result after this step is not by a good quality the upcoming identification process can fail. A major difficulty can appear in case of fingerprint identification if the images that should be identified from a fingerprint image database are noisy with different type of noise. The objectives of the paper are: the successful completion of the noisy digital image filtering, a novel more robust algorithm of identifying the best filtering algorithm and the classification and ranking of the images. The choice about the best filtered images of a set of 9 algorithms is made with a dual method of fuzzy and aggregation model. We are proposing through this paper a set of 9 filters with different novelty designed for processing the digital images using the following methods: quartiles, medians, average, thresholds and histogram equalization, applied all over the image or locally on small areas. Finally the statistics reveal the classification and ranking of the best algorithms.

[Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

Science.gov (United States)

Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

2010-04-01

Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

Science.gov (United States)

Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

2017-07-01

In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical

Fingerprint Image Enhancement Based on Second Directional Derivative of the Digital Image

Directory of Open Access Journals (Sweden)

Onnia Vesa

2002-01-01

Full Text Available This paper presents a novel approach of fingerprint image enhancement that relies on detecting the fingerprint ridges as image regions where the second directional derivative of the digital image is positive. A facet model is used in order to approximate the derivatives at each image pixel based on the intensity values of pixels located in a certain neighborhood. We note that the size of this neighborhood has a critical role in achieving accurate enhancement results. Using neighborhoods of various sizes, the proposed algorithm determines several candidate binary representations of the input fingerprint pattern. Subsequently, an output binary ridge-map image is created by selecting image zones, from the available binary image candidates, according to a MAP selection rule. Two public domain collections of fingerprint images are used in order to objectively assess the performance of the proposed fingerprint image enhancement approach.

Detection of visible and latent fingerprints using micro-X-ray fluorescence elemental imaging.

Science.gov (United States)

Worley, Christopher G; Wiltshire, Sara S; Miller, Thomasin C; Havrilla, George J; Majidi, Vahid

2006-01-01

Using micro-X-ray fluorescence (MXRF), a novel means of detecting fingerprints was examined in which the prints were imaged based on their elemental composition. MXRF is a nondestructive technique. Although this method requires a priori knowledge about the approximate location of a print, it offers a new and complementary means for detecting fingerprints that are also left pristine for further analysis (including potential DNA extraction) or archiving purposes. Sebaceous fingerprints and those made after perspiring were detected based on elements such as potassium and chlorine present in the print residue. Unique prints were also detected including those containing lotion, saliva, banana, or sunscreen. This proof-of-concept study demonstrates the potential for visualizing fingerprints by MXRF on surfaces that can be problematic using current methods.

Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

Energy Technology Data Exchange (ETDEWEB)

Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

1997-03-01

Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

Three-dimensional imaging of artificial fingerprint by optical coherence tomography

Science.gov (United States)

Larin, Kirill V.; Cheng, Yezeng

2008-03-01

Fingerprint recognition is one of the popular used methods of biometrics. However, due to the surface topography limitation, fingerprint recognition scanners are easily been spoofed, e.g. using artificial fingerprint dummies. Thus, biometric fingerprint identification devices need to be more accurate and secure to deal with different fraudulent methods including dummy fingerprints. Previously, we demonstrated that Optical Coherence Tomography (OCT) images revealed the presence of the artificial fingerprints (made from different household materials, such as cement and liquid silicone rubber) at all times, while the artificial fingerprints easily spoofed the commercial fingerprint reader. Also we demonstrated that an analysis of the autocorrelation of the OCT images could be used in automatic recognition systems. Here, we exploited the three-dimensional (3D) imaging of the artificial fingerprint by OCT to generate vivid 3D image for both the artificial fingerprint layer and the real fingerprint layer beneath. With the reconstructed 3D image, it could not only point out whether there exists an artificial material, which is intended to spoof the scanner, above the real finger, but also could provide the hacker's fingerprint. The results of these studies suggested that Optical Coherence Tomography could be a powerful real-time noninvasive method for accurate identification of artificial fingerprints real fingerprints as well.

Nucleus fingerprinting for the unique identification of Feulgen-stained nuclei

Science.gov (United States)

Friedrich, David; Brozio, Matthias; Bell, André; Biesterfeld, Stefan; Böcking, Alfred; Aach, Til

2012-03-01

DNA Image Cytometry is a method for non-invasive cancer diagnosis which measures the DNA content of Feulgen-stained nuclei. DNA content is measured using a microscope system equipped with a digital camera as a densitometer and estimating the DNA content from the absorption of light when passing through the nuclei. However, a DNA Image Cytometry measurement is only valid if each nucleus is only measured once. To assist the user in preventing multiple measurements of the same nucleus, we have developed a unique digital identifier for the characterization of Feulgen-stained nuclei, the so called Nucleus Fingerprint. Only nuclei with a new fingerprint can be added to the measurement. This fingerprint is based on basic nucleus features, the contour of the nucleus and the spatial relationship to nuclei in the vicinity. Based on this characterization, a classifier for testing two nuclei for identity is presented. In a pairwise comparison of ~40000 pairs of mutually different nuclei, 99.5% were classified as different. In another 450 tests, the fingerprints of the same nucleus recorded a second time were in all cases judged identical. We therefore conclude that our Nucleus Fingerprint approach robustly prevents the repeated measurement of nuclei in DNA Image Cytometry.

Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

Science.gov (United States)

Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

2009-09-01

DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

Science.gov (United States)

Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

2012-01-01

Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

Science.gov (United States)

Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

2012-01-01

Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

Directory of Open Access Journals (Sweden)

Peng Gao

Full Text Available Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines. Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR codes of 471 melon varieties (lines were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

DNA fingerprinting on trial: the dramatic early history of a new forensic technique.

Science.gov (United States)

Aronson, Jay D

2005-09-01

The early history of "DNA fingerprinting" in the UK might have been different were it not for the accounts of two dramatic courtroom trials, made by the participants and the media, in the mid-1980s. But these reports, which misrepresented the importance DNA evidence had in the trials, left a strong impression on the British public and on judges on both sides of the Atlantic. These trials, widely considered to be the first "victories" for DNA fingerprinting, have been frequently cited as proof of the utility and reliability of the technique, in both the UK and beyond. But in reality, it was the threat of DNA evidence being used rather than the integrity or validity of it that resolved these cases. At that time, DNA fingerprinting was still in its infancy, an untried and untested technology.

Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique.

Science.gov (United States)

Intarapanich, Apichart; Kaewkamnerd, Saowaluck; Shaw, Philip J; Ukosakit, Kittipat; Tragoonrung, Somvong; Tongsima, Sissades

2015-01-01

DNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained. We developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists. This work presents an automated genotyping tool from DNA

Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique

Science.gov (United States)

2015-01-01

Background DNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained. Results We developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists. Conclusions This work presents an

Missing data reconstruction using Gaussian mixture models for fingerprint images

Science.gov (United States)

Agaian, Sos S.; Yeole, Rushikesh D.; Rao, Shishir P.; Mulawka, Marzena; Troy, Mike; Reinecke, Gary

2016-05-01

Publisher's Note: This paper, originally published on 25 May 2016, was replaced with a revised version on 16 June 2016. If you downloaded the original PDF, but are unable to access the revision, please contact SPIE Digital Library Customer Service for assistance. One of the most important areas in biometrics is matching partial fingerprints in fingerprint databases. Recently, significant progress has been made in designing fingerprint identification systems for missing fingerprint information. However, a dependable reconstruction of fingerprint images still remains challenging due to the complexity and the ill-posed nature of the problem. In this article, both binary and gray-level images are reconstructed. This paper also presents a new similarity score to evaluate the performance of the reconstructed binary image. The offered fingerprint image identification system can be automated and extended to numerous other security applications such as postmortem fingerprints, forensic science, investigations, artificial intelligence, robotics, all-access control, and financial security, as well as for the verification of firearm purchasers, driver license applicants, etc.

Characterization of human glioblastoma cell lines in vitro and their xenografts in nude mice by DNA fingerprinting

DEFF Research Database (Denmark)

Türeci, O; Fischer, H; Lagoda, P

1990-01-01

Human gliomas were grown as permanent tissue cultures and xenografts in nude mice. DNA fingerprint patterns from two human gliomas were established using two different hypervariable multilocus probes [( GTG]5 and 33.15). In general the cell lines investigated showed an overall stability in the DNA...... fingerprint pattern. However, differences in the DNA fingerprint patterns were shown to occur depending upon the above mentioned parameters....

Serotypes and DNA fingerprint profiles of Pasteurella multocida isolated from raptors

Science.gov (United States)

Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

1995-01-01

Pasteurella multocida isolates from 21 raptors were examined by DNA fingerprint profile and serotyping methods. Isolates were obtained from noncaptive birds of prey found in 11 states from November 28, 1979, through February 10, 1993. Nine isolates were from bald eagles, and the remaining isolates were from hawks, falcons, and owls. Seven isolates were members of capsule group A, and 14 were nonencapsulated. One isolate was identified as somatic type 3, and another was type 3,4,7; both had unique HhaI DNA fingerprint profiles. Nineteen isolates expressed somatic type 1 antigen; HhaI profiles of all type 1 isolates were identical to each other and to the HhaI profile of the reference somatic type 1, strain X-73. The 19 type 1 isolates were differentiated by sequential digestion of DNA with HpaII; four HpaII fingerprint profiles were obtained. The HpaII profile of one isolate was identical to the HpaII profile of strain X-73. Incidence of P. multocida somatic type 1 in raptors suggests that this type may be prevalent in other wildlife or wildlife environments.

Interstrain polymorphisms of isoenzyme profiles and mitochondrial DNA fingerprints among seven strains assigned to Acanthamoeba polyphaga.

Science.gov (United States)

Kong, H H; Park, J H; Chung, D I

1995-12-01

Interstrain polymorphisms of isoenzyme profiles and mitochondrial (Mt) DNA fingerprints were observed among seven strains of Acanthamoeba isolated from different sources and morphologically assigned to A. polyphaga. Mt DNA fingerprints by eight restriction endonucleases (Bgl II, Sca I, Cla I, EcoR I, Xba I, Kpn I, Sal I, and Sst I) revealed considerable interstrain polymorphisms. Isoenzyme profiles revealed considerable interstrain polymorphisms for acid phosphatase, lactate dehydrogenase, and glucose-6-phosphate dehydrogenase while those for glucose phosphate isomerase, leucine aminopeptidase, and malate dehydrogenase showed similarity. Despite of the interstrain polymorphisms, the isoenzyme profiles and Mt DNA fingerprints of the strain Ap were found to be identical with those of the strain Jones. Mt DNA fingerprinting was found to be highly applicable for the strain identification, characterization, and differentiation.

DNA fingerprinting based on simple sequence repeat (SSR ...

African Journals Online (AJOL)

New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

Partial Fingerprint Image Enhancement using Region Division Technique and Morphological Transform

International Nuclear Information System (INIS)

Ahmad, A.; Arshad, I.; Raja, G.

2015-01-01

Fingerprints are the most renowned biometric trait for identification and verification. The quality of fingerprint image plays a vital role in feature extraction and matching. Existing algorithms work well for good quality fingerprint images and fail for partial fingerprint images as they are obtained from excessively dry fingers or affected by disease resulting in broken ridges. We propose an algorithm to enhance partial fingerprint images using morphological operatins with region division technique. The proposed method divides low quality image into six regions from top to bottom. Morphological operations choose an appropriate Structuring Element (SE) that joins broken ridges and thus enhance the image for further processing. The proposed method uses SE line with suitable angle theta and radius r in each region based on the orientation of the ridges. The algorithm is applied to 14 low quality fingerprint images from FVC-2002 database. Experimental results show that percentage accuracy has been improved using the proposed algorithm. The manual markup has been reduced and accuracy of 76.16% with Equal Error Rate (EER) of 3.16% is achieved. (author)

Analysis of fingerprint samples, testing various conditions, for forensic DNA identification.

Science.gov (United States)

Ostojic, Lana; Wurmbach, Elisa

2017-01-01

Fingerprints can be of tremendous value for forensic biology, since they can be collected from a wide variety of evident types, such as handles of weapons, tools collected in criminal cases, and objects with no apparent staining. DNA obtained from fingerprints varies greatly in quality and quantity, which ultimately affects the quality of the resulting STR profiles. Additional difficulties can arise when fingerprint samples show mixed STR profiles due to the handling of multiple persons. After applying a tested protocol for sample collection (swabbing with 5% Triton X-100), DNA extraction (using an enzyme that works at elevated temperatures), and PCR amplification (AmpFlSTR® Identifiler® using 31cycles) extensive analysis was performed to better understand the challenges inherent to fingerprint samples, with the ultimate goal of developing valuable profiles (≥50% complete). The impact of time on deposited fingerprints was investigated, revealing that while the quality of profiles deteriorated, full STR profiles could still be obtained from samples after 40days of storage at room temperature. By comparing the STR profiles from fingerprints of the dominant versus the non-dominant hand, we found a slightly better quality from the non-dominant hand, which was not always significant. Substrates seem to have greater effects on fingerprints. Tests on glass, plastic, paper and metal (US Quarter dollar, made of Cu and Ni), common substrates in offices and homes, showed best results for glass, followed by plastic and paper, while almost no profiles were obtained from a Quarter dollar. Important for forensic casework, we also assessed three-person mixtures of touched fingerprint samples. Unlike routinely used approaches for sampling evidence, the surface of an object (bottle) was sectioned into six equal parts and separate samples were taken from each section. The samples were processed separately for DNA extraction and STR amplification. The results included a few single

Multilocus DNA fingerprints in gallinaceous birds: general approach and problems.

Science.gov (United States)

Hanotte, O; Bruford, M W; Burke, T

1992-06-01

Multilocus profiles were investigated in five different species of Galliformes (ring-necked pheasant Phasianus colchicus, Indian peafowl Pavo cristatus, Japanese quail Coturnix coturnix japonica, domestic chicken Gallus gallus, and red grouse Lagopus lagopus scoticus) using two human multilocus probes (33.6 and 33.15) in combination with each of four restriction enzymes (AluI, DdeI, HaeIII or HinfI). All the species show a DNA fingerprint-like pattern using at least one restriction enzyme in combination with each multilocus probe. The number of bands detected and the value of the index of similarity for each species differ significantly between the profiles obtained with each multilocus probe. Some enzyme/probe combinations reveal strong cross-hybridization of the multilocus probes with satellite or satellite-like DNA sequences in pheasant, peacock, quail and chicken, which partially or completely prevented scoring of the profile. The choice of restriction enzyme was found to influence the number of bands, the value of the index of similarity and the probability of obtaining an identical fingerprint between unrelated individuals. The Mendelian inheritance and independent segregation of the fragments detected using AluI was investigated in three species (ring-necked pheasant, Indian peafowl and red grouse). Some bands were shown to be tightly linked. An extreme case was encountered in the red grouse, where 12 of the 15 bands scored in one parent represented only two, apparently allelic, haplotypes and so derived from a single locus. However, fingerprint patterns will often be adequate for use in paternity analyses, such as in behavioural studies, despite the occurrence of haplotypic sets of bands. Identical DNA multilocus profiles were sometimes observed between captive-bred siblings in one species. These results emphasize the desirability of determining, in each new species, the optimal experimental conditions as a preliminary to any behavioural or population

Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

Science.gov (United States)

Ishii, Satoshi; Sadowsky, Michael J

2009-04-01

A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.

Science.gov (United States)

Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y

2017-12-08

No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

Science.gov (United States)

McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

2018-01-01

One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

Qualitative and quantitative assessment of single fingerprints in forensic DNA analysis.

Science.gov (United States)

Ostojic, Lana; Klempner, Stacey A; Patel, Rosni A; Mitchell, Adele A; Axler-DiPerte, Grace L; Wurmbach, Elisa

2014-11-01

Fingerprints and touched items are important sources of DNA for STR profiling, since this evidence can be recovered in a wide variety of criminal offenses. However, there are some fundamental difficulties in working with these samples, including variability in quantity and quality of extracted DNA. In this study, we collected and analyzed over 700 fingerprints. We compared a commercially available extraction protocol (Zygem) to two methods developed in our laboratory, a simple one-tube protocol and a high sensitivity protocol (HighSens) that includes additional steps to concentrate and purify the DNA. The amplification protocols tested were AmpFLSTR® Identifiler® using either 28 or 31 amplification cycles, and Identifiler® Plus using 32 amplification cycles. We found that the HighSens and Zygem extraction methods were significantly better in their DNA yields than the one-tube method. Identifiler® Plus increased the quality of the STR profiles for the one-tube extraction significantly. However, this effect could not be verified for the other extraction methods. Furthermore, microscopic analysis of single fingerprints revealed that some individuals tended to shed more material than others onto glass slides. However, a dense deposition of skin flakes did not strongly correlate with a high quality STR profile. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The use of DNA fingerprinting to resolve conflicting results in patients with suspected gastrointestinal malignancy.

Science.gov (United States)

Islam, Sameer; Miller, Ethan D; Patel, Neal; De Petris, Giovanni; Highsmith, Edward W; Fleischer, David E

2013-03-01

To underscore the utility of DNA fingerprinting for clarifying disparate results from endoscopic pathologic specimens. Occasionally, serially obtained gastrointestinal biopsies may yield inconsistent results. These discrepancies pose a dilemma for gastroenterologists and their patients, especially when malignancy is a consideration. Patients referred to our tertiary care center from outside institutions had undergone endoscopically obtained esophageal biopsies showing malignancy, verified by pathologists at both our site and from the referring center. Repeat endoscopic biopsies at our center did not show malignancy. To verify that different sets of biopsies came from the same patient, we performed a polymerase chain reaction-based analysis comparing the 2 specimens. This analysis, called DNA fingerprinting, can show a high degree of certainty whether 2 specimens came from the same patient. In each case, DNA fingerprinting verified a match, laying the groundwork for intervention. One patient underwent endoscopic radiofrequency ablation to the esophageal mucosa involved. Another underwent esophagectomy with partial gastrectomy. Both are doing well clinically and remain cancer-free on follow-up. DNA fingerprinting is a powerful and a relatively inexpensive tool. Usually, only small amounts of tissue are required, and even degraded or archival tissue is adequate. DNA fingerprinting can be an important tool in the gastroenterologist's arsenal to help clarify conflicting results, allowing the patient and physician to move forward with the management.

3D fingerprint imaging system based on full-field fringe projection profilometry

Science.gov (United States)

Huang, Shujun; Zhang, Zonghua; Zhao, Yan; Dai, Jie; Chen, Chao; Xu, Yongjia; Zhang, E.; Xie, Lili

2014-01-01

As an unique, unchangeable and easily acquired biometrics, fingerprint has been widely studied in academics and applied in many fields over the years. The traditional fingerprint recognition methods are based on the obtained 2D feature of fingerprint. However, fingerprint is a 3D biological characteristic. The mapping from 3D to 2D loses 1D information and causes nonlinear distortion of the captured fingerprint. Therefore, it is becoming more and more important to obtain 3D fingerprint information for recognition. In this paper, a novel 3D fingerprint imaging system is presented based on fringe projection technique to obtain 3D features and the corresponding color texture information. A series of color sinusoidal fringe patterns with optimum three-fringe numbers are projected onto a finger surface. From another viewpoint, the fringe patterns are deformed by the finger surface and captured by a CCD camera. 3D shape data of the finger can be obtained from the captured fringe pattern images. This paper studies the prototype of the 3D fingerprint imaging system, including principle of 3D fingerprint acquisition, hardware design of the 3D imaging system, 3D calibration of the system, and software development. Some experiments are carried out by acquiring several 3D fingerprint data. The experimental results demonstrate the feasibility of the proposed 3D fingerprint imaging system.

A study of the genetic relationships within and among wolf packs using DNA fingerprinting and mitochondrial DNA

Science.gov (United States)

Lehman, Niles; Clarkson, Peter; Mech, L. David; Meier, Thomas J.; Wayne, Robert K.

1992-01-01

DNA fingerprinting and mitochondrial DNA analyses have not been used in combination to study relatedness in natural populations. We present an approach that involves defining the mean fingerprint similarities among individuals thought to be unrelated because they have different mtDNA genotypes. Two classes of related individuals are identified by their distance in standard errors above this mean value. The number of standard errors is determined by analysis of the association between fingerprint similarity and relatedness in a population with a known genealogy. We apply this approach to gray wolf packs from Minnesota, Alaska, and the Northwest Territories. Our results show that: (1) wolf packs consist primarily of individuals that are closely related genetically, but some packs contain unrelated, non-reproducing individuals; (2) dispersal among packs within the same area is common; and (3) short-range dispersal appears more common for female than male wolves. The first two of these genetically-based observations are consistent with behavioral data on pack structure and dispersal in wolves, while the apparent sex bias in dispersal was not expected.

Estimates of population genetic diversity in brown bullhead catfish by DNA fingerprinting

Energy Technology Data Exchange (ETDEWEB)

Roth, A.C.; Wessendarp, T.K.; Gordon, D.A.; Smith, M.K. [Environmental Protection Agency, Cincinnati, OH (United States); Lattier, D.L. [Oak Ridge Inst. for Science and Education, Cincinnati, OH (United States); Hertzberg, V.; Leonard, A. [Univ. of Cincinnati, OH (United States). Dept. of Environmental Health

1994-12-31

Estimates of population genetic diversity may be a sensitive indicator of environmental impact, since limiting the effective breeding population by any means will result in loss of some variant genotypes, as has been demonstrated by allozyme analysis. DNA fingerprinting techniques are also coming into use for population analyses, and the authors chose to apply fingerprinting analysis three populations of brown bullhead catfish collected in Northern Ohio. DNA was isolated from the red blood cells of individual fish. Purified DNAs were digested with EcoR1 restriction enzyme; the digests were then sized on a 1% agarose gel, transferred to nylon membranes and probed with a radiolabeled M13 probe using the Westneat hybridization protocol (Southern blotting). This method effects fragments containing VNTR (variable number of tandem repeat) sequences complementary to the M13, which are highly variable among individual catfish. Hybridized bands were visualized by a Molecular Dynamics phosphorimager and recorded and analyzed with its proprietary Imagequant image analysis program, Excel and SAS. A total of 10 variable bands were identified and their presence or absence scored in each individual. These data were analyzed to determine between and within-population similarity indices as well as population heterozygosity and genetic diversity measures.

Wavelet/scalar quantization compression standard for fingerprint images

Energy Technology Data Exchange (ETDEWEB)

Brislawn, C.M.

1996-06-12

US Federal Bureau of Investigation (FBI) has recently formulated a national standard for digitization and compression of gray-scale fingerprint images. Fingerprints are scanned at a spatial resolution of 500 dots per inch, with 8 bits of gray-scale resolution. The compression algorithm for the resulting digital images is based on adaptive uniform scalar quantization of a discrete wavelet transform subband decomposition (wavelet/scalar quantization method). The FBI standard produces archival-quality images at compression ratios of around 15 to 1 and will allow the current database of paper fingerprint cards to be replaced by digital imagery. The compression standard specifies a class of potential encoders and a universal decoder with sufficient generality to reconstruct compressed images produced by any compliant encoder, allowing flexibility for future improvements in encoder technology. A compliance testing program is also being implemented to ensure high standards of image quality and interchangeability of data between different implementations.

Effect of dactyloscopic powders on DNA profiling from enhanced fingerprints: results from an experimental study.

Science.gov (United States)

Tozzo, Pamela; Giuliodori, Alice; Rodriguez, Daniele; Caenazzo, Luciana

2014-03-01

We conducted a study on the effect of fingerprint enhancement methods on subsequent short tandem repeat profiling. First, we performed a study typing blood traces deposited on 5 different surfaces, treated with 8 types of dactyloscopic powders. Three different DNA extraction methods were used. Subsequently, we analyzed latent fingerprints on the same 5 surfaces enhanced with the 8 different powders used in the first part of the study. This study has demonstrated that DNA profiling can be performed on fingerprints left on different substrates, and the substrate will affect the amount of DNA that can be recovered for DNA typing. In the first phase of the study, a profile was obtained in 92% of the 120 samples analyzed; in the second part, in 55% of the 80 samples analyzed, we obtained a profile complete in 32.5% of the cases. From the results obtained, it seems that the powders used in latent fingerprints enhancement, rather than having a direct inhibitory effect on extraction and amplification of DNA, may cause partial degradation of DNA, reducing the efficiency of amplification reaction. It should not be forgotten that these results were obtained under laboratory conditions, and in real caseworks, there may still be different problems involved.

Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

Science.gov (United States)

Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

2010-05-01

This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

On some surprising statistical properties of a DNA fingerprinting technique called AFLP

NARCIS (Netherlands)

Gort, G.

2010-01-01

AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

Science.gov (United States)

Bady, Pierre; Diserens, Annie-Claire; Castella, Vincent; Kalt, Stefanie; Heinimann, Karl; Hamou, Marie-France; Delorenzi, Mauro; Hegi, Monika E

2012-06-01

Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

Comparison of Quantifiler(®) Trio and InnoQuant™ human DNA quantification kits for detection of DNA degradation in developed and aged fingerprints.

Science.gov (United States)

Goecker, Zachary C; Swiontek, Stephen E; Lakhtakia, Akhlesh; Roy, Reena

2016-06-01

The development techniques employed to visualize fingerprints collected from crime scenes as well as post-development ageing may result in the degradation of the DNA present in low quantities in such evidence samples. Amplification of the DNA samples with short tandem repeat (STR) amplification kits may result in partial DNA profiles. A comparative study of two commercially available quantification kits, Quantifiler(®) Trio and InnoQuant™, was performed on latent fingerprint samples that were either (i) developed using one of three different techniques and then aged in ambient conditions or (ii) undeveloped and then aged in ambient conditions. The three fingerprint development techniques used were: cyanoacrylate fuming, dusting with black powder, and the columnar-thin-film (CTF) technique. In order to determine the differences between the expected quantities and actual quantities of DNA, manually degraded samples generated by controlled exposure of DNA standards to ultraviolet radiation were also analyzed. A total of 144 fingerprint and 42 manually degraded DNA samples were processed in this study. The results indicate that the InnoQuant™ kit is capable of producing higher degradation ratios compared to the Quantifiler(®) Trio kit. This was an expected result since the degradation ratio is a relative value specific for a kit based on the length and extent of amplification of the two amplicons that vary from one kit to the other. Additionally, samples with lower concentrations of DNA yielded non-linear relationships of degradation ratio with the duration of aging, whereas samples with higher concentrations of DNA yielded quasi-linear relationships. None of the three development techniques produced a noticeably different degradation pattern when compared to undeveloped fingerprints, and therefore do not impede downstream DNA analysis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Fingerprint image enhancement by differential hysteresis processing.

Science.gov (United States)

Blotta, Eduardo; Moler, Emilce

2004-05-10

A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results.

DNA Fingerprinting of Single Colonies of Helicobacter pylori from Gastric Cancer Patients Suggests Infection with a Single Predominant Strain

OpenAIRE

Miehlke, Stephan; Thomas, Rachel; Guiterrez, Oscar; Graham, David Y.; Go, Mae F.

1999-01-01

In each of six gastric cancer patients, repetitive extragenic palindromic PCR DNA fingerprints of 18 single colonies of Helicobacter pylori from the gastric antrum, corpus, and cardia were identical and matched that of the parental isolate. In three additional gastric cancer patients, 17 of 18 single-colony DNA fingerprints were identical to each other and to the DNA fingerprint of the corresponding parental isolate.

Snake Model Based on Improved Genetic Algorithm in Fingerprint Image Segmentation

Directory of Open Access Journals (Sweden)

Mingying Zhang

2016-12-01

Full Text Available Automatic fingerprint identification technology is a quite mature research field in biometric identification technology. As the preprocessing step in fingerprint identification, fingerprint segmentation can improve the accuracy of fingerprint feature extraction, and also reduce the time of fingerprint preprocessing, which has a great significance in improving the performance of the whole system. Based on the analysis of the commonly used methods of fingerprint segmentation, the existing segmentation algorithm is improved in this paper. The snake model is used to segment the fingerprint image. Additionally, it is improved by using the global optimization of the improved genetic algorithm. Experimental results show that the algorithm has obvious advantages both in the speed of image segmentation and in the segmentation effect.

Examining DNA fingerprinting as an epidemiology tool in the tuberculosis program in the Northwest Territories, Canada.

Science.gov (United States)

Case, Cheryl; Kandola, Kami; Chui, Linda; Li, Vincent; Nix, Nancy; Johnson, Rhonda

2013-01-01

Tuberculosis (TB) is an important public health problem in the Northwest Territories (NWT), particularly among Canadian Aboriginal people. To analyse the transmission patterns of tuberculosis among the population living in the NWT, a territorial jurisdiction located within Northern Canada. This population-based retrospective study examined the DNA fingerprints of all laboratory confirmed cases of TB in the NWT, Canada, between 1990 and 2009. An isolate of each lab-confirmed case had genotyping done using IS6110 Restriction Fragment Length Polymorphism. DNA patterns were assigned to each DNA fingerprint, and indistinguishable fingerprints patterns were assigned a cluster. Social network analysis (SNA) was used to examine direct linkages among cases determined through conventional contact tracing (CCT), their DNA fingerprint and home community. Of the 225 lab-confirmed cases identified, the study was limited to 195 subjects due to DNA fingerprinting data availability. The mean age of the cases was 43.8 years (±22.6) and 120 (61.5%) males. The Dene (First Nations) encompassed 120 of the cases (87.7%), 8 cases (4.1%) were Inuit, 2 cases (1.0%) were Metis, 7 cases (3.6%) were Immigrants and 1 case had unknown ethnicity. One hundred and eighty six (95.4%) subjects were clustered, resulting in 8 clusters. Trend analysis showed significant relationships between with risk factors for unemployment (p=0.020), geographic location (p≤0.001) and homelessness (p≤0.001). Other significant risk factors included excessive alcohol consumption, prior infection with Mycobacterium tuberculosis and prior contact with a case of TB. This study demonstrates how DNA fingerprinting and SNA can be additional epidemiological tools, along with CCT method, to determine transmission patterns of TB.

Straightforward fabrication of black nano silica dusting powder for latent fingerprint imaging

Science.gov (United States)

Komalasari, Isna; Krismastuti, Fransiska Sri Herwahyu; Elishian, Christine; Handayani, Eka Mardika; Nugraha, Willy Cahya; Ketrin, Rosi

2017-11-01

Imaging of latent fingerprint pattern (aka fingermark) is one of the most important and accurate detection methods in forensic investigation because of the characteristic of individual fingerprint. This detection technique relies on the mechanical adherence of fingerprint powder to the moisture and oily component of the skin left on the surface. The particle size of fingerprint powder is one of the critical parameter to obtain excellent fingerprint image. This study develops a simple, cheap and straightforward method to fabricate Nano size black dusting fingerprint powder based on Nano silica and applies the powder to visualize latent fingerprint. The nanostructured silica was prepared from tetraethoxysilane (TEOS) and then modified with Nano carbon, methylene blue and sodium acetate to color the powder. Finally, as a proof-of-principle, the ability of this black Nano silica dusting powder to image latent fingerprint is successfully demonstrated and the results show that this fingerprint powder provides clearer fingerprint pattern compared to the commercial one highlighting the potential application of the nanostructured silica in forensic science.

A DNA Fingerprinting Simulation Laboratory for Biology Students: Hands-on Experimentation To Solve a Mock Forensic Problem.

Science.gov (United States)

Palladino, Michael A.; Cosentino, Emily

2001-01-01

Presents an alternative approach to DNA fingerprinting. Demonstrates how undergraduate students can be involved in many aspects of this type of experiment and how DNA fingerprinting experiments can be incorporated into the laboratory curriculum of courses for majors and nonmajors. (NB)

The Influence of Selected Fingerprint Enhancement Techniques on Forensic DNA Typing of Epithelial Cells Deposited on Porous Surfaces.

Science.gov (United States)

Tsai, Li-Chin; Lee, Cheng-Chang; Chen, Chun-Chieh; Lee, James Chun-I; Wang, Sheng-Meng; Huang, Nu-En; Linacre, Adrian; Hsieh, Hsing-Mei

2016-01-01

Fingerprints deposited at crime scene can be a source of DNA. Previous reports on the effects of fingerprint enhancement methods have focused mainly on fingermarks deposited in blood or saliva. Here, we evaluate the effects of fingerprint enhancement methods on fingerprints deposited on porous surfaces. We performed real-time quantification and STR typing, the results of which indicated that two methods (iodine fuming and 1,2-indanedione in ethyl acetate enhancement) had no effect on the quantity of DNA isolated and resultant STR alleles when compared to control samples. DNA quantities and allele numbers were lower for samples enhanced with silver nitrate and 1,2-indanedione in acetic acid when compared to control samples. Based on DNA quantity, quality, and observable stochastic effects, our data indicated that iodine fuming and 1,2-indanedione in ethyl acetate were the preferred options for the enhancement of fingerprints on porous surfaces. © 2015 American Academy of Forensic Sciences.

Accessible biometrics: A frustrated total internal reflection approach to imaging fingerprints.

Science.gov (United States)

Smith, Nathan D; Sharp, James S

2017-05-01

Fingerprints are widely used as a means of identifying persons of interest because of the highly individual nature of the spatial distribution and types of features (or minuta) found on the surface of a finger. This individuality has led to their wide application in the comparison of fingerprints found at crime scenes with those taken from known offenders and suspects in custody. However, despite recent advances in machine vision technology and image processing techniques, fingerprint evidence is still widely being collected using outdated practices involving ink and paper - a process that can be both time consuming and expensive. Reduction of forensic service budgets increasingly requires that evidence be gathered and processed more rapidly and efficiently. However, many of the existing digital fingerprint acquisition devices have proven too expensive to roll out on a large scale. As a result new, low-cost imaging technologies are required to increase the quality and throughput of the processing of fingerprint evidence. Here we describe an inexpensive approach to digital fingerprint acquisition that is based upon frustrated total internal reflection imaging. The quality and resolution of the images produced are shown to be as good as those currently acquired using ink and paper based methods. The same imaging technique is also shown to be capable of imaging powdered fingerprints that have been lifted from a crime scene using adhesive tape or gel lifters. Copyright © 2017 The Chartered Society of Forensic Sciences. Published by Elsevier B.V. All rights reserved.

[Genomic DNA fingerprints of Legionella pneumophila serogroup 2 strains as an epidemiologic marker].

Science.gov (United States)

Bender-Beck, L; Mühlenberg, W; Lück, P C; Ott, M; Horbach, I; Fehrenbach, F J; Wewalka, G; Hacker, J

1995-08-01

Using pulsed-field gel electrophoresis, DNA fingerprints of eleven Legionella pneumophila isolates of serogroup 2 were generated. It was shown that two strains from a patient suffering from pneumonia as well as three environmental strains isolated from the shower in the hotel where the patient stayed 5 days before his illness were identical. Six strains of the same serogroup isolated from other sources were clearly separated. Thus, DNA fingerprints by pulsed-field gel electrophoresis are excellent epidemiological markers for the rarely occurring serogroup 2 of Legionella pneumophila.

Oriented diffusion filtering for enhancing low-quality fingerprint images

KAUST Repository

Gottschlich, C.; Schönlieb, C.-B.

2012-01-01

To enhance low-quality fingerprint images, we present a novel method that first estimates the local orientation of the fingerprint ridge and valley flow and next performs oriented diffusion filtering, followed by a locally adaptive contrast enhancement step. By applying the authors' new approach to low-quality images of the FVC2004 fingerprint databases, the authors are able to show its competitiveness with other state-of-the-art enhancement methods for fingerprints like curved Gabor filtering. A major advantage of oriented diffusion filtering over those is its computational efficiency. Combining oriented diffusion filtering with curved Gabor filters led to additional improvements and, to the best of the authors' knowledge, the lowest equal error rates achieved so far using MINDTCT and BOZORTH3 on the FVC2004 databases. The recognition performance and the computational efficiency of the method suggest to include oriented diffusion filtering as a standard image enhancement add-on module for real-time fingerprint recognition systems. In order to facilitate the reproduction of these results, an implementation of the oriented diffusion filtering for Matlab and GNU Octave is made available for download. © 2012 The Institution of Engineering and Technology.

Oriented diffusion filtering for enhancing low-quality fingerprint images

KAUST Repository

Gottschlich, C.

2012-01-01

To enhance low-quality fingerprint images, we present a novel method that first estimates the local orientation of the fingerprint ridge and valley flow and next performs oriented diffusion filtering, followed by a locally adaptive contrast enhancement step. By applying the authors\\' new approach to low-quality images of the FVC2004 fingerprint databases, the authors are able to show its competitiveness with other state-of-the-art enhancement methods for fingerprints like curved Gabor filtering. A major advantage of oriented diffusion filtering over those is its computational efficiency. Combining oriented diffusion filtering with curved Gabor filters led to additional improvements and, to the best of the authors\\' knowledge, the lowest equal error rates achieved so far using MINDTCT and BOZORTH3 on the FVC2004 databases. The recognition performance and the computational efficiency of the method suggest to include oriented diffusion filtering as a standard image enhancement add-on module for real-time fingerprint recognition systems. In order to facilitate the reproduction of these results, an implementation of the oriented diffusion filtering for Matlab and GNU Octave is made available for download. © 2012 The Institution of Engineering and Technology.

Image-based fingerprint verification system using LabVIEW

Directory of Open Access Journals (Sweden)

Sunil K. Singla

2008-09-01

Full Text Available Biometric-based identification/verification systems provide a solution to the security concerns in the modern world where machine is replacing human in every aspect of life. Fingerprints, because of their uniqueness, are the most widely used and highly accepted biometrics. Fingerprint biometric systems are either minutiae-based or pattern learning (image based. The minutiae-based algorithm depends upon the local discontinuities in the ridge flow pattern and are used when template size is important while image-based matching algorithm uses both the micro and macro feature of a fingerprint and is used if fast response is required. In the present paper an image-based fingerprint verification system is discussed. The proposed method uses a learning phase, which is not present in conventional image-based systems. The learning phase uses pseudo random sub-sampling, which reduces the number of comparisons needed in the matching stage. This system has been developed using LabVIEW (Laboratory Virtual Instrument Engineering Workbench toolbox version 6i. The availability of datalog files in LabVIEW makes it one of the most promising candidates for its usage as a database. Datalog files can access and manipulate data and complex data structures quickly and easily. It makes writing and reading much faster. After extensive experimentation involving a large number of samples and different learning sizes, high accuracy with learning image size of 100 100 and a threshold value of 700 (1000 being the perfect match has been achieved.

DNA fingerprinting of pearls to determine their origins.

Directory of Open Access Journals (Sweden)

Joana B Meyer

Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

The FBI wavelet/scalar quantization standard for gray-scale fingerprint image compression

Energy Technology Data Exchange (ETDEWEB)

Bradley, J.N.; Brislawn, C.M. [Los Alamos National Lab., NM (United States); Hopper, T. [Federal Bureau of Investigation, Washington, DC (United States)

1993-05-01

The FBI has recently adopted a standard for the compression of digitized 8-bit gray-scale fingerprint images. The standard is based on scalar quantization of a 64-subband discrete wavelet transform decomposition of the images, followed by Huffman coding. Novel features of the algorithm include the use of symmetric boundary conditions for transforming finite-length signals and a subband decomposition tailored for fingerprint images scanned at 500 dpi. The standard is intended for use in conjunction with ANSI/NBS-CLS 1-1993, American National Standard Data Format for the Interchange of Fingerprint Information, and the FBI`s Integrated Automated Fingerprint Identification System.

Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

Science.gov (United States)

Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

2010-03-01

The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

Self-Organizing Maps for Fingerprint Image Quality Assessment

DEFF Research Database (Denmark)

Olsen, Martin Aastrup; Tabassi, Elham; Makarov, Anton

2013-01-01

Fingerprint quality assessment is a crucial task which needs to be conducted accurately in various phases in the biometric enrolment and recognition processes. Neglecting quality measurement will adversely impact accuracy and efficiency of biometric recognition systems (e.g. verification and iden......Fingerprint quality assessment is a crucial task which needs to be conducted accurately in various phases in the biometric enrolment and recognition processes. Neglecting quality measurement will adversely impact accuracy and efficiency of biometric recognition systems (e.g. verification...... machine learning techniques. We train a self-organizing map (SOM) to cluster blocks of fingerprint images based on their spatial information content. The output of the SOM is a high-level representation of the finger image, which forms the input to a Random Forest trained to learn the relationship between...

Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

NARCIS (Netherlands)

P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

1995-01-01

textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

The wavelet/scalar quantization compression standard for digital fingerprint images

Energy Technology Data Exchange (ETDEWEB)

Bradley, J.N.; Brislawn, C.M.

1994-04-01

A new digital image compression standard has been adopted by the US Federal Bureau of Investigation for use on digitized gray-scale fingerprint images. The algorithm is based on adaptive uniform scalar quantization of a discrete wavelet transform image decomposition and is referred to as the wavelet/scalar quantization standard. The standard produces archival quality images at compression ratios of around 20:1 and will allow the FBI to replace their current database of paper fingerprint cards with digital imagery.

The FBI compression standard for digitized fingerprint images

Energy Technology Data Exchange (ETDEWEB)

Brislawn, C.M.; Bradley, J.N. [Los Alamos National Lab., NM (United States); Onyshczak, R.J. [National Inst. of Standards and Technology, Gaithersburg, MD (United States); Hopper, T. [Federal Bureau of Investigation, Washington, DC (United States)

1996-10-01

The FBI has formulated national standards for digitization and compression of gray-scale fingerprint images. The compression algorithm for the digitized images is based on adaptive uniform scalar quantization of a discrete wavelet transform subband decomposition, a technique referred to as the wavelet/scalar quantization method. The algorithm produces archival-quality images at compression ratios of around 15 to 1 and will allow the current database of paper fingerprint cards to be replaced by digital imagery. A compliance testing program is also being implemented to ensure high standards of image quality and interchangeability of data between different implementations. We will review the current status of the FBI standard, including the compliance testing process and the details of the first-generation encoder.

The FBI wavelet/scalar quantization standard for gray-scale fingerprint image compression

Energy Technology Data Exchange (ETDEWEB)

Bradley, J.N.; Brislawn, C.M. (Los Alamos National Lab., NM (United States)); Hopper, T. (Federal Bureau of Investigation, Washington, DC (United States))

1993-01-01

The FBI has recently adopted a standard for the compression of digitized 8-bit gray-scale fingerprint images. The standard is based on scalar quantization of a 64-subband discrete wavelet transform decomposition of the images, followed by Huffman coding. Novel features of the algorithm include the use of symmetric boundary conditions for transforming finite-length signals and a subband decomposition tailored for fingerprint images scanned at 500 dpi. The standard is intended for use in conjunction with ANSI/NBS-CLS 1-1993, American National Standard Data Format for the Interchange of Fingerprint Information, and the FBI's Integrated Automated Fingerprint Identification System.

A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

Science.gov (United States)

Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

2001-12-01

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

SSR marker based DNA fingerprinting and diversity study in rice ...

African Journals Online (AJOL)

The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

Science.gov (United States)

Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

2008-01-01

Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

Efficient DNA Fingerprinting Based on the Targeted Sequencing of Active Retrotransposon Insertion Sites Using a Bench-Top High-Throughput Sequencing Platform

OpenAIRE

Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

2014-01-01

In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LI...

ESDA®-Lite collection of DNA from latent fingerprints on documents.

Science.gov (United States)

Plaza, Dane T; Mealy, Jamia L; Lane, J Nicholas; Parsons, M Neal; Bathrick, Abigail S; Slack, Donia P

2015-05-01

The ability to detect and non-destructively collect biological samples for DNA processing would benefit the forensic community by preserving the physical integrity of evidentiary items for more thorough evaluations by other forensic disciplines. The Electrostatic Detection Apparatus (ESDA®) was systemically evaluated for its ability to non-destructively collect DNA from latent fingerprints deposited on various paper substrates for short tandem repeat (STR) DNA profiling. Fingerprints were deposited on a variety of paper substrates that included resume paper, cotton paper, magazine paper, currency, copy paper, and newspaper. Three DNA collection techniques were performed: ESDA collection, dry swabbing, and substrate cutting. Efficacy of each collection technique was evaluated by the quantity of DNA present in each sample and the percent profile generated by each sample. Both the ESDA and dry swabbing non-destructive sampling techniques outperformed the destructive methodology of substrate cutting. A greater number of full profiles were generated from samples collected with the non-destructive dry swabbing collection technique than were generated from samples collected with the ESDA; however, the ESDA also allowed the user to visualize the area of interest while non-destructively collecting the biological material. The ability to visualize the biological material made sampling straightforward and eliminated the need for numerous, random swabbings/cuttings. Based on these results, the evaluated non-destructive ESDA collection technique has great potential for real-world forensic implementation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

OpenAIRE

Harmey, Judith H.; Harmey, Matthew A.

1993-01-01

We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

Lanthanide mixed ligand chelates for DNA profiling and latent fingerprint detection

Science.gov (United States)

Menzel, E. R.; Allred, Clay

1997-02-01

It is our aim to develop a universally applicable latent fingerprint detection method using lanthanide (rare-earth) complexes as a source of luminescence. Use of these lanthanide complexes offers advantages on several fronts, including benefits from large Stokes shifts, long luminescence lifetimes, narrow emissions, ability of sequential assembly of complexes, and chemical variability of the ligands. Proper exploitation of these advantages would lead to a latent fingerprint detection method superior to any currently available. These same characteristics also lend themselves to many of the problems associated with DNA processing in the forensic science context.

Fingerprint matching algorithm for poor quality images

Directory of Open Access Journals (Sweden)

Vedpal Singh

2015-04-01

Full Text Available The main aim of this study is to establish an efficient platform for fingerprint matching for low-quality images. Generally, fingerprint matching approaches use the minutiae points for authentication. However, it is not such a reliable authentication method for low-quality images. To overcome this problem, the current study proposes a fingerprint matching methodology based on normalised cross-correlation, which would improve the performance and reduce the miscalculations during authentication. It would decrease the computational complexities. The error rate of the proposed method is 5.4%, which is less than the two-dimensional (2D dynamic programming (DP error rate of 5.6%, while Lee's method produces 5.9% and the combined method has 6.1% error rate. Genuine accept rate at 1% false accept rate is 89.3% but at 0.1% value it is 96.7%, which is higher. The outcome of this study suggests that the proposed methodology has a low error rate with minimum computational effort as compared with existing methods such as Lee's method and 2D DP and the combined method.

DNA fingerprinting techniques for the analysis of genetic and epigenetic alterations in colorectal cancer.

Science.gov (United States)

Samuelsson, Johanna K; Alonso, Sergio; Yamamoto, Fumiichiro; Perucho, Manuel

2010-11-10

Genetic somatic alterations are fundamental hallmarks of cancer. In addition to point and other small mutations targeting cancer genes, solid tumors often exhibit aneuploidy as well as multiple chromosomal rearrangements of large fragments of the genome. Whether somatic chromosomal alterations and aneuploidy are a driving force or a mere consequence of tumorigenesis remains controversial. Recently it became apparent that not only genetic but also epigenetic alterations play a major role in carcinogenesis. Epigenetic regulation mechanisms underlie the maintenance of cell identity crucial for development and differentiation. These epigenetic regulatory mechanisms have been found substantially altered during cancer development and progression. In this review, we discuss approaches designed to analyze genetic and epigenetic alterations in colorectal cancer, especially DNA fingerprinting approaches to detect changes in DNA copy number and methylation. DNA fingerprinting techniques, despite their modest throughput, played a pivotal role in significant discoveries in the molecular basis of colorectal cancer. The aim of this review is to revisit the fingerprinting technologies employed and the oncogenic processes that they unveiled. 2010 Elsevier B.V. All rights reserved.

Cranberry SSR multiplexing panels for DNA horticultural fingerprinting and genetic studies

Science.gov (United States)

Cranberry (Vaccinium macrocarpon) is in need of inexpensive high-throughput DNA fingerprinting methods for genetic research and germplasm purity testing for agricultural purposes. Therefore, we designed and validated 16-multiplexing panels containing 61 evenly distributed simple sequence (SSR) marke...

Low-Speed Fingerprint Image Capture System User`s Guide, June 1, 1993

Energy Technology Data Exchange (ETDEWEB)

Whitus, B.R.; Goddard, J.S.; Jatko, W.B.; Manges, W.W.; Treece, D.A.

1993-06-01

The Low-Speed Fingerprint Image Capture System (LS-FICS) uses a Sun workstation controlling a Lenzar ElectroOptics Opacity 1000 imaging system to digitize fingerprint card images to support the Federal Bureau of Investigation`s (FBI`s) Automated Fingerprint Identification System (AFIS) program. The system also supports the operations performed by the Oak Ridge National Laboratory- (ORNL-) developed Image Transmission Network (ITN) prototype card scanning system. The input to the system is a single FBI fingerprint card of the agreed-upon standard format and a user-specified identification number. The output is a file formatted to be compatible with the National Institute of Standards and Technology (NIST) draft standard for fingerprint data exchange dated June 10, 1992. These NIST compatible files contain the required print and text images. The LS-FICS is designed to provide the FBI with the capability of scanning fingerprint cards into a digital format. The FBI will replicate the system to generate a data base of test images. The Host Workstation contains the image data paths and the compression algorithm. A local area network interface, disk storage, and tape drive are used for the image storage and retrieval, and the Lenzar Opacity 1000 scanner is used to acquire the image. The scanner is capable of resolving 500 pixels/in. in both x and y directions. The print images are maintained in full 8-bit gray scale and compressed with an FBI-approved wavelet-based compression algorithm. The text fields are downsampled to 250 pixels/in. and 2-bit gray scale. The text images are then compressed using a lossless Huffman coding scheme. The text fields retrieved from the output files are easily interpreted when displayed on the screen. Detailed procedures are provided for system calibration and operation. Software tools are provided to verify proper system operation.

Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

OpenAIRE

Bansal, N S; McDonell, F

1997-01-01

The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Polarization-based and specular-reflection-based noncontact latent fingerprint imaging and lifting

Science.gov (United States)

Lin, Shih-Schön; Yemelyanov, Konstantin M.; Pugh, Edward N., Jr.; Engheta, Nader

2006-09-01

In forensic science the finger marks left unintentionally by people at a crime scene are referred to as latent fingerprints. Most existing techniques to detect and lift latent fingerprints require application of a certain material directly onto the exhibit. The chemical and physical processing applied to the fingerprint potentially degrades or prevents further forensic testing on the same evidence sample. Many existing methods also have deleterious side effects. We introduce a method to detect and extract latent fingerprint images without applying any powder or chemicals on the object. Our method is based on the optical phenomena of polarization and specular reflection together with the physiology of fingerprint formation. The recovered image quality is comparable to existing methods. In some cases, such as the sticky side of tape, our method shows unique advantages.

Two-Level Evaluation on Sensor Interoperability of Features in Fingerprint Image Segmentation

Directory of Open Access Journals (Sweden)

Ya-Shuo Li

2012-03-01

Full Text Available Features used in fingerprint segmentation significantly affect the segmentation performance. Various features exhibit different discriminating abilities on fingerprint images derived from different sensors. One feature which has better discriminating ability on images derived from a certain sensor may not adapt to segment images derived from other sensors. This degrades the segmentation performance. This paper empirically analyzes the sensor interoperability problem of segmentation feature, which refers to the feature’s ability to adapt to the raw fingerprints captured by different sensors. To address this issue, this paper presents a two-level feature evaluation method, including the first level feature evaluation based on segmentation error rate and the second level feature evaluation based on decision tree. The proposed method is performed on a number of fingerprint databases which are obtained from various sensors. Experimental results show that the proposed method can effectively evaluate the sensor interoperability of features, and the features with good evaluation results acquire better segmentation accuracies of images originating from different sensors.

Contrast enhancement of fingerprint images using intuitionistic type II fuzzy set

Directory of Open Access Journals (Sweden)

Devarasan Ezhilmaran

2015-04-01

Full Text Available A novel contrast image enhancement of fingerprint images using intuitionistic type II fuzzy set theory is recommended in this work. The method of Hamacher T co-norm(S norm which generates a new membership function with the help of upper and lower membership function of type II fuzzy set. The finger print identification is one of the very few techniques employed in forensic science to aid criminal investigations in daily life, providing access control in financial security;-, visa related services, as well as others. Mostly fingerprint images are poorly illuminated and hardly visible, so it is necessary to enhance the input images. The enhancement is useful for authentication and matching. The fingerprint enhancement is vital for identifying and authenticating people by matching their fingerprints with the stored one in the database. The proposed enhancement of the intuitionistic type II fuzzy set theory results showed that it is more effective, especially, very useful for forensic science operations. The experimental results were compared with non-fuzzy, fuzzy, intuitionistic fuzzy and type II fuzzy methods in which the proposed method offered better results with good quality, less noise and low blur features.

New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

Science.gov (United States)

Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

2011-09-01

Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

Fingerprint enhancement revisited and the effects of blood enhancement chemicals on subsequent profiler Plus fluorescent short tandem repeat DNA analysis of fresh and aged bloody fingerprints.

Science.gov (United States)

Frégeau, C J; Germain, O; Fourney, R M

2000-03-01

This study was aimed at determining the effect of seven blood enhancement reagents on the subsequent Profiler Plus fluorescent STR DNA analysis of fresh or aged bloody fingerprints deposited on various porous and nonporous surfaces. Amido Black, Crowle's Double Stain. 1,8-diazafluoren-9-one (DFO), Hungarian Red, leucomalachite green, luminol and ninhydrin were tested on linoleum, glass, metal, wood (pine, painted white), clothing (85% polyester/15% cotton, 65% polyester/35% cotton, and blue denim) and paper (Scott 2-ply and Xerox-grade). Preliminary experiments were designed to determine the optimal blood dilutions to use to ensure a DNA typing result following chemical enhancement. A 1:200 blood dilution deposited on linoleum and enhanced with Crowle's Double Stain generated enough DNA for one to two rounds of Profiler Plus PCR amplification. A comparative study of the DNA yields before and after treatment indicated that the quantity of DNA recovered from bloody fingerprints following enhancement was reduced by a factor of 2 to 12. Such a reduction in the DNA yields could potentially compromise DNA typing analysis in the case of small stains. The blood enhancement chemicals selected were also evaluated for their capability to reveal bloodmarks on the various porous and nonporous surfaces chosen in this study. Luminol. Amido Black and Crowle's Double Stain showed the highest sensitivity of all seven chemicals tested and revealed highly diluted (1:200) bloody fingerprints. Both luminol and Amido Black produced excellent results on both porous and nonporous surfaces, but Crowle's Double Stain failed to produce any results on porous substrates. Hungarian Red, DFO, leucomalachite green and ninhydrin showed lower sensitivities. Enhancement of bloodmarks using any of the chemicals selected, and short-term exposure to these same chemicals (i.e., less than 54 days), had no adverse effects on the PCR amplification of the nine STR systems surveyed (D3S 1358, HumvWA, Hum

cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

OpenAIRE

Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

1999-01-01

A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

International Nuclear Information System (INIS)

Dallas, J.F.

1988-01-01

A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

Directory of Open Access Journals (Sweden)

Roy Deodutta

2004-01-01

Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

Genetic effect of A-bomb radiation- Analysis of minisatellite regions detected by DNA fingerprint probe

International Nuclear Information System (INIS)

Kodaira, Mieko

1999-01-01

In author's laboratory, screening of mutation in germ cells of A-bomb survivors is under investigation with use of 8 single-locus minisatellite probes and no increase in mutation rate has been detected hitherto. This paper reported results of screening on the minisatellite region, which consisting of short repeated base sequence, using a DNA fingerprint probe for 33.15 core sequence. Subjects were 50 A-bomb survivor families exposed to mean dose of 1.9 Sv (exposed group) or 0 Gy (control), having 64 or 60 children, respectively. DNA was extracted from their B cells established by EB virus and subjected to agarose-gel electrophoresis followed by southern blotting with some improvements for fingerprinting. On the fingerprints, numbers of the band detected in regions of >3.5 kb were 1080 in children of the exposed group (16.9/child) and 1024 (17.1) in the control group, indicating no detectable effect of exposure on the germ cell mutation rate in the region.(K.H.)

The application of infrared chemical imaging to the detection and enhancement of latent fingerprints: method optimization and further findings.

Science.gov (United States)

Tahtouh, Mark; Despland, Pauline; Shimmon, Ronald; Kalman, John R; Reedy, Brian J

2007-09-01

Fourier transform infrared (FTIR) chemical imaging allows the collection of fingerprint images from backgrounds that have traditionally posed problems for conventional fingerprint detection methods. In this work, the suitability of this technique for the imaging of fingerprints on a wider range of difficult surfaces (including polymer banknotes, various types of paper, and aluminum drink cans) has been tested. For each new surface, a systematic methodology was employed to optimize settings such as spectral resolution, number of scans, and pixel aggregation in order to reduce collection time and file-size without compromising spatial resolution and the quality of the final fingerprint image. The imaging of cyanoacrylate-fumed fingerprints on polymer banknotes has been improved, with shorter collection times for larger image areas. One-month-old fingerprints on polymer banknotes have been successfully fumed and imaged. It was also found that FTIR chemical imaging gives high quality images of cyanoacrylate-fumed fingerprints on aluminum drink cans, regardless of the printed background. Although visible and UV light sources do not yield fingerprint images of the same quality on difficult, nonporous backgrounds, in many cases they can be used to locate a fingerprint prior to higher quality imaging by the FTIR technique. Attempts to acquire FTIR images of fingerprints on paper-based porous surfaces that had been treated with established reagents such as ninhydrin were all unsuccessful due to the swamping effect of the cellulose constituents of the paper.

Analysis of bacterial core communities in the central Baltic by comparative RNA-DNA-based fingerprinting provides links to structure-function relationships.

Science.gov (United States)

Brettar, Ingrid; Christen, Richard; Höfle, Manfred G

2012-01-01

Understanding structure-function links of microbial communities is a central theme of microbial ecology since its beginning. To this end, we studied the spatial variability of the bacterioplankton community structure and composition across the central Baltic Sea at four stations, which were up to 450 km apart and at a depth profile representative for the central part (Gotland Deep, 235 m). Bacterial community structure was followed by 16S ribosomal RNA (rRNA)- and 16S rRNA gene-based fingerprints using single-strand conformation polymorphism (SSCP) electrophoresis. Species composition was determined by sequence analysis of SSCP bands. High similarities of the bacterioplankton communities across several hundred kilometers were observed in the surface water using RNA- and DNA-based fingerprints. In these surface communities, the RNA- and DNA-based fingerprints resulted in very different pattern, presumably indicating large difference between the active members of the community as represented by RNA-based fingerprints and the present members represented by the DNA-based fingerprints. This large discrepancy changed gradually over depth, resulting in highly similar RNA- and DNA-based fingerprints in the anoxic part of the water column below 130 m depth. A conceivable mechanism explaining this high similarity could be the reduced oxidative stress in the anoxic zone. The stable communities on the surface and in the anoxic zone indicate the strong influence of the hydrography on the bacterioplankton community structure. Comparative analysis of RNA- and DNA-based community structure provided criteria for the identification of the core community, its key members and their links to biogeochemical functions.

Trophectoderm DNA fingerprinting by quantitative real-time PCR successfully distinguishes sibling human embryos.

Science.gov (United States)

Scott, Richard T; Su, Jing; Tao, Xin; Forman, Eric J; Hong, Kathleen H; Taylor, Deanne; Treff, Nathan R

2014-11-01

To validate a novel and more practical system for trophectoderm DNA fingerprinting which reliably distinguishes sibling embryos from each other. In this prospective and blinded study two-cell and 5-cell samples from commercially available sibling cell lines and excess DNA from trophectoderm biopsies of sibling human blastocysts were evaluated for accurate assignment of relationship using qPCR-based allelic discrimination from 40 single nucleotide polymorphisms (SNPs) with low allele frequency variation and high heterozygosity. Cell samples with self relationships averaged 95.1 ± 5.9 % similarity. Sibling relationships averaged 57.2 ± 5.9 % similarity for all 40 SNPs, and 40.8 ± 8.2 % similarity for the 25 informative SNPs. Assignment of relationships was accomplished with 100 % accuracy for cell lines and embryos. These data demonstrate the first trophectoderm qPCR-based DNA fingerprinting technology capable of unequivocal discrimination of sibling human embryos. This methodology will empower research and development of new markers of, and interventions that influence embryonic reproductive potential.

Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

Science.gov (United States)

Zhu, X Q; Gasser, R B

1998-06-01

In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

Optical Methods in Fingerprint Imaging for Medical and Personality Applications.

Science.gov (United States)

Wang, Chia-Nan; Wang, Jing-Wein; Lin, Ming-Hsun; Chang, Yao-Lang; Kuo, Chia-Ming

2017-10-23

Over the years, analysis and induction of personality traits has been a topic for individual subjective conjecture or speculation, rather than a focus of inductive scientific analysis. This study proposes a novel framework for analysis and induction of personality traits. First, 14 personality constructs based on the "Big Five" personality factors were developed. Next, a new fingerprint image algorithm was used for classification, and the fingerprints were classified into eight types. The relationship between personality traits and fingerprint type was derived from the results of the questionnaire survey. After comparison of pre-test and post-test results, this study determined the induction ability of personality traits from fingerprint type. Experimental results showed that the left/right thumbprint type of a majority of subjects was left loop/right loop and that the personalities of individuals with this fingerprint type were moderate with no significant differences in the 14 personality constructs.

Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

Science.gov (United States)

Dingman, Douglas W

2012-07-01

Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

DNA fingerprinting demonstrates extremely low levels of genetic variation among blackberry cultivars grown in Finland

Directory of Open Access Journals (Sweden)

K. ANTONIUS

2008-12-01

Full Text Available Most blackberry plants cultivated in Finland closely resemble the American species Rubus allegheniensis. Thirty nine such blackberry accessions in the University of Helsinki clone collection were studied by hybridization-based DNA fingerprinting and compared with some known cultivars of R. allegheniensis derivation. 'Imperial' appears to be identical to the old cultivar 'Majestät', but 'Earliest of All' differs considerably. In addition, 37 of the accessions analysed also have DNA fingerprints that appear to be completely identical to that of 'Majestät'! The remaining two accessions, although identical to each other, exhibit one band not found in 'Majestät' that is probably caused by a somatic mutation.

Usefulness of the secondary probe pTBN12 in DNA fingerprinting of Mycobacterium tuberculosis.

OpenAIRE

Chaves, F; Yang, Z; el Hajj, H; Alonso, M; Burman, W J; Eisenach, K D; Dronda, F; Bates, J H; Cave, M D

1996-01-01

A comparison was made between DNA fingerprints of Mycobacterium tuberculosis produced with the insertion sequence IS6110 and those produced with the polymorphic GC-rich repetitive sequence contained in the plasmid pTBN12. A total of 302 M. tuberculosis isolates from the prison system in Madrid, Spain, and the Denver Public Health Department (Denver, Colo.) were analyzed with the two probes. Both probes identified the same isolates in the same clusters when the fingerprints had six or more cop...

DNA fingerprinting: a quality control case study for human biospecimen authentication.

Science.gov (United States)

Kofanova, Olga A; Mathieson, William; Thomas, Gerry A; Betsou, Fotini

2014-04-01

This case study illustrates the usefulness of the DNA fingerprinting method in biobank quality control (QC) procedures and emphasizes the need for detailed and accurate record keeping during processing of biological samples. It also underlines the value of independent third-party assessment to identify points at which errors are most likely to have occurred when unexpected results are obtained from biospecimens.

ENHANCING NETWORK SECURITY USING 'LEARNING-FROM-SIGNALS' AND FRACTIONAL FOURIER TRANSFORM BASED RF-DNA FINGERPRINTS

Energy Technology Data Exchange (ETDEWEB)

Buckner, Mark A [ORNL; Bobrek, Miljko [ORNL; Farquhar, Ethan [ORNL; Harmer, Paul K [Air Force Institute of Technology; Temple, Michael A [Air Force Institute of Technology

2011-01-01

Wireless Access Points (WAP) remain one of the top 10 network security threats. This research is part of an effort to develop a physical (PHY) layer aware Radio Frequency (RF) air monitoring system with multi-factor authentication to provide a first-line of defense for network security--stopping attackers before they can gain access to critical infrastructure networks through vulnerable WAPs. This paper presents early results on the identification of OFDM-based 802.11a WiFi devices using RF Distinct Native Attribute (RF-DNA) fingerprints produced by the Fractional Fourier Transform (FRFT). These fingerprints are input to a "Learning from Signals" (LFS) classifier which uses hybrid Differential Evolution/Conjugate Gradient (DECG) optimization to determine the optimal features for a low-rank model to be used for future predictions. Results are presented for devices under the most challenging conditions of intra-manufacturer classification, i.e., same-manufacturer, same-model, differing only in serial number. The results of Fractional Fourier Domain (FRFD) RF-DNA fingerprints demonstrate significant improvement over results based on Time Domain (TD), Spectral Domain (SD) and even Wavelet Domain (WD) fingerprints.

Optical Methods in Fingerprint Imaging for Medical and Personality Applications

Directory of Open Access Journals (Sweden)

Chia-Nan Wang

2017-10-01

Full Text Available Over the years, analysis and induction of personality traits has been a topic for individual subjective conjecture or speculation, rather than a focus of inductive scientific analysis. This study proposes a novel framework for analysis and induction of personality traits. First, 14 personality constructs based on the “Big Five” personality factors were developed. Next, a new fingerprint image algorithm was used for classification, and the fingerprints were classified into eight types. The relationship between personality traits and fingerprint type was derived from the results of the questionnaire survey. After comparison of pre-test and post-test results, this study determined the induction ability of personality traits from fingerprint type. Experimental results showed that the left/right thumbprint type of a majority of subjects was left loop/right loop and that the personalities of individuals with this fingerprint type were moderate with no significant differences in the 14 personality constructs.

Optical Methods in Fingerprint Imaging for Medical and Personality Applications

Science.gov (United States)

Wang, Jing-Wein; Lin, Ming-Hsun; Chang, Yao-Lang; Kuo, Chia-Ming

2017-01-01

Over the years, analysis and induction of personality traits has been a topic for individual subjective conjecture or speculation, rather than a focus of inductive scientific analysis. This study proposes a novel framework for analysis and induction of personality traits. First, 14 personality constructs based on the “Big Five” personality factors were developed. Next, a new fingerprint image algorithm was used for classification, and the fingerprints were classified into eight types. The relationship between personality traits and fingerprint type was derived from the results of the questionnaire survey. After comparison of pre-test and post-test results, this study determined the induction ability of personality traits from fingerprint type. Experimental results showed that the left/right thumbprint type of a majority of subjects was left loop/right loop and that the personalities of individuals with this fingerprint type were moderate with no significant differences in the 14 personality constructs. PMID:29065556

Optical image encryption using QR code and multilevel fingerprints in gyrator transform domains

Science.gov (United States)

Wei, Yang; Yan, Aimin; Dong, Jiabin; Hu, Zhijuan; Zhang, Jingtao

2017-11-01

A new concept of GT encryption scheme is proposed in this paper. We present a novel optical image encryption method by using quick response (QR) code and multilevel fingerprint keys in gyrator transform (GT) domains. In this method, an original image is firstly transformed into a QR code, which is placed in the input plane of cascaded GTs. Subsequently, the QR code is encrypted into the cipher-text by using multilevel fingerprint keys. The original image can be obtained easily by reading the high-quality retrieved QR code with hand-held devices. The main parameters used as private keys are GTs' rotation angles and multilevel fingerprints. Biometrics and cryptography are integrated with each other to improve data security. Numerical simulations are performed to demonstrate the validity and feasibility of the proposed encryption scheme. In the future, the method of applying QR codes and fingerprints in GT domains possesses much potential for information security.

Genetic diversity in different populations of sloths assessed by DNA fingerprinting

Directory of Open Access Journals (Sweden)

MORAES N.

2002-01-01

Full Text Available In this study we analyzed a population of Bradypus torquatus with individuals originally distributed in different localities of Bahia, and two populations of B. variegatus with individuals from Bahia and São Paulo States. Using the DNA fingerprinting method, we assessed the genetic variability within and between populations. Analysis of the DNA profiles revealed genetic similarity indices ranging from 0.34 ± 0.07 to 0.87 ± 0.04. Similar low levels of genetic variability were found only in isolated mammalian populations or among related individuals. This study presents the first analyses of genetic diversity in sloth populations.

Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

Science.gov (United States)

A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

Age Estimation with DNA: From Forensic DNA Fingerprinting to Forensic (Epi)Genomics: A Mini-Review.

Science.gov (United States)

Parson, Walther

2018-01-23

Forensic genetics developed from protein-based techniques a quarter of a century ago and became famous as "DNA fingerprinting," this being based on restriction fragment length polymorphisms (RFLPs) of high-molecular-weight DNA. The amplification of much smaller short tandem repeat (STR) sequences using the polymerase chain reaction soon replaced RFLP analysis and advanced to become the gold standard in genetic identification. Meanwhile, STR multiplexes have been developed and made commercially available which simultaneously amplify up to 30 STR loci from as little as 15 cells or fewer. The enormous information content that comes with the large variety of observed STR genotypes allows for genetic individualisation (with the exception of identical twins). Carefully selected core STR loci form the basis of intelligence-led DNA databases that provide investigative leads by linking unsolved crime scenes and criminals through their matched STR profiles. Nevertheless, the success of modern DNA fingerprinting depends on the availability of reference material from suspects. In order to provide new investigative leads in cases where such reference samples are absent, forensic scientists started to explore the prediction of phenotypic traits from the DNA of the evidentiary sample. This paradigm change now uses DNA and epigenetic markers to forecast characteristics that are useful to triage further investigative work. So far, the best investigated externally visible characteristics are eye, hair and skin colour, as well as geographic ancestry and age. Information on the chronological age of a stain donor (or any sample donor) is elemental for forensic investigations in a number of aspects and has, therefore, been explored by researchers in some detail. Among different methodological approaches tested to date, the methylation-sensitive analysis of carefully selected DNA markers (CpG sites) has brought the most promising results by providing prediction accuracies of ±3-4 years

Detection of γ-ray-induced DNA damages in malformed dominant lethal embryos of the Japanese medaka (Oryzias latipes) using AP-PCR fingerprinting

International Nuclear Information System (INIS)

Kubota, Yoshiko; Shimada, Atsuko; Shima, Akihiro

1992-01-01

Adult male fish of the medaka HNI strain exposed to 9.5 Gy or 19 Gy (0.95 Gy/min) of γ-rays were mated with non-irradiated female fish of the Hd-rR strain. Genomic DNA was prepared from malformed individual embryos which were expected to be dominant lethal and used for AP-PCR fingerprinting. By the use of a part of the T3 promoter sequence (20 mer), which is not found in the medaka genome as an arbitrary primer, polymorphisms were found in genomic fingerprints which could distinguish the parental strains. On the other hand, fingerprints of F1 hybrids were found to be the sum of those of their parents. Based on these findings, the fingerprints of genomic DNA of each severely malformed embryo were analyzed, because it was expected that radiation-induced genomic damages resulting in severe malformation and eventually in dominant lethals should be detected as changes in paternal fingerprints of F1 hybrids. Indeed, changes were found in genomic DNA as loss of some paternal bands in fingerprints of malformed embryos. One of 10 malformed embryos obtained from 9.5 Gy γ-irradiated males had lost 5 bands. These results indicated a possibility that quantitative as well as qualitative estimation of γ-ray-induced DNA damages can be made by this method which does not require the functional selection based on a specific target gene. (author). 16 refs., 3 figs., 1 tab

Distorted Fingerprint Verification System

Directory of Open Access Journals (Sweden)

Divya KARTHIKAESHWARAN

2011-01-01

Full Text Available Fingerprint verification is one of the most reliable personal identification methods. Fingerprint matching is affected by non-linear distortion introduced in fingerprint impression during the image acquisition process. This non-linear deformation changes both the position and orientation of minutiae. The proposed system operates in three stages: alignment based fingerprint matching, fuzzy clustering and classifier framework. First, an enhanced input fingerprint image has been aligned with the template fingerprint image and matching score is computed. To improve the performance of the system, a fuzzy clustering based on distance and density has been used to cluster the feature set obtained from the fingerprint matcher. Finally a classifier framework has been developed and found that cost sensitive classifier produces better results. The system has been evaluated on fingerprint database and the experimental result shows that system produces a verification rate of 96%. This system plays an important role in forensic and civilian applications.

High-speed biometrics ultrasonic system for 3D fingerprint imaging

Science.gov (United States)

Maev, Roman G.; Severin, Fedar

2012-10-01

The objective of this research is to develop a new robust fingerprint identification technology based upon forming surface-subsurface (under skin) ultrasonic 3D images of the finger pads. The presented work aims to create specialized ultrasonic scanning methods for biometric purposes. Preliminary research has demonstrated the applicability of acoustic microscopy for fingerprint reading. The additional information from internal skin layers and dermis structures contained in the scan can essentially improve confidence in the identification. Advantages of this system include high resolution and quick scanning time. Operating in pulse-echo mode provides spatial resolution up to 0.05 mm. Technology advantages of the proposed technology are the following: • Full-range scanning of the fingerprint area "nail to nail" (2.5 x 2.5 cm) can be done in less than 5 sec with a resolution of up to 1000 dpi. • Collection of information about the in-depth structure of the fingerprint realized by the set of spherically focused 50 MHz acoustic lens provide the resolution ~ 0.05 mm or better • In addition to fingerprints, this technology can identify sweat porous at the surface and under the skin • No sensitivity to the contamination of the finger's surface • Detection of blood velocity using Doppler effect can be implemented to distinguish living specimens • Utilization as polygraph device • Simple connectivity to fingerprint databases obtained with other techniques • The digitally interpolated images can then be enhanced allowing for greater resolution • Method can be applied to fingernails and underlying tissues, providing more information • A laboratory prototype of the biometrics system based on these described principles was designed, built and tested. It is the first step toward a practical implementation of this technique.

Fingerprinting of Peptides with a Large Channel of Bacteriophage Phi29 DNA Packaging Motor.

Science.gov (United States)

Ji, Zhouxiang; Wang, Shaoying; Zhao, Zhengyi; Zhou, Zhi; Haque, Farzin; Guo, Peixuan

2016-09-01

Nanopore technology has become a highly sensitive and powerful tool for single molecule sensing of chemicals and biopolymers. Protein pores have the advantages of size amenability, channel homogeneity, and fabrication reproducibility. But most well-studied protein pores for sensing are too small for passage of peptide analytes that are typically a few nanometers in dimension. The funnel-shaped channel of bacteriophage phi29 DNA packaging motor has previously been inserted into a lipid membrane to serve as a larger pore with a narrowest N-terminal constriction of 3.6 nm and a wider C-terminal end of 6 nm. Here, the utility of phi29 motor channel for fingerprinting of various peptides using single molecule electrophysiological assays is reported. The translocation of peptides is proved unequivocally by single molecule fluorescence imaging. Current blockage percentage and distinctive current signatures are used to distinguish peptides with high confidence. Each peptide generated one or two distinct current blockage peaks, serving as typical fingerprint for each peptide. The oligomeric states of peptides can also be studied in real time at single molecule level. The results demonstrate the potential for further development of phi29 motor channel for detection of disease-associated peptide biomarkers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

Science.gov (United States)

Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

2012-02-01

We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

A reliable and reproducible technique for DNA fingerprinting in biorepositories: a pilot study from BioBIM.

Science.gov (United States)

Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Ialongo, Cristiano; Leone, Barbara; Lopez, Nadia; Valente, Maria Giovanna; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

2013-12-17

Standard operating procedures (SOPs) optimization for nucleic acid extraction from stored samples is of crucial importance in a biological repository, considering the large number of collected samples and their future downstream molecular and biological applications. However, the validity of molecular studies using stored specimens depends not only on the integrity of the biological samples, but also on the procedures that ensure the traceability of the same sample, certifying its uniqueness, and ensuring the identification of potential sample contaminations. With this aim, we have developed a rapid, reliable, low-cost, and simple DNA fingerprinting tool for a routine use in quality control of biorepositories samples. The method consists of a double ALU insertion/deletion genotyping panel suitable for uniqueness, identification of sample contaminations, and gender validation. Preliminary data suggest that this easy-to-use DNA fingerprinting protocol could routinely provide assurances of DNA identity and quality in a biorepository setting.

Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform.

Science.gov (United States)

Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

2014-10-01

In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LIb) in sweet potato. Using 38 cultivars, we identified 2,024 insertion sites in the two families with an Illumina MiSeq sequencing platform. Of these insertion sites, 91.4% appeared to be polymorphic among the cultivars and 376 cultivar-specific insertion sites were identified, which were converted directly into cultivar-specific sequence-characterized amplified region (SCAR) markers. A phylogenetic tree was constructed using these insertion sites, which corresponded well with known pedigree information, thereby indicating their suitability for genetic diversity studies. Thus, the genome-wide comparative analysis of active retrotransposon insertion sites using the bench-top MiSeq sequencing platform is highly effective for DNA fingerprinting without any requirement for whole genome sequence information. This approach may facilitate the development of practical polymerase chain reaction-based cultivar diagnostic system and could also be applied to the determination of genetic relationships. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

Science.gov (United States)

Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

2017-01-01

Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

SU-E-I-75: Development of New Biological Fingerprints for Patient Recognition to Identify Misfiled Images in a PACS Server

Energy Technology Data Exchange (ETDEWEB)

Shimizu, Y; Yoon, Y; Iwase, K; Yasumatsu, S; Matsunobu, Y [Department of Health Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka, JP (Japan); Morishita, J [Department of Health Sciences, Faculty of Medical Sciences, Kyushu University, Fukuoka, JP (Japan)

2015-06-15

Purpose: We are trying to develop an image-searching technique to identify misfiled images in a picture archiving and communication system (PACS) server by using five biological fingerprints: the whole lung field, cardiac shadow, superior mediastinum, lung apex, and right lower lung. Each biological fingerprint in a chest radiograph includes distinctive anatomical structures to identify misfiled images. The whole lung field was less effective for evaluating the similarity between two images than the other biological fingerprints. This was mainly due to the variation in the positioning for chest radiographs. The purpose of this study is to develop new biological fingerprints that could reduce influence of differences in the positioning for chest radiography. Methods: Two hundred patients were selected randomly from our database (36,212 patients). These patients had two images each (current and previous images). Current images were used as the misfiled images in this study. A circumscribed rectangular area of the lung and the upper half of the rectangle were selected automatically as new biological fingerprints. These biological fingerprints were matched to all previous images in the database. The degrees of similarity between the two images were calculated for the same and different patients. The usefulness of new the biological fingerprints for automated patient recognition was examined in terms of receiver operating characteristic (ROC) analysis. Results: Area under the ROC curves (AUCs) for the circumscribed rectangle of the lung, upper half of the rectangle, and whole lung field were 0.980, 0.994, and 0.950, respectively. The new biological fingerprints showed better performance in identifying the patients correctly than the whole lung field. Conclusion: We have developed new biological fingerprints: circumscribed rectangle of the lung and upper half of the rectangle. These new biological fingerprints would be useful for automated patient identification system

SU-E-I-75: Development of New Biological Fingerprints for Patient Recognition to Identify Misfiled Images in a PACS Server

International Nuclear Information System (INIS)

Shimizu, Y; Yoon, Y; Iwase, K; Yasumatsu, S; Matsunobu, Y; Morishita, J

2015-01-01

Purpose: We are trying to develop an image-searching technique to identify misfiled images in a picture archiving and communication system (PACS) server by using five biological fingerprints: the whole lung field, cardiac shadow, superior mediastinum, lung apex, and right lower lung. Each biological fingerprint in a chest radiograph includes distinctive anatomical structures to identify misfiled images. The whole lung field was less effective for evaluating the similarity between two images than the other biological fingerprints. This was mainly due to the variation in the positioning for chest radiographs. The purpose of this study is to develop new biological fingerprints that could reduce influence of differences in the positioning for chest radiography. Methods: Two hundred patients were selected randomly from our database (36,212 patients). These patients had two images each (current and previous images). Current images were used as the misfiled images in this study. A circumscribed rectangular area of the lung and the upper half of the rectangle were selected automatically as new biological fingerprints. These biological fingerprints were matched to all previous images in the database. The degrees of similarity between the two images were calculated for the same and different patients. The usefulness of new the biological fingerprints for automated patient recognition was examined in terms of receiver operating characteristic (ROC) analysis. Results: Area under the ROC curves (AUCs) for the circumscribed rectangle of the lung, upper half of the rectangle, and whole lung field were 0.980, 0.994, and 0.950, respectively. The new biological fingerprints showed better performance in identifying the patients correctly than the whole lung field. Conclusion: We have developed new biological fingerprints: circumscribed rectangle of the lung and upper half of the rectangle. These new biological fingerprints would be useful for automated patient identification system

Efficient Hardware Implementation For Fingerprint Image Enhancement Using Anisotropic Gaussian Filter.

Science.gov (United States)

Khan, Tariq Mahmood; Bailey, Donald G; Khan, Mohammad A U; Kong, Yinan

2017-05-01

A real-time image filtering technique is proposed which could result in faster implementation for fingerprint image enhancement. One major hurdle associated with fingerprint filtering techniques is the expensive nature of their hardware implementations. To circumvent this, a modified anisotropic Gaussian filter is efficiently adopted in hardware by decomposing the filter into two orthogonal Gaussians and an oriented line Gaussian. An architecture is developed for dynamically controlling the orientation of the line Gaussian filter. To further improve the performance of the filter, the input image is homogenized by a local image normalization. In the proposed structure, for a middle-range reconfigurable FPGA, both parallel compute-intensive and real-time demands were achieved. We manage to efficiently speed up the image-processing time and improve the resource utilization of the FPGA. Test results show an improved speed for its hardware architecture while maintaining reasonable enhancement benchmarks.

Photogrammetric fingerprint unwrapping

Science.gov (United States)

Paar, Gerhard; del Pilar Caballo Perucha, Maria; Bauer, Arnold; Nauschnegg, Bernhard

2008-04-01

Fingerprints are important biometric cues. Compared to conventional fingerprint sensors the use of contact-free stereoscopic image acquisition of the front-most finger segment has a set of advantages: Finger deformation is avoided, the entire relevant area for biometric use is covered, some technical aspects like sensor maintenance and cleaning are facilitated, and access to a three-dimensional reconstruction of the covered area is possible. We describe a photogrammetric workflow for nail-to-nail fingerprint reconstruction: A calibrated sensor setup with typically 5 cameras and dedicated illumination acquires adjacent stereo pairs. Using the silhouettes of the segmented finger a raw cylindrical model is generated. After preprocessing (shading correction, dust removal, lens distortion correction), each individual camera texture is projected onto the model. Image-to-image matching on these pseudo ortho images and dense 3D reconstruction obtains a textured cylindrical digital surface model with radial distances around the major axis and a grid size in the range of 25-50 µm. The model allows for objective fingerprint unwrapping and novel fingerprint matching algorithms since 3D relations between fingerprint features are available as additional cues. Moreover, covering the entire region with relevant fingerprint texture is particularly important for establishing a comprehensive forensic database. The workflow has been implemented in portable C and is ready for industrial exploitation. Further improvement issues are code optimization, unwrapping method, illumination strategy to avoid highlights and to improve the initial segmentation, and the comparison of the unwrapping result to conventional fingerprint acquisition technology.

Assessing the Risk of Secondary Transfer Via Fingerprint Brush Contamination Using Enhanced Sensitivity DNA Analysis Methods.

Science.gov (United States)

Bolivar, Paula-Andrea; Tracey, Martin; McCord, Bruce

2016-01-01

Experiments were performed to determine the extent of cross-contamination of DNA resulting from secondary transfer due to fingerprint brushes used on multiple items of evidence. Analysis of both standard and low copy number (LCN) STR was performed. Two different procedures were used to enhance sensitivity, post-PCR cleanup and increased cycle number. Under standard STR typing procedures, some additional alleles were produced that were not present in the controls or blanks; however, there was insufficient data to include the contaminant donor as a contributor. Inclusion of the contaminant donor did occur for one sample using post-PCR cleanup. Detection of the contaminant donor occurred for every replicate of the 31 cycle amplifications; however, using LCN interpretation recommendations for consensus profiles, only one sample would include the contaminant donor. Our results indicate that detection of secondary transfer of DNA can occur through fingerprint brush contamination and is enhanced using LCN-DNA methods. © 2015 American Academy of Forensic Sciences.

Genetic variation in Phoca vitulina (the harbour seal) revealed by DNA fingerprinting and RAPDs

NARCIS (Netherlands)

Kappe, A.L.; van de Zande, L.; Vedder, E.J.; Bijlsma, R.; van Delden, Wilke

Genetic variation in two harbour seal (Phoca vitulina) populations from the Dutch Wadden Sea and Scotland was examined by RAPD analysis and DNA fingerprinting. For comparison a population of grey seals (Halichoerus grypus) was studied. The RAPD method revealed a very low number of polymorphic bands.

Acute and chronic gregarisation are associated with distinct DNA methylation fingerprints in desert locusts.

Science.gov (United States)

Mallon, Eamonn B; Amarasinghe, Harindra E; Ott, Swidbert R

2016-10-18

Desert locusts (Schistocerca gregaria) show a dramatic form of socially induced phenotypic plasticity known as phase polyphenism. In the absence of conspecifics, locusts occur in a shy and cryptic solitarious phase. Crowding with conspecifics drives a behavioural transformation towards gregariousness that occurs within hours and is followed by changes in physiology, colouration and morphology, resulting in the full gregarious phase syndrome. We analysed methylation-sensitive amplified fragment length polymorphisms (MS-AFLP) to compare the effect of acute and chronic crowding on DNA methylation in the central nervous system. We find that crowd-reared and solitary-reared locusts show markedly different neural MS-AFLP fingerprints. However, crowding for a day resulted in neural MS-AFLP fingerprints that were clearly distinct from both crowd-reared and uncrowded solitary-reared locusts. Our results indicate that changes in DNA methylation associated with behavioural gregarisation proceed through intermediate states that are not simply partial realisations of the endpoint states.

DNA fingerprinting approaches to trace Escherichia coli sharing between dogs and owners.

Science.gov (United States)

Naziri, Z; Derakhshandeh, A; Firouzi, R; Motamedifar, M; Shojaee Tabrizi, A

2016-02-01

To determine the prevalence of cross-species sharing of Escherichia coli between healthy dogs and humans living in the same household. Two faecal E. coli isolates from 25 healthy dog-owner pairs and 16 healthy control humans were tested using three fingerprinting methods. The prevalence of within-household sharing of E. coli was 4, 8 and 8% using pulsed-field gel electrophoresis, randomly amplified polymorphic DNA and enterobacterial repetitive intergenic consensus-PCR analyses respectively. Within-household bacterial sharing was more prevalent than across-household sharing (P fingerprinting techniques will help to find ways for reducing the economic impact of E. coli infections. This study support claims that public health concerns regarding the cross-species sharing of E. coli are warranted but this risk is minimal. © 2015 The Society for Applied Microbiology.

Development of an optimized random amplified polymorphic DNA protocol for fingerprinting of Klebsiella pneumoniae.

Science.gov (United States)

Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M

2012-04-01

To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

Fingerprint pores extractor

CSIR Research Space (South Africa)

Mngenge, NA

2012-11-01

Full Text Available , this is not always the case because of diseases and hash working conditions that affect fingerprints. In order to maintain high level of security independent of varying fingerprint image quality research suggests the use of other fingerprint features to compliment...

Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

Science.gov (United States)

Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

2018-01-01

Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

Genetic diversity analysis of nine chewing cane varieties (lines) and construction of their DNA fingerprints

Science.gov (United States)

In order to provide theoretical basis for variety identification and parental selection during sugarcane breeding process, the present study was conducted to analyze genetic diversity of nine chewing cane varieties (lines) and construct their DNA fingerprints. Combining twenty-one SSR molecular mark...

Fingerprint recognition with identical twin fingerprints.

Science.gov (United States)

Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

2012-01-01

Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

Fingerprint recognition with identical twin fingerprints.

Directory of Open Access Journals (Sweden)

Xunqiang Tao

Full Text Available Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6 images. Compared to the previous work, our contributions are summarized as follows: (1 Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2 Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3 A larger sample (83 pairs was collected. (4 A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5 A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

DNA Fingerprint Analysis of Three Short Tandem Repeat (STR) Loci for Biochemistry and Forensic Science Laboratory Courses

Science.gov (United States)

McNamara-Schroeder, Kathleen; Olonan, Cheryl; Chu, Simon; Montoya, Maria C.; Alviri, Mahta; Ginty, Shannon; Love, John J.

2006-01-01

We have devised and implemented a DNA fingerprinting module for an upper division undergraduate laboratory based on the amplification and analysis of three of the 13 short tandem repeat loci that are required by the Federal Bureau of Investigation Combined DNA Index System (FBI CODIS) data base. Students first collect human epithelial (cheek)…

Recovery of DNA from latent fingerprint tape lifts archived against matte acetate.

Science.gov (United States)

Steadman, Shelly A; Hoofer, Steven R; Geering, Sarah C; King, Stephanie; Bennett, Marc A

2015-05-01

This study was driven by court order to examine methods to remove, extract, and STR-type potential DNA entrapped between latent fingerprint lifting tape and matte acetate that was collected from a 1977 crime scene. Results indicate that recovery of appreciable quantities of DNA is more challenging once adhesive is attached to matte acetate cards and even more difficult when fixed following black powder enhancement. STR amplification of extracts from entrapped fingermarks collected following the dusting/lifting procedure did not produce robust profiles, and extraneous peaks not expressed by print donors were detected for some samples. A hearing was set to argue whether there was DNA remaining to be tested, and if so, whether that DNA could be exculpatory in this postconviction matter. The studies herein provided the basis for the court's decision to not require the testing. © 2015 American Academy of Forensic Sciences.

[Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

Science.gov (United States)

Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

2009-02-01

To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers

Directory of Open Access Journals (Sweden)

Liwu Zhang

2015-10-01

Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers

Institute of Scientific and Technical Information of China (English)

Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi

2015-01-01

Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

Person recognition using fingerprints and top-view finger images

Directory of Open Access Journals (Sweden)

Panyayot Chaikan

2010-03-01

Full Text Available Our multimodal biometric system combines fingerprinting with a top-view finger image captured by a CCD camera without user intervention. The greyscale image is preprocessed to enhance its edges, skin furrows, and the nail shape before being manipulated by a bank of oriented filters. A square tessellation is applied to the filtered image to create a feature map, called a NailCode, which is employed in Euclidean distance computations. The NailCode reduces system errors by 17.68% in the verification mode, and by 6.82% in the identification mode.

A topology based approach to categorization of fingerprint images

DEFF Research Database (Denmark)

Aabrandt, A.; Olsen, M. A.; Busch, C.

2012-01-01

, an image is viewed as a triangulated point cloud and the topology associated with this construct is summarized using its first betti number - a number that indicates the number of distinct cycles in the triangulation associated to the particular image. This number is then compared against the first betti...... numbers of “n” prototype images in order to perform classification (“fingerprint” vs “non-fingerprint”). The proposed method is compared against SIVV (a tool provided by NIST). Experimental results on fingerprint and iris databases demonstrate the potential of the scheme....

Acquiring a 2D rolled equivalent fingerprint image from a non-contact 3D finger scan

Science.gov (United States)

Fatehpuria, Abhishika; Lau, Daniel L.; Hassebrook, Laurence G.

2006-04-01

The use of fingerprints as a biometric is both the oldest mode of computer aided personal identification and the most relied-upon technology in use today. But current fingerprint scanning systems have some challenging and peculiar difficulties. Often skin conditions and imperfect acquisition circumstances cause the captured fingerprint image to be far from ideal. Also some of the acquisition techniques can be slow and cumbersome to use and may not provide the complete information required for reliable feature extraction and fingerprint matching. Most of the difficulties arise due to the contact of the fingerprint surface with the sensor platen. To attain a fast-capture, non-contact, fingerprint scanning technology, we are developing a scanning system that employs structured light illumination as a means for acquiring a 3-D scan of the finger with sufficiently high resolution to record ridge-level details. In this paper, we describe the postprocessing steps used for converting the acquired 3-D scan of the subject's finger into a 2-D rolled equivalent image.

DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

International Nuclear Information System (INIS)

Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

2004-01-01

The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

Evaluation of a single-pixel one-transistor active pixel sensor for fingerprint imaging

Science.gov (United States)

Xu, Man; Ou, Hai; Chen, Jun; Wang, Kai

2015-08-01

Since it first appeared in iPhone 5S in 2013, fingerprint identification (ID) has rapidly gained popularity among consumers. Current fingerprint-enabled smartphones unanimously consists of a discrete sensor to perform fingerprint ID. This architecture not only incurs higher material and manufacturing cost, but also provides only static identification and limited authentication. Hence as the demand for a thinner, lighter, and more secure handset grows, we propose a novel pixel architecture that is a photosensitive device embedded in a display pixel and detects the reflected light from the finger touch for high resolution, high fidelity and dynamic biometrics. To this purpose, an amorphous silicon (a-Si:H) dual-gate photo TFT working in both fingerprint-imaging mode and display-driving mode will be developed.

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

Magnetic Resonance Fingerprinting - a promising new approach to obtain standardized imaging biomarkers from MRI.

Science.gov (United States)

2015-04-01

Current routine MRI examinations rely on the acquisition of qualitative images that have a contrast "weighted" for a mixture of (magnetic) tissue properties. Recently, a novel approach was introduced, namely MR Fingerprinting (MRF) with a completely different approach to data acquisition, post-processing and visualization. Instead of using a repeated, serial acquisition of data for the characterization of individual parameters of interest, MRF uses a pseudo randomized acquisition that causes the signals from different tissues to have a unique signal evolution or 'fingerprint' that is simultaneously a function of the multiple material properties under investigation. The processing after acquisition involves a pattern recognition algorithm to match the fingerprints to a predefined dictionary of predicted signal evolutions. These can then be translated into quantitative maps of the magnetic parameters of interest. MR Fingerprinting (MRF) is a technique that could theoretically be applied to most traditional qualitative MRI methods and replaces them with acquisition of truly quantitative tissue measures. MRF is, thereby, expected to be much more accurate and reproducible than traditional MRI and should improve multi-center studies and significantly reduce reader bias when diagnostic imaging is performed. Key Points • MR fingerprinting (MRF) is a new approach to data acquisition, post-processing and visualization.• MRF provides highly accurate quantitative maps of T1, T2, proton density, diffusion.• MRF may offer multiparametric imaging with high reproducibility, and high potential for multicenter/ multivendor studies.

Fingerprint fake detection by optical coherence tomography

Science.gov (United States)

Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

2013-03-01

The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

Forensic comparison and matching of fingerprints: using quantitative image measures for estimating error rates through understanding and predicting difficulty.

Directory of Open Access Journals (Sweden)

Philip J Kellman

Full Text Available Latent fingerprint examination is a complex task that, despite advances in image processing, still fundamentally depends on the visual judgments of highly trained human examiners. Fingerprints collected from crime scenes typically contain less information than fingerprints collected under controlled conditions. Specifically, they are often noisy and distorted and may contain only a portion of the total fingerprint area. Expertise in fingerprint comparison, like other forms of perceptual expertise, such as face recognition or aircraft identification, depends on perceptual learning processes that lead to the discovery of features and relations that matter in comparing prints. Relatively little is known about the perceptual processes involved in making comparisons, and even less is known about what characteristics of fingerprint pairs make particular comparisons easy or difficult. We measured expert examiner performance and judgments of difficulty and confidence on a new fingerprint database. We developed a number of quantitative measures of image characteristics and used multiple regression techniques to discover objective predictors of error as well as perceived difficulty and confidence. A number of useful predictors emerged, and these included variables related to image quality metrics, such as intensity and contrast information, as well as measures of information quantity, such as the total fingerprint area. Also included were configural features that fingerprint experts have noted, such as the presence and clarity of global features and fingerprint ridges. Within the constraints of the overall low error rates of experts, a regression model incorporating the derived predictors demonstrated reasonable success in predicting objective difficulty for print pairs, as shown both in goodness of fit measures to the original data set and in a cross validation test. The results indicate the plausibility of using objective image metrics to predict expert

Forensic comparison and matching of fingerprints: using quantitative image measures for estimating error rates through understanding and predicting difficulty.

Science.gov (United States)

Kellman, Philip J; Mnookin, Jennifer L; Erlikhman, Gennady; Garrigan, Patrick; Ghose, Tandra; Mettler, Everett; Charlton, David; Dror, Itiel E

2014-01-01

Latent fingerprint examination is a complex task that, despite advances in image processing, still fundamentally depends on the visual judgments of highly trained human examiners. Fingerprints collected from crime scenes typically contain less information than fingerprints collected under controlled conditions. Specifically, they are often noisy and distorted and may contain only a portion of the total fingerprint area. Expertise in fingerprint comparison, like other forms of perceptual expertise, such as face recognition or aircraft identification, depends on perceptual learning processes that lead to the discovery of features and relations that matter in comparing prints. Relatively little is known about the perceptual processes involved in making comparisons, and even less is known about what characteristics of fingerprint pairs make particular comparisons easy or difficult. We measured expert examiner performance and judgments of difficulty and confidence on a new fingerprint database. We developed a number of quantitative measures of image characteristics and used multiple regression techniques to discover objective predictors of error as well as perceived difficulty and confidence. A number of useful predictors emerged, and these included variables related to image quality metrics, such as intensity and contrast information, as well as measures of information quantity, such as the total fingerprint area. Also included were configural features that fingerprint experts have noted, such as the presence and clarity of global features and fingerprint ridges. Within the constraints of the overall low error rates of experts, a regression model incorporating the derived predictors demonstrated reasonable success in predicting objective difficulty for print pairs, as shown both in goodness of fit measures to the original data set and in a cross validation test. The results indicate the plausibility of using objective image metrics to predict expert performance and

Usefulness of biological fingerprint in magnetic resonance imaging for patient verification.

Science.gov (United States)

Ueda, Yasuyuki; Morishita, Junji; Kudomi, Shohei; Ueda, Katsuhiko

2016-09-01

The purpose of our study is to investigate the feasibility of automated patient verification using multi-planar reconstruction (MPR) images generated from three-dimensional magnetic resonance (MR) imaging of the brain. Several anatomy-related MPR images generated from three-dimensional fast scout scan of each MR examination were used as biological fingerprint images in this study. The database of this study consisted of 730 temporal pairs of MR examination of the brain. We calculated the correlation value between current and prior biological fingerprint images of the same patient and also all combinations of two images for different patients to evaluate the effectiveness of our method for patient verification. The best performance of our system were as follows: a half-total error rate of 1.59 % with a false acceptance rate of 0.023 % and a false rejection rate of 3.15 %, an equal error rate of 1.37 %, and a rank-one identification rate of 98.6 %. Our method makes it possible to verify the identity of the patient using only some existing medical images without the addition of incidental equipment. Also, our method will contribute to patient misidentification error management caused by human errors.

Effects of latent fingerprint development reagents on subsequent forensic DNA typing: a review.

Science.gov (United States)

Kumar, Parveen; Gupta, Ritika; Singh, Rajinder; Jasuja, Om Prakash

2015-05-01

Successful development of latent fingerprints can be helpful in solving the case but in case where fingerprints are smudged, distorted or overlapped, the question arises whether it is still possible to identify the person apart from dermatoglyphic features. Sweat residue present in the latent prints is supposed to have quite good quantity of cellular material which if analyzed properly can be used to generate forensic DNA profile of the individual and may answer the queries related to the effect of reagents used to develop the prints, as they may have a significant effect on the process of examination of this evidentiary material. In the present work an effort has been made to summarize the published review of literature on this aspect of personal identification. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

DNA fingerprinting, biological and chemical investigation of certain Yucca species.

Science.gov (United States)

El Hawary, Seham; El Sayed, Abeer; Helmy, Maged W; El Naggar, El Moataz Bellah; Marzouk, Hanan S; Bassam, Samar M

2018-01-05

Yucca aloifolia, Y. aloifolia variegata, Y. elephantipes and Y. filamentosa were investigated. DNA sequencing was performed for the four plants and a genomic DNA fingerprint was obtained and provided. The cytotoxic activities against four human cancer cell lines were investigated. The ethanolic extracts of leaves of Y. aloifolia variegata prevailed, especially against liver cancer HepG-2 and breast cancer MCF-7. In vivo assessment of hepatoprotective activity in rats also revealed the hepatoprotective potential of the ethanolic extracts of the four plants against CCl 4 - induced rats' liver damage. Qualitative and quantitative analysis of the flavonoid and phenolic content of the promising species was performed using HPLC. The analysis identified and quantified 18 flavonoids and 19 phenolic acids in the different fractions of Y. aloifolia variegata, among which the major flavonoids were hesperidin and kaemp-3-(2-p-coumaroyl) glucose and the major phenolic acids were gallic acid and protocatechuic acid.

A New Approach for Fingerprint Image Compression

Energy Technology Data Exchange (ETDEWEB)

Mazieres, Bertrand

1997-12-01

The FBI has been collecting fingerprint cards since 1924 and now has over 200 million of them. Digitized with 8 bits of grayscale resolution at 500 dots per inch, it means 2000 terabytes of information. Also, without any compression, transmitting a 10 Mb card over a 9600 baud connection will need 3 hours. Hence we need a compression and a compression as close to lossless as possible: all fingerprint details must be kept. A lossless compression usually do not give a better compression ratio than 2:1, which is not sufficient. Compressing these images with the JPEG standard leads to artefacts which appear even at low compression rates. Therefore the FBI has chosen in 1993 a scheme of compression based on a wavelet transform, followed by a scalar quantization and an entropy coding : the so-called WSQ. This scheme allows to achieve compression ratios of 20:1 without any perceptible loss of quality. The publication of the FBI specifies a decoder, which means that many parameters can be changed in the encoding process: the type of analysis/reconstruction filters, the way the bit allocation is made, the number of Huffman tables used for the entropy coding. The first encoder used 9/7 filters for the wavelet transform and did the bit allocation using a high-rate bit assumption. Since the transform is made into 64 subbands, quite a lot of bands receive only a few bits even at an archival quality compression rate of 0.75 bit/pixel. Thus, after a brief overview of the standard, we will discuss a new approach for the bit-allocation that seems to make more sense where theory is concerned. Then we will talk about some implementation aspects, particularly for the new entropy coder and the features that allow other applications than fingerprint image compression. Finally, we will compare the performances of the new encoder to those of the first encoder.

Image encryption using fingerprint as key based on phase retrieval algorithm and public key cryptography

Science.gov (United States)

Zhao, Tieyu; Ran, Qiwen; Yuan, Lin; Chi, Yingying; Ma, Jing

2015-09-01

In this paper, a novel image encryption system with fingerprint used as a secret key is proposed based on the phase retrieval algorithm and RSA public key algorithm. In the system, the encryption keys include the fingerprint and the public key of RSA algorithm, while the decryption keys are the fingerprint and the private key of RSA algorithm. If the users share the fingerprint, then the system will meet the basic agreement of asymmetric cryptography. The system is also applicable for the information authentication. The fingerprint as secret key is used in both the encryption and decryption processes so that the receiver can identify the authenticity of the ciphertext by using the fingerprint in decryption process. Finally, the simulation results show the validity of the encryption scheme and the high robustness against attacks based on the phase retrieval technique.

Enhancing security of fingerprints through contextual biometric watermarking.

Science.gov (United States)

Noore, Afzel; Singh, Richa; Vatsa, Mayank; Houck, Max M

2007-07-04

This paper presents a novel digital watermarking technique using face and demographic text data as multiple watermarks for verifying the chain of custody and protecting the integrity of a fingerprint image. The watermarks are embedded in selected texture regions of a fingerprint image using discrete wavelet transform. Experimental results show that modifications in these locations are visually imperceptible and maintain the minutiae details. The integrity of the fingerprint image is verified through the high matching scores obtained from an automatic fingerprint identification system. There is also a high degree of visual correlation between the embedded images, and the extracted images from the watermarked fingerprint. The degree of similarity is computed using pixel-based metrics and human visual system metrics. The results also show that the proposed watermarked fingerprint and the extracted images are resilient to common attacks such as compression, filtering, and noise.

Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

International Nuclear Information System (INIS)

Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

2015-01-01

In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

Low frequency of extra-pair fertilizations in the Great Tit Parus major revealed by DNA fingerprinting

NARCIS (Netherlands)

Verboven, N.; Mateman, A.C.

1997-01-01

Multilocus DNA fingerprinting was used to estimate the frequency of extra-pair fertilizations in a low density, island population of Great Tits Parus major. A total of 69 pairs and 516 offspring from 82 breeding attempts were examined. Only 18 offspring (3.5%) in seven different nests were not

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

International Nuclear Information System (INIS)

Wang Hua; Zhang Jian; Wang Kai; Liu Bing-Bing; Zou Bo; Zou Guang-Tian; Yang Fan; Shen Si-Le

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively. (general)

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

Science.gov (United States)

Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

Implementation of Minutiae Based Fingerprint Identification System Using Crossing Number Concept

Directory of Open Access Journals (Sweden)

Atul S. CHAUDHARI

2014-01-01

Full Text Available Biometric system is essentially a pattern recognition system which recognizes a person by determining the authenticity of a specific physiological (e.g., fingerprints, face, retina, iris or behavioral (e.g., gait, signature characteristic possessed by that person. Among all the presently employed biometric techniques, fingerprint identification systems have received the most attention due to the long history of fingerprints and its extensive use in forensics. Fingerprint is reliable biometric characteristic as it is unique and persistence. Fingerprint is the pattern of ridges and valleys on the surface of fingertip. However, recognizing fingerprints in poor quality images is still a very complex job, so the fingerprint image must be preprocessed before matching. It is very difficult to extract fingerprint features directly from gray scale fingerprint image. In this paper we have proposed the system which uses minutiae based matching algorithm for fingerprint identification. There are three main phases in proposed algorithm. First phase enhance the input fingerprint image by preprocessing it. The enhanced fingerprint image is converted into thinned binary image and then minutiae are extracted by using Crossing Number Concept in second phase. Third stage compares input fingerprint image (after preprocessing and minutiae extraction with fingerprint images enrolled in database and makes decision whether the input fingerprint is matched with the fingerprint stored in database or not.

Tools for quality control of fingerprint databases

Science.gov (United States)

Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

2010-04-01

Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

DNA-fingerprinting di stipiti di Chryseobacterium spp isolati da pazienti con Fibrosi Cistica

Directory of Open Access Journals (Sweden)

Antonietta Lambiase

2007-03-01

Full Text Available Objectives: Pulmonary infections by Gram-negative bacteria, as Pseudomonas aeruginosa, Burkholderia cepacia, Stenotrophomonas maltophilia, are the major cause of morbidity in Cystic Fibrosis patients. In the past decade, several pathogens as Alcaligenes spp and no tuberculosis mycobacteria have been recovered in these patients. Bacteria of genus Chryseobacterium are widespread Gram-negative microrganisms and involved in human infections. Aims of this study were to value the isolation frequency of Chryseobacterium strains in a cohort of Cystic Fibrosis patients, to investigate their antimicrobial sensibility and to establish possible clonal likeness between strains. Methods:A retrospective study was undertaken between January 2003 and December 2005 on 300 patients receiving care at the Regional Cystic Fibrosis Centre of Naples University “Federico II”. Sputum samples were checked: for bacterial identification, selective media and commercial identification systems were used.The activity of antimicrobial agents was determined using diffusion and microdiluthion methods. For DNA-fingerprinting, a genomic DNA macrorestriction followed by pulsed-field electrophoresis was carried out. Results:A total of 26 strains from 17 patients were isolated (7 C. meningosepticum, 14 C. indologenes, 5 C. gleum. Strains were resistant to cephalosporins and carbapenems; some were sensitive to ciprofloxacin, levofloxacin and trimethoprim-sulphamethoxazole. Macrorestriction analysis showed substantial heterogeneity among strains. Conclusions: Actually, the prognostic role of Chryseobacterium in Cystic Fibrosis is unclear and although the small number of isolations, it is need to be on the look out regard such microorganisms. The considerable resistance implies difficulties on therapeutic approach. Results of DNA-fingerprinting indicate no evidence of clonal likeness and then of patient-to-patient spread.

Segmentation of forensic latent fingerprint images lifted contact-less from planar surfaces with optical cohererence tomography

CSIR Research Space (South Africa)

Khutlang, R

2015-07-01

Full Text Available the substrate surface plus the latent fingerprint impression left on it. They are concatenated together to form a 2-D segmented image of the lifted fingerprint. After enhancement using contrast-limited adaptive histogram equalization, minutiae were extracted...

Fingerprint Recognition Using Minutia Score Matching

OpenAIRE

J, Ravi.; Raja, K. B.; R, Venugopal. K.

2010-01-01

The popular Biometric used to authenticate a person is Fingerprint which is unique and permanent throughout a person’s life. A minutia matching is widely used for fingerprint recognition and can be classified as ridge ending and ridge bifurcation. In this paper we projected Fingerprint Recognition using Minutia Score Matching method (FRMSM). For Fingerprint thinning, the Block Filter is used, which scans the image at the boundary to preserves the quality of the image and extract the minutiae ...

Novelty detection-based internal fingerprint segmentation in optical coherence tomography images

CSIR Research Space (South Africa)

Khutlang, R

2014-12-01

Full Text Available present an automatic segmentation of the papillary layer method, in 3-D swept source optical coherence tomography (SS-OCT) images. The papillary contour represents the internal fingerprint, which does not suffer external skin problems. The slices composing...

Novelty detection-based internal fingerprint segmentation in optical coherence tomography images

CSIR Research Space (South Africa)

Khutlang, Rethabile

2017-08-01

Full Text Available present an automatic segmentation of the papillary layer method, from images acquired using contact-less 3-D swept source optical coherence tomography (OCT). The papillary contour represents the internal fingerprint, which does not suffer from the external...

DNA fingerprint similarity between female and juvenile brown-headed cowbirds trapped together

Science.gov (United States)

Hahn, D.C.; Fleischer, R.C.

1995-01-01

This DNA fingerprinting study investigates whether females of the brood parasite brown-headed cowbird, Molothrus ater, associate with their own juvenile offspring at feeding sites more often than would be expected by chance. Cowbirds lay their eggs in the nests of a variety of host species and, as far as is known, leave them to the care of foster parents. Using baited walk-in funnel traps, 36 adult female-juvenile pairs (or trios) of cowbirds were trapped. Blood samples were collected from these individuals to conduct DNA fingerprinting analyses, calculate similarity indices, and to compare S-values for the 11 comparisons of juveniles and the females with which they were caught with S-values of random pairings of juveniles and the females in adjacent gel lanes with which they were not caught. Overall band-sharing was significantly higher for the individuals trapped together than for the random pairings. These associations between juvenile cowbirds and their mothers could occur as a result of female cowbirds monitoring the development of their young in the nests where they have laid. Alternatively, nestling cowbirds in the nest could become familiar visually and locally with a female parent that is frequently in their territory and could follow her when she departs for feeding grounds. In either case these data suggest that adult cowbirds associate with juveniles, in some cases their own offspring, and that offspring may learn to function as cowbirds in part from this association.

Tuberculosis outbreaks predicted by characteristics of first patients in a DNA fingerprint cluster.

Science.gov (United States)

Kik, Sandra V; Verver, Suzanne; van Soolingen, Dick; de Haas, Petra E W; Cobelens, Frank G; Kremer, Kristin; van Deutekom, Henk; Borgdorff, Martien W

2008-07-01

Some clusters of patients who have Mycobacterium tuberculosis isolates with identical DNA fingerprint patterns grow faster than others. It is unclear what predictors determine cluster growth. To assess whether the development of a tuberculosis (TB) outbreak can be predicted by the characteristics of its first two patients. Demographic and clinical data of all culture-confirmed patients with TB in the Netherlands from 1993 through 2004 were combined with DNA fingerprint data. Clusters were restricted to cluster episodes of 2 years to only detect newly arising clusters. Characteristics of the first two patients were compared between small (2-4 cases) and large (5 or more cases) cluster episodes. Of 5,454 clustered cases, 1,756 (32%) were part of a cluster episode of 2 years. Of 622 cluster episodes, 54 (9%) were large and 568 (91%) were small episodes. Independent predictors for large cluster episodes were as follows: less than 3 months' time between the diagnosis of the first two patients, one or both patients were young (<35 yr), both patients lived in an urban area, and both patients came from sub-Saharan Africa. In the Netherlands, patients in new cluster episodes should be screened for these risk factors. When the risk pattern applies, targeted interventions (e.g., intensified contact investigation) should be considered to prevent further cluster expansion.

Identification of a new hominin bone from Denisova Cave, Siberia using collagen fingerprinting and mitochondrial DNA analysis

Science.gov (United States)

Brown, Samantha; Higham, Thomas; Slon, Viviane; Pääbo, Svante; Meyer, Matthias; Douka, Katerina; Brock, Fiona; Comeskey, Daniel; Procopio, Noemi; Shunkov, Michael; Derevianko, Anatoly; Buckley, Michael

2016-03-01

DNA sequencing has revolutionised our understanding of archaic humans during the Middle and Upper Palaeolithic. Unfortunately, while many Palaeolithic sites contain large numbers of bones, the majority of these lack the diagnostic features necessary for traditional morphological identification. As a result the recovery of Pleistocene-age human remains is extremely rare. To circumvent this problem we have applied a method of collagen fingerprinting to more than 2000 fragmented bones from the site of Denisova Cave, Russia, in order to facilitate the discovery of human remains. As a result of our analysis a single hominin bone (Denisova 11) was identified, supported through in-depth peptide sequencing analysis, and found to carry mitochondrial DNA of the Neandertal type. Subsequent radiocarbon dating revealed the bone to be >50,000 years old. Here we demonstrate the huge potential collagen fingerprinting has for identifying hominin remains in highly fragmentary archaeological assemblages, improving the resources available for wider studies into human evolution.

Examining the effects of a DNA fingerprinting workshop on science teachers' professional development and student learning

Science.gov (United States)

Sonmez, Duygu

behavior. The goal is to understand what factors affect teachers' decision making to implement the new knowledge and skills in their classrooms. For this purpose, the study focuses on the effects of a DNA fingerprinting workshop, which has been developed and is regularly offered by a large Midwestern university in the United States for secondary science teachers and their students through cooperation between the university and a large Midwestern public school district. The workshop focuses on the biotechnology applications of genetics---specifically, use of DNA fingerprinting technology in different areas of social life---while forensic science is emphasized. Results indicate that the teachers' motivation to attend the DNA Fingerprinting professional development workshop was mainly influenced by two variables: (1) the need to improve content knowledge and skills, and (2) requirements associated with current educational policies. Level of content knowledge was also found to be a factor contributing to teachers' motivation to implement the workshop. Concerns related to student maturity and classroom management were also identified as factors influencing teachers' implementation behavior. Evidence that the DNA Fingerprinting workshop can be successfully implemented by classroom teachers was obtained. The DNA fingerprinting workshop was found to be a successful model for packaging professional development experiences for content intensive areas.

A Novel Approach Based on PCNNs Template for Fingerprint Image Thinning

NARCIS (Netherlands)

Dacheng, X.; Bailiang, L.; Nijholt, Antinus; Kacprzyk, J.

2009-01-01

A PCNNs-based square-and-triangle-template method for binary fingerprint image thinning is proposed. The algorithm is iterative, in which a combined sequential and parallel processing is employed to accelerate execution. When a neuron satisfies the square template, the pixel corresponding to this

Donor-derived metastatic melanoma in a liver transplant recipient established by DNA fingerprinting.

Science.gov (United States)

Bilal, Muhammad; Eason, James D; Das, Kanak; Sylvestre, Pamela B; Dean, Amanda G; Vanatta, Jason M

2013-10-01

Metastatic melanoma is a donor-derived malignancy that has rarely been reported in liver allograft recipients. We present a case of a transmitted donor-derived melanoma to a liver allograft recipient in whom the diagnosis was established by polymerase chain reaction-based DNA fingerprinting. A 52-year-old African-American man underwent a successful orthotropic liver transplant for alcohol-induced cirrhosis. One year after the orthotropic liver transplant, he presented at our institution with diffuse abdominal pain, and a computed tomography scan of the abdomen and chest showed innumerable masses diffusely involving the liver and multiple subcutaneous nodules in the abdominal and chest wall. A liver biopsy confirmed the diagnosis of metastatic melanoma. The origin of melanoma was traced to the donor by DNA fingerprinting of the native liver, the donor liver, and the donor gallbladder. Chemotherapy was initiated with temozolomide (75 mg/m² daily) and thalidomide (50 mg daily), to which he responded within 8 weeks with radiologic improvement in metastatic lesions. Tacrolimus was switched to sirolimus because of renal insufficiency as well as reported effectiveness against melanoma. Our patient survived for 9 months after the diagnosis of metastatic melanoma. He ultimately died of brain metastases. Donor-derived metastatic melanoma is a rare cancer with the highest transmission and mortality rates, which requires better recognition. Prompt diagnosis of donor-derived melanoma is critical and can be achieved reliably with polymerase chain reaction-based DNA analysis. Management options after diagnosis include de-escalation of immunosuppression, with or without urgent organ removal or retransplant. The roles of chemotherapy, immunotherapy, and radiotherapy require further study.

Secure fingerprint identification based on structural and microangiographic optical coherence tomography.

Science.gov (United States)

Liu, Xuan; Zaki, Farzana; Wang, Yahui; Huang, Qiongdan; Mei, Xin; Wang, Jiangjun

2017-03-10

Optical coherence tomography (OCT) allows noncontact acquisition of fingerprints and hence is a highly promising technology in the field of biometrics. OCT can be used to acquire both structural and microangiographic images of fingerprints. Microangiographic OCT derives its contrast from the blood flow in the vasculature of viable skin tissue, and microangiographic fingerprint imaging is inherently immune to fake fingerprint attack. Therefore, dual-modality (structural and microangiographic) OCT imaging of fingerprints will enable more secure acquisition of biometric data, which has not been investigated before. Our study on fingerprint identification based on structural and microangiographic OCT imaging is, we believe, highly innovative. In this study, we performed OCT imaging study for fingerprint acquisition, and demonstrated the capability of dual-modality OCT imaging for the identification of fake fingerprints.

Bacterial identification and subtyping using DNA microarray and DNA sequencing.

Science.gov (United States)

Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

2012-01-01

The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

An Efficient Reconfigurable Architecture for Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Satish S. Bhairannawar

2016-01-01

Full Text Available The fingerprint identification is an efficient biometric technique to authenticate human beings in real-time Big Data Analytics. In this paper, we propose an efficient Finite State Machine (FSM based reconfigurable architecture for fingerprint recognition. The fingerprint image is resized, and Compound Linear Binary Pattern (CLBP is applied on fingerprint, followed by histogram to obtain histogram CLBP features. Discrete Wavelet Transform (DWT Level 2 features are obtained by the same methodology. The novel matching score of CLBP is computed using histogram CLBP features of test image and fingerprint images in the database. Similarly, the DWT matching score is computed using DWT features of test image and fingerprint images in the database. Further, the matching scores of CLBP and DWT are fused with arithmetic equation using improvement factor. The performance parameters such as TSR (Total Success Rate, FAR (False Acceptance Rate, and FRR (False Rejection Rate are computed using fusion scores with correlation matching technique for FVC2004 DB3 Database. The proposed fusion based VLSI architecture is synthesized on Virtex xc5vlx30T-3 FPGA board using Finite State Machine resulting in optimized parameters.

DNA fingerprinting of lactic acid bacteria in sauerkraut fermentations.

Science.gov (United States)

Plengvidhya, Vethachai; Breidt, Fredrick; Lu, Zhongjing; Fleming, Henry P

2007-12-01

Previous studies using traditional biochemical identification methods to study the ecology of commercial sauerkraut fermentations revealed that four species of lactic acid bacteria, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis, were the primary microorganisms in these fermentations. In this study, 686 isolates were collected from four commercial fermentations and analyzed by DNA fingerprinting. The results indicate that the species of lactic acid bacteria present in sauerkraut fermentations are more diverse than previously reported and include Leuconostoc citreum, Leuconostoc argentinum, Lactobacillus paraplantarum, Lactobacillus coryniformis, and Weissella sp. The newly identified species Leuconostoc fallax was also found. Unexpectedly, only two isolates of P. pentosaceus and 15 isolates of L. brevis were recovered during this study. A better understanding of the microbiota may aid in the development of low-salt fermentations, which may have altered microflora and altered sensory characteristics.

Fingerprint enhancement using a multispectral sensor

Science.gov (United States)

Rowe, Robert K.; Nixon, Kristin A.

2005-03-01

The level of performance of a biometric fingerprint sensor is critically dependent on the quality of the fingerprint images. One of the most common types of optical fingerprint sensors relies on the phenomenon of total internal reflectance (TIR) to generate an image. Under ideal conditions, a TIR fingerprint sensor can produce high-contrast fingerprint images with excellent feature definition. However, images produced by the same sensor under conditions that include dry skin, dirt on the skin, and marginal contact between the finger and the sensor, are likely to be severely degraded. This paper discusses the use of multispectral sensing as a means to collect additional images with new information about the fingerprint that can significantly augment the system performance under both normal and adverse sample conditions. In the context of this paper, "multispectral sensing" is used to broadly denote a collection of images taken under different illumination conditions: different polarizations, different illumination/detection configurations, as well as different wavelength illumination. Results from three small studies using an early-stage prototype of the multispectral-TIR (MTIR) sensor are presented along with results from the corresponding TIR data. The first experiment produced data from 9 people, 4 fingers from each person and 3 measurements per finger under "normal" conditions. The second experiment provided results from a study performed to test the relative performance of TIR and MTIR images when taken under extreme dry and dirty conditions. The third experiment examined the case where the area of contact between the finger and sensor is greatly reduced.

Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

Science.gov (United States)

Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

1998-01-01

We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

Usefulness of the DNA-fingerprinting pattern and the multilocus enzyme electrophoresis profile in the assessment of outbreaks of meningococcal disease

DEFF Research Database (Denmark)

Weis, N; Lind, I

1996-01-01

cases were identical to the outbreak strain. None of the local serogroup C carrier strains isolated during the outbreak of serogroup C disease were identical to the outbreak strain. Both DNA-fingerprinting and MEE improved the differentiation of meningococci when compared with phenotypic......The objective of the study was to assess whether genotypic characterization by means of DNA-fingerprinting pattern (DFP) and multilocus enzyme electrophoresis (MEE) profile as compared to phenotypic characterization would improve the differentiation of Neisseria meningitidis strains associated...... in each outbreak were designated the index strains. Among the remaining 55 outbreak strains 52 were either DFP-identical or DFP-indistinguishable when compared with the one relevant out of the 4 index strains. This was only the case for 17 of the 37 strains isolated from sporadic cases caused by the same...

Reference point detection for improved fingerprint matching

NARCIS (Netherlands)

Ignatenko, T.; Kalker, A.A.C.M.; Veen, van der M.; Bazen, A.; Delp, E.J.; Wong, P.W.

2006-01-01

One of the important stages of fingerprint recognition is the registration of the fingerprints with respect to the original template. This is not a straightforward task as fingerprint images may have been subject to rotations and translations. Popular techniques for fingerprint registration use a

Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

DEFF Research Database (Denmark)

Atabay, H. I.; Bang, Dang Duong; Aydin, F.

2002-01-01

Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

Interpretation of fingerprint image quality features extracted by self-organizing maps

Science.gov (United States)

Danov, Ivan; Olsen, Martin A.; Busch, Christoph

2014-05-01

Accurate prediction of fingerprint quality is of significant importance to any fingerprint-based biometric system. Ensuring high quality samples for both probe and reference can substantially improve the system's performance by lowering false non-matches, thus allowing finer adjustment of the decision threshold of the biometric system. Furthermore, the increasing usage of biometrics in mobile contexts demands development of lightweight methods for operational environment. A novel two-tier computationally efficient approach was recently proposed based on modelling block-wise fingerprint image data using Self-Organizing Map (SOM) to extract specific ridge pattern features, which are then used as an input to a Random Forests (RF) classifier trained to predict the quality score of a propagated sample. This paper conducts an investigative comparative analysis on a publicly available dataset for the improvement of the two-tier approach by proposing additionally three feature interpretation methods, based respectively on SOM, Generative Topographic Mapping and RF. The analysis shows that two of the proposed methods produce promising results on the given dataset.

dna and seed proteins fingerprinting of egyptian crop plants

African Journals Online (AJOL)

Dr. Haddad

2012-11-01

Nov 1, 2012 ... combinations were used for fingerprinting six cultivars which belongs to barley, rice and wheat cultivars leading to the production of numerous AFLP bands, 300 of them were polymorphic. Thirty SSR markers were obtained from fingerprinting eight cultivars belonging to the five studied species using 11.

Evaluation of fingerprint deformation using optical coherence tomography

Science.gov (United States)

Gutierrez da Costa, Henrique S.; Maxey, Jessica R.; Silva, Luciano; Ellerbee, Audrey K.

2014-02-01

Biometric identification systems have important applications to privacy and security. The most widely used of these, print identification, is based on imaging patterns present in the fingers, hands and feet that are formed by the ridges, valleys and pores of the skin. Most modern print sensors acquire images of the finger when pressed against a sensor surface. Unfortunately, this pressure may result in deformations, characterized by changes in the sizes and relative distances of the print patterns, and such changes have been shown to negatively affect the performance of fingerprint identification algorithms. Optical coherence tomography (OCT) is a novel imaging technique that is capable of imaging the subsurface of biological tissue. Hence, OCT may be used to obtain images of subdermal skin structures from which one can extract an internal fingerprint. The internal fingerprint is very similar in structure to the commonly used external fingerprint and is of increasing interest in investigations of identify fraud. We proposed and tested metrics based on measurements calculated from external and internal fingerprints to evaluate the amount of deformation of the skin. Such metrics were used to test hypotheses about the differences of deformation between the internal and external images, variations with the type of finger and location inside the fingerprint.

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Directory of Open Access Journals (Sweden)

Stefan Niemann

2009-10-01

Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Science.gov (United States)

Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

2009-10-12

Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

Cell kinetics, DNA integrity, differentiation, and lipid fingerprinting analysis of rabbit adipose-derived stem cells.

Science.gov (United States)

Barretto, Letícia Siqueira de Sá; Lessio, Camila; Sawaki e Nakamura, Ahy Natally; Lo Turco, Edson Guimarães; da Silva, Camila Gonzaga; Zambon, João Paulo; Gozzo, Fábio César; Pilau, Eduardo Jorge; de Almeida, Fernando Gonçalves

2014-10-01

Human adipose tissue has been described as a potential alternative reservoir for stem cells. Although studies have been performed in rabbits using autologous adipose-derived stem cells (ADSC), these cells have not been well characterized. The primary objectives of this study were to demonstrate the presence of adipose-derived stem cells isolated from rabbit inguinal fat pads and to characterize them through osteogenic and adipogenic in vitro differentiation and lipid fingerprinting analysis. The secondary objective was to evaluate cell behavior through growth kinetics, cell viability, and DNA integrity. Rabbit ADSCs were isolated to determine the in vitro growth kinetics and cell viability. DNA integrity was assessed by an alkaline Comet assay in passages 0 and 5. The osteogenic differentiation was evaluated by Von Kossa, and Alizarin Red S staining and adipogenic differentiation were assessed by Oil Red O staining. Lipid fingerprinting analyses of control, adipogenic, and osteogenic differentiated cells were performed by MALDI-TOF/MS. We demonstrate that rabbit ADSC have a constant growth rate at the early passages, with increased DNA fragmentation at or after passage 5. Rabbit ADSC viability was similar in passages 2 and 5 (90.7% and 86.6%, respectively), but there was a tendency to decreased cellular growth rate after passage 3. The ADSC were characterized by the expression of surface markers such as CD29 (67.4%) and CD44 (89.4%), using CD 45 (0.77%) as a negative control. ADSC from rabbits were successfully isolated form the inguinal region. These cells were capable to differentiate into osteogenic and adipogenic tissue when they were placed in inductive media. After each passage, there was a trend towards decreased cell growth. On the other hand, DNA fragmentation increased at each passage. ADSC had a different lipid profile when placed in control, adipogenic, or osteogenic media.

Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

Science.gov (United States)

Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

2015-12-28

The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.

Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

Science.gov (United States)

Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

2009-07-01

Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

Characterization of selection effects on broiler lines using DNA fingerprinting

Directory of Open Access Journals (Sweden)

GS Schmidt

2003-05-01

Full Text Available The objective of this study was to evaluate the effect of selection for body weight on the genetic variability and diversity in broiler lines. Two paternal broiler lines (LL and LLc were used. LL line was selected for 12 generations for growth and carcass and reproduction characteristics. The LLc line was established from LL line in 1985 and mated at random. Blood samples from six chickens per line were collected and used for molecular analysis. Also, a DNA pool was made for each line to compare effects between lines. Data were analyzed considering the collected information on the presence or absence of DNA bands. Band sharing scores were calculated using the DICE coefficient. The pattern of the 21 most representative bands was used. DNA fingerprinting (DFP showed 90.48 % of polymorphism bands for both lines. Difference between lines was not due to the presence or absence of bands, but to the frequency of such bands in each genotype. Considering that both lines had the same genetic background, changes on band frequency were probably due to selection. Selection for body weight had an effect on the band frequency as evaluated by DFP, and for this reason this technique could be used as a tool in the selection process. Results also suggest that bands 4, 5 and 19 were linked to body weight traits, and bands 9, 10, 12, 13 and 21 were linked to reproductive traits such as egg production.

DNA fingerprinting in zoology: past, present, future.

Science.gov (United States)

Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

2014-02-03

In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

Diversities in virulence, antifungal activity, pigmentation and DNA fingerprint among strains of Burkholderia glumae.

Science.gov (United States)

Karki, Hari S; Shrestha, Bishnu K; Han, Jae Woo; Groth, Donald E; Barphagha, Inderjit K; Rush, Milton C; Melanson, Rebecca A; Kim, Beom Seok; Ham, Jong Hyun

2012-01-01

Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR.

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Accommodating error analysis in comparison and clustering of molecular fingerprints.

OpenAIRE

Salamon, H.; Segal, M. R.; Ponce de Leon, A.; Small, P. M.

1998-01-01

Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is ...

A medium resolution fingerprint matching system

Directory of Open Access Journals (Sweden)

Ayman Mohammad Bahaa-Eldin

2013-09-01

Full Text Available In this paper, a novel minutiae based fingerprint matching system is proposed. The system is suitable for medium resolution fingerprint images obtained by low cost commercial sensors. The paper presents a new thinning algorithm, a new features extraction and representation, and a novel feature distance matching algorithm. The proposed system is rotation and translation invariant and is suitable for complete or partial fingerprint matching. The proposed algorithms are optimized to be executed on low resource environments both in CPU power and memory space. The system was evaluated using a standard fingerprint dataset and good performance and accuracy were achieved under certain image quality requirements. In addition, the proposed system was compared favorably to that of the state of the art systems.

Diversity of DNA fingerprints of Mycobacterium tuberculosis isolates in the United States.

Science.gov (United States)

Yang, Z; Barnes, P F; Chaves, F; Eisenach, K D; Weis, S E; Bates, J H; Cave, M D

1998-04-01

To investigate the diversity of IS6110 fingerprints of Mycobacterium tuberculosis isolates in the United States and to determine if matching IS6110 fingerprints represent recent interstate tuberculosis transmission, we performed restriction fragment length polymorphism analysis of M. tuberculosis isolates from 1,326 patients in three geographically separated states. Seven hundred ninety-five different IS6110 fingerprint patterns were generated, and pattern diversity was similar in each state. Ninety-six percent of the fingerprint patterns were observed in only one state, demonstrating that most IS6110 fingerprint patterns are confined to a single geographic location. Of the IS6110 fingerprint patterns that were shared by isolates from more than one state, most isolates with 1 to 5 IS6110 copies were separable by pTBN12 fingerprinting whereas those with > 15 copies were not. One high-copy-number M. tuberculosis strain had identical IS6110 and pTBN12 fingerprints and included 57 isolates from three states. Epidemiological data demonstrated significant recent transmission of tuberculosis within each city but not among the states. This suggests that identical fingerprints of isolates from geographically separate locations most likely reflect interstate tuberculosis transmission in the past, with subsequent intrastate spread of disease. Further evaluation of M. tuberculosis strains that cause outbreaks in different geographic locations will provide insight into the epidemiological and bacteriological factors that facilitate the spread of tuberculosis.

Fingerprinting with Wow

Science.gov (United States)

Yu, Eugene; Craver, Scott

2006-02-01

Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

MR Fingerprinting for Rapid Quantitative Abdominal Imaging.

Science.gov (United States)

Chen, Yong; Jiang, Yun; Pahwa, Shivani; Ma, Dan; Lu, Lan; Twieg, Michael D; Wright, Katherine L; Seiberlich, Nicole; Griswold, Mark A; Gulani, Vikas

2016-04-01

To develop a magnetic resonance (MR) "fingerprinting" technique for quantitative abdominal imaging. This HIPAA-compliant study had institutional review board approval, and informed consent was obtained from all subjects. To achieve accurate quantification in the presence of marked B0 and B1 field inhomogeneities, the MR fingerprinting framework was extended by using a two-dimensional fast imaging with steady-state free precession, or FISP, acquisition and a Bloch-Siegert B1 mapping method. The accuracy of the proposed technique was validated by using agarose phantoms. Quantitative measurements were performed in eight asymptomatic subjects and in six patients with 20 focal liver lesions. A two-tailed Student t test was used to compare the T1 and T2 results in metastatic adenocarcinoma with those in surrounding liver parenchyma and healthy subjects. Phantom experiments showed good agreement with standard methods in T1 and T2 after B1 correction. In vivo studies demonstrated that quantitative T1, T2, and B1 maps can be acquired within a breath hold of approximately 19 seconds. T1 and T2 measurements were compatible with those in the literature. Representative values included the following: liver, 745 msec ± 65 (standard deviation) and 31 msec ± 6; renal medulla, 1702 msec ± 205 and 60 msec ± 21; renal cortex, 1314 msec ± 77 and 47 msec ± 10; spleen, 1232 msec ± 92 and 60 msec ± 19; skeletal muscle, 1100 msec ± 59 and 44 msec ± 9; and fat, 253 msec ± 42 and 77 msec ± 16, respectively. T1 and T2 in metastatic adenocarcinoma were 1673 msec ± 331 and 43 msec ± 13, respectively, significantly different from surrounding liver parenchyma relaxation times of 840 msec ± 113 and 28 msec ± 3 (P < .0001 and P < .01) and those in hepatic parenchyma in healthy volunteers (745 msec ± 65 and 31 msec ± 6, P < .0001 and P = .021, respectively). A rapid technique for quantitative abdominal imaging was developed that allows simultaneous quantification of multiple tissue

Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

Science.gov (United States)

Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

2014-02-25

Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

Fingerprint and Face Identification for Large User Population

Directory of Open Access Journals (Sweden)

Teddy Ko

2003-06-01

Full Text Available The main objective of this paper is to present the state-of-the-art of the current biometric (fingerprint and face technology, lessons learned during the investigative analysis performed to ascertain the benefits of using combined fingerprint and facial technologies, and recommendations for the use of current available fingerprint and face identification technologies for optimum identification performance for applications using large user population. Prior fingerprint and face identification test study results have shown that their identification accuracies are strongly dependent on the image quality of the biometric inputs. Recommended methodologies for ensuring the capture of acceptable quality fingerprint and facial images of subjects are also presented in this paper.

Longitudinal study of fingerprint recognition.

Science.gov (United States)

Yoon, Soweon; Jain, Anil K

2015-07-14

Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

Online fingerprint verification.

Science.gov (United States)

Upendra, K; Singh, S; Kumar, V; Verma, H K

2007-01-01

As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications.

DNA Fingerprinting of Olive Varieties by Microsatellite Markers

Directory of Open Access Journals (Sweden)

Dunja Bandelj

2002-01-01

Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.

Investigating the Effects of a DNA Fingerprinting Workshop on 10th Grade Students' Self Efficacy and Attitudes toward Science.

Science.gov (United States)

Sonmez, Duygu; Simcox, Amanda

The purpose of this study was investigate the effects of a DNA Fingerprinting Workshop on 10th grade students' self efficacy and attitudes toward science. The content of the workshop based on high school science curriculum and includes multimedia instruction, laboratory experiment and participation of undergraduate students as mentors. N=93…

Enhance Criminal Investigation by Proposed Fingerprint Recognition System

International Nuclear Information System (INIS)

Hashem, S.H.; Maolod, A.T.; Mohammad, A.A.

2014-01-01

Law enforcement officers and forensic specialists spend hours thinking about how fingerprints solve crimes, and trying to find, collect, record and compare these unique identifiers that can connect a specific person to a specific crime. These individuals understand that a basic human feature that most people take for granted, can be one of the most effective tools in crime solving.This research exploits our previous work to be applicable in criminal investigation field. The present study aims to solve the advance crime by strength fingerprint’s criminal investigation to control the alterations happen intentionally to criminals’ fingerprint. That done by suggest strategy introduce an optimal fingerprint image feature’s vector to the person and then considers it to be stored in database for future matching. Selecting optimal fingerprint feature’s vector strategy deal with considering 10 fingerprints for each criminal person (take the fingerprint in different time and different circumstance of criminal such as finger is dirty, wet, trembling, etc.). Proposal begun with apply a proposed enrollment on all 10 fingerprint for each criminal, the enrollment include the following consequence steps; begin with preprocessing step for each of 10 images including enhancement, then two level of feature extraction (first level to extract arches, whorls, and loops, where second level extract minutiae), after that applying proposed Genetic Algorithm to select optimal fingerprint, master fingerprint, which in our point of view present the most universal image which include more detailed features to recognition. Master fingerprint will be feature’s vector which stored in database. Then apply the proposed matching by testing fingerprints with these stored in database.While, measuring of criminal fingerprint investigation performance by calculating False Reject Rate (FRR)and False Accept Rate (FAR) for the traditional system and the proposed in criminal detection field. The

Fingerprint Change: Not Visible, But Tangible.

Science.gov (United States)

Negri, Francesca V; De Giorgi, Annamaria; Bozzetti, Cecilia; Squadrilli, Anna; Petronini, Pier Giorgio; Leonardi, Francesco; Bisogno, Luigi; Garofano, Luciano

2017-09-01

Hand-foot syndrome, a chemotherapy-induced cutaneous toxicity, can cause an alteration in fingerprints causing a setback for cancer patients due to the occurrence of false rejections. A colon cancer patient was fingerprinted after not having been able to use fingerprint recognition devices after 6 months of adjuvant chemotherapy. The fingerprint images were digitally processed to improve fingerprint definition without altering the papillary design. No evidence of skin toxicity was present. Two months later, the situation returned to normal. The fingerprint evaluation conducted on 15 identification points highlighted the quantitative and qualitative fingerprint alteration details detected after the end of chemotherapy and 2 months later. Fingerprint alteration during chemotherapy has been reported, but to our knowledge, this particular case is the first ever reported without evident clinical signs. Alternative fingerprint identification methods as well as improved biometric identification systems are needed in case of unexpected situations. © 2017 American Academy of Forensic Sciences.

Accommodating error analysis in comparison and clustering of molecular fingerprints.

Science.gov (United States)

Salamon, H; Segal, M R; Ponce de Leon, A; Small, P M

1998-01-01

Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is positively correlated for fragments within a lane, an align-and-count method that compensates for relative scaling of lanes reliably counts matching fragments between lanes. Results of a two-step method we developed to cluster identical fingerprints agree closely with 5 years of computer-assisted visual matching among 1,335 M. tuberculosis fingerprints. Fully documented and validated methods of automated comparison and clustering will greatly expand the scope of molecular epidemiology.

Compression of fingerprint data using the wavelet vector quantization image compression algorithm. 1992 progress report

Energy Technology Data Exchange (ETDEWEB)

Bradley, J.N.; Brislawn, C.M.

1992-04-11

This report describes the development of a Wavelet Vector Quantization (WVQ) image compression algorithm for fingerprint raster files. The pertinent work was performed at Los Alamos National Laboratory for the Federal Bureau of Investigation. This document describes a previously-sent package of C-language source code, referred to as LAFPC, that performs the WVQ fingerprint compression and decompression tasks. The particulars of the WVQ algorithm and the associated design procedure are detailed elsewhere; the purpose of this document is to report the results of the design algorithm for the fingerprint application and to delineate the implementation issues that are incorporated in LAFPC. Special attention is paid to the computation of the wavelet transform, the fast search algorithm used for the VQ encoding, and the entropy coding procedure used in the transmission of the source symbols.

RSA Key Development Using Fingerprint Image on Text Message

Science.gov (United States)

Rahman, Sayuti; Triana, Indah; Khairani, Sumi; Yasir, Amru; Sundari, Siti

2017-12-01

Along with the development of technology today, humans are very facilitated in accessing information and Communicate with various media, including through the Internet network . Messages are sent by media such as text are not necessarily guaranteed security. it is often found someone that wants to send a secret message to the recipient, but the messages can be known by irresponsible people. So the sender feels dissappointed because the secret message that should be known only to the recipient only becomes known by the irresponsible people . It is necessary to do security the message by using the RSA algorithm, Using fingerprint image to generate RSA key.This is a solution to enrich the security of a message,it is needed to process images firstly before generating RSA keys with feature extraction.

Influence of Skin Diseases on Fingerprint Recognition

Science.gov (United States)

Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

2012-01-01

There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

Influence of Skin Diseases on Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Martin Drahansky

2012-01-01

Full Text Available There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described.

A Fingerprint Image Encryption Scheme Based on Hyperchaotic Rössler Map

Directory of Open Access Journals (Sweden)

F. Abundiz-Pérez

2016-01-01

Full Text Available Currently, biometric identifiers have been used to identify or authenticate users in a biometric system to increase the security in access control systems. Nevertheless, there are several attacks on the biometric system to steal and recover the user’s biometric trait. One of the most powerful attacks is extracting the fingerprint pattern when it is transmitted over communication lines between modules. In this paper, we present a novel fingerprint image encryption scheme based on hyperchaotic Rössler map to provide high security and secrecy in user’s biometric trait, avoid identity theft, and increase the robustness of the biometric system. A complete security analysis is presented to justify the secrecy of the biometric trait by using our proposed scheme at statistical level with 100% of NPCR, low correlation, and uniform histograms. Therefore, it can be used in secure biometric access control systems.

Effect of Aging and Surface Interactions on the Diffusion of Endogenous Compounds in Latent Fingerprints Studied by Mass Spectrometry Imaging.

Science.gov (United States)

O'Neill, Kelly C; Lee, Young Jin

2018-05-01

The ability to determine the age of fingerprints would be immeasurably beneficial in criminal investigations. We explore the possibility of determining the age of fingerprints by analyzing various compounds as they diffuse from the ridges to the valleys of fingerprints using matrix-assisted laser desorption/ionization mass spectrometry imaging. The diffusion of two classes of endogenous fingerprint compounds, fatty acids and triacylglycerols (TGs), was studied in fresh and aged fingerprints on four surfaces. We expected higher molecular weight TGs would diffuse slower than fatty acids and allow us to determine the age of older fingerprints. However, we found interactions between endogenous compounds and the surface have a much stronger impact on diffusion than molecular weight. For example, diffusion of TGs is faster on hydrophilic plain glass or partially hydrophilic stainless steel surfaces, than on a hydrophobic Rain-x treated surface. This result further complicates utilizing a diffusion model to age fingerprints. © 2017 American Academy of Forensic Sciences.

DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

Science.gov (United States)

Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

2007-03-01

Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

High Resolution Ultrasonic Method for 3D Fingerprint Representation in Biometrics

Science.gov (United States)

Maev, R. Gr.; Bakulin, E. Y.; Maeva, E. Y.; Severin, F. M.

Biometrics is an important field which studies different possible ways of personal identification. Among a number of existing biometric techniques fingerprint recognition stands alone - because very large database of fingerprints has already been acquired. Also, fingerprints are an important evidence that can be collected at a crime scene. Therefore, of all automated biometric techniques, especially in the field of law enforcement, fingerprint identification seems to be the most promising. Ultrasonic method of fingerprint imaging was originally introduced over a decade as the mapping of the reflection coefficient at the interface between the finger and a covering plate and has shown very good reliability and free from imperfections of previous two methods. This work introduces a newer development of the ultrasonic fingerprint imaging, focusing on the imaging of the internal structures of fingerprints (including sweat pores) with raw acoustic resolution of about 500 dpi (0.05 mm) using a scanning acoustic microscope to obtain images and acoustic data in the form of 3D data array. C-scans from different depths inside the fingerprint area of fingers of several volunteers were obtained and showed good contrast of ridges-and-valleys patterns and practically exact correspondence to the standard ink-and-paper prints of the same areas. Important feature reveled on the acoustic images was the clear appearance of the sweat pores, which could provide additional means of identification.

FINGERPRINT MATCHING BASED ON PORE CENTROIDS

Directory of Open Access Journals (Sweden)

S. Malathi

2011-05-01

Full Text Available In recent years there has been exponential growth in the use of bio- metrics for user authentication applications. Automated Fingerprint Identification systems have become popular tool in many security and law enforcement applications. Most of these systems rely on minutiae (ridge ending and bifurcation features. With the advancement in sensor technology, high resolution fingerprint images (1000 dpi pro- vide micro level of features (pores that have proven to be useful fea- tures for identification. In this paper, we propose a new strategy for fingerprint matching based on pores by reliably extracting the pore features The extraction of pores is done by Marker Controlled Wa- tershed segmentation method and the centroids of each pore are con- sidered as feature vectors for matching of two fingerprint images. Experimental results shows that the proposed method has better per- formance with lower false rates and higher accuracy.

Use of LH-PCR as a DNA fingerprint technique to trace sediment-associated microbial communities from various land uses

Science.gov (United States)

Joe-Strack, J. A.; Petticrew, E. L.

2012-04-01

The search for new techniques to effectively and efficiently trace sediment from its source along catchment pathways continues, with a range of new methods being developed and tested annually. A relatively recent approach marries genetic techniques to sediment analysis in order to characterize and differentiate the bacterial populations associated with soil and/or sediment originating from specific locations. Here we present the preliminary results of DNA fingerprint profiles of soil and sediment-associated bacterial communities in and around two different industrial land uses in the central interior of British Columbia, a feedlot and a copper/gold mining site. We assessed the naturally varying 16S rDNA gene using amplicon length heterogeneity-polymerase chain reaction (LH-PCR). Statistical differences between bacterial community profiles were investigated using a suite of methods of which non-metric multidimensional scaling (NMS) and indicator species analysis (ISA) were the most useful. Stronger statistical results were observed for the feedlot data set with spatial differences observed from the source location and within the adjacent creek. Results from the mine site were more difficult to assess although responses were detected in downstream waterways. While bacterial DNA fingerprinting of soil and sediment appears to be a promising tracing technique issues of scale and transferability may limit its use. Lessons learned from this preliminary study will be presented.

Comparative study of different approaches for multivariate image analysis in HPTLC fingerprinting of natural products such as plant resin.

Science.gov (United States)

Ristivojević, Petar; Trifković, Jelena; Vovk, Irena; Milojković-Opsenica, Dušanka

2017-01-01

Considering the introduction of phytochemical fingerprint analysis, as a method of screening the complex natural products for the presence of most bioactive compounds, use of chemometric classification methods, application of powerful scanning and image capturing and processing devices and algorithms, advancement in development of novel stationary phases as well as various separation modalities, high-performance thin-layer chromatography (HPTLC) fingerprinting is becoming attractive and fruitful field of separation science. Multivariate image analysis is crucial in the light of proper data acquisition. In a current study, different image processing procedures were studied and compared in detail on the example of HPTLC chromatograms of plant resins. In that sense, obtained variables such as gray intensities of pixels along the solvent front, peak area and mean values of peak were used as input data and compared to obtained best classification models. Important steps in image analysis, baseline removal, denoising, target peak alignment and normalization were pointed out. Numerical data set based on mean value of selected bands and intensities of pixels along the solvent front proved to be the most convenient for planar-chromatographic profiling, although required at least the basic knowledge on image processing methodology, and could be proposed for further investigation in HPLTC fingerprinting. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

International Nuclear Information System (INIS)

Mirbahar, A.; Khan, S.; Markhand, G.S.

2016-01-01

Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

45,X product of conception after preimplantation genetic diagnosis and euploid embryo transfer: evidence of a spontaneous conception confirmed by DNA fingerprinting.

Science.gov (United States)

Bettio, Daniela; Capalbo, Antonio; Albani, Elena; Rienzi, Laura; Achille, Valentina; Venci, Anna; Ubaldi, Filippo Maria; Levi Setti, Paolo Emanuele

2016-09-06

Preimplantation genetic screening (PGS) provides an opportunity to eliminate a potential implantation failure due to aneuploidy in infertile couples. Some studies clearly show that twins following single embryo transfer (SET) can be the result of a concurrent natural conception and an incidence as high as 1 in 5 twins has been reported. In our case PGS was performed on trophectoderm (TE) biopsies by quantitative polymerase chain reaction (qPCR). The product of conception (POC) was cytogenetically investigated after selection of the placental villi by means of the direct method. Molecular cytogenetic characterization of the POC was performed by fluorescence in situ hybridization (FISH) and array-comparative genomic hybridization (a-CGH) analyses. To investigate the possibility of a spontaneous conception, a panel of 40 single nucleotide polymorphisms (SNPs) was used to compare genetic similarity between the DNA of the POC and the DNA leftover of the TE biopsy. We describe a 36-year old infertile woman undergoing PGS who had a spontaneous abortion after a single euploid embryo transfer on a spontaneous cycle. The POC showed a 45,X karyotype confirmed by FISH and a-CGH. DNA fingerprinting demonstrated a genetic similarity of 75 % between the DNA of the POC and TE biopsy, consistent with a sibling status. All supernumerary euploid embryos were also tested showing a non-self relationship with the POC, excluding a mix-up event at the time of fetal embryo transfer. DNA fingerprinting of the transferred blastocyst and POC, confirmed the occurrence of a spontaneous conception. This case challenges the assumption that a pregnancy after assisted reproductive technology (ART) is always a result of ART, and strengthens the importance to avoid intercourses during PGS and natural transfer cycles. Moreover, cytogenetic analysis of the POCs is strongly recommended along with fingerprinting children born after PGS to see what the concordance is between the embryo transferred and

Aplicación del NFIS (Nist Fingerprint Image Software para la Extracción de Características de Huellas Dactilares Aplicación del NFIS (Nist Fingerprint Image Software para la Extracción de Características de Huellas Dactilares

Directory of Open Access Journals (Sweden)

Noé Mosqueda Valadez

2012-02-01

Full Text Available Este artículo presenta una descripción acerca de las huellas dactilares y sus características, así como la extracción de puntos característicos de la misma por medio del programa NFIS desarrollado por el NIST (National Institute of Standards and Technology en conjunción con el FBI (Federal Bureau of Investigation, descripción de algunas herramientas, así como un panorama general de un sistema AFAS (Automatic Fingerprint Authentification System y de un sistema AFIS (Automatic Fingerprint Identification System. This paper presents a description about the fingerprints and its characteristics, as well as the extraction of their characteristic points by means of the application of the program NFIS (NIST Fingerprint Image Software developed by the NIST (National Institute of Standards and Technology in conjunction with the FBI (Federal Bureau of Investigation, the description of some tools, as well as a general view of a system AFAS (Automatic Fingerprint Authentification System and of a system AFIS (Automatic Fingerprint Identification System.

Fingerprint: A Unique and Reliable Method for Identification

Directory of Open Access Journals (Sweden)

Palash Kumar Bose

2017-01-01

Full Text Available Fingerprints have been the gold standard for personal identification within the forensic community for more than one hundred years. It is still universal in spite of discovery of DNA fingerprint. The science of fingerprint identification has evolved over time from the early use of finger prints to mark business transactions in ancient Babylonia to their use today as core technology in biometric security devices and as scientific evidence in courts of law throughout the world. The science of fingerprints, dactylography or dermatoglyphics, had long been widely accepted, and well acclaimed and reputed as panacea for individualization, particularly in forensic investigations. Human fingerprints are detailed, unique, difficult to alter, and durable over the life of an individual, making them suitable as lifelong markers of human identity. Fingerprints can be readily used by police or other authorities to identify individuals who wish to conceal their identity, or to identify people who are incapacitated or deceased, as in the aftermath of a natural disaster

Artificial fingerprint recognition by using optical coherence tomography with autocorrelation analysis

Science.gov (United States)

Cheng, Yezeng; Larin, Kirill V.

2006-12-01

Fingerprint recognition is one of the most widely used methods of biometrics. This method relies on the surface topography of a finger and, thus, is potentially vulnerable for spoofing by artificial dummies with embedded fingerprints. In this study, we applied the optical coherence tomography (OCT) technique to distinguish artificial materials commonly used for spoofing fingerprint scanning systems from the real skin. Several artificial fingerprint dummies made from household cement and liquid silicone rubber were prepared and tested using a commercial fingerprint reader and an OCT system. While the artificial fingerprints easily spoofed the commercial fingerprint reader, OCT images revealed the presence of them at all times. We also demonstrated that an autocorrelation analysis of the OCT images could be potentially used in automatic recognition systems.

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

Privacy protection schemes for fingerprint recognition systems

Science.gov (United States)

Marasco, Emanuela; Cukic, Bojan

2015-05-01

The deployment of fingerprint recognition systems has always raised concerns related to personal privacy. A fingerprint is permanently associated with an individual and, generally, it cannot be reset if compromised in one application. Given that fingerprints are not a secret, potential misuses besides personal recognition represent privacy threats and may lead to public distrust. Privacy mechanisms control access to personal information and limit the likelihood of intrusions. In this paper, image- and feature-level schemes for privacy protection in fingerprint recognition systems are reviewed. Storing only key features of a biometric signature can reduce the likelihood of biometric data being used for unintended purposes. In biometric cryptosystems and biometric-based key release, the biometric component verifies the identity of the user, while the cryptographic key protects the communication channel. Transformation-based approaches only a transformed version of the original biometric signature is stored. Different applications can use different transforms. Matching is performed in the transformed domain which enable the preservation of low error rates. Since such templates do not reveal information about individuals, they are referred to as cancelable templates. A compromised template can be re-issued using a different transform. At image-level, de-identification schemes can remove identifiers disclosed for objectives unrelated to the original purpose, while permitting other authorized uses of personal information. Fingerprint images can be de-identified by, for example, mixing fingerprints or removing gender signature. In both cases, degradation of matching performance is minimized.

Role of DNA profiling in forensic odontology

Directory of Open Access Journals (Sweden)

S Leena Sakari

2015-01-01

Full Text Available The recent advances in DNA profiling have made DNA evidence to be more widely accepted in courts. This has revolutionized the aspect of forensic odontology. DNA profiling/DNA fingerprinting has come a long way from the conventional fingerprints. DNA that is responsible for all the cell′s activities, yields valuable information both in the healthy and diseased individuals. When other means of traditional identification become impossible following mass calamities or fire explosions, teeth provide a rich source of DNA as they have a high chemical as well as physical resistance. The recent evolution in the isolation of DNA and the ways of running a DNA fingerprint are highlighted in this literature review.

Detection of a new submicroscopic Norrie disease deletion interval with a novel DNA probe isolated by differential Alu PCR fingerprint cloning

NARCIS (Netherlands)

Bergen, A. A.; Wapenaar, M. C.; Schuurman, E. J.; Diergaarde, P. J.; Lerach, H.; Monaco, A. P.; Bakker, E.; Bleeker-Wagemakers, E. M.; van Ommen, G. J.

1993-01-01

Differential Alu PCR fingerprint cloning was used to isolate a DNA probe from the Xp11.4-->p11.21 region of the human X chromosome. This novel sequence, cpXr318 (DXS742), detects a new submicroscopic deletion interval at the Norrie disease locus (NDP). Combining our data with the consensus genetic

Defense of fake fingerprint attacks using a swept source laser optical coherence tomography setup

Science.gov (United States)

Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

2013-03-01

The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

Microsatellite DNA fingerprinting, differentiation, and genetic relationships of clones, cultivars, and varieties of six poplar species from three sections of the genus Populus.

Science.gov (United States)

Rahman, Muhammad H; Rajora, Om P

2002-12-01

Accurate identification of Populus clones and cultivars is essential for effective selection, breeding, and genetic resource management programs. The unit of cultivation and breeding in poplars is a clone, and individual cultivars are normally represented by a single clone. Microsatellite DNA markers of 10 simple sequence repeat loci were used for genetic fingerprinting and differentiation of 96 clones/cultivars and varieties belonging to six Populus species (P. deltoides, P. nigra, P. balsamifera, P. trichocarpa, P. grandidentata, and P maximowiczii) from three sections of the genus. All 96 clones/cultivars could be uniquely fingerprinted based on their single- or multilocus microsatellite genotypes. The five P. grandidentata clones could be differentiated based on their single-locus genotypes, while six clones of P. trichocarpa and 11 clones of P. maximowiczii could be identified by their two-locus genotypes. Twenty clones of P. deltoides and 25 clones of P. nigra could be differentiated by their multilocus genotypes employing three loci, and 29 clones of P. balsamifera required the use of multilocus genotypes at five loci for their genetic fingerprinting and differentiation. The loci PTR3, PTR5, and PTR7 were found to be the most informative for genetic fingerprinting and differentiation of the clones. The mean number of alleles per locus ranged from 2.9 in P. trichocarpa or P. grandidentata to 6.0 in P. balsamifera and 11.2 in 96 clones of the six species. The mean number of observed genotypes per locus ranged from 2.4 in P. grandidentata to 7.4 in P. balsamifera and 19.6 in 96 clones of the six species. The mean number of unique genotypes per locus ranged from 1.3 in P. grandidentata to 3.9 in P. deltoides and 8.8 in 96 clones of the six species. The power of discrimination of the microsatellite DNA markers in the 96 clones ranged from 0.726 for PTR4 to 0.939 for PTR7, with a mean of 0.832 over the 10 simple sequence repeat loci. Clones/cultivars from the same

DNA fingerprinting validates seed dispersal curves from observational studies in the neotropical legume parkia.

Science.gov (United States)

Heymann, Eckhard W; Lüttmann, Kathrin; Michalczyk, Inga M; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

2012-01-01

Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants.

[Study of genome instability using DNA fingerprinting of the offspring of male mice subjected to chronic low dose gamma irradiation].

Science.gov (United States)

Bezlepkin, V G; Vasil'eva, G V; Lomaeva, M G; Sirota, N P; Gaziev, A I

2000-01-01

By a polymerase chain reaction with an arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F1 generation) from male parents of mice exposed to chronic low-level gamma-radiation was studied. Male BALB/c mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old offspring mice and DNA was isolated. The primer in the AP-PCR was a 20-mer oligonucleotide flanking the microsatellite locus Atp1b2 on chromosome 11 of the mouse. A comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of microsatellite-associated sequences in the genome of the offspring of the males exposed to 25 and 50 cGy. The DNA-fingerprints of the offspring of male mice exposed to chronic irradiation with the doses 10 and 25 cGy 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of "non-parent bands". The results of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-level radiation prior to fertilization.

OPTIMAL EXPERIMENT DESIGN FOR MAGNETIC RESONANCE FINGERPRINTING

OpenAIRE

Zhao, Bo; Haldar, Justin P.; Setsompop, Kawin; Wald, Lawrence L.

2016-01-01

Magnetic resonance (MR) fingerprinting is an emerging quantitative MR imaging technique that simultaneously acquires multiple tissue parameters in an efficient experiment. In this work, we present an estimation-theoretic framework to evaluate and design MR fingerprinting experiments. More specifically, we derive the Cram��r-Rao bound (CRB), a lower bound on the covariance of any unbiased estimator, to characterize parameter estimation for MR fingerprinting. We then formulate an optimal experi...

Agro-ecological variations of sheath rot disease of rice caused by Sarocladium oryzae and DNA fingerprinting of the pathogen's population structure.

Science.gov (United States)

Tajul Islam Chowdhury, M; Salim Mian, M; Taher Mia, M A; Rafii, M Y; Latif, M A

2015-12-28

To examine the impact of regional and seasonal variations on the incidence and severity of sheath rot, a major seed-borne disease of rice caused by Sarocladium oryzae, data on incidence and severity were collected from 27 selected fields in the Gazipur, Rangpur, Bogra, Chittagong, Comilla, Gopalgonj, Jessore, Manikgonj, and Bhola districts of Bangladesh in rain-fed and irrigated conditions. Cultural variability of 29 pathogen isolates obtained from 8 different locations was studied on potato dextrose agar (PDA) and genetic variability was determined by DNA fingerprinting using variable number tandem repeat-polymerase chain reaction markers. Overall, disease incidence and severity were higher in irrigated rice. Disease incidence and severity were highest in the Bhola district in rain-fed rice and lowest in irrigated rice. Mycelial growth of 29 representative isolates was found to vary on PDA and the isolates were divided into 6 groups. The range of the overall size of conidia of the selected isolates was 2.40-7.20 x 1.20-2.40 μm. Analysis of the DNA fingerprint types of the 29 isolates of S. oryzae, obtained from the amplification reactions, revealed 10 fingerprinting types (FPTs) that were 80% similar. FPT-1 was the largest group and included 13 isolates (44.8%), while FPT-2 was the third largest group and included 3 isolates. Each of FPT-3, 4, 5, and 6 included only 1 isolate. We observed no relationship between cultural and genetic groupings.

ORIENTATION FIELD RECONSTRUCTION OF ALTERED FINGERPRINT USING ORTHOGONAL WAVELETS

Directory of Open Access Journals (Sweden)

Mini M.G.

2016-11-01

Full Text Available Ridge orientation field is an important feature for fingerprint matching and fingerprint reconstruction. Matching of the altered fingerprint against its unaltered mates can be done by extracting the available features in the altered fingerprint and using it along with approximated ridge orientation. This paper presents a method for approximating ridge orientation field of altered fingerprints. In the proposed method, sine and cosine of doubled orientation of the fingerprint is decomposed using orthogonal wavelets and reconstructed back using only the approximation coefficients. No prior information about the singular points is needed for orientation approximation. The method is found suitable for orientation estimation of low quality fingerprint images also.

An effective one-dimensional anisotropic fingerprint enhancement algorithm

Science.gov (United States)

Ye, Zhendong; Xie, Mei

2012-01-01

Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

Study of noninvasive detection of latent fingerprints using UV laser

Science.gov (United States)

Li, Hong-xia; Cao, Jing; Niu, Jie-qing; Huang, Yun-gang; Mao, Lin-jie; Chen, Jing-rong

2011-06-01

Latent fingerprints present a considerable challenge in forensics, and noninvasive procedure that captures a digital image of the latent fingerprints is significant in the field of criminal investigation. The capability of photography technologies using 266nm UV Nd:YAG solid state laser as excitation light source to provide detailed images of unprocessed latent fingerprints is demonstrated. Unprocessed latent fingerprints were developed on various non-absorbent and absorbing substrates. According to the special absorption, reflection, scattering and fluorescence characterization of the various residues in fingerprints (fatty acid ester, protein, and carbosylic acid salts etc) to the UV light to weaken or eliminate the background disturbance and increase the brightness contrast of fingerprints with the background, and using 266nm UV laser as excitation light source, fresh and old latent fingerprints on the surface of four types of non-absorbent objects as magazine cover, glass, back of cellphone, wood desktop paintwork and two types of absorbing objects as manila envelope, notebook paper were noninvasive detected and appeared through reflection photography and fluorescence photography technologies, and the results meet the fingerprint identification requirements in forensic science.

A fingerprint classification algorithm based on combination of local and global information

Science.gov (United States)

Liu, Chongjin; Fu, Xiang; Bian, Junjie; Feng, Jufu

2011-12-01

Fingerprint recognition is one of the most important technologies in biometric identification and has been wildly applied in commercial and forensic areas. Fingerprint classification, as the fundamental procedure in fingerprint recognition, can sharply decrease the quantity for fingerprint matching and improve the efficiency of fingerprint recognition. Most fingerprint classification algorithms are based on the number and position of singular points. Because the singular points detecting method only considers the local information commonly, the classification algorithms are sensitive to noise. In this paper, we propose a novel fingerprint classification algorithm combining the local and global information of fingerprint. Firstly we use local information to detect singular points and measure their quality considering orientation structure and image texture in adjacent areas. Furthermore the global orientation model is adopted to measure the reliability of singular points group. Finally the local quality and global reliability is weighted to classify fingerprint. Experiments demonstrate the accuracy and effectivity of our algorithm especially for the poor quality fingerprint images.

Piezoelectric micromachined ultrasonic transducers for fingerprint sensing

Science.gov (United States)

Lu, Yipeng

Fingerprint identification is the most prevalent biometric technology due to its uniqueness, universality and convenience. Over the past two decades, a variety of physical mechanisms have been exploited to capture an electronic image of a human fingerprint. Among these, capacitive fingerprint sensors are the ones most widely used in consumer electronics because they are fabricated using conventional complementary metal oxide semiconductor (CMOS) integrated circuit technology. However, capacitive fingerprint sensors are extremely sensitive to finger contamination and moisture. This thesis will introduce an ultrasonic fingerprint sensor using a PMUT array, which offers a potential solution to this problem. In addition, it has the potential to increase security, as it allows images to be collected at various depths beneath the epidermis, providing images of the sub-surface dermis layer and blood vessels. Firstly, PMUT sensitivity is maximized by optimizing the layer stack and electrode design, and the coupling coefficient is doubled via series transduction. Moreover, a broadband PMUT with 97% fractional bandwidth is achieved by utilizing a thinner structure excited at two adjacent mechanical vibration modes with overlapping bandwidth. In addition, we proposed waveguide PMUTs, which function to direct acoustic waves, confine acoustic energy, and provide mechanical protection for the PMUT array. Furthermore, PMUT arrays were fabricated with different processes to form the membrane, including front-side etching with a patterned sacrificial layer, front-side etching with additional anchor, cavity SOI wafers and eutectic bonding. Additionally, eutectic bonding allows the PMUT to be integrated with CMOS circuits. PMUTs were characterized in the mechanical, electrical and acoustic domains. Using transmit beamforming, a narrow acoustic beam was achieved, and high-resolution (sub-100 microm) and short-range (~1 mm) pulse-echo ultrasonic imaging was demonstrated using a steel

Chlorophyll Fluorescence Imaging Uncovers Photosynthetic Fingerprint of Citrus Huanglongbing

Directory of Open Access Journals (Sweden)

Haiyan Cen

2017-08-01

Full Text Available Huanglongbing (HLB is one of the most destructive diseases of citrus, which has posed a serious threat to the global citrus production. This research was aimed to explore the use of chlorophyll fluorescence imaging combined with feature selection to characterize and detect the HLB disease. Chlorophyll fluorescence images of citrus leaf samples were measured by an in-house chlorophyll fluorescence imaging system. The commonly used chlorophyll fluorescence parameters provided the first screening of HLB disease. To further explore the photosynthetic fingerprint of HLB infected leaves, three feature selection methods combined with the supervised classifiers were employed to identify the unique fluorescence signature of HLB and perform the three-class classification (i.e., healthy, HLB infected, and nutrient deficient leaves. Unlike the commonly used fluorescence parameters, this novel data-driven approach by using the combination of the mean fluorescence parameters and image features gave the best classification performance with the accuracy of 97%, and presented a better interpretation for the spatial heterogeneity of photochemical and non-photochemical components in HLB infected citrus leaves. These results imply the potential of the proposed approach for the citrus HLB disease diagnosis, and also provide a valuable insight for the photosynthetic response to the HLB disease.

An investigation of fake fingerprint detection approaches

Science.gov (United States)

Ahmad, Asraful Syifaa'; Hassan, Rohayanti; Othman, Razib M.

2017-10-01

The most reliable biometrics technology, fingerprint recognition is widely used in terms of security due to its permanence and uniqueness. However, it is also vulnerable to the certain type of attacks including presenting fake fingerprints to the sensor which requires the development of new and efficient protection measures. Particularly, the aim is to identify the most recent literature related to the fake fingerprint recognition and only focus on software-based approaches. A systematic review is performed by analyzing 146 primary studies from the gross collection of 34 research papers to determine the taxonomy, approaches, online public databases, and limitations of the fake fingerprint. Fourteen software-based approaches have been briefly described, four limitations of fake fingerprint image were revealed and two known fake fingerprint databases were addressed briefly in this review. Therefore this work provides an overview of an insight into the current understanding of fake fingerprint recognition besides identifying future research possibilities.

Investigation of genomic instability by assay of DNA fingerprint from the offspring of male mice exposed to chronic low-level γ-radiation

International Nuclear Information System (INIS)

Bezlepkin, V.G.; Vasil'eva, G.V.; Lomaeva, M.G.; Sirota, N.P.; Gaziev, A.I.

2000-01-01

By polymerase chain reaction with arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F 1 generation) from male parents of mice exposed to chronic low-dose γ-radiation was studied. Male mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old mice progeny for DNA separation. Primer in the AP-PCR was 20-mer oligonucleotide flanking the micro-satellite locus Atplb2 on chromosome 11 of the mouse. Comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of micro-satellite-associated sequences in the genome of the offspring of males exposed to 25 and 50 cGy. DNA-fingerprints of the offspring of male mice exposed to chronic irradiation doses 10 and 25 cGy. 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of non-parent bands. Result of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-dose radiation prior to fertilization [ru

Application of DNA fingerprinting to the recovery program of the endangered Puerto Rican parrot

Science.gov (United States)

Brock, M.K.; White, B.N.

1992-01-01

The Puerto Rican parrot was reduced to 13 animals in 1975 and as a conservation measure, a captive population was established from a few founders taken from the wild between 1973 and 1983. The number of successful breeding pairs in captivity has been !ow, and the captive breeding program has not been as productive as that of the closely related Hispaniolan parrot. Therefore, a genetic study was initiated to examine the relative levels of relatedness of the captive founders using levels of bandsharing in DNA fingerprints. Unrelated captive founder Puerto Rican parrots had the same average level of bandsharing (0.41) as second-degree relatives of the Hispaniolan parrot (0.38, P > 0,05), with an inbreeding coefficient of 0.04. High levels of bandsharing (>40%) between pairs of males and females correlated with reproductive failure, suggesting that inbreeding depression is partly responsible for the !ow number of' breeding pairs. Consequently, DNA profiling can be used to guide the captive breeding program for the Puerto Rican parrot, and other endangered species, by identifying pairs of males and females with low levels of bandsharing.

DNA Fingerprinting Validates Seed Dispersal Curves from Observational Studies in the Neotropical Legume Parkia

Science.gov (United States)

Heymann, Eckhard W.; Lüttmann, Kathrin; Michalczyk, Inga M.; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

2012-01-01

Background Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. Methodology/Principal Findings In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Conclusions/Significance Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants. PMID:22514748

An Investigation on the Problem of Thinning in Fingerprint Processing

Directory of Open Access Journals (Sweden)

I. O. Omeiza

2012-06-01

Full Text Available A high-integrity thinning procedure for binarised fingerprints is proposed in this paper. Several authors and software developers have approached the thinning problems in fingerprint-processing differently. Their approach produced in most cases, fingerprint skeletons with low reliability and thus require additional minutiae-pruning stage to discard the erroneous minutiae in the obtained skeletons. The work involves a careful blending of some already existing algorithms to achieve optimal performance in thinning binarised fingerprint images. The algorithms considered are as follows. The "Zhang and Suen" parallel algorithm for thinning digital patterns, the improved parallel thinning algorithm by Holt and company and template-based thinning algorithm by Stentiford and Mortimer. The idea of combining these stand-alone algorithms to improve the quality of obtained objects skeleton in general image processing was first suggested in a text by Parker in 1998. However, his work does not specifically address the fingerprint problem. This work has examined and proves the plausibility of this thinning approach in the particular case of fingerprint application domain. The thinning procedure obtained satisfactory skeletons for fingerprint applications.

DWI-based neural fingerprinting technology: a preliminary study on stroke analysis.

Science.gov (United States)

Ye, Chenfei; Ma, Heather Ting; Wu, Jun; Yang, Pengfei; Chen, Xuhui; Yang, Zhengyi; Ma, Jingbo

2014-01-01

Stroke is a common neural disorder in neurology clinics. Magnetic resonance imaging (MRI) has become an important tool to assess the neural physiological changes under stroke, such as diffusion weighted imaging (DWI) and diffusion tensor imaging (DTI). Quantitative analysis of MRI images would help medical doctors to localize the stroke area in the diagnosis in terms of structural information and physiological characterization. However, current quantitative approaches can only provide localization of the disorder rather than measure physiological variation of subtypes of ischemic stroke. In the current study, we hypothesize that each kind of neural disorder would have its unique physiological characteristics, which could be reflected by DWI images on different gradients. Based on this hypothesis, a DWI-based neural fingerprinting technology was proposed to classify subtypes of ischemic stroke. The neural fingerprint was constructed by the signal intensity of the region of interest (ROI) on the DWI images under different gradients. The fingerprint derived from the manually drawn ROI could classify the subtypes with accuracy 100%. However, the classification accuracy was worse when using semiautomatic and automatic method in ROI segmentation. The preliminary results showed promising potential of DWI-based neural fingerprinting technology in stroke subtype classification. Further studies will be carried out for enhancing the fingerprinting accuracy and its application in other clinical practices.

A preliminary study of DTI Fingerprinting on stroke analysis.

Science.gov (United States)

Ma, Heather T; Ye, Chenfei; Wu, Jun; Yang, Pengfei; Chen, Xuhui; Yang, Zhengyi; Ma, Jingbo

2014-01-01

DTI (Diffusion Tensor Imaging) is a well-known MRI (Magnetic Resonance Imaging) technique which provides useful structural information about human brain. However, the quantitative measurement to physiological variation of subtypes of ischemic stroke is not available. An automatically quantitative method for DTI analysis will enhance the DTI application in clinics. In this study, we proposed a DTI Fingerprinting technology to quantitatively analyze white matter tissue, which was applied in stroke classification. The TBSS (Tract Based Spatial Statistics) method was employed to generate mask automatically. To evaluate the clustering performance of the automatic method, lesion ROI (Region of Interest) is manually drawn on the DWI images as a reference. The results from the DTI Fingerprinting were compared with those obtained from the reference ROIs. It indicates that the DTI Fingerprinting could identify different states of ischemic stroke and has promising potential to provide a more comprehensive measure of the DTI data. Further development should be carried out to improve DTI Fingerprinting technology in clinics.

DNA fingerprinting of Mycobacterium tuberculosis: from phage typing to whole-genome sequencing.

Science.gov (United States)

Schürch, Anita C; van Soolingen, Dick

2012-06-01

Current typing methods for Mycobacterium tuberculosis complex evolved from simple phenotypic approaches like phage typing and drug susceptibility profiling to DNA-based strain typing methods, such as IS6110-restriction fragment length polymorphisms (RFLP) and variable number of tandem repeats (VNTR) typing. Examples of the usefulness of molecular typing are source case finding and epidemiological linkage of tuberculosis (TB) cases, international transmission of MDR/XDR-TB, the discrimination between endogenous reactivation and exogenous re-infection as a cause of relapses after curative treatment of tuberculosis, the evidence of multiple M. tuberculosis infections, and the disclosure of laboratory cross-contaminations. Simultaneously, phylogenetic analyses were developed based on single nucleotide polymorphisms (SNPs), genomic deletions usually referred to as regions of difference (RDs) and spoligotyping which served both strain typing and phylogenetic analysis. National and international initiatives that rely on the application of these typing methods have brought significant insight into the molecular epidemiology of tuberculosis. However, current DNA fingerprinting methods have important limitations. They can often not distinguish between genetically closely related strains and the turn-over of these markers is variable. Moreover, the suitability of most DNA typing methods for phylogenetic reconstruction is limited as they show a high propensity of convergent evolution or misinfer genetic distances. In order to fully explore the possibilities of genotyping in the molecular epidemiology of tuberculosis and to study the phylogeny of the causative bacteria reliably, the application of whole-genome sequencing (WGS) analysis for all M. tuberculosis isolates is the optimal, although currently still a costly solution. In the last years WGS for typing of pathogens has been explored and yielded important additional information on strain diversity in comparison to the

Extracting subsurface fingerprints using optical coherence tomography

CSIR Research Space (South Africa)

Akhoury, SS

2015-02-01

Full Text Available Subsurface Fingerprints using Optical Coherence Tomography Sharat Saurabh Akhoury, Luke Nicholas Darlow Modelling and Digital Science, Council for Scientific and Industrial Research, Pretoria, South Africa Abstract Physiologists have found... approach to extract the subsurface fingerprint representation using a high-resolution imaging technology known as Optical Coherence Tomography (OCT). ...

Performance characterization of structured light-based fingerprint scanner

Science.gov (United States)

Hassebrook, Laurence G.; Wang, Minghao; Daley, Raymond C.

2013-05-01

Our group believes that the evolution of fingerprint capture technology is in transition to include 3-D non-contact fingerprint capture. More specifically we believe that systems based on structured light illumination provide the highest level of depth measurement accuracy. However, for these new technologies to be fully accepted by the biometric community, they must be compliant with federal standards of performance. At present these standards do not exist for this new biometric technology. We propose and define a set of test procedures to be used to verify compliance with the Federal Bureau of Investigation's image quality specification for Personal Identity Verification single fingerprint capture devices. The proposed test procedures include: geometric accuracy, lateral resolution based on intensity or depth, gray level uniformity and flattened fingerprint image quality. Several 2-D contact analogies, performance tradeoffs and optimization dilemmas are evaluated and proposed solutions are presented.

Case study of 3D fingerprints applications.

Directory of Open Access Journals (Sweden)

Feng Liu

Full Text Available Human fingers are 3D objects. More information will be provided if three dimensional (3D fingerprints are available compared with two dimensional (2D fingerprints. Thus, this paper firstly collected 3D finger point cloud data by Structured-light Illumination method. Additional features from 3D fingerprint images are then studied and extracted. The applications of these features are finally discussed. A series of experiments are conducted to demonstrate the helpfulness of 3D information to fingerprint recognition. Results show that a quick alignment can be easily implemented under the guidance of 3D finger shape feature even though this feature does not work for fingerprint recognition directly. The newly defined distinctive 3D shape ridge feature can be used for personal authentication with Equal Error Rate (EER of ~8.3%. Also, it is helpful to remove false core point. Furthermore, a promising of EER ~1.3% is realized by combining this feature with 2D features for fingerprint recognition which indicates the prospect of 3D fingerprint recognition.

Visualization of latent fingerprints beneath opaque electrical tapes by optical coherence tomography

Science.gov (United States)

Liu, Kangkang; Zhang, Ning; Meng, Li; Li, Zhigang; Xu, Xiaojing

2018-03-01

Electrical tape is found as one type of important trace evidence in crime scene. For example, it is very frequently used to insulate wires in explosive devices in many criminal cases. The fingerprints of the suspects were often left on the adhesive side of the tapes, which can provide very useful clues for the investigation and make it possible for individual identification. The most commonly used method to detect and visualize those latent fingerprints is to peel off each layer of the tapes first and then adopt the chemical methods to develop the fingerprints on the tapes. However, the peeling-off and chemical development process would degrade and contaminate the fingerprints and thus adversely affect the accuracy of identification. Optical coherence tomography (OCT) is a novel forensic imaging modality based on lowcoherence interferometry, which has the advantages of non-destruction, micrometer-level high resolution and crosssectional imaging. In this study, a fiber-based spectral-domain OCT (SD-OCT) system with {6μm resolution was employed to obtain the image of fingerprint sandwiched between two opaque electrical tapes without any pre-processing procedure like peeling-off. Three-dimensional (3D) OCT reconstruction was performed and the subsurface image was produced to visualize the latent fingerprints. The results demonstrate that OCT is a promising tool for recovering the latent fingerprints hidden beneath opaque electrical tape non-destructively and rapidly.

DWI-Based Neural Fingerprinting Technology: A Preliminary Study on Stroke Analysis

Directory of Open Access Journals (Sweden)

Chenfei Ye

2014-01-01

Full Text Available Stroke is a common neural disorder in neurology clinics. Magnetic resonance imaging (MRI has become an important tool to assess the neural physiological changes under stroke, such as diffusion weighted imaging (DWI and diffusion tensor imaging (DTI. Quantitative analysis of MRI images would help medical doctors to localize the stroke area in the diagnosis in terms of structural information and physiological characterization. However, current quantitative approaches can only provide localization of the disorder rather than measure physiological variation of subtypes of ischemic stroke. In the current study, we hypothesize that each kind of neural disorder would have its unique physiological characteristics, which could be reflected by DWI images on different gradients. Based on this hypothesis, a DWI-based neural fingerprinting technology was proposed to classify subtypes of ischemic stroke. The neural fingerprint was constructed by the signal intensity of the region of interest (ROI on the DWI images under different gradients. The fingerprint derived from the manually drawn ROI could classify the subtypes with accuracy 100%. However, the classification accuracy was worse when using semiautomatic and automatic method in ROI segmentation. The preliminary results showed promising potential of DWI-based neural fingerprinting technology in stroke subtype classification. Further studies will be carried out for enhancing the fingerprinting accuracy and its application in other clinical practices.

Combining Biometric Fractal Pattern and Particle Swarm Optimization-Based Classifier for Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Chia-Hung Lin

2010-01-01

Full Text Available This paper proposes combining the biometric fractal pattern and particle swarm optimization (PSO-based classifier for fingerprint recognition. Fingerprints have arch, loop, whorl, and accidental morphologies, and embed singular points, resulting in the establishment of fingerprint individuality. An automatic fingerprint identification system consists of two stages: digital image processing (DIP and pattern recognition. DIP is used to convert to binary images, refine out noise, and locate the reference point. For binary images, Katz's algorithm is employed to estimate the fractal dimension (FD from a two-dimensional (2D image. Biometric features are extracted as fractal patterns using different FDs. Probabilistic neural network (PNN as a classifier performs to compare the fractal patterns among the small-scale database. A PSO algorithm is used to tune the optimal parameters and heighten the accuracy. For 30 subjects in the laboratory, the proposed classifier demonstrates greater efficiency and higher accuracy in fingerprint recognition.

Fingerprint segmentation: an investigation of various techniques and a parameter study of a variance-based method

CSIR Research Space (South Africa)

Msiza, IS

2011-09-01

Full Text Available Fingerprint image segmentation plays an important role in any fingerprint image analysis implementation and it should, ideally, be executed during the initial stages of a fingerprint manipulation process. After careful consideration of various...

Limited variation of DNA fingerprints (IS6110 and IS1081) in Korean strains of Mycobacterium tuberculosis.

Science.gov (United States)

Huh, Y J; Ahn, D I; Kim, S J

1995-08-01

To establish the usefulness of DNA fingerprinting for the epidemiology of Mycobacterium tuberculosis isolated from Korean tuberculosis patients. Comparison of restriction fragment length polymorphism (RFLP) patterns produced by southern hybridization of PvuII-digested chromosomal DNA. IS6110-associated banding patterns of 41 isolates varied considerably, containing 1-13 copies. The RFLP pattern of the epidemiologically related M. tuberculosis isolates was identical in 8 of 10 groups of close contact patients. No noticeable differences in RFLP were observed between drug-sensitive and drug-resistant isolates. IS1081-containing restriction fragment analysis of 52 isolates showed 6 different banding patterns, and the C type was found dominant in Korea. Identification of G type M. tuberculosis, which has a 8.0 kb IS1081-containing PvuII fragment, is unusual because it has been observed only in M. bovis BCG so far. IS6110 was a very useful tool for tracing the transmission route of tuberculosis; IS1081 was also useful for subdividing M. tuberculosis into several groups.

Electronic fingerprinting of the dead.

Science.gov (United States)

Rutty, G N; Stringer, K; Turk, E E

2008-01-01

To date, a number of methods exist for the capture of fingerprints from cadavers that can then be used in isolation as a primary method for the identification of the dead. We report the use of a handheld, mobile wireless unit used in conjunction with a personal digital assistant (PDA) device for the capture of fingerprints from the dead. We also consider a handheld single-digit fingerprint scanner that utilises a USB laptop connection for the electronic capture of cadaveric fingerprints. Both are single-operator units that, if ridge detail is preserved, can collect a 10-set of finger pad prints in approximately 45 and 90 s, respectively. We present our observations on the restrictions as to when such devices can be used with cadavers. We do, however, illustrate that the images are of sufficient quality to allow positive identification from finger pad prints of the dead. With the development of mobile, handheld, biometric, PDA-based units for the police, we hypothesize that, under certain circumstances, devices such as these could be used for the accelerated acquisition of fingerprint identification data with the potential for rapid near-patient identification in the future.

Holistic processing of fingerprints by expert forensic examiners.

Science.gov (United States)

Vogelsang, Macgregor D; Palmeri, Thomas J; Busey, Thomas A

2017-01-01

Holistic processing is often characterized as a process by which objects are perceived as a whole rather than a compilation of individual features. This mechanism may play an important role in the development of perceptual expertise because it allows for rapid integration across image regions. The present work explores whether holistic processing is present in latent fingerprint examiners, who compare fingerprints collected from crime scenes against a set of standards taken from a suspect. We adapted a composite task widely used in the face recognition and perceptual expertise literatures, in which participants were asked to match only a particular half of a fingerprint with a previous image while ignoring the other half. We tested both experts and novices, using both upright and inverted fingerprints. For upright fingerprints, we found weak evidence for holistic processing, but with no differences between experts and novices with respect to holistic processing. For inverted fingerprints, we found stronger evidence of holistic processing, with weak evidence for differences between experts and novices. These relatively weak holistic processing effects contrast with robust evidence for holistic processing with faces and with objects in other domains of perceptual expertise. The data constrain models of holistic processing by demonstrating that latent fingerprint experts and novices may not substantively differ in terms of the amount of holistic processing and that inverted stimuli actually produced more evidence for holistic processing than upright stimuli. Important differences between the present fingerprint stimuli and those in the literature include the lack of verbal labels for experts and the absence of strong vertical asymmetries, both of which might contribute to stronger holistic processing signatures in other stimulus domains.

Angstrom-Resolution Magnetic Resonance Imaging of Single Molecules via Wave-Function Fingerprints of Nuclear Spins

Science.gov (United States)

Ma, Wen-Long; Liu, Ren-Bao

2016-08-01

Single-molecule sensitivity of nuclear magnetic resonance (NMR) and angstrom resolution of magnetic resonance imaging (MRI) are the highest challenges in magnetic microscopy. Recent development in dynamical-decoupling- (DD) enhanced diamond quantum sensing has enabled single-nucleus NMR and nanoscale NMR. Similar to conventional NMR and MRI, current DD-based quantum sensing utilizes the "frequency fingerprints" of target nuclear spins. The frequency fingerprints by their nature cannot resolve different nuclear spins that have the same noise frequency or differentiate different types of correlations in nuclear-spin clusters, which limit the resolution of single-molecule MRI. Here we show that this limitation can be overcome by using "wave-function fingerprints" of target nuclear spins, which is much more sensitive than the frequency fingerprints to the weak hyperfine interaction between the targets and a sensor under resonant DD control. We demonstrate a scheme of angstrom-resolution MRI that is capable of counting and individually localizing single nuclear spins of the same frequency and characterizing the correlations in nuclear-spin clusters. A nitrogen-vacancy-center spin sensor near a diamond surface, provided that the coherence time is improved by surface engineering in the near future, may be employed to determine with angstrom resolution the positions and conformation of single molecules that are isotope labeled. The scheme in this work offers an approach to breaking the resolution limit set by the "frequency gradients" in conventional MRI and to reaching the angstrom-scale resolution.

Diversity among Cynodon accessions and taxa based on DNA amplification fingerprinting.

Science.gov (United States)

Assefa, S; Taliaferro, C M; Anderson, M P; de los Reyes, B G; Edwards, R M

1999-06-01

The genus Cynodon (Gramineae), comprised of 9 species, is geographically widely distributed and genetically diverse. Information on the amounts of molecular genetic variation among and within Cynodon taxa is needed to enhance understanding of phylogenetic relations and facilitate germplasm management and breeding improvement efforts. Genetic relatedness among 62 Cynodon accessions, representing eight species, was assessed using DNA amplification fingerprinting (DAF). Ten 8-mer oligonucleotides were used to amplify specific Cynodon genomic sequences. The DNA amplification products of individual accessions were scored for presence (1) or absence (0) of bands. Similarity matrices were developed and the accessions were grouped by cluster (UPGMA) and principal coordinate analysis. Analyses were conducted within ploidy level (2x = 18 and 4x = 36) and over ploidy levels. Each primer revealed polymorphic loci among accessions within species. Of 539 loci (bands) scored, 496 (92%) were polymorphic. Cynodon arcuatus was clearly separated from other species by numerous monomorphic bands. The strongest species similarities were between C. aethiopicus and C. arcuatus, C. transvaalensis and C. plectostachyus, and C. incompletus and C. nlemfuensis. Intraspecific variation was least for C. aethiopicus, C. arcuatus, and C. transvaalensis, and greatest for C. dactylon. Accessions of like taxonomic classification were generally clustered, except the cosmopolitan C. dactylon var. dactylon and C. dactylon var. afganicus. Within taxa, accessions differing in chromosome number clustered in all instances indicating the 2x and 4x forms to be closely related. Little, if any, relationship was found between relatedness as indicated by the DAF profiles and previous estimates of hybridization potential between the different taxa.

Magnetic Resonance Fingerprinting - a promising new approach to obtain standardized imaging biomarkers from MRI

OpenAIRE

2015-01-01

Current routine MRI examinations rely on the acquisition of qualitative images that have a contrast ?weighted? for a mixture of (magnetic) tissue properties. Recently, a novel approach was introduced, namely MR Fingerprinting (MRF) with a completely different approach to data acquisition, post-processing and visualization. Instead of using a repeated, serial acquisition of data for the characterization of individual parameters of interest, MRF uses a pseudo randomized acquisition that causes ...

Chemical Visualization of Sweat Pores in Fingerprints Using GO-Enhanced TOF-SIMS.

Science.gov (United States)

Cai, Lesi; Xia, Meng-Chan; Wang, Zhaoying; Zhao, Ya-Bin; Li, Zhanping; Zhang, Sichun; Zhang, Xinrong

2017-08-15

Time-of-flight secondary ion mass spectrometry (TOF-SIMS) has been used in imaging of small molecules (SIMS was used to detect and image relatively high mass molecules such as poison, alkaloids (>600 Da) and controlled drugs, and antibiotics (>700 Da) in fingerprints. Detail features of fingerprints such as the number and distribution of sweat pores in a ridge and even the delicate morphology of one pore were clearly revealed in SIMS images of relatively high mass molecules. The detail features combining with identified chemical composition were sufficient to establish a human identity and link the suspect to a crime scene. The wide detectable mass range and high spatial resolution make GO-enhanced TOF-SIMS a promising tool in accurate and fast analysis of fingerprints, especially in fragmental fingerprint analysis.

A STRONG SECURITY PROTOCOL AGAINST FINGERPRINT DATABASE ATTACKS

Directory of Open Access Journals (Sweden)

U. Latha

2013-08-01

Full Text Available The Biometric data is subject to on-going changes and create a crucial problem in fingerprint database. To deal with this, a security protocol is proposed to protect the finger prints information from the prohibited users. Here, a security protocol is proposed to protect the finger prints information. The proposed system comprised of three phases namely, fingerprint reconstruction, feature extraction and development of trigon based security protocol. In fingerprint reconstruction, the different crack variance level finger prints images are reconstructed by the M-band Dual Tree Complex Wavelet Transform (DTCWT. After that features are extracted by binarization. A set of finger print images are utilized to evaluate the performance of security protocol and the result from this process guarantees the healthiness of the proposed trigon based security protocol. The implementation results show the effectiveness of proposed trigon based security protocol in protecting the finger print information and the achieved improvement in image reconstruction and the security process.

A novel hand-type detection technique with fingerprint sensor

Science.gov (United States)

Abe, Narishige; Shinzaki, Takashi

2013-05-01

In large-scale biometric authentication systems such as the US-Visit (USA), a 10-fingerprints scanner which simultaneously captures four fingerprints is used. In traditional systems, specific hand-types (left or right) are indicated, but it is difficult to detect hand-type due to the hand rotation and the opening and closing of fingers. In this paper, we evaluated features that were extracted from hand images (which were captured by a general optical scanner) that are considered to be effective for detecting hand-type. Furthermore, we extended the knowledge to real fingerprint images, and evaluated the accuracy with which it detects hand-type. We obtained an accuracy of about 80% with only three fingers (index, middle, ring finger).

Genetic fingerprinting and phylogenetic diversity of Staphylococcus ...

African Journals Online (AJOL)

Genetic fingerprinting of 18 different isolates of Staphylococcus aureus from Nigeria using random amplified polymorphic DNA (RAPD) was carried out. Ten out of 100 Operon primers showed polymorphism among the isolates tested generating 88 bands, 51 of which were polymorphic with sizes ranging between 200 and ...

Verification and Validation of a Fingerprint Image Registration Software

Directory of Open Access Journals (Sweden)

Liu Yan

2006-01-01

Full Text Available The need for reliable identification and authentication is driving the increased use of biometric devices and systems. Verification and validation techniques applicable to these systems are rather immature and ad hoc, yet the consequences of the wide deployment of biometric systems could be significant. In this paper we discuss an approach towards validation and reliability estimation of a fingerprint registration software. Our validation approach includes the following three steps: (a the validation of the source code with respect to the system requirements specification; (b the validation of the optimization algorithm, which is in the core of the registration system; and (c the automation of testing. Since the optimization algorithm is heuristic in nature, mathematical analysis and test results are used to estimate the reliability and perform failure analysis of the image registration module.

DNA fingerprinting and diversity analysis in Aus genotypes using microsatellite markers

Directory of Open Access Journals (Sweden)

MD. MONIRUL ISLAM

2015-08-01

Full Text Available DNA fingerprinting and genetic diversity of 94 Aus (6 BRRI released Aus variety and 88 local Aus landraces genotypes were carried out to protect the Aus landraces from biopiracy. A total of 91 microsatellite markers were tested for screening the genotypes. Among 91 amplified products, 56% have polymorphic bands giving 195 alleles. The number of alleles per locus ranged from four (RM25 and RM147 to twenty seven (RM519, where average allele number was 9.76. The Polymorphism Information Contents (PIC lied between 0.455 (RM5 to 0.934 (RM519. Most robust marker was found RM519 since it provided the highest PIC value (0.934. Pair-wise genetic dissimilarity co-efficient showed the lowest genetic dissimilarity was found BRRI dhan42 and BRRI dhan43 and the highest genetic dissimilarity was found local landraces each other. Here it is shown that most Aus landraces is recognized to have broad genetic base. Thus it is recommended to use these landraces for future breeding program or include new and untouched local landraces to incorporate new genes and broaden genetic base.

Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

NARCIS (Netherlands)

Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

1994-01-01

PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

NARCIS (Netherlands)

Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

Network-based Fingerprint Authentication System Using a Mobile Device

OpenAIRE

Zhang, Qihu

2016-01-01

Abstract—　Fingerprint-based user authentication is highly effective in networked services such as electronic payment, but conventional authentication solutions have problems in cost, usability and security. To resolve these problems, we propose a touch-less fingerprint authentication solution, in which a mobile device's built-in camera is used to capture fingerprint image, and then it is sent to the server to determine the identity of the user. We designed and implemented a prototype as an a...

The structure of DNA by direct imaging

KAUST Repository

Marini, Monica

2015-08-28

The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

The structure of DNA by direct imaging

KAUST Repository

Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo M.

2015-01-01

The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations.

Structural Fingerprints of Transcription Factor Binding Site Regions

Directory of Open Access Journals (Sweden)

Peter Willett

2009-03-01

Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

Using DNA fingerprints to infer familial relationships within NHANES III households.

Science.gov (United States)

Katki, Hormuzd A; Sanders, Christopher L; Graubard, Barry I; Bergen, Andrew W

2010-06-01

Developing, targeting, and evaluating genomic strategies for population-based disease prevention require population-based data. In response to this urgent need, genotyping has been conducted within the Third National Health and Nutrition Examination (NHANES III), the nationally-representative household-interview health survey in the U.S. However, before these genetic analyses can occur, family relationships within households must be accurately ascertained. Unfortunately, reported family relationships within NHANES III households based on questionnaire data are incomplete and inconclusive with regards to actual biological relatedness of family members. We inferred family relationships within households using DNA fingerprints (Identifiler(R)) that contain the DNA loci used by law enforcement agencies for forensic identification of individuals. However, performance of these loci for relationship inference is not well understood. We evaluated two competing statistical methods for relationship inference on pairs of household members: an exact likelihood ratio relying on allele frequencies to an Identical By State (IBS) likelihood ratio that only requires matching alleles. We modified these methods to account for genotyping errors and population substructure. The two methods usually agree on the rankings of the most likely relationships. However, the IBS method underestimates the likelihood ratio by not accounting for the informativeness of matching rare alleles. The likelihood ratio is sensitive to estimates of population substructure, and parent-child relationships are sensitive to the specified genotyping error rate. These loci were unable to distinguish second-degree relationships and cousins from being unrelated. The genetic data is also useful for verifying reported relationships and identifying data quality issues. An important by-product is the first explicitly nationally-representative estimates of allele frequencies at these ubiquitous forensic loci.

Image cytometry: nuclear and chromosomal DNA quantification.

Science.gov (United States)

Carvalho, Carlos Roberto; Clarindo, Wellington Ronildo; Abreu, Isabella Santiago

2011-01-01

Image cytometry (ICM) associates microscopy, digital image and software technologies, and has been particularly useful in spatial and densitometric cytological analyses, such as DNA ploidy and DNA content measurements. Basically, ICM integrates methodologies of optical microscopy calibration, standard density filters, digital CCD camera, and image analysis softwares for quantitative applications. Apart from all system calibration and setup, cytological protocols must provide good slide preparations for efficient and reliable ICM analysis. In this chapter, procedures for ICM applications employed in our laboratory are described. Protocols shown here for human DNA ploidy determination and quantification of nuclear and chromosomal DNA content in plants could be used as described, or adapted for other studies.

An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

Directory of Open Access Journals (Sweden)

Zheng Zhao

2017-01-01

Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

Optimal experiment design for magnetic resonance fingerprinting.

Science.gov (United States)

Bo Zhao; Haldar, Justin P; Setsompop, Kawin; Wald, Lawrence L

2016-08-01

Magnetic resonance (MR) fingerprinting is an emerging quantitative MR imaging technique that simultaneously acquires multiple tissue parameters in an efficient experiment. In this work, we present an estimation-theoretic framework to evaluate and design MR fingerprinting experiments. More specifically, we derive the Cramér-Rao bound (CRB), a lower bound on the covariance of any unbiased estimator, to characterize parameter estimation for MR fingerprinting. We then formulate an optimal experiment design problem based on the CRB to choose a set of acquisition parameters (e.g., flip angles and/or repetition times) that maximizes the signal-to-noise ratio efficiency of the resulting experiment. The utility of the proposed approach is validated by numerical studies. Representative results demonstrate that the optimized experiments allow for substantial reduction in the length of an MR fingerprinting acquisition, and substantial improvement in parameter estimation performance.

A network identity authentication system based on Fingerprint identification technology

Science.gov (United States)

Xia, Hong-Bin; Xu, Wen-Bo; Liu, Yuan

2005-10-01

Fingerprint verification is one of the most reliable personal identification methods. However, most of the automatic fingerprint identification system (AFIS) is not run via Internet/Intranet environment to meet today's increasing Electric commerce requirements. This paper describes the design and implementation of the archetype system of identity authentication based on fingerprint biometrics technology, and the system can run via Internet environment. And in our system the COM and ASP technology are used to integrate Fingerprint technology with Web database technology, The Fingerprint image preprocessing algorithms are programmed into COM, which deployed on the internet information server. The system's design and structure are proposed, and the key points are discussed. The prototype system of identity authentication based on Fingerprint have been successfully tested and evaluated on our university's distant education applications in an internet environment.

Evidence of transmission of Mycobacterium tuberculosis by random amplified polymorphic DNA (RAPD) fingerprinting in Taipei City, Taiwan.

Science.gov (United States)

Harn, H J; Shen, K L; Ho, L I; Yu, K W; Liu, G C; Yueh, K C; Lee, J H

1997-01-01

AIMS: To determine, by strain identification of Mycobacterium tuberculosis, whether transmission has occurred between individuals or whether new strains are present. METHODS: A rapid protocol for random amplified polymorphic DNA (RAPD) analysis was developed. This protocol was applied to 64 strains of M tuberculosis that had been confirmed by culture and microbiological methods. RESULTS: There are five groups of M tuberculosis prevalent in Taipei city, Taiwan. The major types are groups I and III. Groups I and II had been prevalent until the end of last year when, according to our group analysis, they had been eradicated. However, group III was continuously present from the middle of 1995 to the middle of 1996, and group IV was present at the end of both years, which indicated that both groups were transmitted continuously. These clustered strains had demographic characteristics consistent with a finding of transmission tuberculosis. Also, there were 13 of 64 strains with unique RAPD fingerprints that were inferred to be due primarily to the reactivation of infection. In the drug resistance analysis, the major type represented included group III and part of group IV. CONCLUSIONS: Our preliminary data imply, not only that the prevalence of M tuberculosis in Taipei city is due to transmission rather than reactivation, but that drug resistance also may play a role in tuberculosis transmission. Images PMID:9378819

DNA fingerprinting tags novel altered chromosomal regions and identifies the involvement of SOX5 in the progression of prostate cancer.

Science.gov (United States)

Ma, Stephanie; Chan, Yuen Piu; Woolcock, Bruce; Hu, Liang; Wong, Kai Yau; Ling, Ming Tat; Bainbridge, Terry; Webber, Douglas; Chan, Tim Hon Man; Guan, Xin-Yuan; Lam, Wan; Vielkind, Juergen; Chan, Kwok Wah

2009-05-15

Identification of genomic alterations associated with the progression of prostate cancer may facilitate the better understanding of the development of this highly variable disease. Matched normal, premalignant high-grade prostatic intraepithelial neoplasia and invasive prostate carcinoma cells were procured by laser capture microdissection (LCM) from human radical prostatectomy specimens. From these cells, comparative DNA fingerprints were generated by a modified PCR-based technique called scanning of microdissected archival lesion (SMAL)-PCR. Recurrent polymorphic fingerprint fragments were used in tagging altered chromosomal regions. Altered regions were found at cytobands 1p31.3, 1q44, 2p23.1, 3p26.3, 3q22.3, 4q22.3, 4q35.2, 5q23.2, 8q22.3, 8q24.13, 9q21.3, 9q22.32, 10q11.21, 11p13, 12p12.1, 13q12.1, 16q12.2 and 18q21.31. Candidate genes in the surrounding area that may possibly harbor mutations that change normal prostatic cells to progress into their tumor stages were proposed. Of these fragments, a 420 bp alteration, absent in all 26 normal samples screened, was observed in 2 tumors. This fragment was cloned, sequenced and localized to chromosome 12p12.1. Within this region, candidate gene sex determining region Y-box 5 (SOX5) was proposed. Further studies of SOX5 in cell lines, xenografts and human prostate specimens, at both the RNA and protein levels, found overexpression of the gene in tumors. This overexpression was then subsequently found by fluorescent in situ hybridization to be caused by amplification of the region. In conclusion, our results suggest LCM coupled with SMAL-PCR DNA fingerprinting is a useful method for the screening and identification of chromosomal regions and genes associated with cancer development. Further, overexpression of SOX5 is associated with prostate tumor progression and early development of distant metastasis. (c) 2008 Wiley-Liss, Inc.

Impact of Finger Type in Fingerprint Authentication

Science.gov (United States)

Gafurov, Davrondzhon; Bours, Patrick; Yang, Bian; Busch, Christoph

Nowadays fingerprint verification system is the most widespread and accepted biometric technology that explores various features of the human fingers for this purpose. In general, every normal person has 10 fingers with different size. Although it is claimed that recognition performance with little fingers can be less accurate compared to other finger types, to our best knowledge, this has not been investigated yet. This paper presents our study on the topic of influence of the finger type into fingerprint recognition performance. For analysis we employ two fingerprint verification software packages (one public and one commercial). We conduct test on GUC100 multi sensor fingerprint database which contains fingerprint images of all 10 fingers from 100 subjects. Our analysis indeed confirms that performance with small fingers is less accurate than performance with the others fingers of the hand. It also appears that best performance is being obtained with thumb or index fingers. For example, performance deterioration from the best finger (i.e. index or thumb) to the worst fingers (i.e. small ones) can be in the range of 184%-1352%.

Efficiency and Flexibility of Fingerprint Scheme Using Partial Encryption and Discrete Wavelet Transform to Verify User in Cloud Computing.

Science.gov (United States)

Yassin, Ali A

2014-01-01

Now, the security of digital images is considered more and more essential and fingerprint plays the main role in the world of image. Furthermore, fingerprint recognition is a scheme of biometric verification that applies pattern recognition techniques depending on image of fingerprint individually. In the cloud environment, an adversary has the ability to intercept information and must be secured from eavesdroppers. Unluckily, encryption and decryption functions are slow and they are often hard. Fingerprint techniques required extra hardware and software; it is masqueraded by artificial gummy fingers (spoof attacks). Additionally, when a large number of users are being verified at the same time, the mechanism will become slow. In this paper, we employed each of the partial encryptions of user's fingerprint and discrete wavelet transform to obtain a new scheme of fingerprint verification. Moreover, our proposed scheme can overcome those problems; it does not require cost, reduces the computational supplies for huge volumes of fingerprint images, and resists well-known attacks. In addition, experimental results illustrate that our proposed scheme has a good performance of user's fingerprint verification.

Molecular fingerprinting of the Egyptian medicinal plant Cocculus ...

African Journals Online (AJOL)

Since no information about the genome of C. pendulus is available, the current study deals with molecular investigation of C. pendulus expressed by DNA fingerprinting of the young leaves of this plant using amplified fragment length polymorphism (AFLP) technique with four primer combinations. The obtained results ...

Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

Science.gov (United States)

Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

2014-07-01

Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A Fingerprint Encryption Scheme Based on Irreversible Function and Secure Authentication

Directory of Open Access Journals (Sweden)

Yijun Yang

2015-01-01

Full Text Available A fingerprint encryption scheme based on irreversible function has been designed in this paper. Since the fingerprint template includes almost the entire information of users’ fingerprints, the personal authentication can be determined only by the fingerprint features. This paper proposes an irreversible transforming function (using the improved SHA1 algorithm to transform the original minutiae which are extracted from the thinned fingerprint image. Then, Chinese remainder theorem is used to obtain the biokey from the integration of the transformed minutiae and the private key. The result shows that the scheme has better performance on security and efficiency comparing with other irreversible function schemes.

Fingerprint recognition system by use of graph matching

Science.gov (United States)

Shen, Wei; Shen, Jun; Zheng, Huicheng

2001-09-01

Fingerprint recognition is an important subject in biometrics to identify or verify persons by physiological characteristics, and has found wide applications in different domains. In the present paper, we present a finger recognition system that combines singular points and structures. The principal steps of processing in our system are: preprocessing and ridge segmentation, singular point extraction and selection, graph representation, and finger recognition by graphs matching. Our fingerprint recognition system is implemented and tested for many fingerprint images and the experimental result are satisfactory. Different techniques are used in our system, such as fast calculation of orientation field, local fuzzy dynamical thresholding, algebraic analysis of connections and fingerprints representation and matching by graphs. Wed find that for fingerprint database that is not very large, the recognition rate is very high even without using a prior coarse category classification. This system works well for both one-to-few and one-to-many problems.

DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

OpenAIRE

Antonio, May A. D.; Hillier, Sharon L.

2003-01-01

Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identifie...

DNA nanomaterials for preclinical imaging and drug delivery.

Science.gov (United States)

Jiang, Dawei; England, Christopher G; Cai, Weibo

2016-10-10

Besides being the carrier of genetic information, DNA is also an excellent biological organizer to establish well-designed nanostructures in the fields of material engineering, nanotechnology, and biomedicine. DNA-based materials represent a diverse nanoscale system primarily due to their predictable base pairing and highly regulated conformations, which greatly facilitate the construction of DNA nanostructures with distinct shapes and sizes. Integrating the emerging advancements in bioconjugation techniques, DNA nanostructures can be readily functionalized with high precision for many purposes ranging from biosensors to imaging to drug delivery. Recent progress in the field of DNA nanotechnology has exhibited collective efforts to employ DNA nanostructures as smart imaging agents or delivery platforms within living organisms. Despite significant improvements in the development of DNA nanostructures, there is limited knowledge regarding the in vivo biological fate of these intriguing nanomaterials. In this review, we summarize the current strategies for designing and purifying highly-versatile DNA nanostructures for biological applications, including molecular imaging and drug delivery. Since DNA nanostructures may elicit an immune response in vivo, we also present a short discussion of their potential toxicities in biomedical applications. Lastly, we discuss future perspectives and potential challenges that may limit the effective preclinical and clinical employment of DNA nanostructures. Due to their unique properties, we predict that DNA nanomaterials will make excellent agents for effective diagnostic imaging and drug delivery, improving patient outcome in cancer and other related diseases in the near future. Copyright © 2016 Elsevier B.V. All rights reserved.

Advanced Fingerprint Analysis Project Fingerprint Constituents

Energy Technology Data Exchange (ETDEWEB)

GM Mong; CE Petersen; TRW Clauss

1999-10-29

The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes

NARCIS (Netherlands)

S. Tims (Sebastian); W.J.B. van Wamel (Willem); H.P. Endtz (Hubert); A.F. van Belkum (Alex); M.H. Kayser (Manfred)

2009-01-01

textabstractHuman fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically

A clinical and bacteriologic investigation of invasive streptococcal infections in Japan on the basis of serotypes, toxin production, and genomic DNA fingerprints.

Science.gov (United States)

Nakashima, K; Ichiyama, S; Iinuma, Y; Hasegawa, Y; Ohta, M; Ooe, K; Shimizu, Y; Igarashi, H; Murai, T; Shimokata, K

1997-08-01

In a survey of invasive streptococcal infections in Japan, we analyzed isolates of Streptococcus pyogenes collected between 1992 and 1994. Genomic DNA fingerprints produced by pulsed-field gel electrophoresis (PFGE) were compared by computer-assisted analysis. Conventional serologic M types were subdivided into PFGE types showing close genetic similarity. Among the 42 isolates from patients with invasive diseases, 16 PFGE types were identified and genetic diversity was clearly demonstrated. Identical fingerprints were observed in both invasive and noninvasive isolates. Only 43% of invasive isolates produced streptococcal pyrogenic exotoxin A (SPE A), and 31% did not contain the speA gene. These findings suggest that the dissemination of a specific clone is not sufficient to explain all cases of these diseases in Japan and pose a question as to the role of SPE A as a major virulent factor. Bacterial factors other than SPE A and host factors should be considered in evaluation of the pathogenesis of the diseases.

Multispectral imaging for biometrics

Science.gov (United States)

Rowe, Robert K.; Corcoran, Stephen P.; Nixon, Kristin A.; Ostrom, Robert E.

2005-03-01

Automated identification systems based on fingerprint images are subject to two significant types of error: an incorrect decision about the identity of a person due to a poor quality fingerprint image and incorrectly accepting a fingerprint image generated from an artificial sample or altered finger. This paper discusses the use of multispectral sensing as a means to collect additional information about a finger that significantly augments the information collected using a conventional fingerprint imager based on total internal reflectance. In the context of this paper, "multispectral sensing" is used broadly to denote a collection of images taken under different polarization conditions and illumination configurations, as well as using multiple wavelengths. Background information is provided on conventional fingerprint imaging. A multispectral imager for fingerprint imaging is then described and a means to combine the two imaging systems into a single unit is discussed. Results from an early-stage prototype of such a system are shown.

The examination of Hevea brasiliensis plants produced by in vitro culture and mutagenesis by DNA fingerprinting techniques

International Nuclear Information System (INIS)

Low, F.C.; Atan, S.; Jaafar, H.

1998-01-01

Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of

Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties.

Science.gov (United States)

Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei

2015-01-01

Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.

Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions

Directory of Open Access Journals (Sweden)

Silvia L. Bustamante

2003-07-01

Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

Efficient internal and surface fingerprint extraction and blending using optical coherence tomography.

Science.gov (United States)

Darlow, Luke Nicholas; Connan, James

2015-11-01

Optical coherence tomography provides a 3D representation of fingertip skin where surface and internal fingerprints are found. These fingerprints are topographically identical. However, the surface skin is prone to damage, distortion, and spoofing; and the internal fingerprint is difficult to access and extract. This research presents a novel scaling-resolution approach to fingerprint zone detection and extraction. Furthermore, a local-quality-based blending procedure is also proposed. The accuracy of the zone-detection algorithm is comparable to an earlier work, yielding a mean-squared error of 25.9 and structural similarity of 95.8% (compared to a ground-truth estimate). Blending the surface and internal fingerprints improved the National Institute of Science and Technology's Fingerprint Image Quality scores and the average maximum match scores (when matched against conventional surface counterparts). The fingerprint blending procedure was able to combine high-quality regions from both fingerprints, thus mitigating surface wrinkles and anomalous poor-quality regions. Furthermore, spoof detection via a surface-to-internal fingerprint comparison was proposed and tested.

Uniform Local Binary Pattern for Fingerprint Liveness Detection in the Gaussian Pyramid

Directory of Open Access Journals (Sweden)

Yujia Jiang

2018-01-01

Full Text Available Fingerprint recognition schemas are widely used in our daily life, such as Door Security, Identification, and Phone Verification. However, the existing problem is that fingerprint recognition systems are easily tricked by fake fingerprints for collaboration. Therefore, designing a fingerprint liveness detection module in fingerprint recognition systems is necessary. To solve the above problem and discriminate true fingerprint from fake ones, a novel software-based liveness detection approach using uniform local binary pattern (ULBP in spatial pyramid is applied to recognize fingerprint liveness in this paper. Firstly, preprocessing operation for each fingerprint is necessary. Then, to solve image rotation and scale invariance, three-layer spatial pyramids of fingerprints are introduced in this paper. Next, texture information for three layers spatial pyramids is described by using uniform local binary pattern to extract features of given fingerprints. The accuracy of our proposed method has been compared with several state-of-the-art methods in fingerprint liveness detection. Experiments based on standard databases, taken from Liveness Detection Competition 2013 composed of four different fingerprint sensors, have been carried out. Finally, classifier model based on extracted features is trained using SVM classifier. Experimental results present that our proposed method can achieve high recognition accuracy compared with other methods.

In Silico Genomic Fingerprints of the Bacillus anthracis Group Obtained by Virtual Hybridization

Directory of Open Access Journals (Sweden)

Hueman Jaimes-Díaz

2015-02-01

Full Text Available In this study we evaluate the capacity of Virtual Hybridization to identify between highly related bacterial strains. Eight genomic fingerprints were obtained by virtual hybridization for the Bacillus anthracis genome set, and a set of 15,264 13-nucleotide short probes designed to produce genomic fingerprints unique for each organism. The data obtained from each genomic fingerprint were used to obtain hybridization patterns simulating a DNA microarray. Two virtual hybridization methods were used: the Direct and the Extended method to identify the number of potential hybridization sites and thus determine the minimum sensitivity value to discriminate between genomes with 99.9% similarity. Genomic fingerprints were compared using both methods and phylogenomic trees were constructed to verify that the minimum detection value is 0.000017. Results obtained from the genomic fingerprints suggest that the distribution in the trees is correct, as compared to other taxonomic methods. Specific virtual hybridization sites for each of the genomes studied were also identified.

Towards secondary fingerprint classification

CSIR Research Space (South Africa)

Msiza, IS

2011-07-01

Full Text Available an accuracy figure of 76.8%. This small difference between the two figures is indicative of the validity of the proposed secondary classification module. Keywords?fingerprint core; fingerprint delta; primary classifi- cation; secondary classification I..., namely, the fingerprint core and the fingerprint delta. Forensically, a fingerprint core is defined as the innermost turning point where the fingerprint ridges form a loop, while the fingerprint delta is defined as the point where these ridges form a...

Development and Characterization of Complex DNA Fingerprinting Probes for the Infectious Yeast Candida dubliniensis

Science.gov (United States)

Joly, Sophie; Pujol, Claude; Rysz, Michal; Vargas, Kaaren; Soll, David R.

1999-01-01

Using a strategy to clone large genomic sequences containing repetitive elements from the infectious yeast Candida dubliniensis, the three unrelated sequences Cd1, Cd24, and Cd25, with respective molecular sizes of 15,500, 10,000, and 16,000 bp, were cloned and analyzed for their efficacy as DNA fingerprinting probes. Each generated a complex Southern blot hybridization pattern with endonuclease-digested genomic DNA. Cd1 generated an extremely variable pattern that contained all of the bands of the pattern generated by the repeat element RPS of Candida albicans. We demonstrated that Cd1 does not contain RPS but does contain a repeat element associated with RPS throughout the C. dubliniensis genome. The Cd1 pattern was the least stable over time both in vitro and in vivo and for that reason proved most effective in assessing microevolution. Cd24, which did not exhibit microevolution in vitro, was highly variable in vivo, suggesting in vivo-dependent microevolution. Cd25 was deemed the best probe for broad epidemiological studies, since it was the most stable over time, was the only truly C. dubliniensis-specific probe of the three, generated the most complex pattern, was distributed throughout all C. dubliniensis chromosomes, and separated a worldwide collection of 57 C. dubliniensis isolates into two distinct groups. The presence of a species-specific repetitive element in Cd25 adds weight to the already substantial evidence that C. dubliniensis represents a bona fide species. PMID:10074523

Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions Caracterización molecular del germoplasma de ñame colombiano utilizando "DNA Amplificaron Fingerprinting (DAF" en condiciones radiactivas

Directory of Open Access Journals (Sweden)

Bustamante Silvia L.

2003-12-01

Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

Research on Image Encryption Based on DNA Sequence and Chaos Theory

Science.gov (United States)

Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

2018-04-01

Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

Ridge Distance Estimation in Fingerprint Images: Algorithm and Performance Evaluation

Directory of Open Access Journals (Sweden)

Tian Jie

2004-01-01

Full Text Available It is important to estimate the ridge distance accurately, an intrinsic texture property of a fingerprint image. Up to now, only several articles have touched directly upon ridge distance estimation. Little has been published providing detailed evaluation of methods for ridge distance estimation, in particular, the traditional spectral analysis method applied in the frequency field. In this paper, a novel method on nonoverlap blocks, called the statistical method, is presented to estimate the ridge distance. Direct estimation ratio (DER and estimation accuracy (EA are defined and used as parameters along with time consumption (TC to evaluate performance of these two methods for ridge distance estimation. Based on comparison of performances of these two methods, a third hybrid method is developed to combine the merits of both methods. Experimental results indicate that DER is 44.7%, 63.8%, and 80.6%; EA is 84%, 93%, and 91%; and TC is , , and seconds, with the spectral analysis method, statistical method, and hybrid method, respectively.

Verifying Parentage and Confirming Identity in Blackberry with a Fingerprinting Set

Science.gov (United States)

Parentage and identity confirmation is an important aspect of clonally propagated crops outcrossing. Potential errors resulting misidentification include off-type pollination events, labeling errors, or sports of clones. DNA fingerprinting sets are an excellent solution to quickly identify off-type ...

Imaging the DNA damage response with PET and SPECT

Energy Technology Data Exchange (ETDEWEB)

Knight, James C.; Koustoulidou, Sofia; Cornelissen, Bart [University of Oxford, CR-UK/MRC Oxford Institute for Radiation Oncology, Department of Oncology, Oxford (United Kingdom)

2017-06-15

DNA integrity is constantly challenged by endogenous and exogenous factors that can alter the DNA sequence, leading to mutagenesis, aberrant transcriptional activity, and cytotoxicity. Left unrepaired, damaged DNA can ultimately lead to the development of cancer. To overcome this threat, a series of complex mechanisms collectively known as the DNA damage response (DDR) are able to detect the various types of DNA damage that can occur and stimulate the appropriate repair process. Each DNA damage repair pathway leads to the recruitment, upregulation, or activation of specific proteins within the nucleus, which, in some cases, can represent attractive targets for molecular imaging. Given the well-established involvement of DDR during tumorigenesis and cancer therapy, the ability to monitor these repair processes non-invasively using nuclear imaging techniques may facilitate the earlier detection of cancer and may also assist in monitoring response to DNA damaging treatment. This review article aims to provide an overview of recent efforts to develop PET and SPECT radiotracers for imaging of DNA damage repair proteins. (orig.)

DNA Methylation Alterations in Breast Cancer

National Research Council Canada - National Science Library

Yamamoto, Fumiichiro

2002-01-01

We have performed the NotI-MseI MS-AFLP experiments using normal and tumor DNA from breast cancer patients and determined the identity of bands exhibiting consistent changes in breast cancer DNA fingerprint...

Genetic relationships among wild and cultivated accessions of curry leaf plant (Murraya koenigii (L.) Spreng.), as revealed by DNA fingerprinting methods.

Science.gov (United States)

Verma, Sushma; Rana, T S

2013-02-01

Murraya koenigii (L.) Spreng. (Rutaceae), is an aromatic plant and much valued for its flavor, nutritive and medicinal properties. In this study, three DNA fingerprinting methods viz., random amplification of polymorphic DNA (RAPD), directed amplification of minisatellite DNA (DAMD), and inter-simple sequence repeat (ISSR), were used to unravel the genetic variability and relationships across 92 wild and cultivated M. koenigii accessions. A total of 310, 102, and 184, DNA fragments were amplified using 20 RAPD, 5 DAMD, and 13 ISSR primers, revealing 95.80, 96.07, and 96.73% polymorphism, respectively, across all accessions. The average polymorphic information content value obtained with RAPD, DAMD, and ISSR markers was 0.244, 0.250, and 0.281, respectively. The UPGMA tree, based on Jaccard's similarity coefficient generated from the cumulative (RAPD, DAMD, and ISSR) band data showed two distinct clusters, clearly separating wild and cultivated accessions in the dendrogram. Percentage polymorphism, gene diversity (H), and Shannon information index (I) estimates were higher in cultivated accessions compared to wild accessions. The overall high level of polymorphism and varied range of genetic distances revealed a wide genetic base in M. koenigii accessions. The study suggests that RAPD, DAMD, and ISSR markers are highly useful to unravel the genetic variability in wild and cultivated accessions of M. koenigii.

Fingerprint detection and using intercalated CdSe nanoparticles on non-porous surfaces

Energy Technology Data Exchange (ETDEWEB)

Algarra, Manuel, E-mail: malgarra67@gmail.com [Centro de Geología da Universidade do Porto, Departamento de Geociências, Ambiente e Ordenamemto do Territorio do Porto, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Radotić, Ksenija; Kalauzi, Aleksandar; Mutavdžić, Dragosav; Savić, Aleksandar [Institute for Multidisciplinary Research, University of Belgrade, Kneza Višeslava 1, 11000 Beograd (Serbia); Jiménez-Jiménez, José; Rodríguez-Castellón, Enrique [Departamento de Química Inorgánica, Facultad de Ciencias, Universidad de Málaga, Campus de Teatinos s/n, 29071Málaga (Spain); Silva, Joaquim C.G. Esteves da [Centro de Investigação em Química (CIQ-UP). Faculdade de Ciências da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Guerrero-González, Juan José [Policía Científica, Cuerpo Nacional de Policía, Málaga (Spain)

2014-02-17

Graphical abstract: -- Highlights: •Fluorescent nanocomposite based on the inclusion of CdSe quantum dots in porous phosphate heterostructures. •Characterized by FTIR, XRD and fluorescence spectroscopies. •Deconvolution of the emission spectra was confirmed by using multivariate curve resolution (MCR) method. •Application for fingerprint detection and analysis on different non-porous surfaces. -- Abstract: A fluorescent nanocomposite based on the inclusion of CdSe quantum dots in porous phosphate heterostructures, functionalized with amino groups (PPH-NH{sub 2}@CdSe), was synthesized, characterized and used for fingerprint detection. The main scopes of this work were first to develop a friendly chemical powder for detecting latent fingerprints, especially in non-porous surfaces; their further intercalation in PPH structure enables not to spread the fluorescent nanoparticles, for that reason very good fluorescent images can be obtained. The fingerprints, obtained on different non-porous surfaces such as iron tweezers, mobile telephone screen and magnetic band of a credit card, treated with this powder emit a pale orange luminescence under ultraviolet excitation. A further image processing consists of contrast enhancement that allows obtaining positive matches according to the information supplied from a police database, and showed to be more effective than that obtained with the non-processed images. Experimental results illustrate the effectiveness of proposed methods.

Fingerprint detection and using intercalated CdSe nanoparticles on non-porous surfaces

International Nuclear Information System (INIS)

Algarra, Manuel; Radotić, Ksenija; Kalauzi, Aleksandar; Mutavdžić, Dragosav; Savić, Aleksandar; Jiménez-Jiménez, José; Rodríguez-Castellón, Enrique; Silva, Joaquim C.G. Esteves da; Guerrero-González, Juan José

2014-01-01

Graphical abstract: -- Highlights: •Fluorescent nanocomposite based on the inclusion of CdSe quantum dots in porous phosphate heterostructures. •Characterized by FTIR, XRD and fluorescence spectroscopies. •Deconvolution of the emission spectra was confirmed by using multivariate curve resolution (MCR) method. •Application for fingerprint detection and analysis on different non-porous surfaces. -- Abstract: A fluorescent nanocomposite based on the inclusion of CdSe quantum dots in porous phosphate heterostructures, functionalized with amino groups (PPH-NH 2 @CdSe), was synthesized, characterized and used for fingerprint detection. The main scopes of this work were first to develop a friendly chemical powder for detecting latent fingerprints, especially in non-porous surfaces; their further intercalation in PPH structure enables not to spread the fluorescent nanoparticles, for that reason very good fluorescent images can be obtained. The fingerprints, obtained on different non-porous surfaces such as iron tweezers, mobile telephone screen and magnetic band of a credit card, treated with this powder emit a pale orange luminescence under ultraviolet excitation. A further image processing consists of contrast enhancement that allows obtaining positive matches according to the information supplied from a police database, and showed to be more effective than that obtained with the non-processed images. Experimental results illustrate the effectiveness of proposed methods

A Framework for Reproducible Latent Fingerprint Enhancements.

Science.gov (United States)

Carasso, Alfred S

2014-01-01

Photoshop processing of latent fingerprints is the preferred methodology among law enforcement forensic experts, but that appproach is not fully reproducible and may lead to questionable enhancements. Alternative, independent, fully reproducible enhancements, using IDL Histogram Equalization and IDL Adaptive Histogram Equalization, can produce better-defined ridge structures, along with considerable background information. Applying a systematic slow motion smoothing procedure to such IDL enhancements, based on the rapid FFT solution of a Lévy stable fractional diffusion equation, can attenuate background detail while preserving ridge information. The resulting smoothed latent print enhancements are comparable to, but distinct from, forensic Photoshop images suitable for input into automated fingerprint identification systems, (AFIS). In addition, this progressive smoothing procedure can be reexamined by displaying the suite of progressively smoother IDL images. That suite can be stored, providing an audit trail that allows monitoring for possible loss of useful information, in transit to the user-selected optimal image. Such independent and fully reproducible enhancements provide a valuable frame of reference that may be helpful in informing, complementing, and possibly validating the forensic Photoshop methodology.

Touchless fingerprint biometrics

CERN Document Server

Labati, Ruggero Donida; Scotti, Fabio

2015-01-01

Offering the first comprehensive analysis of touchless fingerprint-recognition technologies, Touchless Fingerprint Biometrics gives an overview of the state of the art and describes relevant industrial applications. It also presents new techniques to efficiently and effectively implement advanced solutions based on touchless fingerprinting.The most accurate current biometric technologies in touch-based fingerprint-recognition systems require a relatively high level of user cooperation to acquire samples of the concerned biometric trait. With the potential for reduced constraints, reduced hardw

Implementation of digital image encryption algorithm using logistic function and DNA encoding

Science.gov (United States)

Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

2018-03-01

Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

DNA probe for strain typing of Cryptococcus neoformans.

OpenAIRE

Varma, A; Kwon-Chung, K J

1992-01-01

A 7-kb linear plasmid, harbored by a URA5 transformant, hybridized to all the chromosomes of Cryptococcus neoformans separated by contour-clamped homogeneous electric field electrophoresis. Its linear maintenance was determined to have been facilitated by the presence of telomere-like sequences at its free ends. Hybridization of this plasmid to AccI-digested genomic DNAs of 26 C. neoformans strains generated 21 unique DNA fingerprints. The DNA fingerprints of isolates within the same serotype...

Transparent Fingerprint Sensor System for Large Flat Panel Display.

Science.gov (United States)

Seo, Wonkuk; Pi, Jae-Eun; Cho, Sung Haeung; Kang, Seung-Youl; Ahn, Seong-Deok; Hwang, Chi-Sun; Jeon, Ho-Sik; Kim, Jong-Uk; Lee, Myunghee

2018-01-19

In this paper, we introduce a transparent fingerprint sensing system using a thin film transistor (TFT) sensor panel, based on a self-capacitive sensing scheme. An armorphousindium gallium zinc oxide (a-IGZO) TFT sensor array and associated custom Read-Out IC (ROIC) are implemented for the system. The sensor panel has a 200 × 200 pixel array and each pixel size is as small as 50 μm × 50 μm. The ROIC uses only eight analog front-end (AFE) amplifier stages along with a successive approximation analog-to-digital converter (SAR ADC). To get the fingerprint image data from the sensor array, the ROIC senses a capacitance, which is formed by a cover glass material between a human finger and an electrode of each pixel of the sensor array. Three methods are reviewed for estimating the self-capacitance. The measurement result demonstrates that the transparent fingerprint sensor system has an ability to differentiate a human finger's ridges and valleys through the fingerprint sensor array.

Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

Directory of Open Access Journals (Sweden)

Giuseppe Concheri

Full Text Available BACKGROUND: The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. METHODOLOGY/PRINCIPAL FINDINGS: The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS and optical emission spectrometry (ICP-OES approaches, and b amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA. CONCLUSIONS: Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

Verifying the geographic origin of mahogany (Swietenia macrophylla King) with DNA-fingerprints.

Science.gov (United States)

Degen, B; Ward, S E; Lemes, M R; Navarro, C; Cavers, S; Sebbenn, A M

2013-01-01

Illegal logging is one of the main causes of ongoing worldwide deforestation and needs to be eradicated. The trade in illegal timber and wood products creates market disadvantages for products from sustainable forestry. Although various measures have been established to counter illegal logging and the subsequent trade, there is a lack of practical mechanisms for identifying the origin of timber and wood products. In this study, six nuclear microsatellites were used to generate DNA fingerprints for a genetic reference database characterising the populations of origin of a large set of mahogany (Swietenia macrophylla King, Meliaceae) samples. For the database, leaves and/or cambium from 1971 mahogany trees sampled in 31 stands from Mexico to Bolivia were genotyped. A total of 145 different alleles were found, showing strong genetic differentiation (δ(Gregorious)=0.52, F(ST)=0.18, G(ST(Hedrick))=0.65) and clear correlation between genetic and spatial distances among stands (r=0.82, P<0.05). We used the genetic reference database and Bayesian assignment testing to determine the geographic origins of two sets of mahogany wood samples, based on their multilocus genotypes. In both cases the wood samples were assigned to the correct country of origin. We discuss the overall applicability of this methodology to tropical timber trading. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Laser speckle decorrelation for fingerprint acquisition

International Nuclear Information System (INIS)

Schirripa Spagnolo, Giuseppe; Cozzella, Lorenzo

2012-01-01

Biometry is gaining popularity as a physical security approach in situations where a high level of security is necessary. Currently, biometric solutions are embedded in a very large and heterogeneous group of applications. One of the most sensible is for airport security access to boarding gates. More airports are introducing biometric solutions based on face, fingerprint or iris recognition for passenger identification. In particular, fingerprints are the most widely used biometric, and they are mandatorily included in electronic identification documents. One important issue, which is difficult to address in traditional fingerprint acquisition systems, is preventing contact between subsequent users; sebum, which can be a potential vector for contagious diseases. Currently, non-contact devices are used to overcome this problem. In this paper, a new contact device based on laser speckle decorrelation is presented. Our system has the advantage of being compact and low-cost compared with an actual contactless system, allowing enhancement of the sebum pattern imaging contrast in a simple and low-cost way. Furthermore, it avoids the spreading of contagious diseases. (paper)

In vivo metabolic fingerprinting of neutral lipids with hyperspectral stimulated Raman scattering microscopy.

Science.gov (United States)

Fu, Dan; Yu, Yong; Folick, Andrew; Currie, Erin; Farese, Robert V; Tsai, Tsung-Huang; Xie, Xiaoliang Sunney; Wang, Meng C

2014-06-18

Metabolic fingerprinting provides valuable information on the physiopathological states of cells and tissues. Traditional imaging mass spectrometry and magnetic resonance imaging are unable to probe the spatial-temporal dynamics of metabolites at the subcellular level due to either lack of spatial resolution or inability to perform live cell imaging. Here we report a complementary metabolic imaging technique that is based on hyperspectral stimulated Raman scattering (hsSRS). We demonstrated the use of hsSRS imaging in quantifying two major neutral lipids: cholesteryl ester and triacylglycerol in cells and tissues. Our imaging results revealed previously unknown changes of lipid composition associated with obesity and steatohepatitis. We further used stable-isotope labeling to trace the metabolic dynamics of fatty acids in live cells and live Caenorhabditis elegans with hsSRS imaging. We found that unsaturated fatty acid has preferential uptake into lipid storage while saturated fatty acid exhibits toxicity in hepatic cells. Simultaneous metabolic fingerprinting of deuterium-labeled saturated and unsaturated fatty acids in living C. elegans revealed that there is a lack of interaction between the two, unlike previously hypothesized. Our findings provide new approaches for metabolic tracing of neutral lipids and their precursors in living cells and organisms, and could potentially serve as a general approach for metabolic fingerprinting of other metabolites.

Comparison of chickpea rhizobia isolates from diverse Portuguese natural populations based on symbiotic effectiveness and DNA fingerprint.

Science.gov (United States)

Laranjo, M; Branco, C; Soares, R; Alho, L; Carvalho, M D E; Oliveira, S

2002-01-01

To test the hypothesis that differences in chickpea yields obtained in four distinct Portuguese regions (Beja, Elvas-Casas Velhas, Elvas-Estação Nacional de Melhoramento de Plantas (ENMP) and Evora) could be due to variation between the natural rhizobia populations. Estimation of the size of the different rhizobial populations showed that Elvas-ENMP population was the largest one. Elvas-ENMP population also revealed a higher proportion of isolates carrying more than one plasmid. Assessment of genetic diversity of the native rhizobia populations by a DNA fingerprinting PCR method, here designated as DAPD (Direct Amplified Polymorphic DNA), showed a higher degree of variation in Elvas-ENMP and Beja populations. The symbiotic effectiveness (SE) of 39 isolates was determined and ranged 13-34%. Statistical analysis showed that SE was negatively correlated with plasmid number of the isolate. The largest indigenous rhizobia population was found in Elvas-ENMP. DAPD pattern and plasmid profile analysis both suggested a higher genetic diversity among the populations of Elvas-ENMP and Beja. No relationship was found between SE of the isolates and their origin site. The large native population, rather than the symbiotic performance of individual rhizobia, could contribute to the higher chickpea yields obtained in Elvas-ENMP.

iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

Science.gov (United States)

Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

2010-11-01

Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

Physics and fingerprints

Science.gov (United States)

Voss-de Haan, Patrick

2006-08-01

This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

High Resolution Ultrasonic Method for 3D Fingerprint Recognizable Characteristics in Biometrics Identification

Science.gov (United States)

Maev, R. Gr.; Bakulin, E. Yu.; Maeva, A.; Severin, F.

Biometrics is a rapidly evolving scientific and applied discipline that studies possible ways of personal identification by means of unique biological characteristics. Such identification is important in various situations requiring restricted access to certain areas, information and personal data and for cases of medical emergencies. A number of automated biometric techniques have been developed, including fingerprint, hand shape, eye and facial recognition, thermographic imaging, etc. All these techniques differ in the recognizable parameters, usability, accuracy and cost. Among these, fingerprint recognition stands alone since a very large database of fingerprints has already been acquired. Also, fingerprints are key evidence left at a crime scene and can be used to indentify suspects. Therefore, of all automated biometric techniques, especially in the field of law enforcement, fingerprint identification seems to be the most promising. We introduce a newer development of the ultrasonic fingerprint imaging. The proposed method obtains a scan only once and then varies the C-scan gate position and width to visualize acoustic reflections from any appropriate depth inside the skin. Also, B-scans and A-scans can be recreated from any position using such data array, which gives the control over the visualization options. By setting the C-scan gate deeper inside the skin, distribution of the sweat pores (which are located along the ridges) can be easily visualized. This distribution should be unique for each individual so this provides a means of personal identification, which is not affected by any changes (accidental or intentional) of the fingers' surface conditions. This paper discusses different setups, acoustic parameters of the system, signal and image processing options and possible ways of 3-dimentional visualization that could be used as a recognizable characteristic in biometric identification.

Single DNA imaging and length quantification through a mobile phone microscope

Science.gov (United States)

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2016-03-01

The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

Extracting valley-ridge lines from point-cloud-based 3D fingerprint models.

Science.gov (United States)

Pang, Xufang; Song, Zhan; Xie, Wuyuan

2013-01-01

3D fingerprinting is an emerging technology with the distinct advantage of touchless operation. More important, 3D fingerprint models contain more biometric information than traditional 2D fingerprint images. However, current approaches to fingerprint feature detection usually must transform the 3D models to a 2D space through unwrapping or other methods, which might introduce distortions. A new approach directly extracts valley-ridge features from point-cloud-based 3D fingerprint models. It first applies the moving least-squares method to fit a local paraboloid surface and represent the local point cloud area. It then computes the local surface's curvatures and curvature tensors to facilitate detection of the potential valley and ridge points. The approach projects those points to the most likely valley-ridge lines, using statistical means such as covariance analysis and cross correlation. To finally extract the valley-ridge lines, it grows the polylines that approximate the projected feature points and removes the perturbations between the sampled points. Experiments with different 3D fingerprint models demonstrate this approach's feasibility and performance.

Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

NARCIS (Netherlands)

Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

Image Quality Assessment for Fake Biometric Detection: Application to Iris, Fingerprint, and Face Recognition.

Science.gov (United States)

Galbally, Javier; Marcel, Sébastien; Fierrez, Julian

2014-02-01

To ensure the actual presence of a real legitimate trait in contrast to a fake self-manufactured synthetic or reconstructed sample is a significant problem in biometric authentication, which requires the development of new and efficient protection measures. In this paper, we present a novel software-based fake detection method that can be used in multiple biometric systems to detect different types of fraudulent access attempts. The objective of the proposed system is to enhance the security of biometric recognition frameworks, by adding liveness assessment in a fast, user-friendly, and non-intrusive manner, through the use of image quality assessment. The proposed approach presents a very low degree of complexity, which makes it suitable for real-time applications, using 25 general image quality features extracted from one image (i.e., the same acquired for authentication purposes) to distinguish between legitimate and impostor samples. The experimental results, obtained on publicly available data sets of fingerprint, iris, and 2D face, show that the proposed method is highly competitive compared with other state-of-the-art approaches and that the analysis of the general image quality of real biometric samples reveals highly valuable information that may be very efficiently used to discriminate them from fake traits.

Fingerprints in cancer cells

International Nuclear Information System (INIS)

Servomaa, K.

1994-01-01

Gene research has shown that factors causing cancer, or carcinogens, may leave marks typical of each particular carcinogen (fingerprints) in the genotype of the cell. Radiation, for instance, may leave such fingerprints in a cancer cell. In particular, the discovery of a gene called p53 has yielded much new information on fingerprints. It has been discovered, for example, that toxic fungus and UV-radiation each leave fingerprints in the p53 gene. Based on the detection of fingerprints, it may be possible in the future to tell a cancer patient what factor had trigged the maglinancy

A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

Science.gov (United States)

Yamamoto, F; Yamamoto, M

2004-07-01

We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

Transparent Fingerprint Sensor System for Large Flat Panel Display

Directory of Open Access Journals (Sweden)

Wonkuk Seo

2018-01-01

Full Text Available In this paper, we introduce a transparent fingerprint sensing system using a thin film transistor (TFT sensor panel, based on a self-capacitive sensing scheme. An armorphousindium gallium zinc oxide (a-IGZO TFT sensor array and associated custom Read-Out IC (ROIC are implemented for the system. The sensor panel has a 200 × 200 pixel array and each pixel size is as small as 50 μm × 50 μm. The ROIC uses only eight analog front-end (AFE amplifier stages along with a successive approximation analog-to-digital converter (SAR ADC. To get the fingerprint image data from the sensor array, the ROIC senses a capacitance, which is formed by a cover glass material between a human finger and an electrode of each pixel of the sensor array. Three methods are reviewed for estimating the self-capacitance. The measurement result demonstrates that the transparent fingerprint sensor system has an ability to differentiate a human finger’s ridges and valleys through the fingerprint sensor array.

DNA fingerprinting sets for four southern pines

Science.gov (United States)

Craig Echt; Sedley Josserand

2018-01-01

DNA markers can provide valuable genetic information for forest tree research, breeding, conservation, and restoration programs. When properly evaluated, selected sets of DNA markers can be used to efficiently get information about genetic diversity in regions, forests, or stands, or in seed lots and orchards. Selected markers also can be used to determine parentage or...

Clonality Analysis of Helicobacter pylori in Patients Isolated from Several Biopsy Specimens and Gastric Juice in a Japanese Urban Population by Random Amplified Polymorphic DNA Fingerprinting

Directory of Open Access Journals (Sweden)

Nariaki Toita

2013-01-01

Full Text Available Background. The number of Helicobacter pylori clones infecting a single host has been discussed in numerous reports. The number has been suggested to vary depending on the regions in the world. Aim. The purpose of this study was to examine the number of clones infecting a single host in a Japanese urban population. Materials and Methods. Thirty-one Japanese patients undergoing upper gastrointestinal endoscopy were enrolled in this study. H. pylori isolates (total 104 strains were obtained from biopsy specimens (antrum, corpus, and duodenum and gastric juice. Clonal diversity was examined by the random amplified polymorphic DNA (RAPD fingerprinting method. Results. The RAPD fingerprinting patterns of isolates from each patient were identical or very similar. And the isolates obtained from several patients with 5- to 9-year intervals showed identical or very similar RAPD patterns. Conclusion. Each Japanese individual of an urban population is predominantly infected with a single H. pylori clone.

Wine fingerprinting using a bio-geochemical approach

Directory of Open Access Journals (Sweden)

Fernandes José Ramiro

2015-01-01

Full Text Available The wine sector is a billion euro business and therefore subjected to multiple attempts of fraudulent practices. This requires the development of rapid and reliable methods to detect such situations. Several methodologies have been developed based on the chemical profiles of the wines, but they are limited due to the environmental conditions that cannot be controlled. The use of DNA-based detection systems are an emergent research field that have been extended to a wide variety of food prod- ucts and are still the most reliable methods for varietal identification. However these methods are not suitable for geographical determination. Soil related fingerprints have a primary role considering that there is a relationship between the elemental compo- sition of wine and the composition of the provenance soil. WineBioCode is a project aiming to define the best strategy for wine authenticity based on a multidisciplinary approach. Two DNA-based strategies have been developed based on Real-time PCR and a label free optical biosensor platform. Both platforms enabled successful identification of specific DNA-targets when applied to Vitis vinifera L., and can be applied throughout the grape-wine chain. The methods are complementary and can be used in dif- ferent situations, according to the requirements. The geographical evaluation has been assessed by the strontium 87Sr/86Sr isotope ratio determination involving soil evaluation in the vineyards followed by its assay in the wine samples. The results are being integrated in order to establish the best procedure to be undertaken for wine fingerprinting, including varietal composition and geographical origin, therefore fulfilling the requirements of the geographical denominations in wine certification.

Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

Science.gov (United States)

Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

2009-05-01

Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

Directory of Open Access Journals (Sweden)

KUSUMADEWI SRI YULITA

2011-07-01

Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.

Science.gov (United States)

Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

2010-12-01

Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin.

FINGERPRINT VERIFICATION IN PERSONAL IDENTIFICATION BY APPLYING LOCAL WALSH HADAMARD TRANSFORM AND GABOR COEFFICIENTS

Directory of Open Access Journals (Sweden)

K N Pushpalatha

2017-05-01

Full Text Available In an era of advanced computer technology world where innumerable services such as access to bank accounts, or access to secured data or entry to some national important organizations require authentication of genuine individual. Among all biometric personal identification systems, fingerprint recognition system is most accurate and economical technology. In this paper we have proposed fingerprint recognition system using Local Walsh Hadamard Transform (LWHT with Phase Magnitude Histograms (PMHs for feature extraction. Fingerprints display oriented texture-like patterns. Gabor filters have the property of capturing global and local texture information from blur or unclear images and filter bank provides the orientation features which are robust to image distortion and rotation. The LWHT algorithm is compared with other two approaches viz., Gabor Coefficients and Directional Features. The three methods are compared using FVC 2006 Finger print database images. It is found from the observation that the values of TSR, FAR and FRR have improved results compared to existing algorithm.

Characterization of rat lines with normotensive and hypertensive status using genomic fingerprinting

NARCIS (Netherlands)

Adarichev, V A; Korokhov, N P; Ostapchuk, Ia V; Dymshits, G M; Markel', A L; Ostaptchouk, Jana

1996-01-01

The properties of normotensive and hypertensive rat lines were investigated by the DNA fingerprinting method using a multilocus micro-satellite (CAC)5 probe. The HaeIII and HinfI restriction endonucleases were found to be the most informative enzymes in this case. The high genetic homogeneity of the

Nanotag luminescent fingerprint anti-counterfeiting technology

DEFF Research Database (Denmark)

Radziwon, Michal Jędrzej; Rubahn, Horst-Günter; Johansen, Stefan

2012-01-01

We describe a method to fabricate, transfer and validate via image processing nanofibre- based, unique security marks (“nanotags”) for anti-counterfeiting purposes. Epitaxial surface growth of oligophenylenes on a heated muscovite mica crystal results in a thin film of mutually aligned nanofibres....... This fingerprint can be transferred on an adhesive tape as a label of a product, imaged using low magnification microscopy, digitalised and stored in a database. Infrared surface heating, enforced cooling and load lock transfer makes the fabrication process fast and scalable to mass production....

A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

Directory of Open Access Journals (Sweden)

Chunyan Song

2015-10-01

Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

SU-E-I-74: Image-Matching Technique of Computed Tomography Images for Personal Identification: A Preliminary Study Using Anthropomorphic Chest Phantoms

Energy Technology Data Exchange (ETDEWEB)

Matsunobu, Y; Shiotsuki, K [Department of Health Sciences, Graduate School of Medical Sciences, Kyushu University, Fukuoka (Japan); Morishita, J [Department of Health Sciences, Faculty of Medical Sciences, Kyushu University, Fukuoka, JP (Japan)

2015-06-15

Purpose: Fingerprints, dental impressions, and DNA are used to identify unidentified bodies in forensic medicine. Cranial Computed tomography (CT) images and/or dental radiographs are also used for identification. Radiological identification is important, particularly in the absence of comparative fingerprints, dental impressions, and DNA samples. The development of an automated radiological identification system for unidentified bodies is desirable. We investigated the potential usefulness of bone structure for matching chest CT images. Methods: CT images of three anthropomorphic chest phantoms were obtained on different days in various settings. One of the phantoms was assumed to be an unidentified body. The bone image and the bone image with soft tissue (BST image) were extracted from the CT images. To examine the usefulness of the bone image and/or the BST image, the similarities between the two-dimensional (2D) or threedimensional (3D) images of the same and different phantoms were evaluated in terms of the normalized cross-correlation value (NCC). Results: For the 2D and 3D BST images, the NCCs obtained from the same phantom assumed to be an unidentified body (2D, 0.99; 3D, 0.93) were higher than those for the different phantoms (2D, 0.95 and 0.91; 3D, 0.89 and 0.80). The NCCs for the same phantom (2D, 0.95; 3D, 0.88) were greater compared to those of the different phantoms (2D, 0.61 and 0.25; 3D, 0.23 and 0.10) for the bone image. The difference in the NCCs between the same and different phantoms tended to be larger for the bone images than for the BST images. These findings suggest that the image-matching technique is more useful when utilizing the bone image than when utilizing the BST image to identify different people. Conclusion: This preliminary study indicated that evaluating the similarity of bone structure in 2D and 3D images is potentially useful for identifying of an unidentified body.

SU-E-I-74: Image-Matching Technique of Computed Tomography Images for Personal Identification: A Preliminary Study Using Anthropomorphic Chest Phantoms

International Nuclear Information System (INIS)

Matsunobu, Y; Shiotsuki, K; Morishita, J

2015-01-01

Purpose: Fingerprints, dental impressions, and DNA are used to identify unidentified bodies in forensic medicine. Cranial Computed tomography (CT) images and/or dental radiographs are also used for identification. Radiological identification is important, particularly in the absence of comparative fingerprints, dental impressions, and DNA samples. The development of an automated radiological identification system for unidentified bodies is desirable. We investigated the potential usefulness of bone structure for matching chest CT images. Methods: CT images of three anthropomorphic chest phantoms were obtained on different days in various settings. One of the phantoms was assumed to be an unidentified body. The bone image and the bone image with soft tissue (BST image) were extracted from the CT images. To examine the usefulness of the bone image and/or the BST image, the similarities between the two-dimensional (2D) or threedimensional (3D) images of the same and different phantoms were evaluated in terms of the normalized cross-correlation value (NCC). Results: For the 2D and 3D BST images, the NCCs obtained from the same phantom assumed to be an unidentified body (2D, 0.99; 3D, 0.93) were higher than those for the different phantoms (2D, 0.95 and 0.91; 3D, 0.89 and 0.80). The NCCs for the same phantom (2D, 0.95; 3D, 0.88) were greater compared to those of the different phantoms (2D, 0.61 and 0.25; 3D, 0.23 and 0.10) for the bone image. The difference in the NCCs between the same and different phantoms tended to be larger for the bone images than for the BST images. These findings suggest that the image-matching technique is more useful when utilizing the bone image than when utilizing the BST image to identify different people. Conclusion: This preliminary study indicated that evaluating the similarity of bone structure in 2D and 3D images is potentially useful for identifying of an unidentified body

High performance gel imaging with a commercial single lens reflex camera

Science.gov (United States)

Slobodan, J.; Corbett, R.; Wye, N.; Schein, J. E.; Marra, M. A.; Coope, R. J. N.

2011-03-01

A high performance gel imaging system was constructed using a digital single lens reflex camera with epi-illumination to image 19 × 23 cm agarose gels with up to 10,000 DNA bands each. It was found to give equivalent performance to a laser scanner in this high throughput DNA fingerprinting application using the fluorophore SYBR Green®. The specificity and sensitivity of the imager and scanner were within 1% using the same band identification software. Low and high cost color filters were also compared and it was found that with care, good results could be obtained with inexpensive dyed acrylic filters in combination with more costly dielectric interference filters, but that very poor combinations were also possible. Methods for determining resolution, dynamic range, and optical efficiency for imagers are also proposed to facilitate comparison between systems.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Electrostatic force microscopy: imaging DNA and protein polarizations one by one

International Nuclear Information System (INIS)

Mikamo-Satoh, Eriko; Yamada, Fumihiko; Takagi, Akihiko; Matsumoto, Takuya; Kawai, Tomoji

2009-01-01

We present electrostatic force microscopy images of double-stranded DNA and transcription complex on an insulating mica substrate obtained with molecular resolution using a frequency-mode noncontact atomic force microscope. The electrostatic potential images show that both DNA and transcription complexes are polarized with an upward dipole moment. Potential differences of these molecules from the mica substrate enabled us to estimate dipole moments of isolated DNA and transcription complex in zero external field to be 0.027 D/base and 0.16 D/molecule, respectively. Scanning capacitance microscopy demonstrates characteristic contrast inversion between DNA and transcription complex images, indicating the difference in electric polarizability of these molecules. These findings indicate that the electrostatic properties of individual biological molecules can be imaged on an insulator substrate while retaining complex formation.

Examining multi-component DNA-templated nanostructures as imaging agents

Science.gov (United States)

Jaganathan, Hamsa

2011-12-01

Magnetic resonance imaging (MRI) is the leading non-invasive tool for disease imaging and diagnosis. Although MRI exhibits high spatial resolution for anatomical features, the contrast resolution is low. Imaging agents serve as an aid to distinguish different types of tissues within images. Gadolinium chelates, which are considered first generation designs, can be toxic to health, while ultra-small, superparamagnetic nanoparticles (NPs) have low tissue-targeting efficiency and rapid bio-distribution, resulting to an inadequate detection of the MRI signal and enhancement of image contrast. In order to improve the utility of MRI agents, the challenge in composition and structure needs to be addressed. One-dimensional (1D), superparamagnetic nanostructures have been reported to enhance magnetic and in vivo properties and therefore has a potential to improve contrast enhancement in MRI images. In this dissertation, the structure of 1D, multi-component NP chains, scaffolded on DNA, were pre-clinically examined as potential MRI agents. First, research was focused on characterizing and understanding the mechanism of proton relaxation for DNA-templated NP chains using nuclear magnetic resonance (NMR) spectrometry. Proton relaxation and transverse relaxivity were higher in multi-component NP chains compared to disperse NPs, indicating the arrangement of NPs on a 1D structure improved proton relaxation sensitivity. Second, in vitro evaluation for potential issues in toxicity and contrast efficiency in tissue environments using a 3 Tesla clinical MRI scanner was performed. Cell uptake of DNA-templated NP chains was enhanced after encapsulating the nanostructure with layers of polyelectrolytes and targeting ligands. Compared to dispersed NPs, DNA-templated NP chains improved MRI contrast in both the epithelial basement membrane and colon cancer tumors scaffolds. The last part of the project was focused on developing a novel MRI agent that detects changes in DNA methylation

Low rank alternating direction method of multipliers reconstruction for MR fingerprinting.

Science.gov (United States)

Assländer, Jakob; Cloos, Martijn A; Knoll, Florian; Sodickson, Daniel K; Hennig, Jürgen; Lattanzi, Riccardo

2018-01-01

The proposed reconstruction framework addresses the reconstruction accuracy, noise propagation and computation time for magnetic resonance fingerprinting. Based on a singular value decomposition of the signal evolution, magnetic resonance fingerprinting is formulated as a low rank (LR) inverse problem in which one image is reconstructed for each singular value under consideration. This LR approximation of the signal evolution reduces the computational burden by reducing the number of Fourier transformations. Also, the LR approximation improves the conditioning of the problem, which is further improved by extending the LR inverse problem to an augmented Lagrangian that is solved by the alternating direction method of multipliers. The root mean square error and the noise propagation are analyzed in simulations. For verification, in vivo examples are provided. The proposed LR alternating direction method of multipliers approach shows a reduced root mean square error compared to the original fingerprinting reconstruction, to a LR approximation alone and to an alternating direction method of multipliers approach without a LR approximation. Incorporating sensitivity encoding allows for further artifact reduction. The proposed reconstruction provides robust convergence, reduced computational burden and improved image quality compared to other magnetic resonance fingerprinting reconstruction approaches evaluated in this study. Magn Reson Med 79:83-96, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

DNA stable-isotope probing (DNA-SIP).

Science.gov (United States)

Dunford, Eric A; Neufeld, Josh D

2010-08-02

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

Capacity and optimal collusion attack channels for Gaussian fingerprinting games

Science.gov (United States)

Wang, Ying; Moulin, Pierre

2007-02-01

In content fingerprinting, the same media covertext - image, video, audio, or text - is distributed to many users. A fingerprint, a mark unique to each user, is embedded into each copy of the distributed covertext. In a collusion attack, two or more users may combine their copies in an attempt to "remove" their fingerprints and forge a pirated copy. To trace the forgery back to members of the coalition, we need fingerprinting codes that can reliably identify the fingerprints of those members. Researchers have been focusing on designing or testing fingerprints for Gaussian host signals and the mean square error (MSE) distortion under some classes of collusion attacks, in terms of the detector's error probability in detecting collusion members. For example, under the assumptions of Gaussian fingerprints and Gaussian attacks (the fingerprinted signals are averaged and then the result is passed through a Gaussian test channel), Moulin and Briassouli1 derived optimal strategies in a game-theoretic framework that uses the detector's error probability as the performance measure for a binary decision problem (whether a user participates in the collusion attack or not); Stone2 and Zhao et al. 3 studied average and other non-linear collusion attacks for Gaussian-like fingerprints; Wang et al. 4 stated that the average collusion attack is the most efficient one for orthogonal fingerprints; Kiyavash and Moulin 5 derived a mathematical proof of the optimality of the average collusion attack under some assumptions. In this paper, we also consider Gaussian cover signals, the MSE distortion, and memoryless collusion attacks. We do not make any assumption about the fingerprinting codes used other than an embedding distortion constraint. Also, our only assumptions about the attack channel are an expected distortion constraint, a memoryless constraint, and a fairness constraint. That is, the colluders are allowed to use any arbitrary nonlinear strategy subject to the above

MR fingerprinting using fast imaging with steady state precession (FISP) with spiral readout.

Science.gov (United States)

Jiang, Yun; Ma, Dan; Seiberlich, Nicole; Gulani, Vikas; Griswold, Mark A

2015-12-01

This study explores the possibility of using gradient echo-based sequences other than balanced steady-state free precession (bSSFP) in the magnetic resonance fingerprinting (MRF) framework to quantify the relaxation parameters . An MRF method based on a fast imaging with steady-state precession (FISP) sequence structure is presented. A dictionary containing possible signal evolutions with physiological range of T1 and T2 was created using the extended phase graph formalism according to the acquisition parameters. The proposed method was evaluated in a phantom and a human brain. T1 , T2 , and proton density were quantified directly from the undersampled data by the pattern recognition algorithm. T1 and T2 values from the phantom demonstrate that the results of MRF FISP are in good agreement with the traditional gold-standard methods. T1 and T2 values in brain are within the range of previously reported values. MRF-FISP enables a fast and accurate quantification of the relaxation parameters. It is immune to the banding artifact of bSSFP due to B0 inhomogeneities, which could improve the ability to use MRF for applications beyond brain imaging. © 2014 Wiley Periodicals, Inc.

Development of an efficient retrotransposon-based fingerprinting method for rapid pea variety identification.

Science.gov (United States)

Smýkal, Petr

2006-01-01

Fast and efficient DNA fingerprinting of crop cultivars and individuals is frequently used in both theoretical population genetics and in practical breeding. Numerous DNA marker technologies exist and the ratio of speed, cost and accuracy are of importance. Therefore even in species where highly accurate and polymorphic marker systems are available, such as microsatellite SSR (simple sequence repeats), also alternative methods may be of interest. Thanks to their high abundance and ubiquity, temporary mobile retrotransposable elements come into recent focus. Their properties, such as genome wide distribution and well-defined origin of individual insertions by descent, predetermine them for use as molecular markers. In this study, several Ty3-gypsy type retrotransposons have been developed and adopted for the inter-retrotransposon amplified polymorphism (IRAP) method, which is suitable for fast and efficient pea cultivar fingerprinting. The method can easily distinguish even between genetically closely related pea cultivars and provide high polymorphic information content (PIC) in a single PCR analysis.

Dealing with Insufficient Location Fingerprints in Wi-Fi Based Indoor Location Fingerprinting

Directory of Open Access Journals (Sweden)

Kai Dong

2017-01-01

Full Text Available The development of the Internet of Things has accelerated research in the indoor location fingerprinting technique, which provides value-added localization services for existing WLAN infrastructures without the need for any specialized hardware. The deployment of a fingerprinting based localization system requires an extremely large amount of measurements on received signal strength information to generate a location fingerprint database. Nonetheless, this requirement can rarely be satisfied in most indoor environments. In this paper, we target one but common situation when the collected measurements on received signal strength information are insufficient, and show limitations of existing location fingerprinting methods in dealing with inadequate location fingerprints. We also introduce a novel method to reduce noise in measuring the received signal strength based on the maximum likelihood estimation, and compute locations from inadequate location fingerprints by using the stochastic gradient descent algorithm. Our experiment results show that our proposed method can achieve better localization performance even when only a small quantity of RSS measurements is available. Especially when the number of observations at each location is small, our proposed method has evident superiority in localization accuracy.

Preclinical Magnetic Resonance Fingerprinting (MRF) at 7 T: Effective Quantitative Imaging for Rodent Disease Models

Science.gov (United States)

Gao, Ying; Chen, Yong; Ma, Dan; Jiang, Yun; Herrmann, Kelsey A.; Vincent, Jason A.; Dell, Katherine M.; Drumm, Mitchell L.; Brady-Kalnay, Susann M.; Griswold, Mark A.; Flask, Chris A.; Lu, Lan

2015-01-01

High field, preclinical magnetic resonance imaging (MRI) scanners are now commonly used to quantitatively assess disease status and efficacy of novel therapies in a wide variety of rodent models. Unfortunately, conventional MRI methods are highly susceptible to respiratory and cardiac motion artifacts resulting in potentially inaccurate and misleading data. We have developed an initial preclinical, 7.0 T MRI implementation of the highly novel Magnetic Resonance Fingerprinting (MRF) methodology that has been previously described for clinical imaging applications. The MRF technology combines a priori variation in the MRI acquisition parameters with dictionary-based matching of acquired signal evolution profiles to simultaneously generate quantitative maps of T1 and T2 relaxation times and proton density. This preclinical MRF acquisition was constructed from a Fast Imaging with Steady-state Free Precession (FISP) MRI pulse sequence to acquire 600 MRF images with both evolving T1 and T2 weighting in approximately 30 minutes. This initial high field preclinical MRF investigation demonstrated reproducible and differentiated estimates of in vitro phantoms with different relaxation times. In vivo preclinical MRF results in mouse kidneys and brain tumor models demonstrated an inherent resistance to respiratory motion artifacts as well as sensitivity to known pathology. These results suggest that MRF methodology may offer the opportunity for quantification of numerous MRI parameters for a wide variety of preclinical imaging applications. PMID:25639694

Design And Implementation Of Bank Locker Security System Based On Fingerprint Sensing Circuit And RFID Reader

Directory of Open Access Journals (Sweden)

Khaing Mar Htwe

2015-07-01

Full Text Available Abstract The main goal of this system is to design a locker security system using RFID and Fingerprint. In this system only authenticated person can open the door. A security system is implemented containing door locking system using passive type of RFID which can activate authenticate and validate the user and unlock the door in real time for secure access. The advantage of using passive RFID is that it functions without a battery and passive tags are lighter and are less expensive than the active tags. This system consists of fingerprint reader microcontroller RFID reader and PC. The RFID reader reads the id number from passive. The fingerprint sensor will check incoming image with enrolled data and it will send confirming signal for C program. If both RFID check and fingerprint image confirmation are matched the microcontroller will drive door motor according to sensors at door edges. This system is more secure than other systems because two codes protection method used.

Detection of cores in fingerprints with improved dimension reduction

NARCIS (Netherlands)

Bazen, A.M.; Veldhuis, Raymond N.J.

In this paper, we present a statistical approach to core detection in fingerprint images that is based on the likelihood ratio, using models of variation of core templates and randomly chosen templates. Additionally, we propose an alternative dimension reduction method. Unlike standard linear

DNA Fingerprinting Abnormalities Can Distinguish Ulcerative Colitis Patients with Dysplasia and Cancer from Those Who Are Dysplasia/Cancer-Free

Science.gov (United States)

Chen, Ru; Rabinovitch, Peter S.; Crispin, David A.; Emond, Mary J.; Koprowicz, Kent M.; Bronner, Mary P.; Brentnall, Teresa A.

2003-01-01

Patients with extensive ulcerative colitis (UC) of longer than 8 years duration are at high risk for the development of colorectal cancer. The cancers in these patients appear to develop in a stepwise manner with progressive histological changes from negative for dysplasia → indefinite for dysplasia → dysplasia → cancer. The aim of this study was to determine the timing and extent of genomic instability in the progression of UC dysplasia and cancer. Using two polymerase chain reaction (PCR)-based DNA fingerprinting methods, arbitrarily primed PCR and intersimple sequence repeat PCR, we assessed DNA sequence variation in biopsies across the spectrum of cancerous, dysplastic, and nondysplastic mucosa. UC patients with dysplasia/cancer had substantial genomic instability in both their dysplastic and nondysplastic colonic mucosa, whereas instability was not present in the majority of UC patients without dysplasia/cancer. The degree of instability in nondysplastic tissue was similar to that of dysplastic/cancerous mucosa from the same patient, suggesting that this instability was widespread and reached the maximum level early in neoplastic progression. These results suggest that UC patients who develop dysplasia or cancer have an underlying process of genomic instability in their colonic mucosa whereas UC patients who are dysplasia-free do not. PMID:12547724

DNA fingerprinting for the authentication of Ruta graveolens

African Journals Online (AJOL)

Jane

2011-08-15

Aug 15, 2011 ... In this study, random amplified polymorphic DNA (RAPD) was employed to ... samples using the DNA isolated from the dried leaf, seed and stem of both samples. ..... opposite strands and is complementary to the primer for.

Collusion-resistant audio fingerprinting system in the modulated complex lapped transform domain.

Directory of Open Access Journals (Sweden)

Jose Juan Garcia-Hernandez

Full Text Available Collusion-resistant fingerprinting paradigm seems to be a practical solution to the piracy problem as it allows media owners to detect any unauthorized copy and trace it back to the dishonest users. Despite the billionaire losses in the music industry, most of the collusion-resistant fingerprinting systems are devoted to digital images and very few to audio signals. In this paper, state-of-the-art collusion-resistant fingerprinting ideas are extended to audio signals and the corresponding parameters and operation conditions are proposed. Moreover, in order to carry out fingerprint detection using just a fraction of the pirate audio clip, block-based embedding and its corresponding detector is proposed. Extensive simulations show the robustness of the proposed system against average collusion attack. Moreover, by using an efficient Fast Fourier Transform core and standard computer machines it is shown that the proposed system is suitable for real-world scenarios.

Use of DNA markers in forest tree improvement research

Science.gov (United States)

D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

1992-01-01

DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

Flow cytometric fingerprinting for microbial strain discrimination and physiological characterization.

Science.gov (United States)

Buysschaert, Benjamin; Kerckhof, Frederiek-Maarten; Vandamme, Peter; De Baets, Bernard; Boon, Nico

2018-02-01

The analysis of microbial populations is fundamental, not only for developing a deeper understanding of microbial communities but also for their engineering in biotechnological applications. Many methods have been developed to study their characteristics and over the last few decades, molecular analysis tools, such as DNA sequencing, have been used with considerable success to identify the composition of microbial populations. Recently, flow cytometric fingerprinting is emerging as a promising and powerful method to analyze bacterial populations. So far, these methods have primarily been used to observe shifts in the composition of microbial communities of natural samples. In this article, we apply a flow cytometric fingerprinting method to discriminate among 29 Lactobacillus strains. Our results indicate that it is possible to discriminate among 27 Lactobacillus strains by staining with SYBR green I and that the discriminatory power can be increased by combined SYBR green I and propidium iodide staining. Furthermore, we illustrate the impact of physiological changes on the fingerprinting method by demonstrating how flow cytometric fingerprinting is able to discriminate the different growth phases of a microbial culture. The sensitivity of the method is assessed by its ability to detect changes in the relative abundance of a mix of polystyrene beads down to 1.2%. When a mix of bacteria was used, the sensitivity was as between 1.2% and 5%. The presented data demonstrate that flow cytometric fingerprinting is a sensitive and reproducible technique with the potential to be applied as a method for the dereplication of bacterial isolates. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

Imaging of DNA and Protein by SFM and Combined SFM-TIRF Microscopy.

Science.gov (United States)

Grosbart, Małgorzata; Ristić, Dejan; Sánchez, Humberto; Wyman, Claire

2018-01-01

Direct imaging is invaluable for understanding the mechanism of complex genome transactions where proteins work together to organize, transcribe, replicate and repair DNA. Scanning (or atomic) force microscopy is an ideal tool for this, providing 3D information on molecular structure at nm resolution from defined components. This is a convenient and practical addition to in vitro studies as readily obtainable amounts of purified proteins and DNA are required. The images reveal structural details on the size and location of DNA bound proteins as well as protein-induced arrangement of the DNA, which are directly correlated in the same complexes. In addition, even from static images, the different forms observed and their relative distributions can be used to deduce the variety and stability of different complexes that are necessarily involved in dynamic processes. Recently available instruments that combine fluorescence with topographic imaging allow the identification of specific molecular components in complex assemblies, which broadens the applications and increases the information obtained from direct imaging of molecular complexes. We describe here basic methods for preparing samples of proteins, DNA and complexes of the two for topographic imaging and quantitative analysis. We also describe special considerations for combined fluorescence and topographic imaging of molecular complexes.

Fingerprint separation: an application of ICA

Science.gov (United States)

Singh, Meenakshi; Singh, Deepak Kumar; Kalra, Prem Kumar

2008-04-01

Among all existing biometric techniques, fingerprint-based identification is the oldest method, which has been successfully used in numerous applications. Fingerprint-based identification is the most recognized tool in biometrics because of its reliability and accuracy. Fingerprint identification is done by matching questioned and known friction skin ridge impressions from fingers, palms, and toes to determine if the impressions are from the same finger (or palm, toe, etc.). There are many fingerprint matching algorithms which automate and facilitate the job of fingerprint matching, but for any of these algorithms matching can be difficult if the fingerprints are overlapped or mixed. In this paper, we have proposed a new algorithm for separating overlapped or mixed fingerprints so that the performance of the matching algorithms will improve when they are fed with these inputs. Independent Component Analysis (ICA) has been used as a tool to separate the overlapped or mixed fingerprints.

A new method of artificial latent fingerprint creation using artificial sweat and inkjet printer.

Science.gov (United States)

Hong, Sungwook; Hong, Ingi; Han, Aleum; Seo, Jin Yi; Namgung, Juyoung

2015-12-01

In order to study fingerprinting in the field of forensic science, it is very important to have two or more latent fingerprints with identical chemical composition and intensity. However, it is impossible to obtain identical fingerprints, in reality, because fingerprinting comes out slightly differently every time. A previous research study had proposed an artificial fingerprint creation method in which inkjet ink was replaced with amino acids and sodium chloride solution: the components of human sweat. But, this method had some drawbacks: divalent cations were not added while formulating the artificial sweat solution, and diluted solutions were used for creating weakly deposited latent fingerprint. In this study, a method was developed for overcoming the drawbacks of the methods used in the previous study. Several divalent cations were added in this study because the amino acid-ninhydrin (or some of its analogues) complex is known to react with divalent cations to produce a photoluminescent product; and, similarly, the amino acid-1,2-indanedione complex is known to be catalyzed by a small amount of zinc ions to produce a highly photoluminescent product. Also, in this study, a new technique was developed which enables to adjust the intensity when printing the latent fingerprint patterns. In this method, image processing software is used to control the intensity of the master fingerprint patterns, which adjusts the printing intensity of the latent fingerprints. This new method opened the way to produce a more realistic artificial fingerprint in various strengths with one artificial sweat working solution. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Patent applications for using DNA technologies to authenticate medicinal herbal material

Directory of Open Access Journals (Sweden)

Chan Albert

2009-11-01

Full Text Available Abstract Herbal medicines are used in many countries for maintaining health and treating diseases. Their efficacy depends on the use of the correct materials, and life-threatening poisoning may occur if toxic adulterants or substitutes are administered instead. Identification of a medicinal material at the DNA level provides an objective and powerful tool for quality control. Extraction of high-quality DNA is the first crucial step in DNA authentication, followed by a battery of DNA techniques including whole genome fingerprinting, DNA sequencing and DNA microarray to establish the identity of the material. New or improved technologies have been developed and valuable data have been collected and compiled for DNA authentication. Some of these technologies and data are patentable. This article provides an overview of some recent patents that cover the extraction of DNA from medicinal materials, the amplification of DNA using improved reaction conditions, the generation of DNA sequences and fingerprints, and the development of high-throughput authentication methods. It also briefly explains why these patents have been granted.

Fingerprints in Compressed Strings

DEFF Research Database (Denmark)

Bille, Philip; Cording, Patrick Hagge; Gørtz, Inge Li

2013-01-01

The Karp-Rabin fingerprint of a string is a type of hash value that due to its strong properties has been used in many string algorithms. In this paper we show how to construct a data structure for a string S of size N compressed by a context-free grammar of size n that answers fingerprint queries...... derivative that captures LZ78 compression and its variations) we get O(loglogN) query time. Hence, our data structures has the same time and space complexity as for random access in SLPs. We utilize the fingerprint data structures to solve the longest common extension problem in query time O(logNlogℓ) and O....... That is, given indices i and j, the answer to a query is the fingerprint of the substring S[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(logN) query time, and for Linear SLPs (an SLP...

Study on internal to surface fingerprint correlation using optical coherence tomography and internal fingerprint extraction

CSIR Research Space (South Africa)

Darlow, LN

2015-11-01

Full Text Available of, the above-mentioned works. Internal fingerprint zone detection is an improvement as it uses fuzzy c-means to improve clustering performance, uses better cluster result postprocessing, and improves upon the fine-tuning procedure through... Internal fingerprint extraction consists of two main parts: fingerprint zone detection and extraction. Zone detection uses fuzzy c-means clustering to approximate the location of the papillary junction (i.e., the internal fingerprint zone). Edge detection...

Modeling Audio Fingerprints : Structure, Distortion, Capacity

NARCIS (Netherlands)

Doets, P.J.O.

2010-01-01

An audio fingerprint is a compact low-level representation of a multimedia signal. An audio fingerprint can be used to identify audio files or fragments in a reliable way. The use of audio fingerprints for identification consists of two phases. In the enrollment phase known content is fingerprinted,

The Evidentiary Value of DNA Fingerprint as Criminal Evidence

Directory of Open Access Journals (Sweden)

Mussa Masoud Irhouma

2016-12-01

Full Text Available The subject of criminal evidence is considered to be one of the greatest challenges that face authorities concerned with fighting crime at all levels. Due to this, authorities try to benefit as much as possible from scientific evidence due to the important role it plays in revealing the identity of criminals or victims in present or past criminal cases against unknown people through the physical traces that are found at the scene of an event, which include biological traces. DNA is one of these scientific evidences which can be benefited from in the field of crime investigation. Despite the importance of DNA technology in this area of work, there is still some debate surrounding its acceptance as criminal evidence. Some experts believe it to be of great importance whereas others cast doubt on its evidentiary value. They attribute this to a number of factors including the experts who are entrusted to examine DNA samples, the laboratories in which DNA analysis takes place, as well as the fact that resorting to DNA as a criminal evidence raises some legal complexities related to the permissibility of using it and the conditions and scope of its use. This paper sheds light on DNA and its evidentiary value among the judiciary in criminal cases by answering a number of questions such as the possibility of forcing a person to undergo DNA analysis or not to do so and to what extent it is to be relied upon as criminal evidence. This paper concluded the importance of DNA and its role in the field of criminal evidence. Despite this, even if the DNA evidence is sufficient in proving the innocence of the accused, it is only an indication that must not be solely relied upon and treated as a single conclusive evidence, particularly in cases that involve prescribed Islamic or retributive punishments.

Fingerprint re-alignment: a solution based on the true fingerprint center point

CSIR Research Space (South Africa)

Msiza, IS

2011-02-01

Full Text Available Solution Based on the True Fingerprint Center Point Ishmael S. Msiza, Brain Leke-Betechuoh, and Tendani Malumedzha Biometrics Research Group ? Information Security CSIR, Modelling & Digital Science Unit Pretoria, Republic of South Africa e... with a pattern that belongs to the Tented Arch (TA) fingerprint class. Fingerprints that belong to the TA class have a single core and a single delta, with the core located almost directly above the delta, as depicted in figure 3 (b). Many singular...

Genetic and chemical diversity of high mucilaginous plants of Sida complex by ISSR markers and chemical fingerprinting.

Science.gov (United States)

Thul, Sanjog T; Srivastava, Ankit K; Singh, Subhash C; Shanker, Karuna

2011-09-01

A method was developed based on multiple approaches wherein DNA and chemical analysis was carried out toward differentiation of important species of Sida complex that is being used for commercial preparation. Isolated DNA samples were successfully performed through PCR amplification using ISSR markers and degree of genetic diversity among the different species of Sida is compared with that of chemical diversity. For genetic fingerprint investigation, selected 10 ISSR primers generating reproducible banding patterns were used. Among the total of 63 amplicons, 62 were recorded as polymorphic, genetic similarity index deduced from ISSR profiles ranged from 12 to 51%. Based on similarity index, S. acuta and S. rhombifolia found to be most similar (51%). High number of species-specific bands played pivotal role to delineate species at genetic level. Investigation based on HPTLC fingerprints analysis revealed 23 bands representing to characteristic chemicals and similarity index ranged from 73 to 91%. Prominent distinguishable bands were observed only in S. acuta, while S. cordifolia and S. rhombifolia shared most bands making them difficult to identify on chemical fingerprint basis. This report summarizes the genotypic and chemotypic diversity and the use of profiles for authentication of species of Sida complex.