WorldWideScience

Sample records for dna extraction procedures

  1. Evaluation of the ISO standard 11063 DNA extraction procedure for assessing soil microbial abundance and community structure.

    Directory of Open Access Journals (Sweden)

    Pierre Plassart

    Full Text Available Soil DNA extraction has become a critical step in describing microbial biodiversity. Historically, ascertaining overarching microbial ecological theories has been hindered as independent studies have used numerous custom and commercial DNA extraction procedures. For that reason, a standardized soil DNA extraction method (ISO-11063 was previously published. However, although this ISO method is suited for molecular tools such as quantitative PCR and community fingerprinting techniques, it has only been optimized for examining soil bacteria. Therefore, the aim of this study was to assess an appropriate soil DNA extraction procedure for examining bacterial, archaeal and fungal diversity in soils of contrasting land-use and physico-chemical properties. Three different procedures were tested: the ISO-11063 standard; a custom procedure (GnS-GII; and a modified ISO procedure (ISOm which includes a different mechanical lysis step (a FastPrep ®-24 lysis step instead of the recommended bead-beating. The efficacy of each method was first assessed by estimating microbial biomass through total DNA quantification. Then, the abundances and community structure of bacteria, archaea and fungi were determined using real-time PCR and terminal restriction fragment length polymorphism approaches. Results showed that DNA yield was improved with the GnS-GII and ISOm procedures, and fungal community patterns were found to be strongly dependent on the extraction method. The main methodological factor responsible for differences between extraction procedure efficiencies was found to be the soil homogenization step. For integrative studies which aim to examine bacteria, archaea and fungi simultaneously, the ISOm procedure results in higher DNA recovery and better represents microbial communities.

  2. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples.

    Science.gov (United States)

    Miller, D N; Bryant, J E; Madsen, E L; Ghiorse, W C

    1999-11-01

    We compared and statistically evaluated the effectiveness of nine DNA extraction procedures by using frozen and dried samples of two silt loam soils and a silt loam wetland sediment with different organic matter contents. The effects of different chemical extractants (sodium dodecyl sulfate [SDS], chloroform, phenol, Chelex 100, and guanadinium isothiocyanate), different physical disruption methods (bead mill homogenization and freeze-thaw lysis), and lysozyme digestion were evaluated based on the yield and molecular size of the recovered DNA. Pairwise comparisons of the nine extraction procedures revealed that bead mill homogenization with SDS combined with either chloroform or phenol optimized both the amount of DNA extracted and the molecular size of the DNA (maximum size, 16 to 20 kb). Neither lysozyme digestion before SDS treatment nor guanidine isothiocyanate treatment nor addition of Chelex 100 resin improved the DNA yields. Bead mill homogenization in a lysis mixture containing chloroform, SDS, NaCl, and phosphate-Tris buffer (pH 8) was found to be the best physical lysis technique when DNA yield and cell lysis efficiency were used as criteria. The bead mill homogenization conditions were also optimized for speed and duration with two different homogenizers. Recovery of high-molecular-weight DNA was greatest when we used lower speeds and shorter times (30 to 120 s). We evaluated four different DNA purification methods (silica-based DNA binding, agarose gel electrophoresis, ammonium acetate precipitation, and Sephadex G-200 gel filtration) for DNA recovery and removal of PCR inhibitors from crude extracts. Sephadex G-200 spin column purification was found to be the best method for removing PCR-inhibiting substances while minimizing DNA loss during purification. Our results indicate that for these types of samples, optimum DNA recovery requires brief, low-speed bead mill homogenization in the presence of a phosphate-buffered SDS-chloroform mixture, followed

  3. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  4. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  5. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  6. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  7. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  8. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  9. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  10. Two mini-preparation protocols to DNA extraction from plants with ...

    African Journals Online (AJOL)

    Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

  11. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  12. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  13. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  14. An improved protocol and a new grinding device for extraction of genomic DNA from microorganisms by a two-step extraction procedure.

    Science.gov (United States)

    Zhang, S S; Chen, D; Lu, Q

    2012-05-21

    Current protocols to extract genomic DNA from microorganisms are still laborious, tedious and costly, especially for the species with thick cell walls. In order to improve the effectiveness of extracting DNA from microbial samples, a novel protocol, defined as two-step extraction method, along with an improved tissue-grinding device, was developed. The protocol included two steps, disruption of microbial cells or spores by grinding the sample together with silica sand in a new device and extraction of DNA with an effective buffer containing cell lysis chemicals. The device was prepared by using a commercial electric mini-grinder, adapted with a grinding stone, and a sample cup processed by lathing from a polytetrafluoroethylene rod. We tested the method with vegetative cells of four microbial species and two microbial spores that have thick cell walls and are therefore hard to process; these included Escherichia coli JM109, Bacillus subtilis WB600, Sacchromyces cerevisiae INVSc1, Trichoderma viride AS3.3711, and the spores of S. cerevisiae and T. viride, respectively, representing Gram-positive bacteria, Gram-negative bacteria, yeast, filamentous fungi. We found that this new method and device extracted usable quantities of genomic DNA from the samples. The DNA fragments that were extracted exceeded 23 kb. The target sequences up to about 5 kb were successfully and exclusively amplified by PCR using extracted DNA as the template. In addition, the DNA extraction was finalized within 1.5 h. Thus, we conclude that this two-step extraction method is an effective and improved protocol for extraction of genomic DNA from microbial samples.

  15. Extraction of Chromosomal DNA from Schizosaccharomyces pombe.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-05-02

    Extraction of DNA from Schizosaccharomyces pombe cells is required for various uses, including templating polymerase chain reactions (PCRs), Southern blotting, library construction, and high-throughput sequencing. To purify high-quality DNA, the cell wall is removed by digestion with Zymolyase or Lyticase and the resulting spheroplasts lysed using sodium dodecyl sulfate (SDS). Cell debris, SDS, and SDS-protein complexes are subsequently precipitated by the addition of potassium acetate and removed by centrifugation. Finally, DNA is precipitated using isopropanol. At this stage, purity is usually sufficient for PCR. However, for more sensitive procedures, such as restriction enzyme digestion, additional purification steps, including proteinase K digestion and phenol-chloroform extraction, are recommended. All of these steps are described in detail here. © 2016 Cold Spring Harbor Laboratory Press.

  16. Modifying and adapting a plant-based DNA extraction protocol for ...

    African Journals Online (AJOL)

    ... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.

  17. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  18. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  19. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

  20. Impact of two different commercial DNA extraction methods on BK virus viral load

    Directory of Open Access Journals (Sweden)

    Massimiliano Bergallo

    2016-03-01

    Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

  1. A simple procedure for the extraction of DNA from long-term formalin-preserved brain tissues for the detection of EBV by PCR.

    Science.gov (United States)

    Hassani, Asma; Khan, Gulfaraz

    2015-12-01

    Long-term formalin fixed brain tissues are potentially an important source of material for molecular studies. Ironically, very few protocols have been published describing DNA extraction from such material for use in PCR analysis. In our attempt to investigate the role of Epstein-Barr virus (EBV) in the pathogenesis of multiple sclerosis (MS), extracting PCR quality DNA from brain samples fixed in formalin for 2-22 years, proved to be very difficult and challenging. As expected, DNA extracted from these samples was not only of poor quality and quantity, but more importantly, it was frequently found to be non-amplifiable due to the presence of PCR inhibitors. Here, we describe a simple and reproducible procedure for extracting DNA using a modified proteinase K and phenol-chloroform methodology. Central to this protocol is the thorough pre-digestion washing of the tissues in PBS, extensive digestion with proteinase K in low SDS containing buffer, and using low NaCl concentration during DNA precipitation. The optimized protocol was used in extracting DNA from meninges of 26 MS and 6 non-MS cases. Although the quality of DNA from these samples was generally poor, small size amplicons (100-200 nucleotides) of the house-keeping gene, β-globin could be reliably amplified from all the cases. PCR for EBV revealed positivity in 35% (9/26) MS cases, but 0/6 non-MS cases. These findings indicate that the method described here is suitable for PCR detection of viral sequences in long-term formalin persevered brain tissues. Our findings also support a possible role for EBV in the pathogenesis of MS. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  3. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Designing easy DNA extraction: Teaching creativity through laboratory practice.

    Science.gov (United States)

    Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

    2017-05-01

    Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  5. Toxic reagents and expensive equipment: are they really necessary for the extraction of good quality fungal DNA?

    Science.gov (United States)

    Rodrigues, P; Venâncio, A; Lima, N

    2018-01-01

    The aim of this work was to evaluate a fungal DNA extraction procedure with the lowest inputs in terms of time as well as of expensive and toxic chemicals, but able to consistently produce genomic DNA of good quality for PCR purposes. Two types of fungal biological material were tested - mycelium and conidia - combined with two protocols for DNA extraction using Sodium Dodecyl Sulphate (SDS) and Cetyl Trimethyl Ammonium Bromide as extraction buffers and glass beads for mechanical disruption of cell walls. Our results showed that conidia and SDS buffer was the combination that lead to the best DNA quality and yield, with the lowest variation between samples. This study clearly demonstrates that it is possible to obtain high yield and pure DNA from pigmented conidia without the use of strong cell disrupting procedures and of toxic reagents. There are numerous methods for DNA extraction from fungi. Some rely on expensive commercial kits and/or equipments, unavailable for many laboratories, or make use of toxic chemicals such as chloroform, phenol and mercaptoethanol. This study clearly demonstrates that it is possible to obtain high yields of pure DNA from pigmented conidia without the use of strong and expensive cell disrupting procedures and of toxic reagents. The method herein described is simultaneously inexpensive and adequate to DNA extraction from several different types of fungi. © 2017 The Society for Applied Microbiology.

  6. Evaluation of methods for the extraction and purification of DNA from the human microbiome.

    Directory of Open Access Journals (Sweden)

    Sanqing Yuan

    Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

  7. Effect of DNA extraction and sample preservation method on rumen bacterial population.

    Science.gov (United States)

    Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

    2014-10-01

    The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  9. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  10. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  11. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  12. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  13. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  14. Automated extraction of DNA from clothing

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

    2011-01-01

    Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing...

  15. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  16. CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

    Directory of Open Access Journals (Sweden)

    MacKinnon Ruth N

    2012-02-01

    Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

  17. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  18. Application of FTA technology to extraction of sperm DNA from mixed body fluids containing semen.

    Science.gov (United States)

    Fujita, Yoshihiko; Kubo, Shin-ichi

    2006-01-01

    FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. In this study, we report a rapid and simple method of extracting DNA from sperm when body fluids mixed with semen were collected using FTA cards. After proteinase K digestion of the sperm and body fluid mixture, the washed pellet suspension as the sperm fraction and the concentrated supernatant as the epithelial cell fraction were respectively applied to FTA cards containing DTT. The FTA cards were dried, then directly added to a polymerase chain reaction (PCR) mix and processed by PCR. The time required from separation of the mixed fluid into sperm and epithelial origin DNA extractions was only about 2.5-3h. Furthermore, the procedure was extremely simple. It is considered that our designed DNA extraction procedure using an FTA card is available for application to routine work.

  19. DNA Extraction Techniques for Use in Education

    Science.gov (United States)

    Hearn, R. P.; Arblaster, K. E.

    2010-01-01

    DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

  20. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Science.gov (United States)

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  1. Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

    Directory of Open Access Journals (Sweden)

    Elena Ordoñez

    2013-01-01

    Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

  2. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  3. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  4. Sources of pre-analytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC.

    Directory of Open Access Journals (Sweden)

    Elodie Caboux

    Full Text Available The European Prospective Investigation into Cancer and nutrition (EPIC is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88% performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies.

  5. Simple DNA extraction of urine samples: Effects of storage temperature and storage time.

    Science.gov (United States)

    Ng, Huey Hian; Ang, Hwee Chen; Hoe, See Ying; Lim, Mae-Lynn; Tai, Hua Eng; Soh, Richard Choon Hock; Syn, Christopher Kiu-Choong

    2018-06-01

    Urine samples are commonly analysed in cases with suspected illicit drug consumption. In events of alleged sample mishandling, urine sample source identification may be necessary. A simple DNA extraction procedure suitable for STR typing of urine samples was established on the Promega Maxwell ® 16 paramagnetic silica bead platform. A small sample volume of 1.7mL was used. Samples were stored at room temperature, 4°C and -20°C for 100days to investigate the influence of storage temperature and time on extracted DNA quantity and success rate of STR typing. Samples stored at room temperature exhibited a faster decline in DNA yield with time and lower typing success rates as compared to those at 4°C and -20°C. This trend can likely be attributed to DNA degradation. In conclusion, this study presents a quick and effective DNA extraction protocol from a small urine volume stored for up to 100days at 4°C and -20°C. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  7. DNA extraction from herbarium specimens.

    Science.gov (United States)

    Drábková, Lenka Záveská

    2014-01-01

    With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

  8. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  9. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  10. Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

    International Nuclear Information System (INIS)

    Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

    2011-01-01

    Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

  11. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  12. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  13. Comparative analysis of protocols for DNA extraction from soybean caterpillars.

    Science.gov (United States)

    Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

    2016-04-07

    Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

  14. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

    Directory of Open Access Journals (Sweden)

    Wajhul Qamar

    2017-11-01

    Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

  15. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  16. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  17. Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

    Science.gov (United States)

    Desai, Chirayu; Madamwar, Datta

    2007-03-01

    PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

  18. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  19. An efficient method for DNA extraction from Cladosporioid fungi

    OpenAIRE

    Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de, P.J.G.M.

    2010-01-01

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A260/A280 ratio ranging between 1.6 and 2.0. Isolated genomic DNA w...

  20. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  1. Extraction of DNA from plant and fungus tissues in situ

    Directory of Open Access Journals (Sweden)

    Abu Almakarem Amal S

    2012-06-01

    Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

  2. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

  3. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    Science.gov (United States)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (pextract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (pextract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  4. Evaluation of four automated protocols for extraction of DNA from FTA cards.

    Science.gov (United States)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-10-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

  5. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  6. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  7. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Directory of Open Access Journals (Sweden)

    Cássia Yumi Ikuta

    2016-11-01

    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  8. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    International Nuclear Information System (INIS)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.

    1991-01-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  9. How Severely Is DNA Quantification Hampered by RNA Co-extraction?

    Science.gov (United States)

    Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

    2015-10-01

    The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

  10. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  11. Comparison of Methods of Extracting Salmonella enterica Serovar Enteritidis DNA from Environmental Substrates and Quantification of Organisms by Using a General Internal Procedural Control

    NARCIS (Netherlands)

    Klerks, M.M.; Bruggen, van A.H.C.; Zijlstra, C.; Donnikov, M.; Vos, de R.

    2006-01-01

    This paper compares five commercially available DNA extraction methods with respect to DNA extraction efficiency of Salmonella enterica serovar Enteritidis from soil, manure, and compost and uses an Escherichia coli strain harboring a plasmid expressing green fluorescent protein as a general

  12. A simple and cost-effective method of DNA extraction from small formalin-fixed paraffin-embedded tissue for molecular oncologic testing.

    Science.gov (United States)

    Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin

    2014-01-01

    Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.

  13. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    OpenAIRE

    Farkhondeh Saba; Moslem Papizadeh; Javad Khansha; Mahshid Sedghi; Mehrnoosh Rasooli; Mohammad Ali Amoozegar; Mohammad Reza Soudi; Seyed Abolhassan Shahzadeh Fazeli

    2016-01-01

    Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR). Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Me...

  14. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  15. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    OpenAIRE

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-01-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cell...

  16. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  17. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  18. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  19. [DNA Extraction from Old Bones by AutoMate Express™ System].

    Science.gov (United States)

    Li, B; Lü, Z

    2017-08-01

    To establish a method for extracting DNA from old bones by AutoMate Express™ system. Bones were grinded into powder by freeze-mill. After extraction by AutoMate Express™, DNA were amplified and genotyped by Identifiler®Plus and MinFiler™ kits. DNA were extracted from 10 old bone samples, which kept in different environments with the postmortem interval from 10 to 20 years, in 3 hours by AutoMate Express™ system. Complete STR typing results were obtained from 8 samples. AutoMate Express™ system can quickly and efficiently extract DNA from old bones, which can be applied in forensic practice. Copyright© by the Editorial Department of Journal of Forensic Medicine

  20. Assessment of age and greenness of herbarium specimens as predictors for successful extraction and amplification of DNA

    NARCIS (Netherlands)

    Erkens, R.H.J.; Cross, H.; Maas, J.W.; Hoenselaar, K.; Chatrou, L.W.

    2008-01-01

    Age and the greenness of leaves have been frequently used as indicators for selecting herbarium specimens for molecular studies. Although plant DNA extraction and amplification have been common lab procedures for the past 20 years, no studies specifically investigated the success of these

  1. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  2. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  3. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  4. DNA extraction methods for detecting genetically modified foods: A comparative study.

    Science.gov (United States)

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

    2011-06-15

    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  5. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

    Science.gov (United States)

    Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

    2014-02-27

    Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

  7. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

    2013-01-01

    protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore......, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already...

  8. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

  9. Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

  10. Necessity of purification during bacterial DNA extraction with environmental soils

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Lim

    2017-08-01

    Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

  11. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    Energy Technology Data Exchange (ETDEWEB)

    Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

  12. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  14. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Directory of Open Access Journals (Sweden)

    Hong Chen

    Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  15. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  16. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Evelio Ángel

    2014-04-01

    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  17. Direct extraction of genomic DNA from maize with aqueous ionic liquid buffer systems for applications in genetically modified organisms analysis.

    Science.gov (United States)

    Gonzalez García, Eric; Ressmann, Anna K; Gaertner, Peter; Zirbs, Ronald; Mach, Robert L; Krska, Rudolf; Bica, Katharina; Brunner, Kurt

    2014-12-01

    To date, the extraction of genomic DNA is considered a bottleneck in the process of genetically modified organisms (GMOs) detection. Conventional DNA isolation methods are associated with long extraction times and multiple pipetting and centrifugation steps, which makes the entire procedure not only tedious and complicated but also prone to sample cross-contamination. In recent times, ionic liquids have emerged as innovative solvents for biomass processing, due to their outstanding properties for dissolution of biomass and biopolymers. In this study, a novel, easily applicable, and time-efficient method for the direct extraction of genomic DNA from biomass based on aqueous-ionic liquid solutions was developed. The straightforward protocol relies on extraction of maize in a 10 % solution of ionic liquids in aqueous phosphate buffer for 5 min at room temperature, followed by a denaturation step at 95 °C for 10 min and a simple filtration to remove residual biopolymers. A set of 22 ionic liquids was tested in a buffer system and 1-ethyl-3-methylimidazolium dimethylphosphate, as well as the environmentally benign choline formate, were identified as ideal candidates. With this strategy, the quality of the genomic DNA extracted was significantly improved and the extraction protocol was notably simplified compared with a well-established method.

  18. Comparison of DNA extraction methods for human gut microbial community profiling.

    Science.gov (United States)

    Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

    2018-03-01

    The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  19. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows

    Directory of Open Access Journals (Sweden)

    Jueeli D. Vaidya

    2018-01-01

    Full Text Available DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF and fibrous content (FC fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100, 67% GS and 33% maize silage (GS67MS33, 33% GS and 67% MS (GS33MS67, or 100% MS (MS100. An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method (p < 0.001 and fraction (p < 0.001. The 260/280 ratio was not affected by extraction (p = 0.08 but was affected by fraction (p = 0.03. On the other hand, the 260/230 ratio was affected by extraction method (p < 0.001 but not affected by fraction (p = 0.8. However, all four extraction procedures yielded DNA suitable for further analysis of bacterial, archaeal and anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction (p = 0.012, and that PBB (p = 0.012 and FDSS (p = 0.024 also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In

  20. Determining efficient extraction procedure of phytochemicals from ...

    African Journals Online (AJOL)

    Determining efficient extraction procedure of phytochemicals from the fruit paste of Ziziphus abyssinica and Tamarindus indica . ... Methodology and results: The methods used included cold and soxhlet extraction using methanol as the solvent and hot extraction using distilled water. To determine the efficiency in which ...

  1. Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

    Science.gov (United States)

    Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

    2015-12-28

    Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

  2. Digital PCR for direct quantification of viruses without DNA extraction.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

  3. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  4. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  5. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  6. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  7. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  8. A reproducible and scalable procedure for preparing bacterial extracts for cell-free protein synthesis.

    Science.gov (United States)

    Katsura, Kazushige; Matsuda, Takayoshi; Tomabechi, Yuri; Yonemochi, Mayumi; Hanada, Kazuharu; Ohsawa, Noboru; Sakamoto, Kensaku; Takemoto, Chie; Shirouzu, Mikako

    2017-11-01

    Cell-free protein synthesis is a useful method for preparing proteins for functional or structural analyses. However, batch-to-batch variability with regard to protein synthesis activity remains a problem for large-scale production of cell extract in the laboratory. To address this issue, we have developed a novel procedure for large-scale preparation of bacterial cell extract with high protein synthesis activity. The developed procedure comprises cell cultivation using a fermentor, harvesting and washing of cells by tangential flow filtration, cell disruption with high-pressure homogenizer and continuous diafiltration. By optimizing and combining these methods, ∼100 ml of the cell extract was prepared from 150 g of Escherichia coli cells. The protein synthesis activities, defined as the yield of protein per unit of absorbance at 260 nm of the cell extract, were shown to be reproducible, and the average activity of several batches was twice that obtained using a previously reported method. In addition, combinatorial use of the high-pressure homogenizer and diafiltration increased the scalability, indicating that the cell concentration at disruption varies from 0.04 to 1 g/ml. Furthermore, addition of Gam protein and examinations of the N-terminal sequence rendered the extract prepared here useful for rapid screening with linear DNA templates. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  9. DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

    African Journals Online (AJOL)

    BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

  10. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  11. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Science.gov (United States)

    Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

    2014-01-01

    Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

  12. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  13. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Directory of Open Access Journals (Sweden)

    D.C.A. Leite

    2014-01-01

    Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

  14. DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

    Science.gov (United States)

    Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

    2018-04-01

    Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

  15. DNA extraction from hair shafts of wild Brazilian felids and canids.

    Science.gov (United States)

    Alberts, C C; Ribeiro-Paes, J T; Aranda-Selverio, G; Cursino-Santos, J R; Moreno-Cotulio, V R; Oliveira, A L D; Porchia, B F M M; Santos, W F; Souza, E B

    2010-12-21

    Wild felids and canids are usually the main predators in the food chains where they dwell and are almost invisible to behavior and ecology researchers. Due to their grooming behavior, they tend to swallow shed hair, which shows up in the feces. DNA found in hair shafts can be used in molecular studies that can unravel, for instance, genetic variability, reproductive mode and family structure, and in some species, it is even possible to estimate migration and dispersion rates in given populations. First, however, DNA must be extracted from hair. We extracted successfully and dependably hair shaft DNA from eight wild Brazilian felids, ocelot, margay, oncilla, Geoffroy's cat, pampas cat, jaguarundi, puma, and jaguar, as well as the domestic cat and from three wild Brazilian canids, maned wolf, crab-eating fox, and hoary fox, as well as the domestic dog. Hair samples came mostly from feces collected at the São Paulo Zoo and were also gathered from non-sedated pet or from recently dead wild animals and were also collected from museum specimens. Fractions of hair samples were stained before DNA extraction, while most samples were not. Our extraction protocol is based on a feather DNA extraction technique, based in the phenol:chloroform:isoamyl alcohol general method, with proteinase K as digestive enzyme.

  16. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  17. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    Directory of Open Access Journals (Sweden)

    Shirleny Monserrat Sandoval-Arias

    2014-11-01

    Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

  19. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  20. Effect of Cassia hirsuta (L) extract on DNA profile of some ...

    African Journals Online (AJOL)

    The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

  1. DNA extraction from human saliva deposited on skin and its use in forensic identification procedures Extração de DNA de saliva humana depositada sobre a pele e sua aplicabilidade aos processos de identificação forense

    Directory of Open Access Journals (Sweden)

    Evelyn Anzai-Kanto

    2005-09-01

    Full Text Available Saliva is usually deposited in bite marks found in many homicides, assault and other criminal cases. In the present study, saliva obtained from volunteers was deposited on skin and recovered for DNA extraction and typing in order to evaluate its usefulness for practical case investigation and discuss the contribution of forensic dentistry to saliva DNA typing. Twenty saliva samples were colleted from different donors and used as suspects' samples. Five of these samples were randomly selected and deposited (250 µl on arm skin. Saliva was collected from skin using the double swab technique. DNA from saliva and skin-deposited saliva samples was extracted by the phenol-chloroform method. DNA samples were amplified by PCR for DNA typing using a set of 15 STRs. The recovery of DNA from saliva deposited in the skin was 14 to 10 times lower than DNA quantity from saliva samples. DNA typing was demonstrated in 4 of 5 deposited saliva samples, the likelihood ratios estimated for these samples based on data of the Brazilian population were 1:11, 1:500, 1:159.140 and 1:153.700.123. Our results indicate that standardized procedures used for DNA collection and extraction from skin-deposited saliva can be used as a method to recover salivary DNA in criminal cases. However, it is important to observe that DNA recovery in forensic samples can be difficult. This study suggests that the analysis of saliva deposited on skin be incorporated into a criminal investigation since it may have great discriminatory power.A saliva é usualmente depositada em marcas de mordida encontradas em homicídios, agressões e outros crimes. Neste estudo, a saliva obtida de voluntários foi depositada na pele, recuperada para extração e tipagem do DNA, para avaliação de sua utilização e sua contribuição na odontologia legal. Vinte amostras de saliva foram coletadas de diferentes doadores e utilizadas como amostras de suspeitos. Cinco dessas amostras foram sorteadas e

  2. Comparison of different methodologies for DNA extraction from Aegla longirostri

    Directory of Open Access Journals (Sweden)

    João Vitor Trindade Bitencourt

    2007-11-01

    Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

  3. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  4. DNA extraction from wings as a suitable approach for queen bees genotyping

    Directory of Open Access Journals (Sweden)

    Elena Facchini

    2018-06-01

    Full Text Available In livestock, genomics has been used since a decade in combination with phenotypic information for the estimation of breeding values. In honey bees (Apis mellifera, the advantage for including genomics in selective breeding programmes is represented by the possibility to reduce the generation interval and increase the accuracies of estimated breeding values resulting in higher genetic gain (Brascamp et al., 2018. The limit for this application is DNA extraction. Extraction methods for small animals such as insects often rely upon destructive approaches. The challenge is to develop tissue sampling methods that permit the survival of the animal while providing adequate quality DNA for genotyping. Along with previous reports of DNA extraction from several matrices, this study aims to contribute in developing suitable methodologies for genotyping honey bees queens using DNA extracted from wing cuttings (Chaline et al., 2004; Gregory and Rinderer, 2004; Gould et al., 2011. The clipping of the queen wings in beekeeping is a common practice and it ensures the survival and normal activities of the animal (Forster, 1971. A total of 57 queens with known pedigree were enrolled for this study. Wings from each queen were cut and stored at -20°C until processed (Fig. 1. Extractions were carried out using a modified protocol provided by Qiagen (DNeasy® Blood & Tissue. The modification consists in an initial incubation of the samples with proteinase K for 20 minutes, further steps are carried out following the manufacturer’s instructions. To test the suitability of the extracted DNA for genotyping, PCR was performed on Esterase FE4 like gene. Although quantification with NanoDrop™ resulted in <20 ng/μL of DNA in solution, the extracted material was sufficient for PCR amplification of candidate genes for sequencing and genotyping. Our results show that it is possible to extract DNA from wings’ cuttings permitting to implement genomic approaches in honey

  5. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  6. Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2017-01-01

    Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

  7. The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

    Science.gov (United States)

    Kasu, Mohaimin; Shires, Karen

    2015-07-01

    The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Suitability of DNA extracted from archival specimens of fruit-eating bats of the genus Artibeus (Chiroptera, Phyllostomidae for polymerase chain reaction and sequencing analysis

    Directory of Open Access Journals (Sweden)

    Mário Pinzan Scatena

    2008-01-01

    Full Text Available To establish a technique which minimized the effects of fixation on the extraction of DNA from formalin-fixed tissues preserved in scientific collections we extracted DNA samples from fixed tissues using different methods and evaluated the effect of the different procedures on PCR and sequencing analysis. We investigated muscle and liver tissues from museum specimens of five species of fruit-eating (frugivorous bats of the Neotropical genus Artibeus (Chiroptera, Phyllostomidae: A. fimbriatus, A. lituratus, A. jamaicensis, A. obscurus, and A. planirostris. The results indicated that treatment of tissues in buffered solutions at neutral pH and about 37 °C for at least four days improves the quality and quantity of extracted DNA and the quality of the amplification and sequencing products. However, the comparison between the performance of DNA obtained from fixed and fresh tissues showed that, in spite of the fact that both types of tissue generate reliable sequences for use in phylogenetic analyses, DNA samples from fixed tissues presented a larger rate of errors in the different stages of the study. These results suggest that DNA extracted from formalin-fixed tissue can be used in molecular studies of Neotropical Artibeus bats and that our methodology may be applicable to other animal groups.

  9. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  10. DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, K.R. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Borba, J.C. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Meija, M. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Mills, D.L. [TeGrex Technologies, Sperryville, VA 22740 (United States); Haverstick, D.M. [Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States); Olson, K.E.; Aranda, R. [Office of the Chief Scientist, Defense Forensic Science Center, N 31st Street, Atlanta, GA 30297 (United States); Garner, G.T. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Carrilho, E. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Landers, J.P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-09-21

    We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. - Highlights: • dSPE design on centrifugal PeT device with a unique mixing strategy was proposed. • Increased fluidic control with novel adhesive tape valves on a PeT device. • Multiplexed spin-dSPE device to run up to 4 samples simultaneously. • Demonstrated strong singleplexed and multiplexed amplification following chip dSPE.

  11. Relationship between magnesium extracted by 0.01 M calcium chloride extraction procedure and conventional procedures

    NARCIS (Netherlands)

    Erp, van P.J.; Houba, V.J.G.; Reijneveld, J.A.; Beusichem, van M.L.

    2001-01-01

    A multinutrient soil extraction procedure in routine soil testing is attractive. Therefore, it has been suggested to convert conventional soil testing programs into a 0.01 M calcium chloride (CaCl2) multinutrient soil testing program using the relationship between test values of the 0.01 M CaCl2

  12. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  13. Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

    NARCIS (Netherlands)

    Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

    2010-01-01

    The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were

  14. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  15. Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

    Science.gov (United States)

    Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

    2010-01-01

    Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

  16. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  17. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-01-01

    Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

  18. Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-06-16

    As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  19. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Directory of Open Access Journals (Sweden)

    Schnabel Robert D

    2009-06-01

    Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  20. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  1. Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

    Science.gov (United States)

    Kar, Indrani; Chattopadhyaya, Rajagopal

    2017-11-01

    The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

  2. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  3. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  4. Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

    Directory of Open Access Journals (Sweden)

    Shichu Huang

    Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

  5. Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

    Science.gov (United States)

    Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

    2013-01-01

    In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

  6. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  7. Extraction of DNA from Forensic Biological Samples for Genotyping.

    Science.gov (United States)

    Stray, J E; Liu, J Y; Brevnov, M G; Shewale, J G

    2010-07-01

    Biological forensic samples constitute evidence with probative organic matter. Evidence believed to contain DNA is typically processed for extraction and purification of its nucleic acid content. Forensic DNA samples are composed of two things, a tissue and the substrate it resides on. Compositionally, a sample may contain almost anything and for each, the type, integrity, and content of both tissue and substrate will vary, as will the contaminant levels. This fact makes the success of extraction one of the most unpredictable steps in genotypic analysis. The development of robust genotyping systems and analysis platforms for short tandem repeat (STR) and mitochondrial DNA sequencing and the acceptance of results generated by these methods in the court system, resulted in a high demand for DNA testing. The increasing variety of sample submissions created a need to isolate DNA from forensic samples that may be compromised or contain low levels of biological material. In the past decade, several robust chemistries and isolation methods have been developed to safely and reliably recover DNA from a wide array of sample types in high yield and free of PCR inhibitors. In addition, high-throughput automated workflows have been developed to meet the demand for processing increasing numbers of samples. This review summarizes a number of the most widely adopted methods and the best practices for DNA isolation from forensic biological samples, including manual, semiautomated, and fully automated platforms. Copyright © 2010 Central Police University.

  8. Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

    Directory of Open Access Journals (Sweden)

    Gilda ESLAMI

    2017-06-01

    Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

  9. Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

    Science.gov (United States)

    Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.

    2015-01-01

    Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

  10. Comparison of two commercial DNA extraction kits for the analysis of nasopharyngeal bacterial communities

    Directory of Open Access Journals (Sweden)

    Keith A. Crandall

    2016-04-01

    Full Text Available Characterization of microbial communities via next-generation sequencing (NGS requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagenfor the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732.Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests and taxa proportions (Kruskal-Wallis test were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001 between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

  11. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  12. DNA isolation by Chelex-100: an efficient approach to consider in leptospirosis early stages

    Directory of Open Access Journals (Sweden)

    Angel Alberto Noda

    2014-06-01

    Full Text Available Objective: To compare the value of leptospiral DNA extraction procedures from clinical samples for the early diagnosis of leptospirosis. Methods: Three DNA extraction procedures were applied for microbiological analysis, results of QIAmp DNA mini kit (QIAGEN, Germany, CLART HPV kit (GENOMICA, Spain and Chelex-100 assay were compared concerning extraction efficiency, DNA purity and DNA suitability for amplification by specific polymerase chain reaction for pathogenic leptospires from blood, plasma and serum artificially infected. Results: The comparison of extraction methods highlighted the efficiency of Chelex-100 and QIAmp DNA mini kit. Chelex-100 achieved the isolation of the highest concentration of leptospiral DNA from the culture and the spiked samples, with acceptable purities and without inhibitors to PCR. Conclusions: Chelex-100 assay is a rapid and effective approach for DNA isolation in clinical samples having pathogenic leptospires and it could be useful in the early diagnosis of leptospirosis.

  13. Real-Time PCR Quantification of Chloroplast DNA Supports DNA Barcoding of Plant Species.

    Science.gov (United States)

    Kikkawa, Hitomi S; Tsuge, Kouichiro; Sugita, Ritsuko

    2016-03-01

    Species identification from extracted DNA is sometimes needed for botanical samples. DNA quantification is required for an accurate and effective examination. If a quantitative assay provides unreliable estimates, a higher quantity of DNA than the estimated amount may be used in additional analyses to avoid failure to analyze samples from which extracting DNA is difficult. Compared with conventional methods, real-time quantitative PCR (qPCR) requires a low amount of DNA and enables quantification of dilute DNA solutions accurately. The aim of this study was to develop a qPCR assay for quantification of chloroplast DNA from taxonomically diverse plant species. An absolute quantification method was developed using primers targeting the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene using SYBR Green I-based qPCR. The calibration curve was generated using the PCR amplicon as the template. DNA extracts from representatives of 13 plant families common in Japan. This demonstrates that qPCR analysis is an effective method for quantification of DNA from plant samples. The results of qPCR assist in the decision-making will determine the success or failure of DNA analysis, indicating the possibility of optimization of the procedure for downstream reactions.

  14. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  15. [Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

    Science.gov (United States)

    Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

    2013-08-01

    To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

  16. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  17. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  18. Nonhomologous DNA End Joining in Cell-Free Extracts

    Directory of Open Access Journals (Sweden)

    Sheetal Sharma

    2010-01-01

    Full Text Available Among various DNA damages, double-strand breaks (DSBs are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems.

  19. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  20. A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

    Directory of Open Access Journals (Sweden)

    Aqeela S. Abuidrees

    2016-06-01

    Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

  1. Development of a dual test procedure for DNA typing and methamphetamine detection using a trace amount of stimulant-containing blood.

    Science.gov (United States)

    Irii, Toshiaki; Maebashi, Kyoko; Fukui, Kenji; Sohma, Ryoko; Matsumoto, Sari; Takasu, Shojiro; Iwadate, Kimiharu

    2016-05-01

    Investigation of drug-related crimes, such as violation of the Stimulant Drug Control Law, requires identifying the used drug (mainly stimulant drugs, methamphetamine hydrochloride) from a drug solution and the DNA type of the drug user from a trace of blood left in the syringe used to inject the drug. In current standard test procedures, DNA typing and methamphetamine detection are performed as independent tests that use two separate portions of a precious sample. The sample can be entirely used up by either analysis. Therefore, we developed a new procedure involving partial lysis of a stimulant-containing blood sample followed by separation of the lysate into a precipitate for DNA typing and a liquid-phase fraction for methamphetamine detection. The method enables these two tests to be run in parallel using a single portion of sample. Samples were prepared by adding methamphetamine hydrochloride water solution to blood. Samples were lysed with Proteinase K in PBS at 56°C for 20min, cooled at -20°C after adding methanol, and then centrifuged at 15,000rpm. Based on the biopolymer-precipitating ability of alcohol, the precipitate was used for DNA typing and the liquid-phase fraction for methamphetamine detection. For DNA typing, the precipitate was dissolved and DNA was extracted, quantified, and subjected to STR analysis using the AmpFℓSTR® Identifiler® Plus PCR Amplification Kit. For methamphetamine detection, the liquid-phase fraction was evaporated with N2 gas after adding 20μL acetic acid and passed through an extraction column; the substances captured in the column were eluted with a solvent, derivatized, and quantitatively detected using gas chromatograph/mass spectrometry. This method was simple and could be completed in approximately 2h. Both DNA typing and methamphetamine detection were possible, which suggests that this method may be valuable for use in criminal investigations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2017-01-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  3. A Rapid and Reproducible Genomic DNA Extraction Protocol for Sequence-Based Identification of Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and Green Algae

    Directory of Open Access Journals (Sweden)

    Farkhondeh Saba

    2016-09-01

    Full Text Available Background:  Sequence-based identification of various microorganisms including Archaea, Bacteria, Cyanobacteria, Diatoms, Fungi, and green algae necessitates an efficient and reproducible genome extraction procedure though which a pure template DNA is yielded and it can be used in polymerase chain reactions (PCR. Considering the fact that DNA extraction from these microorganisms is time consuming and laborious, we developed and standardized a safe, rapid and inexpensive miniprep protocol. Methods:  According to our results, amplification of various genomic regions including SSU, LSU, ITS, β-tubulin, actin, RPB2, and EF-1 resulted in a reproducible and efficient DNA extraction from a wide range of microorganisms yielding adequate pure genomic material for reproducible PCR-amplifications. Results:   This method relies on a temporary shock of increased concentrations of detergent which can be applied concomitant with multiple freeze-thaws to yield sufficient amount of DNA for PCR amplification of multiple or single fragments(s of the genome. As an advantage, the recipe seems very flexible, thus, various optional steps can be included depending on the samples used.Conclusion:   Having the needed flexibility in each step, this protocol is applicable on a very wide range of samples. Hence, various steps can be included depending on the desired quantity and quality.

  4. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  5. Solid-phase extraction procedures in systematic toxicological analysis

    NARCIS (Netherlands)

    Franke, J.P.; de Zeeuw, R.A

    1998-01-01

    In systematic toxicological analysis (STA) the substance(s) present is (are) not known at the start of the analysis. in such an undirected search the extraction procedure cannot be directed to a given substance but must be a general procedure where a compromise must be reached in that the substances

  6. DNA Damage Protecting Activity and Antioxidant Potential of Launaea taraxacifolia Leaves Extract.

    Science.gov (United States)

    Adinortey, Michael Buenor; Ansah, Charles; Weremfo, Alexander; Adinortey, Cynthia Ayefoumi; Adukpo, Genevieve Etornam; Ameyaw, Elvis Ofori; Nyarko, Alexander Kwadwo

    2018-01-01

    The leaf extract of Launaea taraxacifolia commonly known as African Lettuce is used locally to treat dyslipidemia and liver diseases, which are associated with oxidative stress. Methanol extract from L. taraxacifolia leaves was tested for its antioxidant activity and its ability to protect DNA from oxidative damage. In vitro antioxidant potential of the leaf extract was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), nitric oxide (NO), and hydroxyl (OH) radical scavenging assays. Ferric reducing power, total antioxidant capacity (TAC), metal chelating, and anti-lipid peroxidation ability of the extract were also examined using gallic acid, ascorbic acid, citric acid, and ethylenediaminetetraacetic acid as standards. L. taraxacifolia leaves extract showed antioxidant activity with IC 50 values of 16.18 μg/ml (DPPH), 123.3 μg/ml (NO), 128.2 μg/ml (OH radical), 97.94 μg/ml (metal chelating), 80.28 μg/ml (TAC), and 23 μg/ml (anti-lipid peroxidation activity). L. taraxacifolia leaves extract exhibited a strong capability for DNA damage protection at 20 mg/ml concentration. These findings suggest that the methanolic leaf extract of L. taraxacifolia could be used as a natural antioxidant and also as a preventive therapy against diseases such as arteriosclerosis associated with DNA damage.

  7. High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

    Science.gov (United States)

    Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

  8. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

    OpenAIRE

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

  9. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  10. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  11. Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

    Science.gov (United States)

    Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

    2006-09-18

    A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

  12. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    Science.gov (United States)

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  13. Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

    2012-01-01

    Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

  14. Digital PCR for direct quantification of viruses without DNA extraction

    OpenAIRE

    Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

    2015-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

  15. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    Alyssa D. Ammazzalorso

    2015-08-01

    Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  16. Noninvasive genetic sampling of endangered muriqui (Primates, Atelidae: efficiency of fecal DNA extraction

    Directory of Open Access Journals (Sweden)

    Paulo B. Chaves

    2006-01-01

    Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.

  17. Optimization of phenol extraction procedures for preparation of RNA from mammalian lymphoid organs

    Energy Technology Data Exchange (ETDEWEB)

    Griffin, G.D.; Sellin, H.G.; Novelli, G.D.

    1978-07-01

    Methods have been developed to optimize the extraction of RNA from mammalian lymphoid organs (spleen) with respect to both quantity and quality of RNA and with minimal DNA contamination. Nuclease inhibitors, including diethyl pyrocarbonate, polyvinyl sulfate, and bentonite were used in the initial disruption of the tissue, which was accomplished by blender, Dounce homogenizer, or preparation of a cell suspension. Seven buffer systems, varying with respect to pH, detergent, and NaCl concentration, were used in the initial extraction with phenol, and the temperature of extraction was also varied. Protocols involving the selective use of naphthalene 1.5-disulfonic acid and sodium dodecyl sulfate were developed to provide an initial RNA extract with minimal DNA content. Dounce homogenization, followed by separate treatment of nuclear and cytosol fractions, was found to be the most effective technique, both in terms of RNA yield (averaging 76%) and the quality of RNA recovered (as judged by gel electrophoresis). RNA from blender preparations contained larger amounts of DNA and RNA yield was decreased to 54%. RNA extracted from spleen cell suspensions was of poor quality and gave very poor yield (27%).

  18. The use of direct analysis in real time (DART) to assess the levels of inhibitors co-extracted with DNA and the associated impact in quantification and amplification.

    Science.gov (United States)

    Moreno, Lilliana I; McCord, Bruce R

    2016-10-01

    The measure of quality in DNA sample processing starts with an effective nucleic acid isolation procedure. Most problems with DNA sample typing can be attributed to low quantity DNA and/or to the presence of inhibitors in the sample. Therefore, establishing which isolation method is best at removing potential inhibitors may help overcome some of the problems analysts encounter by providing useful information in the determination of the optimal approach for any given sample. Direct analysis in real time (DART) mass spectrometry was used in this study to investigate the ability of different extraction methods to remove PCR inhibitors. Methods investigated included both liquid/liquid (phenol-chloroform) and solid phase based robotic procedures, (PrepFiler™ and EZ1 chemistries). Following extraction, samples were analyzed by DART in order to determine the level of remaining inhibitors and then quantified and amplified to determine the effect any remaining inhibitor had on the overall results. The data suggests that organic extraction methods result in detrimental amounts of phenol carryover while automated methods may produce carry-over of bile salts and other chemicals that preferentially bind the solid phase matrix. Both of these effects can have a negative impact in downstream sample processing and genotyping by PCR. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

    Directory of Open Access Journals (Sweden)

    Imelda Kristina Sutrisno

    2013-06-01

    Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

  20. DNA in ancient bone - where is it located and how should we extract it?

    DEFF Research Database (Denmark)

    Campos, Paula; Craig, Oliver E.; Turner-Walker, Gordon

    2012-01-01

    Despite the widespread use of bones in ancient DNA (aDNA) studies, relatively little concrete information exists in regard to how the DNA in mineralised collagen degrades, or where it survives in the material's architecture. While, at the macrostructural level, physical exclusion of microbes...... and other external contaminants may be an important feature, and, at the ultrastructural level, the adsorption of DNA to hydroxyapatite and/or binding of DNA to Type I collagen may stabilise the DNA, the relative contribution of each, and what other factors may be relevant, are unclear....... The question arises as to whether this may be due to post-collection preservation or just an artefact of the extraction methods used in these different studies? In an attempt to resolve these questions, we examine the efficacy of DNA extraction methods, and the quality and quantity of DNA recovered from both...

  1. Analytical procedures for identifying anthocyanins in natural extracts

    International Nuclear Information System (INIS)

    Marco, Paulo Henrique; Poppi, Ronei Jesus; Scarminio, Ieda Spacino

    2008-01-01

    Anthocyanins are among the most important plant pigments. Due to their potential benefits for human health, there is considerable interest in these natural pigments. Nonetheless, there is great difficulty in finding a technique that could provide the identification of structurally similar compounds and estimate the number and concentration of the species present. A lot of techniques have been tried to find the best methodology to extract information from these systems. In this paper, a review of the most important procedures is given, from the extraction to the identification of anthocyanins in natural extracts. (author)

  2. Development of a modified cortisol extraction procedure for intermediately sized fish not amenable to whole-body or plasma extraction methods.

    Science.gov (United States)

    Guest, Taylor W; Blaylock, Reginald B; Evans, Andrew N

    2016-02-01

    The corticosteroid hormone cortisol is the central mediator of the teleost stress response. Therefore, the accurate quantification of cortisol in teleost fishes is a vital tool for addressing fundamental questions about an animal's physiological response to environmental stressors. Conventional steroid extraction methods using plasma or whole-body homogenates, however, are inefficient within an intermediate size range of fish that are too small for phlebotomy and too large for whole-body steroid extractions. To assess the potential effects of hatchery-induced stress on survival of fingerling hatchery-reared Spotted Seatrout (Cynoscion nebulosus), we developed a novel extraction procedure for measuring cortisol in intermediately sized fish (50-100 mm in length) that are not amenable to standard cortisol extraction methods. By excising a standardized portion of the caudal peduncle, this tissue extraction procedure allows for a small portion of a larger fish to be sampled for cortisol, while minimizing the potential interference from lipids that may be extracted using whole-body homogenization procedures. Assay precision was comparable to published plasma and whole-body extraction procedures, and cortisol quantification over a wide range of sample dilutions displayed parallelism versus assay standards. Intra-assay %CV was 8.54%, and average recovery of spiked samples was 102%. Also, tissue cortisol levels quantified using this method increase 30 min after handling stress and are significantly correlated with blood values. We conclude that this modified cortisol extraction procedure provides an excellent alternative to plasma and whole-body extraction procedures for intermediately sized fish, and will facilitate the efficient assessment of cortisol in a variety of situations ranging from basic laboratory research to industrial and field-based environmental health applications.

  3. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  4. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  5. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  6. Simple practical approach for sample loading prior to DNA extraction using a silica monolith in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-12-07

    A novel DNA loading methodology is presented for performing DNA extraction on a microfluidic system. DNA in a chaotropic salt solution was manually loaded onto a silica monolith orthogonal to the subsequent flow of wash and elution solutions. DNA was successfully extracted from buccal swabs using electro-osmotic pumping (EOP) coupled with in situ reagents contained within a 1.5% agarose gel matrix. The extracted DNA was of sufficient quantity and purity for polymerase chain reaction (PCR) amplification.

  7. Determination of polyphenolic content, HPLC analyses and DNA cleavage activity of Malaysian Averrhoa carambola L. fruit extracts

    Directory of Open Access Journals (Sweden)

    Zakia Khanam

    2015-10-01

    Full Text Available In developing countries, the increasing gap between population growth and food supply has created renewed interest in finding reliable and cheap natural resources of nutraceutical value and health promoting properties. Therefore, the present study deals with the phytochemical analyses and DNA cleavage activity of Averrhoa carambola L. fruit (starfruit extracts. The phytochemical studies involve colour tests and quantification of phenolics and flavonoids of the prepared ethanolic and aqueous extracts. Identification of phenolic acids and flavonoids present in the extracts were conducted by high performance liquid chromatography (HPLC equipped with diode array detector (DAD. DNA cleavage activity of the extracts was evaluated through gel electrophoresis against plasmid Escherichia coli DNA at different concentrations (0.125–0.60 μg/μl. The results of the study exhibited that the starfruit is a rich source of polyphenols and all the extracts exhibited a dose dependent DNA cleavage activity, whereas ethanolic extract induced more cleavage as compared to the aqueous extract. In conclusion, the present study provides preliminary evidence with regard to nutraceutical value of the fruit. So, further extensive study is a prerequisite to exploit DNA cleaving properties of the fruit extracts for therapeutic application.

  8. Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

    Science.gov (United States)

    Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

    2009-10-01

    Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

  9. Evaluation of five DNA extraction methods for purification of DNA from atherosclerotic tissue and estimation of prevalence of Chlamydia pneumoniae in tissue from a Danish population undergoing vascular repair

    Directory of Open Access Journals (Sweden)

    Lindholt Jes S

    2003-09-01

    Full Text Available Abstract Background To date PCR detection of Chlamydia pneumoniae DNA in atherosclerotic lesions from Danish patients has been unsuccessful. To establish whether non-detection was caused by a suboptimal DNA extraction method, we tested five different DNA extraction methods for purification of DNA from atherosclerotic tissue. Results The five different DNA extraction methods were tested on homogenate of atherosclerotic tissue spiked with C. pneumoniae DNA or EB, on pure C. pneumoniae DNA samples and on whole C. pneumoniae EB. Recovery of DNA was measured with a C. pneumoniae-specific quantitative real-time PCR. A DNA extraction method based on DNA-binding to spin columns with a silica-gel membrane (DNeasy Tissue kit showed the highest recovery rate for the tissue samples and pure DNA samples. However, an automated extraction method based on magnetic glass particles (MagNA Pure performed best on intact EB and atherosclerotic tissue spiked with EB. The DNeasy Tissue kit and MagNA Pure methods and the highly sensitive real-time PCR were subsequently used on 78 atherosclerotic tissue samples from Danish patients undergoing vascular repair. None of the samples were positive for C. pneumoniae DNA. The atherosclerotic samples were tested for inhibition by spiking with two different, known amounts of C. pneumoniae DNA and no samples showed inhibition. Conclusion As a highly sensitive PCR method and an optimised DNA extraction method were used, non-detection in atherosclerotic tissue from the Danish population was probably not caused by use of inappropriate methods. However, more samples may need to be analysed per patient to be completely certain on this. Possible methodological and epidemiological reasons for non-detection of C. pneumoniae DNA in atherosclerotic tissue from the Danish population are discussed. Further testing of DNA extraction methods is needed as this study has shown considerable intra- and inter-method variation in DNA recovery.

  10. Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

    Science.gov (United States)

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  11. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    Directory of Open Access Journals (Sweden)

    Paula Baptista

    2011-06-01

    Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  12. A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

    DEFF Research Database (Denmark)

    Lever, Mark; Torti, Andrea; Eickenbusch, Philip

    2015-01-01

    tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world...... DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample...

  13. Modification of gDNA extraction from soil for PCR designed for the routine examination of soil samples contaminated with Toxocara spp. eggs.

    Science.gov (United States)

    Borecka, A; Gawor, J

    2008-06-01

    A modification of gDNA extraction was developed for the polymerase chain reaction (PCR) technique, intended for the detection and differentiation of Toxocara spp. eggs in soil or sediments. Sand samples from sandpits confirmed as being contaminated with Toxocara spp. eggs by the flotation technique were analysed by PCR. The use of proteinase K made it possible to obtain genomic DNA from the sample without needing to isolate eggs using flotation or to inactivate PCR inhibitors present in the sand. Specific primers in the PCR reaction allowed discrimination between T. canis and T. cati eggs. The modification simplified the procedure, thanks to eliminating the step of gDNA isolation from eggs, which is both laborious and difficult.

  14. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Science.gov (United States)

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

    2012-05-01

    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

    Directory of Open Access Journals (Sweden)

    Gemma Henderson

    Full Text Available Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However

  18. Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

    Directory of Open Access Journals (Sweden)

    Åkerlund Monika

    2010-01-01

    Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

  19. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    Science.gov (United States)

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

    2014-11-01

    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  20. Evaluation of DNA damage of hydro-alcoholic and aqueous extract of Echium amoenum and Nardostachys jatamansi

    Directory of Open Access Journals (Sweden)

    Mahmoud Etebari

    2012-01-01

    Full Text Available Background: Today most of herbal medicines are marketing without any standard safety profiles. Although common assumption is that these products are nontoxic but this assumption may be incorrect and dangerous, so toxicological studies should be done for herbal drugs. According to the frequent use of Echium amoenum as immunostimulant and useful in conditions including pain, cough, sore throat and arthritis, and Nardostachys jatamansi as tranquilizer and sleep inducer and evidences of some toxicities, we assessed the probable effect of their extracts on DNA of hepG 2 cells using the comet assay. Materials and Methods: Different concentrations of above extracts of the plants are incubated with hepG 2 cells for 24 h. A mixture of cell suspension and agarose gel were put on slides, then slides were embedded in a lysing solution and were put in electrophoresis buffer (pH = 13. Then the electrophoresis procedure took place in an alkaline solution and after neutralization stage, colorization was done by ethidium bromide and comets were observed using a fluorescence microscope. At least 100 cells of each sample were evaluated and three parameters including comet length, percent of DNA in tail, and tail moment were assessed. Results: Both Aqueous and hydro-alcoholic extract of E. amoenum were genotoxic in the concentrations of 25 mg/ml and aqueous and hydro-alcoholic extract of N. jatamansi were genotoxic in the concentrations 5 and 10 mg/ml, respectively. Conclusions: Although E. amoenum and N. jatamansi are highly used in medicine, these herbs have genotoxic effects in determined concentrations and they should be used cautiously.

  1. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

    2015-01-01

    ) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

  2. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  3. Grape (Vitis vinifera) extracts protect against radiation-induced oxidative stress and DNA damage

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar; Saxena, S.; Gautam, S.

    2016-01-01

    Ionizing radiation (IR) causes oxidative stress through the overwhelming generation of reactive oxygen species (ROS) in the living cells leading further to the oxidative damage to biomolecules. Grapes (Vitis vinifera) contain several bioactive phytochemicals and are the richest source of antioxidant. In this study, we investigated and compared in vitro antioxidant activity and DNA damage protective property of the grape extracts of four different cultivars, including the Thompson seedless, Flame seedless, Kishmish chorni and Red globe. The activities of ascorbic acid oxidase and catalase significantly (p<0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly among extracts of any cultivar. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay and ABTS. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. DNA damage was evaluated in acellular system using pBR322 plasmid relaxation. Grape extract was able to effectively scavenge free radicals in vitro. It could significantly prevent radiation-induced DNA damage. Furthermore, the protective action of grape depends on the source of extract and type of the cultivars. (author)

  4. Comparison of eight methods for the extraction of Bacillus atrophaeus spore DNA from eleven common interferents and a common swab.

    Directory of Open Access Journals (Sweden)

    Helen L Rose

    Full Text Available Eight DNA extraction products or methods (Applied Biosystems PrepFiler Forensic DNA Extraction Kit; Bio-Rad Instagene Only, Bio-Rad Instagene & Spin Column Purification; EpiCentre MasterPure DNA & RNA Kit; FujiFilm QuickGene Mini80; Idaho Technologies 1-2-3 Q-Flow Kit; MoBio UltraClean Microbial DNA Isolation Kit; Sigma Extract-N-Amp Plant and Seed Kit were adapted to facilitate extraction of DNA under BSL3 containment conditions. DNA was extracted from 12 common interferents or sample types, spiked with spores of Bacillus atropheaus. Resulting extracts were tested by real-time PCR. No one method was the best, in terms of DNA extraction, across all sample types. Statistical analysis indicated that the PrepFiler method was the best method from six dry powders (baking, biological washing, milk, plain flour, filler and talcum and one solid (Underarm deodorant, the UltraClean method was the best from four liquids (aftershave, cola, nutrient broth, vinegar, and the MasterPure method was the best from the swab sample type. The best overall method, in terms of DNA extraction, across all sample types evaluated was the UltraClean method.

  5. High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

    DEFF Research Database (Denmark)

    Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke

    2013-01-01

    the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

  6. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  7. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

    Science.gov (United States)

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

  8. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Science.gov (United States)

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

    2015-05-01

    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  9. Beware of the possibility of fingerprinting techniques transferring DNA.

    Science.gov (United States)

    van Oorschot, Roland A H; Treadwell, Sally; Beaurepaire, James; Holding, Nicole L; Mitchell, Robert J

    2005-11-01

    Fingerprinting brushes have the potential to collect and transfer DNA during powdering. Squirrel-hair fingerprint brushes exposed to specific sets of saliva stains and brushes used in routine casework were tested for their ability to collect and transfer DNA containing material using standard DNA extraction procedures and AmpFlSTR Profiler Plus amplification and typing procedures. The tests found that the risk of transferring DNA during powdering and having a detrimental impact on the analysis increases if the examiner powders over either biological stains (such as blood or saliva) or very fresh prints and uses more sensitive PCR amplification and typing procedures. We advocate caution when powdering prints from which DNA may also be collected and provide options for consideration to limit the risk of transferred DNA contamination while fingerprinting.

  10. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  11. A simple Chelex protocol for DNA extraction from Anopheles spp.

    Science.gov (United States)

    Musapa, Mulenga; Kumwenda, Taida; Mkulama, Mtawa; Chishimba, Sandra; Norris, Douglas E; Thuma, Philip E; Mharakurwa, Sungano

    2013-01-09

    Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens. We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km(2) vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol(9,10). The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction(9). Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality, a PCR for identification of Anopheles gambiae sibling species(10) and a nested PCR for typing of Plasmodium falciparum infection

  12. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  13. Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers

    Science.gov (United States)

    Harika, Katakam; Mahla, Ranjeet Singh; Shivaji, Sisinthy

    2012-01-01

    Background Non-invasively collected samples allow a variety of genetic studies on endangered and elusive species. However due to low amplification success and high genotyping error rates fewer samples can be identified up to the individual level. Number of PCRs needed to obtain reliable genotypes also noticeably increase. Methods We developed a quantitative PCR assay to measure and grade amplifiable nuclear DNA in feline faecal extracts. We determined DNA degradation in experimentally aged faecal samples and tested a suite of pre-PCR protocols to considerably improve DNA retrieval. Results Average DNA concentrations of Grade I, II and III extracts were 982pg/µl, 9.5pg/µl and 0.4pg/µl respectively. Nearly 10% of extracts had no amplifiable DNA. Microsatellite PCR success and allelic dropout rates were 92% and 1.5% in Grade I, 79% and 5% in Grade II, and 54% and 16% in Grade III respectively. Our results on experimentally aged faecal samples showed that ageing has a significant effect on quantity and quality of amplifiable DNA (pDNA degradation occurs within 3 days of exposure to direct sunlight. DNA concentrations of Day 1 samples stored by ethanol and silica methods for a month varied significantly from fresh Day 1 extracts (p0.05). DNA concentrations of fresh tiger and leopard faecal extracts without addition of carrier RNA were 816.5pg/µl (±115.5) and 690.1pg/µl (±207.1), while concentrations with addition of carrier RNA were 49414.5pg/µl (±9370.6) and 20982.7pg/µl (±6835.8) respectively. Conclusions Our results indicate that carnivore faecal samples should be collected as freshly as possible, are better preserved by two-step method and should be extracted with addition of carrier RNA. We recommend quantification of template DNA as this facilitates several downstream protocols. PMID:23071624

  14. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  15. Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

    International Nuclear Information System (INIS)

    Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

    2012-01-01

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials.

  16. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  17. Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

    Science.gov (United States)

    Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

    2013-07-01

    Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

  18. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods.

    Science.gov (United States)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N; Hoflund, Anders; Mogensen, Helle S; Hansen, Anders J; Morling, Niels

    2013-05-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were processed. The highest DNA recovery was obtained with the PrepFiler Express kit on an AutoMate Express while the lowest DNA recovery was obtained using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen. Extraction using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen resulted in the lowest percentage of PCR inhibition (0%) while extraction using manual Chelex resulted in the highest percentage of PCR inhibition (51%). The largest number of reportable STR-profiles was obtained with DNA from samples extracted with the PrepFiler Express kit (75%) while the lowest number was obtained with DNA from samples extracted using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen (41%). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  19. The development of simple field based procedures for extraction of ...

    African Journals Online (AJOL)

    Field and laboratory experiments were conducted to develop procedures for extracting volatiles from the vine of Adenia cissampeloides which could effect the highest yield at the lowest extraction costs and also could be produced at the cottage industry level. The participatory rural appraisal technique was used to ensure ...

  20. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  1. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  2. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  3. Direct quantification of cell-free, circulating DNA from unpurified plasma.

    Science.gov (United States)

    Breitbach, Sarah; Tug, Suzan; Helmig, Susanne; Zahn, Daniela; Kubiak, Thomas; Michal, Matthias; Gori, Tommaso; Ehlert, Tobias; Beiter, Thomas; Simon, Perikles

    2014-01-01

    Cell-free DNA (cfDNA) in body tissues or fluids is extensively investigated in clinical medicine and other research fields. In this article we provide a direct quantitative real-time PCR (qPCR) as a sensitive tool for the measurement of cfDNA from plasma without previous DNA extraction, which is known to be accompanied by a reduction of DNA yield. The primer sets were designed to amplify a 90 and 222 bp multi-locus L1PA2 sequence. In the first module, cfDNA concentrations in unpurified plasma were compared to cfDNA concentrations in the eluate and the flow-through of the QIAamp DNA Blood Mini Kit and in the eluate of a phenol-chloroform isoamyl (PCI) based DNA extraction, to elucidate the DNA losses during extraction. The analyses revealed 2.79-fold higher cfDNA concentrations in unpurified plasma compared to the eluate of the QIAamp DNA Blood Mini Kit, while 36.7% of the total cfDNA were found in the flow-through. The PCI procedure only performed well on samples with high cfDNA concentrations, showing 87.4% of the concentrations measured in plasma. The DNA integrity strongly depended on the sample treatment. Further qualitative analyses indicated differing fractions of cfDNA fragment lengths in the eluate of both extraction methods. In the second module, cfDNA concentrations in the plasma of 74 coronary heart disease patients were compared to cfDNA concentrations of 74 healthy controls, using the direct L1PA2 qPCR for cfDNA quantification. The patient collective showed significantly higher cfDNA levels (mean (SD) 20.1 (23.8) ng/ml; range 5.1-183.0 ng/ml) compared to the healthy controls (9.7 (4.2) ng/ml; range 1.6-23.7 ng/ml). With our direct qPCR, we recommend a simple, economic and sensitive procedure for the quantification of cfDNA concentrations from plasma that might find broad applicability, if cfDNA became an established marker in the assessment of pathophysiological conditions.

  4. Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs

    Directory of Open Access Journals (Sweden)

    Ana Cristina dos Reis Ferreira

    2015-06-01

    Full Text Available ABSTRACT. Ferreira A.C.dosR. & dos Santos B.M. [Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs.] Avaliação de três métodos de extração de DNA de Salmonella sp. em ovos de galinhas contaminados artificialmente. Revista Brasileira de Medicina Veterinária, 37(2:115-119, 2015. Departamento de Veterinária, Universidade Federal de Viçosa, Campus Universitário, Av. Peter Henry Rolfs, s/n, Viçosa, MG 36571-000, Brasil. E-mail: bmsantos@ufv.br The present study evaluated the efficiency of different protocols for the genomic DNA extraction of Salmonella bacteria in chicken eggs free of specific pathogens – SPF. Seventy-five eggs were used and divided into five groups with fifteen eggs each. Three of the five groups of eggs were inoculated with enteric Salmonella cultures. One of the five groups was inoculated with Escherichia coli bacterium culture. And another group of eggs was the negative control that received saline solution 0.85% infertile. The eggs were incubated on a temperature that varied from 20 to 25°C during 24, 48 and 72 hours. Five yolks of each group were collected every 24 hours. These yolks were homogenized and centrifuged during 10 minutes. The supernatant was rejected. After the discard, PBS ph 7.2 was added and centrifuged again. The sediment obtained of each group was used for the extraction of bacterial genomic DNA. Silica particles and a commercial kit were utilized as the extraction methods. The extracted DNA was kept on a temperature of 20°C until the evaluation through PCR. The primers utilized were related with the invA gene and they were the following: 5’ GTA AAA TTA TCG CCA CGT TCG GGC AA 3’ and 5’ TCA TCG CAC CGT CAA AGG AAC C 3’. The amplification products were visualized in transilluminator with ultraviolet light. The obtained results through the bacterial DNA extractions demonstrated that the extraction method utilizing silica particles was

  5. An optimized protocol for DNA extraction from wheat seeds and Loop-Mediated Isothermal Amplification (LAMP) to detect Fusarium graminearum contamination of wheat grain.

    Science.gov (United States)

    Abd-Elsalam, Kamel; Bahkali, Ali; Moslem, Mohamed; Amin, Osama E; Niessen, Ludwig

    2011-01-01

    A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs) were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP) procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  6. Non-destructive sampling of ancient insect DNA

    DEFF Research Database (Denmark)

    Thomsen, Philip Francis; Elias, Scott; Gilbert, Tom

    2009-01-01

    BACKGROUND: A major challenge for ancient DNA (aDNA) studies on insect remains is that sampling procedures involve at least partial destruction of the specimens. A recent extraction protocol reveals the possibility of obtaining DNA from past insect remains without causing visual morphological...... of 77-204 base pairs (-bp) in size using species-specific and general insect primers. CONCLUSION/SIGNIFICANCE: The applied non-destructive DNA extraction method shows promising potential on insect museum specimens of historical age as far back as AD 1820, but less so on the ancient permafrost......-preserved insect fossil remains tested, where DNA was obtained from samples up to ca. 26,000 years old. The non-frozen sediment DNA approach appears to have great potential for recording the former presence of insect taxa not normally preserved as macrofossils and opens new frontiers in research on ancient...

  7. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  8. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  9. UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract

    International Nuclear Information System (INIS)

    Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh

    2016-01-01

    UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)

  10. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  11. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

  12. PROTOCOL FOR EXTRACTION OF BACTERIAL METAGENOME DNA TO PRAWN Macrobrachium carcinus L

    Directory of Open Access Journals (Sweden)

    J U González de la Cruz

    2011-07-01

    Full Text Available In this work we adapted a protocol for the extraction of metagenomic DNA (ADNmg bacteria in the digestive system (intestines, stomach and hepatopancreas of Macrobrachium carcinus L., with reference to the method of extracting bacterial DNA from soils and sediments (Rojas-Herrera et al., 2008. This methodology consisted of enzymatic, physics, mechanics and chemistry after a series of tests was abolished enzymatic lysis. However, the success ADNmg extraction was influenced mainly by the preparation of the samples, in particular the hepatopancreas, where it was necessary to remove the fat by thermal shock temperature and phase separation by centrifugation with the sample frozen.The effectiveness of isolated DNA fragmentation was verified by gel electrophoresis in denaturing gradient (DGGE after amplification with universal primers. In general, it had a low diversity (19 phylotypes between the different organs analyzed of 13.5 ± 1 (intestines to 11.7 ± 0.96 (stomach. The Shannon-Weaver index (2.45, Simpsons (10.88 and equity (0972 obtained from the digitization of the image of the gel, suggested that the phylotypes that form the gut microflora M. carcinus, is distributed unevenly between the different organs analyzed.

  13. The currently used commercial DNA-extraction methods give different results of clostridial and actinobacterial populations derived from human fecal samples.

    Science.gov (United States)

    Maukonen, Johanna; Simões, Catarina; Saarela, Maria

    2012-03-01

    Recently several human health-related microbiota studies have had partly contradictory results. As some differences may be explained by methodologies applied, we evaluated how different storage conditions and commonly used DNA-extraction kits affect bacterial composition, diversity, and numbers of human fecal microbiota. According to our results, the DNA-extraction did not affect the diversity, composition, or quantity of Bacteroides spp., whereas after a week's storage at -20 °C, the numbers of Bacteroides spp. were 1.6-2.5 log units lower (P Eubacterium rectale (Erec)-group, Clostridium leptum group, bifidobacteria, and Atopobium group were 0.5-4 log units higher (P < 0.05) after mechanical DNA-extraction as detected with qPCR, regardless of storage. Furthermore, the bacterial composition of Erec-group differed significantly after different DNA-extractions; after enzymatic DNA-extraction, the most prevalent genera detected were Roseburia (39% of clones) and Coprococcus (10%), whereas after mechanical DNA-extraction, the most prevalent genera were Blautia (30%), Coprococcus (13%), and Dorea (10%). According to our results, rigorous mechanical lysis enables detection of higher bacterial numbers and diversity from human fecal samples. As it was shown that the results of clostridial and actinobacterial populations are highly dependent on the DNA-extraction methods applied, the use of different DNA-extraction protocols may explain the contradictory results previously obtained. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  14. Dimethyl adipimidate/Thin film Sample processing (DTS); A simple, low-cost, and versatile nucleic acid extraction assay for downstream analysis.

    Science.gov (United States)

    Shin, Yong; Lim, Swee Yin; Lee, Tae Yoon; Park, Mi Kyoung

    2015-09-15

    Sample processing, especially that involving nucleic acid extraction, is a prerequisite step for the isolation of high quantities of relatively pure DNA for downstream analyses in many life science and biomedical engineering studies. However, existing methods still have major problems, including labor-intensive time-consuming methods and high costs, as well as requirements for a centrifuge and the complex fabrication of filters and membranes. Here, we first report a versatile Dimethyl adipimidate/Thin film based Sample processing (DTS) procedure without the limitations of existing methods. This procedure is useful for the extraction of DNA from a variety of sources, including 6 eukaryotic cells, 6 bacteria cells, and 2 body fluids in a single step. Specifically, the DTS procedure does not require a centrifuge and has improved time efficiency (30 min), affordability, and sensitivity in downstream analysis. We validated the DTS procedure for the extraction of DNA from human body fluids, as well as confirmed that the quality and quantity of the extracted DNA were sufficient to allow robust detection of genetic and epigenetic biomarkers in downstream analysis.

  15. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    Science.gov (United States)

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  16. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences

    Directory of Open Access Journals (Sweden)

    Brett eWagner Mackenzie

    2015-02-01

    Full Text Available The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation, with a smaller proportion of variation associated with DNA extraction method (technical variation and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  17. Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

    Science.gov (United States)

    The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

  18. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  19. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  20. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    NARCIS (Netherlands)

    Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

  1. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Science.gov (United States)

    Adamowicz, Michael S; Stasulli, Dominique M; Sobestanovich, Emily M; Bille, Todd W

    2014-01-01

    Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  2. Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

    Science.gov (United States)

    Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

    2017-03-01

    In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

  3. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  4. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. DNA extraction in Echinococcus granulosus and Taenia spp. eggs in dogs stool samples applying thermal shock.

    Science.gov (United States)

    Hidalgo, Alejandro; Melo, Angélica; Romero, Fernando; Hidalgo, Víctor; Villanueva, José; Fonseca-Salamanca, Flery

    2018-03-01

    The extraction of DNA in taeniid eggs shows complications attached to the composition of stool samples and the high resistance of eggs to degradation. The objective of this study was to test a method of DNA extraction in taeniid eggs by applying a thermal shock to facilitate the chemical-enzymatic degradation of these elements. A group of six tubes containing 1 ml of dog stool sample was spiked with eggs of Echinococcus granulosus and another group of six with Taenia pisiformis. Samples were floated with supersaturated sugar solution and centrifuged. The upper portion of each tube (500 μl) was aspirated and deposited in 1.5 ml tubes. Three tubes from each group were incubated at -20 °C and then at 90 °C, the remaining three from each group, incubated at room temperature. Proteinase K and lysis buffer were added to each tube and incubated for 12 h at 58 °C. The lysis effect was evaluated by microscopy at 3, 6 and 12 h and integrity by electrophoresis in 1% agarose gels. With the same experimental scheme, the thermal shock effect was evaluated in extractions of 1, 2, 3 and 4 eggs of each species and the DNA was quantified. Additionally, the protocol was applied in samples of 4 dogs diagnosed with natural infection by Taeniidae worms. Finally, all the extractions were tested by PCR amplification. Both E. granulosus and T. pisiformis eggs showed a similar response in the tests. In samples without treatment, the lysis effect was poor and showed no differences over time, but in those subjected to thermal shock, eggs degradation increased with time. In both treatments, there was no DNA loss integrity. The protocol applied to limited amounts of eggs yielded PCR products in 100% of the samples exposed to thermal shock, allowing PCR amplifications up to 1 egg. In non-exposed samples, the results were not replicable. However, DNA quantification showed low values in both treatments. In turn, DNA extractions with thermal shock in infected dog samples

  6. Development of a real-world direct interface for integrated DNA extraction and amplification in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenway, Gillian M; Greenman, John; Haswell, Stephen J

    2011-02-07

    Integrated DNA extraction and amplification have been carried out in a microfluidic device using electro-osmotic pumping (EOP) for fluidic control. All the necessary reagents for performing both DNA extraction and polymerase chain reaction (PCR) amplification were pre-loaded into the microfluidic device following encapsulation in agarose gel. Buccal cells were collected using OmniSwabs [Whatman™, UK] and manually added to a chaotropic binding/lysis solution pre-loaded into the microfluidic device. The released DNA was then adsorbed onto a silica monolith contained within the DNA extraction chamber and the microfluidic device sealed using polymer electrodes. The washing and elution steps for DNA extraction were carried out using EOP, resulting in transfer of the eluted DNA into the PCR chamber. Thermal cycling, achieved using a Peltier element, resulted in amplification of the Amelogenin locus as confirmed using conventional capillary gel electrophoresis. It was demonstrated that the PCR reagents could be stored in the microfluidic device for at least 8 weeks at 4 °C with no significant loss of activity. Such methodology lends itself to the production of 'ready-to-use' microfluidic devices containing all the necessary reagents for sample processing, with many obvious applications in forensics and clinical medicine.

  7. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  8. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

  9. Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

    2006-08-14

    Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

  10. Standardization of solvent extraction procedure for determination of uranium in seawater

    International Nuclear Information System (INIS)

    Sukanta Maity; Sahu, S.K.; Pandit, G.G.

    2015-01-01

    Solvent extraction procedure using ammonium pyrolidine dithiocarbamate complexing agent in methyl isobutyl ketone organic phase and acid exchange back-extraction is described for the simultaneous quantitative pre-concentration of uranium in seawater followed by its determination by differential pulse adsorptive stripping voltammetry. Solvent extraction time is optimized for extraction of uranium from seawater. Solvent extraction efficiency for uranium in seawater at different pH was carried out. The method gives a recovery of 98 ± 2 % for 400 mL sample at pH 3.0 ± 0.02, facilitating the rapid and interference free analysis of seawater samples. (author)

  11. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Science.gov (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  12. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by 32P-postlabeling

    International Nuclear Information System (INIS)

    Randerath, E.; Zhou, G.D.; Donnelly, K.C.; Safe, S.H.; Randerath, K.

    1996-01-01

    In the present study, a mouse bioassay was used in combination with 32 P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10 6 DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10 7 or 1.2 x 10 7 DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the 32 P-labeled derivative of the reaction product of 7β, 8α-dihydroxy-9α, 10α-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N 2 of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs

  13. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

    2015-01-01

    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  14. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  15. Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

    DEFF Research Database (Denmark)

    Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

    2013-01-01

    Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......-time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

  16. Impact of Sample Type and DNA Isolation Procedure on Genomic Inference of Microbiome Composition

    DEFF Research Database (Denmark)

    Knudsen, Berith Elkær; Bergmark, Lasse; Munk, Patrick

    2016-01-01

    that in standard protocols. Based on this insight, we designed an improved DNA isolation procedure optimized for microbiome genomics that can be used for the three examined specimen types and potentially also for other biological specimens. A standard operating procedure is available from https://dx.doi.org/10......Explorations of complex microbiomes using genomics greatly enhance our understanding about their diversity, biogeography, and function. The isolation of DNA from microbiome specimens is a key prerequisite for such examinations, but challenges remain in obtaining sufficient DNA quantities required...... for certain sequencing approaches, achieving accurate genomic inference of microbiome composition, and facilitating comparability of findings across specimen types and sequencing projects. These aspects are particularly relevant for the genomics-based global surveillance of infectious agents and antimicrobial...

  17. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  18. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

  19. Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

    Science.gov (United States)

    Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

    2012-11-20

    The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

  20. Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

    Science.gov (United States)

    Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

    2016-01-01

    FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

  1. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Science.gov (United States)

    Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

    2016-01-01

    The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  2. The fruit extract of Berberis crataegina DC: exerts potent antioxidant activity and protects DNA integrity.

    Science.gov (United States)

    Charehsaz, Mohammad; Sipahi, Hande; Celep, Engin; Üstündağ, Aylin; Cemiloğlu Ülker, Özge; Duydu, Yalçın; Aydın, Ahmet; Yesilada, Erdem

    2015-04-17

    Dried fruits of Berberis crataegina (Berberidaceae) have been frequently consumed as food garniture in Turkish cuisine, while its fruit paste has been used to increase stamina and in particular to prevent from cardiovascular dysfunctions in Northeastern Black Sea region of Turkey. This study investigated this folkloric information in order to explain the claimed healing effects as well as to evaluate possible risks. Total phenolic, flavonoid and proanthocyanidin contents and antioxidant capacity of the methanolic fruit extract were evaluated through several in vitro assays. The cytotoxic and genotoxic effects of B. crataegina fruit extract were also assessed in both cervical cancer cell line (HeLa) and human peripheral blood lymphocytes. The extract showed protective effects against ferric-induced oxidative stress and had a relatively good antioxidant activity. It also ameliorated the H2O2 mediated DNA damage in lymphocytes, suggesting the protective effect against oxidative DNA damage. The methanolic extract of B. crataegina fruits may be a potential antioxidant nutrient and also may exert a protective role against lipid peroxidation as well as oxidative DNA damage.

  3. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Directory of Open Access Journals (Sweden)

    Michael S Adamowicz

    Full Text Available Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  4. Avaliação de dois métodos de extração de DNA de material parafinado para amplificação em PCR Evaluation of two methods of DNA extraction from paraffin-embedded material for PCR amplification

    Directory of Open Access Journals (Sweden)

    Luciana Estevam Simonato

    2007-04-01

    Full Text Available INTRODUÇÃO: Diversos métodos para extração de DNA a partir de tecidos biológicos inclusos em parafina encontram-se descritos na literatura, sendo o sucesso desse procedimento de grande importância para a realização de métodos moleculares de diagnóstico empregando a reação em cadeia da polimerase (PCR. OBJETIVO: Este estudo avaliou dois métodos de extração de DNA de material parafinado, visando à amplificação do DNA genômico pela técnica da PCR. MATERIAL E MÉTODO: Foram utilizadas 35 amostras de casos de carcinoma epidermóide de assoalho bucal diagnosticados e tratados no Centro de Oncologia Bucal da Universidade Estadual Paulista (Unesp. Os métodos de extração de DNA avaliados incluíram: 1. digestão com proteinase K seguida por purificação com Chelex 100® (BioRad; e 2. sistema QIAamp DNA minikit® (Qiagen. O DNA obtido foi quantificado por espectrofotometria e amplificado pela técnica da PCR, utilizando-se oligonucleotídeos iniciadores para betaglobina. RESULTADOS: A concentração de DNA obtido do material extraído com o primeiro método apresentou média de 120,62 ng/µl com razão entre as leituras das absorbâncias 260/280 variando de 0,8 a 1,41. Para as amostras extraídas com o segundo procedimento, o rendimento médio foi de 67,38 ng/µl, no entanto a razão 260/280 variou entre 1,11 e 2,53. O material foi submetido à PCR e, das 35 amostras extraídas com cada método, respectivamente, 29 e 30 apresentaram sinal positivo. CONCLUSÃO: Os dois métodos utilizados para obtenção de DNA de material parafinado apresentaram desempenho semelhante, revelando que ambos têm potencial para auxiliar na prática da biologia molecular diagnóstica, assim como no estudo diagnóstico retrospectivo em material parafinizado.BACKGROUND: There are several methods for DNA extraction from formalin-fixed paraffin-embedded tissues reported in the literature. High success rate on this procedure is important for the use of

  5. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  6. Comparative analysis of environmental DNA extraction and purification methods from different humic acid rich soils

    CSIR Research Space (South Africa)

    Lakay, FM

    2007-01-01

    Full Text Available Three different soil DNA isolation and four purification strategies were compared on different soil samples with variable rates of success. Bead beating extraction gave significantly higher DNA yields than microwave-based and liquid nitrogen...

  7. An Optimized Protocol for DNA Extraction from Wheat Seeds and Loop-Mediated Isothermal Amplification (LAMP to Detect Fusarium graminearum Contamination of Wheat Grain

    Directory of Open Access Journals (Sweden)

    Mohamed Moslem

    2011-06-01

    Full Text Available A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  8. Isolation of high-quality DNA in 16 aromatic and medicinal Colombian species using silica-based extraction columns

    Directory of Open Access Journals (Sweden)

    Vega Vela Nelson Enrique

    2011-12-01

    Full Text Available

    Aromatic and medicinal plant species are a valuable resource for research and development of pharmaceutical, cosmetic, crop protection and nutritional agents, due to the high amount of bioactive phytochemicals that they contain. However, these compounds are a major obstacle in the isolation of high-quality DNA suitable for genetic analyses. In this paper, we report a protocol that optimizes the use of the cationic detergent CTAB and the reductant β-mercaptoethanol in cell lysis. The elimination of plant secondary metabolites such as polysaccharides and polyphenols, that typically co-isolate with DNA, was achieved using the chemical denaturing properties of the guanidinium cation, which together with the adsorbent chemical specificity of the silica, resulted in the purification of high-quality DNA suitable for digestion with restriction enzymes and optimal for PCR amplification of AFLP-type molecular markers. This protocol was evaluated on 16 Colombian aromatic and medicinal plant species promising for their essential oils. The results allow suggesting that this procedure might be appropriate for other species, tissues and sample types recalcitrant to DNA extraction.

  9. An improved method for genomic DNA extraction from strawberry leaves Otimização de um método para extração de DNA genômico a partir de folhas de morangueiro

    Directory of Open Access Journals (Sweden)

    Claudinéia Ferreira Nunes

    2011-08-01

    Full Text Available Several extraction methods of genomic DNA for identification and characterization of genetic diversity in different plant species are routinely applied during molecular analysis. However, the presence of undesirable compounds such as polyphenols and polysaccharides is one of the biggest problems faced during the isolation and purification of high quality DNA in plants. Therefore, achievement of fast and accurate methods for DNA extraction is crucial in order to produce pure samples. Leaves of strawberry genotypes (Fragaria ananassa have high contents of polysaccharides and polyphenols which increase the sample viscosity and decrease the DNA quality, interfering with the PCR performance. Thereby, in this study we evaluated the quality and amount of genomic DNA extracted from young leaves of strawberry after tissue lyophilization and maceration in presence of polivinilpirrolidone (PVP. The CTAB method was used as reference procedure and it was modified to improve the DNA extraction. The modifications consisted of tissue lyophilization overnight until it was completely freeze-dried and addition of PVP during the tissue maceration in liquid nitrogen. The results showed the efficiency and reliability of the modified method compared to the unmodified method, indicating that combination of lyophilization and PVP improve the quality and amount of the DNA extracted from strawberry leaves.Vários métodos de extração de DNA genômico para a identificação e caracterização da diversidade genética em diferentes espécies de plantas são rotineiramente aplicados durante a análise molecular. Entretanto, a presença de compostos indesejáveis, tais como polifenóis e polissacarídeos, é um dos maiores problemas que ocorrem durante o isolamento e purificação de DNA de alta qualidade em plantas. Dessa forma, o sucesso no desenvolvimento de métodos de extração de DNA rápidos e acurados é crucial para produzir amostras puras. Folhas de genótipos de

  10. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. Effects of an extract from the sea squirt Ecteinascidia turbinata on DNA synthesis and excision repair in human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Dunn, W.C.; Carrier, W.L.; Regan, J.D.

    1982-01-01

    An aqueous ethanol extract from the marine tunicate species Ecteinascidia turbinata was studied to determine its effect on semiconservative DNA synthesis in human skin fibroblast cultures as measured by (/sup 3/H) thymidine uptake in acid-insoluble cell fractions. In addition, the effect of this extract on DNA excision repair in ultraviolet light (254 nm) irradiated fibroblasts was measured by the bromodeoxyuridine photolysis assay, thymine dimer chromatography, and DNA single-strand break analysis on alkaline sucrose gradients. Repair inhibition was accompanied by an accumulation of single-strand DNA breaks which was enhanced by the addtion of 2 mM hydroxyurea. These results are discussed with respect to a mechanism of action of the marine tunicate extract at the level of DNA polymerases and are contrasted with previously studied inhibitory mechanisms of arabinofuranosyl nucleosides.

  12. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Directory of Open Access Journals (Sweden)

    Junya Yamagishi

    Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  13. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows.

    Science.gov (United States)

    Vaidya, Jueeli D; van den Bogert, Bartholomeus; Edwards, Joan E; Boekhorst, Jos; van Gastelen, Sanne; Saccenti, Edoardo; Plugge, Caroline M; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini) differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100), 67% GS and 33% maize silage (GS67MS33), 33% GS and 67% MS (GS33MS67), or 100% MS (MS100). An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method ( p anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA) of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction ( p = 0.012), and that PBB ( p = 0.012) and FDSS ( p = 0.024) also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In summary, the comprehensive assessment of observed communities of bacteria, archaea and anaerobic fungi described here provides insight into a rational basis for selecting an optimal methodology to obtain a representative picture of the rumen microbiota.

  14. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing...

  15. Automated extraction of genomic DNA from medically important yeast species and filamentous fungi by using the MagNA Pure LC system.

    Science.gov (United States)

    Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

    2002-06-01

    A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (10(5) to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sensitivity when DNA was extracted manually; in 9 of 28 runs, we could achieve a higher sensitivity of 1 CFU/ml blood, which was found to be significant (p DNA from all fungal species analyzed could be extracted and amplified by real-time PCR. Negative controls from all MagNA Pure isolations remained negative. Sixty-three clinical samples showed identical results by both methods, whereas in 4 of 67 samples, discordant results were obtained. Thus, the MagNA Pure LC technique offers a fast protocol for automated DNA isolation from numerous fungi, revealing high sensitivity and purity.

  16. DNA damage induced in mouse tissues by organic wood preserving waste extracts as assayed by {sup 32}P-postlabeling

    Energy Technology Data Exchange (ETDEWEB)

    Randerath, E. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Zhou, G.D. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States); Donnelly, K.C. [Department of Veterinary Anatomy and Public Health, Texas A and M University, College Station, TX (United States); Safe, S.H. [Department of Veterinary Physiology/Pharmacology, Texas A and M University, College Station, TX (United States); Randerath, K. [Division of Toxicology, Department of Pharmacology, Baylor College of Medicine, Houston, TX (United States)

    1996-09-01

    In the present study, a mouse bioassay was used in combination with {sup 32}P-postlabeling to determine DNA adduct formation induced by hexane/acetone extracts of two samples from a WPW site. Female ICR mice were treated dermally with extract corresponding to 3 mg residue or vehicle control once per day for 2 days and killed 24 h later. Skin, lung, liver, kidney, and heart DNA preparations were assayed by nuclease P1-enhanced postlabeling. Adduct profiles were tissue-specific and displayed a multitude of non-polar DNA adducts with levels amounting to one adduct in 1.6 x 10{sup 6} DNA nucleotides in skin (both extracts) and one adduct in 3.2 x 10{sup 7} or 1.2 x 10{sup 7} DNA nucleotides in liver (extract 1 or extract 2). Based on their chromatographic properties, these adducts appeared largely derived from polycyclic aromatic hydrocarbons (PAHs) present in the extracts. One of the major adducts was identified as the {sup 32}P-labeled derivative of the reaction product of 7{beta}, 8{alpha}-dihydroxy-9{alpha}, 10{alpha}-epoxy-7, 8, 9, 10-tetrahydrobenzo[a]pyrene (BPDE I) with N{sup 2} of deoxyguanosine. Total non-polar DNA adduct levels were highest in skin and lung, amounting to 17.4 and 24.0% of the skin values for extracts 1 and 2, respectively, in lung while the corresponding levels in liver were 5.0 and 12.6%. These results were in accord with the carcinogenic potencies of PAHs in these organs. Extract 2 induced higher adduct levels in internal organs, although its PAH concentrations were lower than those of extract 1, i.e. lung, liver, kidney, and heart had 1.4, 2.5, 1.9, and 1.7 times higher total adduct levels and 1.6, 3.3, 1.6, and 1.9 times higher benzo[a]pyrene adduct levels. With the exception of total adducts in lung, the differences between the two extracts were all significant, suggestive of compound interactions. (orig.) (orig.). With 5 figs., 6 tabs.

  17. Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

    Science.gov (United States)

    Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao

    2018-05-25

    Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

  18. Comparação de seis métodos de extração de DNA genômico de Giardia duodenalis

    Directory of Open Access Journals (Sweden)

    Paulo Henrique Exterchoter Weiss

    2016-05-01

    Methods: Suitable DNA samples for genotypic amplification protocols were obtained by means of PCR, comparing six methods for DNA extraction from G. duodenalis cysts in purified and unpurified samples: QIAmp DNA Stool Mini kit, freeze-thaw procedure, sonication glass bead disruption, formamide denaturation, and conventional method (phenol/chloroform.Results: The methods of sonication and the use of glass beads were more effective in extracting DNA. There was no difference between the use of purified and unpurified samples for protozoan DNA extraction.Conclusions: In the present study we verified that both purified and unpurified samples can be used to G. duodenalis DNA extraction.Though various DNA extraction methods are recommended in the literature, the use of sonicator and glass beads were more effective in this study.

  19. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Wang, Z.; Wu, X.; Friedberg, E.C.

    1993-01-01

    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  20. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

    2013-01-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...

  1. Evaluation of simplified dna extraction methods for EMM typing of group a streptococci

    Directory of Open Access Journals (Sweden)

    Jose JJM

    2006-01-01

    Full Text Available Simplified methods of DNA extraction for amplification and sequencing for emm typing of group A streptococci (GAS can save valuable time and cost in resource crunch situations. To evaluate this, we compared two methods of DNA extraction directly from colonies with the standard CDC cell lysate method for emm typing of 50 GAS strains isolated from children with pharyngitis and impetigo. For this, GAS colonies were transferred into two sets of PCR tubes. One set was preheated at 94oC for two minutes in the thermal cycler and cooled while the other set was frozen overnight at -20oC and then thawed before adding the PCR mix. For the cell lysate method, cells were treated with mutanolysin and hyaluronidase before heating at 100oC for 10 minutes and cooling immediately as recommended in the CDC method. All 50 strains could be typed by sequencing the hyper variable region of the emm gene after amplification. The quality of sequences and the emm types identified were also identical. Our study shows that the two simplified DNA extraction methods directly from colonies can conveniently be used for typing a large number of GAS strains easily in relatively short time.

  2. Comparison of seven DNA extraction and ampliffication protocols in historical herbarium specimens of Juncaceae

    Czech Academy of Sciences Publication Activity Database

    Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír

    2002-01-01

    Roč. 20, - (2002), s. 161-175 ISSN 0735-9640 R&D Projects: GA MŠk LN00A079; GA ČR GA206/02/0355 Institutional research plan: CEZ:AV0Z6005908 Keywords : cpDNA * DNA extraction * herbarium specimens Subject RIV: EF - Botanics Impact factor: 0.803, year: 2002

  3. Recovery of DNA for forensic analysis from lip cosmetics.

    Science.gov (United States)

    Webb, L G; Egan, S E; Turbett, G R

    2001-11-01

    To obtain a reference DNA profile from a missing person, we analyzed a variety of personal effects, including two lip cosmetics, both of which gave full DNA profiles. Further investigations were undertaken to explore this previously unreported source of DNA. We have tested a range of brands and types of lip cosmetics. Our studies have revealed that lip cosmetics are an excellent source of DNA, with almost 80% of samples giving a result. However, artifacts are frequently observed in the DNA profiles when Chelex is used for the DNA extraction and additional DNA purification procedures are required to ensure that an accurate DNA profile is obtained.

  4. High-capacity conductive nanocellulose paper sheets for electrochemically controlled extraction of DNA oligomers.

    Directory of Open Access Journals (Sweden)

    Aamir Razaq

    Full Text Available Highly porous polypyrrole (PPy-nanocellulose paper sheets have been evaluated as inexpensive and disposable electrochemically controlled three-dimensional solid phase extraction materials. The composites, which had a total anion exchange capacity of about 1.1 mol kg(-1, were used for extraction and subsequent release of negatively charged fluorophore tagged DNA oligomers via galvanostatic oxidation and reduction of a 30-50 nm conformal PPy layer on the cellulose substrate. The ion exchange capacity, which was, at least, two orders of magnitude higher than those previously reached in electrochemically controlled extraction, originated from the high surface area (i.e. 80 m(2 g(-1 of the porous composites and the thin PPy layer which ensured excellent access to the ion exchange material. This enabled the extractions to be carried out faster and with better control of the PPy charge than with previously employed approaches. Experiments in equimolar mixtures of (dT(6, (dT(20, and (dT(40 DNA oligomers showed that all oligomers could be extracted, and that the smallest oligomer was preferentially released with an efficiency of up to 40% during the reduction of the PPy layer. These results indicate that the present material is very promising for the development of inexpensive and efficient electrochemically controlled ion-exchange membranes for batch-wise extraction of biomolecules.

  5. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  6. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  7. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    2012-01-01

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  8. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  9. Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

    Science.gov (United States)

    Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

    2016-04-01

    Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  11. Replication of UV-irradiated DNA in human cell extracts: Evidence for mutagenic bypass of pyrimidine dimers

    International Nuclear Information System (INIS)

    Thomas, D.C.; Kunkel, T.A.

    1993-01-01

    The authors have examined the efficiency and fidelity of simian virus 40-origin-dependent replication of UV-irradiated double-stranded DNA in extracts of human cells. Using as a mutational target the α-complementation domain of the Escherichia coli lacZ gene in bacteriophage M13mp2DNA, replication of undamaged DNA in HeLa cell extracts was highly accurate, whereas replication of DNA irradiated with UV light (280-320 nm) was both less efficient and less accurate. Replication was inhibited by irradiation in a dose-dependent manner. Nonetheless, covalently closed, monomer-length circular products were generated that were resistant to digestion by Dpn I, showing that they resulted from semiconservative replication. These products were incised by T4 endonuclease V, whereas the undamaged replication products were not, suggesting that pyrimidine dimers were bypassed during replication. When replicated, UV-irradiated DNA was used to transfect an E. coli α-complementation host strain to score mutant M13mp2 plaques, the mutant plaque frequency was substantially higher than that obtained with either unirradiated, replicated DNA, or unreplicated, UV-irradiated DNA. Both the increased mutagenicity and the inhibition of replication associated with UV irradiation were reversed by treatment of the irradiated DNA with photolyase before replication. Sequence analysis of mutants resulting from replication of UV-irradiated DNA demonstrated that most mutants contained C → T transition errors at dipyrimidine sites. A few mutants contained 1-nt frameshift errors or tandem double CC → TT substitutions. The data are consistent with the interpretation that pyrimidine dimers are bypassed during replication by the multiprotein replication apparatus in human cell extracts and that this bypass is mutagenic primarily via misincorporation of dAMP opposite a cytosine (or uracil) in the dimer. 56 refs., 2 figs., 3 tabs

  12. Overcoming DNA extraction problems from carnivorous plants

    Directory of Open Access Journals (Sweden)

    Fleischmann, Andreas

    2009-12-01

    Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

    Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

  13. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Žel Jana

    2006-08-01

    Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

  14. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Science.gov (United States)

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

  15. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  16. Antioxidant Activity of Lawsonia inermis Extracts Inhibits Chromium(VI-Induced Cellular and DNA Toxicity

    Directory of Open Access Journals (Sweden)

    Gunjan Guha

    2011-01-01

    Full Text Available Hexavalent chromium Cr(VI is a very strong oxidant which consequently causes high cytotoxicity through oxidative stress. Prevention of Cr(VI-induced cellular damage has been sought in this study in aqueous and methanolic extracts of Lawsonia inermis Linn. (Lythraceae, commonly known as Henna. The extracts showed significant (P < .05 potential in scavenging free radicals (DPPH• and ABTS•+ and Fe3+, and in inhibiting lipid peroxidation. DNA damage caused by exposure of pBR322 to Cr(VI-UV is markedly inhibited by both extracts in varying degrees. A distinct decline in Cr(VI-induced cytotoxicity was noticed in MDA-MB-435S (human breast carcinoma cells with an increase in dosage of both extracts individually. Furthermore, both extracts proved to contain a high content of phenolic compounds which were found to have a strong and significant (P < .05 positive correlation to the radical scavenging potential, lipid peroxidation inhibition capacity and cyto-protective efficiency against Cr(VI-induced oxidative cellular damage. HPLC analysis identified some of the major phenolic compounds in both extracts, which might be responsible for the antioxidant potential and the properties of DNA and cyto-protection. This study contributes to the search for natural resources that might yield potent therapeutic drugs against Cr(VI-induced oxidative cell damage.

  17. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... The effects of three different grinding methods in DNA extraction of cowpea .... 100 mg of the leaf tissues were weighed in an electronic balance. CTAB method .... The primers were synthesized by Life Technologies (AB & Invitrogen). .... This work was supported by 'Shuang-Zhi Plan' of Sichuan. Agricultural ...

  18. Efficient recovery of environmental DNA for expression cloning by indirect extraction methods

    NARCIS (Netherlands)

    Gabor, Esther; de Vries, Erik; Janssen, DB

    2003-01-01

    Using direct and cell extraction-based (indirect) isolation methods, DNA was obtained from environmental samples with largely differing characteristics (loam soil, sand soil, sediment, activated sludge, and compost) and evaluated with respect to the comprised bacterial diversity and its suitability

  19. Using a commercially available DNA extraction kit to obtain high quality human genomic DNA suitable for PCR and genotyping from 11-year-old saliva saturated cotton spit wads

    Directory of Open Access Journals (Sweden)

    Hudziak James J

    2008-12-01

    Full Text Available Abstract Background We sought to describe the integrity of human genomic DNA extracted from saliva saturated cotton spit wads stored at -20°C for approximately 11 years. 783 spit wad samples were collected from an ADHD sample population (Vermont Family Study during 1996–2000. Human genomic DNA was extracted from the spit wads using a commercially available kit; QIAamp DNA Blood Midi Kit (Qiagen, Inc., Valencia, CA. with a few modifications. Results The resulting DNA yield was more than adequate for genetic analysis and ranged from approximately 1 μg to a total of 80 μg (mean 17.3 μgs ± 11.9 μgs. A260/A280 ratios for the human genomic DNA extracted from the spit wads was consistently within the generally acceptable values of 1.7–2.0, with the lowest purity being 1.70, and a mean value of 1.937 ± 0.226 for the 783 samples. The DNA also was suitable for PCR reactions as evidenced by the amplification of the serotonin-transporter-linked polymorphic region, 5HTTLPR. 5HTTLPR is a functional polymorphism in the promoter region of the serotonin transporter gene (HTT, SLC6A4, or SERT, consisting of two intensively studied alleles. 770 of the 783 samples (98.3% produced fragments after PCR of the expected size with primers specific for 5HTTLPR. Conclusion High quality and abundant genomic DNA can be successfully retrieved from saliva saturated cotton spit wads using the commercially available kit, QIAamp DNA Blood Midi Kit from Qiagen, Inc. Furthermore, the DNA can be extracted in less than 3 hours and multiple samples can be processed simultaneously thus reducing processing time.

  20. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  1. Comparative analysis of different DNA extraction protocols in fresh and herbarium specimens of the genus Dalbergia.

    Science.gov (United States)

    Ribeiro, R A; Lovato, M B

    2007-03-29

    Five published DNA extraction protocols were compared for their ability to produce good quality DNA from fresh and herbarium leaves of several species of the genus Dalbergia. The leaves of these species contain high amounts of secondary metabolites, which make it difficult to perform a clean DNA extraction and thereby interfering with subsequent PCR amplification. The protocol that produced the best DNA quality in most of the Dalbergia species analyzed, utilizes polyvinylpyrrolidone to bind the phenolic compounds, a high molar concentration of NaCl to inhibit co-precipitation of polysaccharides and DNA, and LiCl for removing RNA by selective precipitation. The DNA quality of herbarium specimens was worse than that for fresh leaves, due to collecting conditions and preservation of samples. We analyzed 54 herbarium specimens, but the recovered DNA allowed successful PCR amplification in only eight. For the genus Dalbergia, the herbarium is an important source of material for phylogenetic and evolutionary studies; due to the occurrence of the different species in various geographical regions in Brazil, it is difficult to obtain fresh material in nature. Our results demonstrated that for Dalbergia species the methods used for the collection and preservation of herbarium specimens have a mayor influence on DNA quality and in the success of phylogenetic studies of the species.

  2. A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

    Directory of Open Access Journals (Sweden)

    Trzewik Aleksandra

    2016-01-01

    Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

  3. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2016-10-01

    Full Text Available The spore-forming microbiota is mainly responsible for the deterioration of pasteurized milk with long shelf life in the United States. The identification of these microorganisms, using molecular tools, is of particular importance for the maintenance of the quality of milk. However, these molecular techniques are not only costly but also labor-intensive and time-consuming. The aim of this study was to compare the efficiency of boiling in conjunction with four other methods for the genomic DNA extraction of sporulated bacteria with proteolytic and lipolytic potential isolated from raw milk in the states of Paraná and Maranhão, Brazil. Protocols based on cellular lysis by enzymatic digestion, phenolic extraction, microwave-heating, as well as the use of guanidine isothiocyanate were used. This study proposes a method involving simple boiling for the extraction of genomic DNA from these microorganisms. Variations in the quality and yield of the extracted DNA among these methods were observed. However, both the cell lysis protocol by enzymatic digestion (commercial kit and the simple boiling method proposed in this study yielded sufficient DNA for successfully carrying out the Polymerase Chain Reaction (PCR of the rpoB and 16S rRNA genes for all 11 strains of microorganisms tested. Other protocols failed to yield sufficient quantity and quality of DNA from all microorganisms tested, since only a few strains have showed positive results by PCR, thereby hindering the search for new microorganisms. Thus, the simple boiling method for DNA extraction from sporulated bacteria in spoiled milk showed the same efficacy as that of the commercial kit. Moreover, the method is inexpensive, easy to perform, and much less time-consuming.

  4. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    Science.gov (United States)

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  5. Evaluation of Antioxidant and DNA Damage Protection Activity of the Hydroalcoholic Extract of Desmostachya bipinnata L. Stapf

    Directory of Open Access Journals (Sweden)

    Upendarrao Golla

    2014-01-01

    Full Text Available Desmostachya bipinnata Stapf (Poaceae/Gramineae is an official drug of ayurvedic pharmacopoeia. Various parts of this plant were used extensively in traditional and folklore medicine to cure various human ailments. The present study was aimed to evaluate the antioxidant and DNA damage protection activity of hydroalcoholic extract of Desmostachya bipinnata both in vitro and in vivo, to provide scientific basis for traditional usage of this plant. The extract showed significant antioxidant activity in a dose-dependent manner with an IC50 value of 264.18±3.47 μg/mL in H2O2 scavenging assay and prevented the oxidative damage to DNA in presence of DNA damaging agent (Fenton’s reagent at a concentration of 50 μg/mL. Also, the presence of extract protected yeast cells in a dose-dependent manner against DNA damaging agent (Hydroxyurea in spot assay. Moreover, the presence of extract exhibited significant antioxidant activity in vivo by protecting yeast cells against oxidative stressing agent (H2O2. Altogether, the results of current study revealed that Desmostachya bipinnata is a potential source of antioxidants and lends pharmacological credence to the ethnomedical use of this plant in traditional system of medicine, justifying its therapeutic application for free-radical-induced diseases.

  6. A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

    Science.gov (United States)

    Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

    2001-12-01

    Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

  7. Genotyping for DQA1 and PM loci in urine using PCR-based amplification: effects of sample volume, storage temperature, preservatives, and aging on DNA extraction and typing.

    Science.gov (United States)

    Vu, N T; Chaturvedi, A K; Canfield, D V

    1999-05-31

    Urine is often the sample of choice for drug screening in aviation/general forensic toxicology and in workplace drug testing. In some instances, the origin of the submitted samples may be challenged because of the medicolegal and socioeconomic consequences of a positive drug test. Methods for individualization of biological samples have reached a new boundary with the application of the polymerase chain reaction (PCR) in DNA profiling, but a successful characterization of the urine specimens depends on the quantity and quality of DNA present in the samples. Therefore, the present study investigated the influence of storage conditions, sample volume, concentration modes, extraction procedures, and chemical preservations on the quantity of DNA recovered, as well as the success rate of PCR-based genotyping for DQA1 and PM loci in urine. Urine specimens from male and female volunteers were divided and stored at various temperatures for up to 30 days. The results suggested that sample purification by dialfiltration, using 3000-100,000 molecular weight cut-off filters, did not enhance DNA recovery and typing rate as compared with simple centrifugation procedures. Extraction of urinary DNA by the organic method and by the resin method gave comparable typing results. Larger sample volume yielded a higher amount of DNA, but the typing rates were not affected for sample volumes between 1 and 5 ml. The quantifiable amounts of DNA present were found to be greater in female (14-200 ng/ml) than in male (4-60 ng/ml) samples and decreased with the elapsed time under both room temperature (RT) and frozen storage. Typing of the male samples also demonstrated that RT storage samples produced significantly higher success rates than that of frozen samples, while there was only marginal difference in the DNA typing rates among the conditions tested using female samples. Successful assignment of DQA1 + PM genotype was achieved for all samples of fresh urine, independent of gender

  8. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... This makes coffee seed as one of the important material for molecular marker ... homogenised in 10 ml of freshly prepared extraction buffer (200. mM Tris-HCl pH 8.0, .... DNA material for particular molecular analysis. This method will be ... Pharmawati M, Yan G, Sedgley R, Finnegan PM (2004). Chloroplast.

  9. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  10. Automated Extraction of Genomic DNA from Medically Important Yeast Species and Filamentous Fungi by Using the MagNA Pure LC System

    OpenAIRE

    Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

    2002-01-01

    A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (105 to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sen...

  11. Comparison of DNA quantification methodology used in the DNA extraction protocol for the UK Biobank cohort.

    Science.gov (United States)

    Welsh, Samantha; Peakman, Tim; Sheard, Simon; Almond, Rachael

    2017-01-05

    UK Biobank is a large prospective cohort study in the UK established by the Medical Research Council (MRC) and the Wellcome Trust to enable approved researchers to investigate the role of genetic factors, environmental exposures and lifestyle in the causes of major diseases of late and middle age. A wide range of phenotypic data has been collected at recruitment and has recently been enhanced by the UK Biobank Genotyping Project. All UK Biobank participants (500,000) have been genotyped on either the UK Biobank Axiom® Array or the Affymetrix UK BiLEVE Axiom® Array and the workflow for preparing samples for genotyping is described. The genetic data is hoped to provide further insight into the genetics of disease. All data, including the genetic data, is available for access to approved researchers. Data for two methods of DNA quantification (ultraviolet-visible spectroscopy [UV/Vis]) measured on the Trinean DropSense™ 96 and PicoGreen®) were compared by two laboratories (UK Biobank and Affymetrix). The sample processing workflow established at UK Biobank, for genotyping on the custom Affymetrix Axiom® array, resulted in high quality DNA (average DNA concentration 38.13 ng/μL, average 260/280 absorbance 1.91). The DNA generated high quality genotype data (average call rate 99.48% and pass rate 99.45%). The DNA concentration measured on the Trinean DropSense™ 96 at UK Biobank correlated well with DNA concentration measured by PicoGreen® at Affymetrix (r = 0.85). The UK Biobank Genotyping Project demonstrated that the high throughput DNA extraction protocol described generates high quality DNA suitable for genotyping on the Affymetrix Axiom array. The correlation between DNA concentration derived from UV/Vis and PicoGreen® quantification methods suggests, in large-scale genetic studies involving two laboratories, it may be possible to remove the DNA quantification step in one laboratory without affecting downstream analyses. This would result in

  12. Advances in forensic DNA quantification: a review.

    Science.gov (United States)

    Lee, Steven B; McCord, Bruce; Buel, Eric

    2014-11-01

    This review focuses upon a critical step in forensic biology: detection and quantification of human DNA from biological samples. Determination of the quantity and quality of human DNA extracted from biological evidence is important for several reasons. Firstly, depending on the source and extraction method, the quality (purity and length), and quantity of the resultant DNA extract can vary greatly. This affects the downstream method as the quantity of input DNA and its relative length can determine which genotyping procedure to use-standard short-tandem repeat (STR) typing, mini-STR typing or mitochondrial DNA sequencing. Secondly, because it is important in forensic analysis to preserve as much of the evidence as possible for retesting, it is important to determine the total DNA amount available prior to utilizing any destructive analytical method. Lastly, results from initial quantitative and qualitative evaluations permit a more informed interpretation of downstream analytical results. Newer quantitative techniques involving real-time PCR can reveal the presence of degraded DNA and PCR inhibitors, that provide potential reasons for poor genotyping results and may indicate methods to use for downstream typing success. In general, the more information available, the easier it is to interpret and process the sample resulting in a higher likelihood of successful DNA typing. The history of the development of quantitative methods has involved two main goals-improving precision of the analysis and increasing the information content of the result. This review covers advances in forensic DNA quantification methods and recent developments in RNA quantification. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Reconstitution of the cellular response to DNA damage in vitro using damage-activated extracts from mammalian cells

    International Nuclear Information System (INIS)

    Roper, Katherine; Coverley, Dawn

    2012-01-01

    In proliferating mammalian cells, DNA damage is detected by sensors that elicit a cellular response which arrests the cell cycle and repairs the damage. As part of the DNA damage response, DNA replication is inhibited and, within seconds, histone H2AX is phosphorylated. Here we describe a cell-free system that reconstitutes the cellular response to DNA double strand breaks using damage-activated cell extracts and naïve nuclei. Using this system the effect of damage signalling on nuclei that do not contain DNA lesions can be studied, thereby uncoupling signalling and repair. Soluble extracts from G1/S phase cells that were treated with etoposide before isolation, or pre-incubated with nuclei from etoposide-treated cells during an in vitro activation reaction, restrain both initiation and elongation of DNA replication in naïve nuclei. At the same time, H2AX is phosphorylated in naïve nuclei in a manner that is dependent upon the phosphatidylinositol 3-kinase-like protein kinases. Notably, phosphorylated H2AX is not focal in naïve nuclei, but is evident throughout the nucleus suggesting that in the absence of DNA lesions the signal is not amplified such that discrete foci can be detected. This system offers a novel screening approach for inhibitors of DNA damage response kinases, which we demonstrate using the inhibitors wortmannin and LY294002. -- Highlights: ► A cell free system that reconstitutes the response to DNA damage in the absence of DNA lesions. ► Damage-activated extracts impose the cellular response to DNA damage on naïve nuclei. ► PIKK-dependent response impacts positively and negatively on two separate fluorescent outputs. ► Can be used to screen for inhibitors that impact on the response to damage but not on DNA repair. ► LY294002 and wortmannin demonstrate the system's potential as a pathway focused screening approach.

  14. Development and characterization of a green procedure for apigenin extraction from Scutellaria barbata D. Don.

    Science.gov (United States)

    Yang, Yu-Chiao; Wei, Ming-Chi

    2018-06-30

    This study compared the use of ultrasound-assisted supercritical CO 2 (USC-CO 2 ) extraction to obtain apigenin-rich extracts from Scutellaria barbata D. Don with that of conventional supercritical CO 2 (SC-CO 2 ) extraction and heat-reflux extraction (HRE), conducted in parallel. This green procedure yielded 20.1% and 31.6% more apigenin than conventional SC-CO 2 extraction and HRE, respectively. Moreover, the extraction time required by the USC-CO 2 procedure, which used milder conditions, was approximately 1.9 times and 2.4 times shorter than that required by conventional SC-CO 2 extraction and HRE, respectively. Furthermore, the theoretical solubility of apigenin in the supercritical fluid system was obtained from the USC-CO 2 dynamic extraction curves and was in good agreement with the calculated values for the three empirical density-based models. The second-order kinetics model was further applied to evaluate the kinetics of USC-CO 2 extraction. The results demonstrated that the selected model allowed the evaluation of the extraction rate and extent of USC-CO 2 extraction. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. DNA extraction from dry museum beetles without conferring external morphological damage

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

    2007-01-01

    undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

  16. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...... methodologies and the supremacy of our method was confirmed. Maximum recovery of genomic DNA in the absence of substantial amount of impurities made the method convenient for nucleic acid extraction. The nucleic acids obtained using this method are suitable for different downstream applications. This improved...

  17. The removal of metals from edible oil by a membrane extraction procedure 355

    NARCIS (Netherlands)

    Keurentjes, J.T.F.; Bosklopper, T.G.J.; Dorp, van L.J.; Riet, van 't K.

    1990-01-01

    Edible oils may contain traces of metals. In oil refining procedures these metals have to be removed to guarantee oxidatively stable products. In this study we present a hollow fiber membrane extraction system for the removal of metals from an oil. Several extraction liquids were tested, of which an

  18. Automated extraction of DNA from reference samples from various types of biological materials on the Qiagen BioRobot EZ1 Workstation

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Jørgensen, Mads; Hansen, Anders Johannes

    2009-01-01

    , and muscle biopsies. The DNA extraction was validated according to EN/ISO 17025 for the STR kits AmpFlSTR« Identifiler« and AmpFlSTR« Yfiler« (Applied Biosystems). Of 298 samples extracted, 11 (4%) did not yield acceptable results. In conclusion, we have demonstrated that extraction of DNA from various types......We have validated and implemented a protocol for DNA extraction from various types of biological materials using a Qiagen BioRobot EZ1 Workstation. The sample materials included whole blood, blood from deceased, buccal cells on Omni swabs and FTA Cards, blood on FTA Cards and cotton swabs...... of biological material can be performed quickly and without the use of hazardous chemicals, and that the DNA may be successfully STR typed according to the requirements of forensic genetic investigations accredited according to EN/ISO 17025...

  19. c-DNA of HIV-1 detection on spot of Buffy-Coat of leukocytes (DBCS

    Directory of Open Access Journals (Sweden)

    Marco Rossi de Gasperis

    2010-03-01

    Full Text Available Introduction:The elective way for the diagnosis of HIV-1-infection in the window period and in children under the age of 16-18 months is to search virus integrated in leukocytes. Aim of the study was to assess the sensitivity and specificity of extraction from Buffy-Dried Coat Spot (DBCS in leukocyte to detect c-DNA with nested-PCR in HIV-1-infected individuals compared to Dried Blood Spot (DBS both extracted by automated instrument EZ1 (QIAGEN, Hilden, Germany. Both DBCS and both DBS were compared with those tests from whole blood by conventional DNA-extraction Methods: Five ml of whole blood from 50 HIV-infected individuals were collected. 40 μl of each sample were spotted on “FTA ELUTE Micro Card” (Whatman, Inc., Clifton, NJ, 200 μl were extracted according to the manual procedure (QIAGEN “QIAamp DNA minikit and the remaining sample was incubated at 37 °C for 120 minutes. Plasma was centrifuged at 1000 rcf/1g for 10 minutes at room temperature. Forty μl of the obtained buffy-coat was spotted. Both DBCS and both DBS were dried at room temperature for 24 hours.Two of 5 punch from each spot were extracted with TISSUE DNA kit (Biorobot EZ1 DSP “Qiagen” and eluted in 50 μl of buffer.The recovery of genomic DNA was measured amplifying the ß-globin gene by Real-Time “SybrGreen I”.The DNA was amplified for the “pol” gene of HIV-1 by nested PCR and revealed in “SYBR-green I”. Eight HIV-antibody-negative samples were used as internal control. Results:The experimental protocol adopted for the DBCS showed high sensitivity and specificity.The extracted DNA from DBS and DBCS was characterized by excellent quality and without any inhibitory agents. The amount of proviral DNA extracted from DBCS is similar to that obtained by conventional extraction, while the DBS test was significantly less sensitive. Conclusion:These preliminary data suggest that the amount of c-DNA obtained with DBS technique is often not enough for the

  20. Improved method for extraction and detection of Helicobacter pylori DNA in formalin-fixed paraffin embedded gastric biopsies using laser micro-dissection.

    Science.gov (United States)

    Loayza, María Fernanda; Villavicencio, Fernando Xavier; Santander, Stephanie Carolina; Baldeón, Manuel; Ponce, Lourdes Karina; Salvador, Iván; Vivar Díaz, Nicolás

    2015-01-01

    To assess the molecular events exerted by Helicobacter pylori interacting directly with gastric epithelial cells, an improved procedure for microbial DNA isolation from stained hematoxilin-eosin gastric biopsies was developed based on laser micro-dissection (LM) [1]. Few articles have described the use of LM to select and detect H. pylori genome from formalin-fixed paraffin embedded gastric tissue [2]. To improve the yield and quality of DNA isolated from H. pylori contacting intestinal epithelial cells, the following conditions were established after modification of the QIAamp DNA Micro kit. •Use of at least 25 cut sections of 10-20 μm of diameter and 3 μm thick with more than 10 bacteria in each cut.•Lysis with 30 μL of tissue lysis buffer and 20 μL of proteinase K (PK) with the tube in an upside-down position.•The use of thin purification columns with 35 μL of elution buffer. The mean of DNA concentration obtained from 25 LM cut sections was 1.94± 0 .16 ng/μL, and it was efficiently amplified with qPCR in a Bio Rad iCycler instrument. The LM can improve the sample selection and DNA extraction for molecular analysis of H. pylori associated with human gastric epithelium.

  1. Comparison of DNA Extraction Methods in Terms of Yield, Purity, Long-Term Storage, and Downstream Manipulation with Brewer's Yeast Chromosomal DNA

    Czech Academy of Sciences Publication Activity Database

    Kopecká, J.; Matoulková, D.; Němec, M.; Jelínková, Markéta; Felsberg, Jürgen

    2014-01-01

    Roč. 72, č. 1 (2014), s. 1-5 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Brewer's yeast * Isolation of DNA * Phenol/chloroform extraction Subject RIV: EE - Microbiology, Virology Impact factor: 0.886, year: 2014

  2. Automated extraction of DNA and PCR setup using a Tecan Freedom EVO® liquid handler

    DEFF Research Database (Denmark)

    Frøslev, Tobias Guldberg; Hansen, Anders Johannes; Stangegaard, Michael

    2009-01-01

    We have implemented and validated automated protocols for DNA extraction and PCR setup using a Tecan Freedom EVO® liquid handler mounted with the TeMagS magnetic separation device. The methods were validated for accredited, forensic genetic work according to ISO 17025 using the Qiagen Mag...... genetic DNA typing can be implemented on a simple robot leading to the reduction of manual work as well as increased quality and throughput....

  3. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  4. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Science.gov (United States)

    Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

    2011-01-01

    Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  5. The Extraction and Partial Purification of Bacterial DNA as a Practical Exercise for GCE Advanced Level Students.

    Science.gov (United States)

    Falconer, A. C.; Hayes, L. J.

    1986-01-01

    Describes a relatively simple method of extraction and purification of bacterial DNA. This technique permits advanced secondary-level science students to obtain adequate amounts of DNA from very small pellets of bacteria and to observe some of its polymer properties. (ML)

  6. Pellet pestle homogenization of agarose gel slices at 45 degrees C for deoxyribonucleic acid extraction.

    Science.gov (United States)

    Kurien, B T; Kaufman, K M; Harley, J B; Scofield, R H

    2001-09-15

    A simple method for extracting DNA from agarose gel slices is described. The extraction is rapid and does not involve harsh chemicals or sophisticated equipment. The method involves homogenization of the excised gel slice (in Tris-EDTA buffer), containing the DNA fragment of interest, at 45 degrees C in a microcentrifuge tube with a Kontes pellet pestle for 1 min. The "homogenate" is then centrifuged for 30 s and the supernatant is saved. The "homogenized" agarose is extracted one more time and the supernatant obtained is combined with the previous supernatant. The DNA extracted using this method lent itself to restriction enzyme analysis, ligation, transformation, and expression of functional protein in bacteria. This method was found to be applicable with 0.8, 1.0, and 2.0% agarose gels. DNA fragments varying from 23 to 0.4 kb were extracted using this procedure and a yield ranging from 40 to 90% was obtained. The yield was higher for fragments 2.0 kb and higher (70-90%). This range of efficiency was maintained when the starting material was kept between 10 and 300 ng. The heat step was found to be critical since homogenization at room temperature failed to yield any DNA. Extracting DNA with our method elicited an increased yield (up to twofold) compared with that extracted with a commercial kit. Also, the number of transformants obtained using the DNA extracted with our method was at least twice that obtained using the DNA extracted with the commercial kit. Copyright 2001 Academic Press.

  7. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  8. Protective effects of aqueous and ethanolic extracts of Portulaca oleracea L. aerial parts on H2O2-induced DNA damage in lymphocytes by comet assay.

    Science.gov (United States)

    Behravan, Javad; Mosafa, Fatemeh; Soudmand, Negar; Taghiabadi, Elahe; Razavi, Bibi Marjan; Karimi, Gholamreza

    2011-09-01

    The comet assay is a standard method for measuring DNA damage. In this study, the protective effects of ethanolic and aqueous extracts of Portulaca oleracea L. (P. oleracea) on human lymphocyte DNA lesions were evaluated with the comet assay. Lymphocytes were isolated from blood samples taken from healthy volunteers. Human lymphocytes were incubated in H(2)O(2) (50,100, and 200 μM), aqueous extract (0.05, 0.1, 0.5, 1, and 2.5mg/ml), and ethanolic extracts (0.05, 0.1, 0.5, 1, and 2.5mg/ml) of P. oleraceae aerial parts alone with a combination of H(2)O(2) (100 μM) with either 1 or 2.5mg/ml of both extracts at 4°C for 30 minutes. The extent of DNA migration was measured using the alkaline single cell gel electrophoresis approach assay, and DNA damage was expressed as percentage tail DNA. We found that the aqueous extract of P. oleracea significantly inhibited DNA damage, while there was no effect of the ethanolic extract. These data suggest that the aqueous extract of P. oleracea can prevent oxidative DNA damage to human lymphocytes, which is likely due to antioxidant constituents in the extract. Copyright © 2011. Published by Elsevier B.V.

  9. An Improved DNA Extraction Method for Efficient and Quantitative Recovery of Phytoplankton Diversity in Natural Assemblages.

    Directory of Open Access Journals (Sweden)

    Jian Yuan

    Full Text Available Marine phytoplankton are highly diverse with different species possessing different cell coverings, posing challenges for thoroughly breaking the cells in DNA extraction yet preserving DNA integrity. While quantitative molecular techniques have been increasingly used in phytoplankton research, an effective and simple method broadly applicable to different lineages and natural assemblages is still lacking. In this study, we developed a bead-beating protocol based on our previous experience and tested it against 9 species of phytoplankton representing different lineages and different cell covering rigidities. We found the bead-beating method enhanced the final yield of DNA (highest as 2 folds in comparison with the non-bead-beating method, while also preserving the DNA integrity. When our method was applied to a field sample collected at a subtropical bay located in Xiamen, China, the resultant ITS clone library revealed a highly diverse assemblage of phytoplankton and other micro-eukaryotes, including Archaea, Amoebozoa, Chlorophyta, Ciliphora, Bacillariophyta, Dinophyta, Fungi, Metazoa, etc. The appearance of thecate dinoflagellates, thin-walled phytoplankton and "naked" unicellular organisms indicates that our method could obtain the intact DNA of organisms with different cell coverings. All the results demonstrate that our method is useful for DNA extraction of phytoplankton and environmental surveys of their diversity and abundance.

  10. Endonuclease activities in extracts of Micrococcus luteus that act on. gamma. -irradiated DNA

    Energy Technology Data Exchange (ETDEWEB)

    Schoen-Bopp, A; Schaefer, G; Hagen, U [Kernforschungszentrum Karlsruhe (Germany, F.R.). Inst. fuer Strahlenbiologie

    1977-03-01

    Several protein fractions containing endonuclease activity against ..gamma..-irradiated DNA (..gamma..-endonuclease) were isolated from M.luteus. The crude extract was eluted on a phosphocellulose column and chromatographed on TEAE cellulose and subsequently on hydroxypatite. Five peaks of ..gamma..-endonuclease were obtained from each preparation. Repeated experiments showed comparable chromatographic behaviour of the fractions. There was no detectable activity of uv-endonuclease in the fractions with ..gamma..-endonuclease but a small contamination of endonuclease against unirradiated DNA and against DNA with apurinic sites. The ..gamma..-endonuclease was stimulated by, but was not dependent on, magnesium. Several tests for endonuclease activity have been used: the analysis of strand breaks in calf-thymus DNA or in PM2 DNA, and the determination of end-groups formed by endonuclease, either 3'OH end-groups or phosphomonoester end groups. From the results obtained it can be assumed that the strand breaks induced by the ..gamma..-endonuclease carry 3'OH and 5' phosphate end groups.

  11. A simple and efficient total genomic DNA extraction method for individual zooplankton.

    Science.gov (United States)

    Fazhan, Hanafiah; Waiho, Khor; Shahreza, Md Sheriff

    2016-01-01

    Molecular approaches are widely applied in species identification and taxonomic studies of minute zooplankton. One of the most focused zooplankton nowadays is from Subclass Copepoda. Accurate species identification of all life stages of the generally small sized copepods through molecular analysis is important, especially in taxonomic and systematic assessment of harpacticoid copepod populations and to understand their dynamics within the marine community. However, total genomic DNA (TGDNA) extraction from individual harpacticoid copepods can be problematic due to their small size and epibenthic behavior. In this research, six TGDNA extraction methods done on individual harpacticoid copepods were compared. The first new simple, feasible, efficient and consistent TGDNA extraction method was designed and compared with the commercial kit and modified available TGDNA extraction methods. The newly described TGDNA extraction method, "Incubation in PCR buffer" method, yielded good and consistent results based on the high success rate of PCR amplification (82%) compared to other methods. Coupled with its relatively consistent and economical method the "Incubation in PCR buffer" method is highly recommended in the TGDNA extraction of other minute zooplankton species.

  12. Maintaining Breast Cancer Specimen Integrity and Individual or Simultaneous Extraction of Quality DNA, RNA, and Proteins from Allprotect-Stabilized and Nonstabilized Tissue Samples

    LENUS (Irish Health Repository)

    Mee, Blanaid C.

    2011-12-29

    The Saint James\\'s Hospital Biobank was established in 2008, to develop a high-quality breast tissue BioResource, as a part of the breast cancer clinical care pathway. The aims of this work were: (1) to ascertain the quality of RNA, DNA, and protein in biobanked carcinomas and normal breast tissues, (2) to assess the efficacy of AllPrep® (Qiagen) in isolating RNA, DNA, and protein simultaneously, (3) to compare AllPrep with RNEasy® and QIAamp® (both Qiagen), and (4) to examine the effectiveness of Allprotect® (Qiagen), a new tissue stabilization medium in preserving DNA, RNA, and proteins. One hundred eleven frozen samples of carcinoma and normal breast tissue were analyzed. Tumor and normal tissue morphology were confirmed by frozen sections. Tissue type, tissue treatment (Allprotect vs. no Allprotect), extraction kit, and nucleic acid quantification were analyzed by utilizing a 4 factorial design (SPSS PASW 18 Statistics Software®). QIAamp (DNA isolation), AllPrep (DNA, RNA, and Protein isolation), and RNeasy (RNA isolation) kits were assessed and compared. Mean DNA yield and A260\\/280 values using QIAamp were 33.2 ng\\/μL and 1.86, respectively, and using AllPrep were 23.2 ng\\/μL and 1.94. Mean RNA yield and RNA Integrity Number (RIN) values with RNeasy were 73.4 ng\\/μL and 8.16, respectively, and with AllPrep were 74.8 ng\\/μL and 7.92. Allprotect-treated tissues produced higher RIN values of borderline significance (P=0.055). No discernible loss of RNA stability was detected after 6 h incubation of stabilized or nonstabilized tissues at room temperature or 4°C or in 9 freeze-thaw cycles. Allprotect requires further detailed evaluation, but we consider AllPrep to be an excellent option for the simultaneous extraction of RNA, DNA, and protein from tumor and normal breast tissues. The essential presampling procedures that maintain the diagnostic integrity of pathology specimens do not appear to compromise the quality of molecular isolates.

  13. On-chip concentration of bacteria using a 3D dielectrophoretic chip and subsequent laser-based DNA extraction in the same chip

    International Nuclear Information System (INIS)

    Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun

    2010-01-01

    We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.

  14. AFSC/RACE/SAP/Shavey: DNA extraction from archived Giemsa-stained blood smears using polymerase chain reaction to detect host and parasitic DNA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...

  15. Development of a simple extraction procedure for chlorpyrifos determination in food samples by immunoassay.

    Science.gov (United States)

    Gabaldón, J A; Maquieira, A; Puchades, R

    2007-02-28

    The suitability of immunoassay methodology for rapid and accurate determination of chlorpyrifos in vegetables was tested. The optimised ELISA detection limit was 0.32ng/ml, with a working range from 0.69 to 6.21ng/ml and an immunoassay test-mid point (IC(50)) of 2.08ng/ml. A rapid sample preparation procedure considering different parameters such as the amount of sample, volume of extractant, extraction time and dilution factor was optimised. The developed direct extraction (DE) and multiresidue (ME) standard procedures were performed in different fortified fresh and processed vegetable samples (tomato, bonnet pepper, bean, pea, asparagus, broccoli, watermelon, melon, lettuce, cucumber, celery and red pepper). Recoveries were in all cases in the whole range 85.2-108.9% for both DE and ME extracts. Also, the comparison of the results obtained by both immunochemical and chromatographic methods for spiked fruits and vegetables were good with a correlation coefficient (r) of 0.97.

  16. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  17. Membrane biofouling characterization: effects of sample preparation procedures on biofilm structure and the microbial community

    KAUST Repository

    Xue, Zheng

    2014-07-15

    Ensuring the quality and reproducibility of results from biofilm structure and microbial community analysis is essential to membrane biofouling studies. This study evaluated the impacts of three sample preparation factors (ie number of buffer rinses, storage time at 4°C, and DNA extraction method) on the downstream analysis of nitrifying biofilms grown on ultrafiltration membranes. Both rinse and storage affected biofilm structure, as suggested by their strong correlation with total biovolume, biofilm thickness, roughness and the spatial distribution of EPS. Significant variations in DNA yields and microbial community diversity were also observed among samples treated by different rinses, storage and DNA extraction methods. For the tested biofilms, two rinses, no storage and DNA extraction with both mechanical and chemical cell lysis from attached biofilm were the optimal sample preparation procedures for obtaining accurate information about biofilm structure, EPS distribution and the microbial community. © 2014 © 2014 Taylor & Francis.

  18. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    Science.gov (United States)

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  19. DNA agarose gel electrophoresis for antioxidant analysis: Development of a quantitative approach for phenolic extracts.

    Science.gov (United States)

    Silva, Sara; Costa, Eduardo M; Vicente, Sandra; Veiga, Mariana; Calhau, Conceição; Morais, Rui M; Pintado, Manuela E

    2017-10-15

    Most of the fast in vitro assays proposed to determine the antioxidant capacity of a compound/extract lack either biological context or employ complex protocols. Therefore, the present work proposes the improvement of an agarose gel DNA electrophoresis in order to allow for a quantitative estimation of the antioxidant capacity of pure phenolic compounds as well as of a phenolic rich extract, while also considering their possible pro-oxidant effects. The result obtained demonstrated that the proposed method allowed for the evaluation of the protection of DNA oxidation [in the presence of hydrogen peroxide (H 2 O 2 ) and an H 2 O 2 /iron (III) chloride (FeCl 3 ) systems] as well as for the observation of pro-oxidant activities, with the measurements registering interclass correlation coefficients above 0.9. Moreover, this method allowed for the characterization of the antioxidant capacity of a blueberry extract while demonstrating that it had no perceived pro-oxidant effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. DNA data in criminal procedure in the European fundamental rights context.

    Science.gov (United States)

    Soleto, Helena

    2014-01-01

    Despite being one of the most useful and reliable identification tools, DNA profiling in criminal procedure balances on the border between the limitation and violation of Fundamental Rights that can occur beginning with the collection of the sample, its analysis, and its use; and ending with its processing. Throughout this complex process, violation of human or fundamental rights -such as the right to physical and moral integrity, the right not to be subject to degrading treatment, the right not to incriminate oneself, the right to family privacy together with that of not incriminating descendants or relatives in general, the right to personal development and the right to informative self-determination- is possible. This article presents an analysis of all the above-mentioned DNA treating phases in criminal process in the light of possible violations of some Fundamental Rights, while at the same time discarding some of them on the basis of European human rights protection standards. As the case-law of the European Court of Human Rights shows, the legislation on DNA collection and DNA related data processing or its implementation does not always respect all human rights and should be carefully considered before its adoption and during its application.

  1. Comparison of three sequential extraction procedures to describe metal fractionation in anaerobic granular sludges

    NARCIS (Netherlands)

    Hullebusch, van E.D.; Sudarno, S.; Zandvoort, M.H.; Lens, P.N.L.

    2005-01-01

    In the last few decades. several sequential extraction procedures have been developed to quantify the chemical status of metals in the solid phase. In this study. three extraction techniques (modified [A. Tessier, P.G.C. Campbell, M. Bisson, Anal. Chem. 51 (1979) 844]: [R.C. Stover. L.E. Sommers,

  2. New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

    Science.gov (United States)

    Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

    2011-09-01

    Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

  3. Compatibility of DNA IQ™, QIAamp® DNA Investigator, and QIAsymphony® DNA Investigator® with various fingerprint treatments.

    Science.gov (United States)

    Lin, Sze-Wah; Ip, Stephen C Y; Lam, Tze-Tsun; Tan, Tung-Fai; Yeung, Wai-Lung; Tam, Wai-Ming

    2017-03-01

    Latent fingerprint and touch DNA are the two most important contact evidence for individualization in forensic science which provide complementary information that can lead to direct and unequivocal identification of the culprit. In order to retrieve useful information from both fingerprints and DNA, which are usually mingled together, one strategy is to perform fingerprint examination prior to DNA analysis since common DNA sampling technique such as swabbing could disturb or even destroy fingerprint details. Here, we describe the compatibility of three automatic DNA extraction systems, namely, DNA IQ™, QIAamp ® DNA Investigator, and QIAsymphony ® DNA Investigator ® , with respective to the effects of various fingerprint detection techniques. Our results demonstrate that Super Glue fingerprint treatment followed by DNA IQ™ extraction shows better effectiveness in DNA profiling. Aluminum powder dusting offers the least interference to the three DNA extraction systems above. Magnetic powder dusting, on the other hand, strongly impedes DNA recovery. Physical Developer is the most intrusive, which yields profiles with poor quality, including lower peak heights, poor peak height ratios, and poor intra-color balance. In terms of the choice of extraction method, DNA IQ™ system is recommended for sampling after fingerprint treatments, but not the two DNA Investigator systems.

  4. Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

    Science.gov (United States)

    Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

    2007-06-01

    Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

  5. Assessing the bias linked to DNA recovery from biofiltration woodchips for microbial community investigation by fingerprinting.

    Science.gov (United States)

    Cabrol, Léa; Malhautier, Luc; Poly, Franck; Lepeuple, Anne-Sophie; Fanlo, Jean-Louis

    2010-01-01

    In this study, we explored methodological aspects of nucleic acid recovery from microbial communities involved in a gas biofilter filled with pine bark woodchips. DNA was recovered indirectly in two steps, comparing different methods: cell dispersion (crushing, shaking, and sonication) and DNA extraction (three commercial kits and a laboratory protocol). The objectives were (a) to optimize cell desorption from the packing material and (b) to compare the 12 combinations of desorption and extraction methods, according to three relevant criteria: DNA yield, DNA purity, and community structure representation by denaturing gradient gel electrophoresis (DGGE). Cell dispersion was not influenced by the operational parameters tested for shaking and blending, while it increased with time for sonication. DNA extraction by the laboratory protocol provided the highest DNA yields, whereas the best DNA purity was obtained by a commercial kit designed for DNA extraction from soil. After successful PCR amplification, the 12 methods did not generate the same bias in microbial community representation. Eight combinations led to high diversity estimation, independently of the experimental procedure. Among them, six provided highly similar DGGE profiles. Two protocols generated a significantly dissimilar community profile, with less diversity. This study highlighted the crucial importance of DNA recovery bias evaluation.

  6. Comparison of four DNA extraction methods for the detection of Mycobacterium leprae from Ziehl-Neelsen-stained microscopic slides.

    Science.gov (United States)

    Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia

    2015-12-01

    The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  7. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  8. Doping control in Japan. An automated extraction procedure for the doping test.

    Science.gov (United States)

    Nakajima, T.; Matsumoto, T.

    1976-01-01

    Horse racing in Japan consists of two systems, the National (10 racecourses) and the Regional public racing (32 racecourses) having about 2,500 racing meetings in total per year. Urine or saliva samples for dope testing are collected by the officials from thw winner, second and third, and transported to the laboratory in a frozen state. In 1975, 76, 117 samples were analyzed by this laboratory. The laboratory provides the following four methods of analysis, which are variously combined by request. (1) Method for detection of drugs extracted by chloroform from alkalinized sample. (2) Methods for detection of camphor and its derivatives. (3) Method for detection of barbiturates. (4) Method for detection of ethanol. These methods consist of screening, mainly by thin layer chromatography and confirmatory tests using ultra violet spectrophotometry, gas chromatography and mass spectrometry combined with gas chromatography. In the screening test of doping drugs, alkalinized samples are extracted with chloroform. In order to automate the extraction procedure, the authors contrived a new automatic extractor. They also devised a means of pH adjustment of horse urine by using buffer solution and an efficient mechanism of evaporation of organic solvent. Analytical data obtained by the automatic extractor are presented in this paper. In 1972, we started research work to automate the extraction procedure in method (1) above, and the Automatic Extractor has been in use in routine work since last July. One hundred and twnety samples per hour are extracted automatically by three automatic extractors. The analytical data using this apparatus is presented below. PMID:1000163

  9. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  10. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  11. Pomegranate extract protects against cerebral ischemia/reperfusion injury and preserves brain DNA integrity in rats.

    Science.gov (United States)

    Ahmed, Maha A E; El Morsy, Engy M; Ahmed, Amany A E

    2014-08-21

    Interruption to blood flow causes ischemia and infarction of brain tissues with consequent neuronal damage and brain dysfunction. Pomegranate extract is well tolerated, and safely consumed all over the world. Interestingly, pomegranate extract has shown remarkable antioxidant and anti-inflammatory effects in experimental models. Many investigators consider natural extracts as novel therapies for neurodegenerative disorders. Therefore, this study was carried out to investigate the protective effects of standardized pomegranate extract against cerebral ischemia/reperfusion-induced brain injury in rats. Adult male albino rats were randomly divided into sham-operated control group, ischemia/reperfusion (I/R) group, and two other groups that received standardized pomegranate extract at two dose levels (250, 500 mg/kg) for 15 days prior to ischemia/reperfusion (PMG250+I/R, and PMG500+I/R groups). After I/R or sham operation, all rats were sacrificed and brains were harvested for subsequent biochemical analysis. Results showed reduction in brain contents of MDA (malondialdehyde), and NO (nitric oxide), in addition to enhancement of SOD (superoxide dismutase), GPX (glutathione peroxidase), and GRD (glutathione reductase) activities in rats treated with pomegranate extract prior to cerebral I/R. Moreover, pomegranate extract decreased brain levels of NF-κB p65 (nuclear factor kappa B p65), TNF-α (tumor necrosis factor-alpha), caspase-3 and increased brain levels of IL-10 (interleukin-10), and cerebral ATP (adenosine triphosphate) production. Comet assay showed less brain DNA (deoxyribonucleic acid) damage in rats protected with pomegranate extract. The present study showed, for the first time, that pre-administration of pomegranate extract to rats, can offer a significant dose-dependent neuroprotective activity against cerebral I/R brain injury and DNA damage via antioxidant, anti-inflammatory, anti-apoptotic and ATP-replenishing effects. Copyright © 2014 Elsevier Inc

  12. Effects of storage temperature on the quantity and integrity of genomic DNA extracted from mice tissues: A comparison of recovery methods

    Directory of Open Access Journals (Sweden)

    Huda H. Al-Griw

    2017-08-01

    Full Text Available Efficient extraction of genomic DNA (gDNA from biological materials found in harsh environments is the first step for successful forensic DNA profiling. This study aimed to evaluate two methods for DNA recovery from animal tissues (livers, muscles, focusing on the best storage temperature for DNA yield in term of quality, quantity, and integrity for use in several downstream molecular techniques. Six male Swiss albino mice were sacrificed, liver and muscle tissues (n=32 were then harvested and stored for one week in different temperatures, -20C, 4C, 25C and 40C. The conditioned animal tissues were used for DNA extraction by Chelex-100 method or NucleoSpin Blood and Tissue kit. The extracted gDNA was visualized on 1.5% agarose gel electrophoresis to determine the quality of gDNA and analysed spectrophotometrically to determine the DNA concentration and the purity. Both methods, Chelex-100 and NucleoSpin Blood and Tissue kit found to be appropriate for yielding high quantity of gDNA, with the Chelex100 method yielding a greater quantity (P < 0.045 than the kit. At -20C, 4C, and 25C temperatures, the concentration of DNA yield was numerically lower than at 40C. The NucleoSpin Blood and Tissue kit produced a higher (P=0.031 purity product than the Chelex-100 method, particularly for muscle tissues. The Chelex-100 method is cheap, fast, effective, and is a crucial tool for yielding DNA from animal tissues (livers, muscles exposed to harsh environment with little limitations.

  13. Development of extraction procedure for determination of mercury species using SPME-assisted dispersive derivative agent

    Science.gov (United States)

    Abdullah, Md Pauzi; Khalik, Wan Mohd Afiq Wan Mohd; Othman, Mohamed Rozali

    2016-11-01

    The extraction procedure for determination of low level mercury using solid phase microextraction was successfully carried out. Design of experimental works using factorial design and central composite design were applied to screen and predict the optimum condition for extraction step. In this study, variables namely concentration level (5 % m/v) and volume of derivatization solution (150 µL) has depicted as main effect for controlling the suitability of derivative reagent condition. Maximum of signal response (account as total peak areas for mercury species) was obtained when extraction procedure was set up at pH of water sample (5.8), extraction time (14 min), extraction temperature (43 °C) and stirring rate (450 rpm). Reducing time required to reach equilibrium is new improvement achieved in this study. Detection limit for each species (MeHg 26.17 ngL-1; EtHg 48.84 ngL-1 and IHg 14.11 ngL-1) was calculated lower than our previous work. Recovery, repeatability and reproducibility trial were recorded varied at acceptable range and relative standard deviation was calculated below than 10 %.

  14. Dynamic Architecture of Eukaryotic DNA Replication Forks In Vivo, Visualized by Electron Microscopy.

    Science.gov (United States)

    Zellweger, Ralph; Lopes, Massimo

    2018-01-01

    The DNA replication process can be heavily perturbed by several different conditions of genotoxic stress, particularly relevant for cancer onset and therapy. The combination of psoralen crosslinking and electron microscopy has proven instrumental to reveal the fine architecture of in vivo DNA replication intermediates and to uncover their remodeling upon specific conditions of genotoxic stress. The replication structures are stabilized in vivo (by psoralen crosslinking) prior to extraction and enrichment procedures, allowing their visualization at the transmission electron microscope. This chapter outlines the procedures required to visualize and interpret in vivo replication intermediates of eukaryotic genomic DNA, and includes an improved method for enrichment of replication intermediates, compared to previously used BND-cellulose columns.

  15. [Effect of Mn(II) on the error-prone DNA polymerase iota activity in extracts from human normal and tumor cells].

    Science.gov (United States)

    Lakhin, A V; Efremova, A S; Makarova, I V; Grishina, E E; Shram, S I; Tarantul, V Z; Gening, L V

    2013-01-01

    The DNA polymerase iota (Pol iota), which has some peculiar features and is characterized by an extremely error-prone DNA synthesis, belongs to the group of enzymes preferentially activated by Mn2+ instead of Mg2+. In this work, the effect of Mn2+ on DNA synthesis in cell extracts from a) normal human and murine tissues, b) human tumor (uveal melanoma), and c) cultured human tumor cell lines SKOV-3 and HL-60 was tested. Each group displayed characteristic features of Mn-dependent DNA synthesis. The changes in the Mn-dependent DNA synthesis caused by malignant transformation of normal tissues are described. It was also shown that the error-prone DNA synthesis catalyzed by Pol iota in extracts of all cell types was efficiently suppressed by an RNA aptamer (IKL5) against Pol iota obtained in our work earlier. The obtained results suggest that IKL5 might be used to suppress the enhanced activity of Pol iota in tumor cells.

  16. Extraction Methods, Variability Encountered in

    NARCIS (Netherlands)

    Bodelier, P.L.E.; Nelson, K.E.

    2014-01-01

    Synonyms Bias in DNA extractions methods; Variation in DNA extraction methods Definition The variability in extraction methods is defined as differences in quality and quantity of DNA observed using various extraction protocols, leading to differences in outcome of microbial community composition

  17. Radioprotective effect of methanolic root extract of Loeseneriella arnottiana on radiation induced DNA damage in human lymphocytes in vitro

    International Nuclear Information System (INIS)

    Prajna, P.S.

    2012-01-01

    Intense exposure to ionization radiation by accidental, occupational or therapeutical purpose causes cellular damage mainly by formation of excessive reactive oxygen species (ROS) or by free radicals. Humans are intentionally exposed to ionising radiation for diagnostic or therapeutic purposes. The use of ionising radiation in cancer therapy may lead to transient and/or permanent injury to normal tissues within the treatment field. To increase the therapeutic index of radiation therapy, various modes of radioprotection have been developed that selectively reduce cytotoxic effects to normal tissues. Because radiation-induced cellular damage is attributed primarily to the harmful effects of free radicals, molecules with radical scavenging properties are particularly promising as radioprotectors. Loeseneriella arnottiana, a member of family Hippocrateaceae, is a climbing shrub used by traditional medicine practitioners. To study the antioxidant activity and radioprotective effect of methanolic root extract of Loeseneriella arnottiana against electron beam radiation induced DNA damage in human lymphocytes. Loeseneriella arnottiana roots were dried and extracted using methanol by solvent extraction method. Antioxidant activity was measured by DPPH method. DNA damage was assessed by comet assay parameters. The lymphocytes were incubated for one hour with two different concentrations 10 μg and 50 μg of root extract before exposure to 2 Gy electron beam radiation. 30 μg of methanolic root extract of Loeseneriella arnottiana exhibited 96% radical scavenging activity comparable to 15 μg of ascorbic acid. In reducing power assay it showed dose dependent increase in absorbance indicating that extract is capable of donating hydrogen atoms. Pretreatment of lymphocytes with 10 μg and 50 μg of root extract before irradiation resulted in reduction in the Comet length, Olive tail moment, percentage of DNA in tail when compared to the radiation control group. Results of this

  18. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    DEFF Research Database (Denmark)

    Kruhøffer, Mogens; Andersen, Lars Dyrskjøt; Voss, Thorsten

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood...... and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated micro......RNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis....

  19. Application of thiopropyl sepharose 6B for removal of PCR inhibitors from DNA extracts of a thigh bone recovered from the sea

    DEFF Research Database (Denmark)

    Sørensen, Erik; Hansen, Steen Holger; Eriksen, Birthe

    2003-01-01

    for the removal of PCR inhibitors in DNA extracts originating from stains on clothing. Here we show that TS is efficient also for the removal of inhibitors from PCR extracts from a highly decomposed human thigh bone. TS treatment, however, leads to a substantial loss of DNA making the technique best suited when...

  20. Mutant analysis of Cdt1's function in suppressing nascent strand elongation during DNA replication in Xenopus egg extracts.

    Science.gov (United States)

    Nakazaki, Yuta; Tsuyama, Takashi; Azuma, Yutaro; Takahashi, Mikiko; Tada, Shusuke

    2017-09-02

    The initiation of DNA replication is strictly regulated by multiple mechanisms to ensure precise duplication of chromosomes. In higher eukaryotes, activity of the Cdt1 protein is temporally regulated during the cell cycle, and deregulation of Cdt1 induces DNA re-replication. In previous studies, we showed that excess Cdt1 inhibits DNA replication by suppressing progression of replication forks in Xenopus egg extracts. Here, we investigated the functional regions of Cdt1 that are required for the inhibition of DNA replication. We constructed a series of N-terminally or C-terminally deleted mutants of Cdt1 and examined their inhibitory effects on DNA replication in Xenopus egg extracts. Our results showed that the region spanning amino acids (a. a.) 255-620 is required for efficient inhibition of DNA replication, and that, within this region, a. a. 255-289 have a critical role in inhibition. Moreover, one of the Cdt1 mutants, Cdt1 R285A, was compromised with respect to the licensing activity but still inhibited DNA replication. This result suggests that Cdt1 has an unforeseen function in the negative regulation of DNA replication, and that this function is located within a molecular region that is distinct from those required for the licensing activity. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. PCR-Free Enrichment of Mitochondrial DNA from Human Blood and Cell Lines for High Quality Next-Generation DNA Sequencing.

    Directory of Open Access Journals (Sweden)

    Meetha P Gould

    Full Text Available Recent advances in sequencing technology allow for accurate detection of mitochondrial sequence variants, even those in low abundance at heteroplasmic sites. Considerable sequencing cost savings can be achieved by enriching samples for mitochondrial (relative to nuclear DNA. Reduction in nuclear DNA (nDNA content can also help to avoid false positive variants resulting from nuclear mitochondrial sequences (numts. We isolate intact mitochondrial organelles from both human cell lines and blood components using two separate methods: a magnetic bead binding protocol and differential centrifugation. DNA is extracted and further enriched for mitochondrial DNA (mtDNA by an enzyme digest. Only 1 ng of the purified DNA is necessary for library preparation and next generation sequence (NGS analysis. Enrichment methods are assessed and compared using mtDNA (versus nDNA content as a metric, measured by using real-time quantitative PCR and NGS read analysis. Among the various strategies examined, the optimal is differential centrifugation isolation followed by exonuclease digest. This strategy yields >35% mtDNA reads in blood and cell lines, which corresponds to hundreds-fold enrichment over baseline. The strategy also avoids false variant calls that, as we show, can be induced by the long-range PCR approaches that are the current standard in enrichment procedures. This optimization procedure allows mtDNA enrichment for efficient and accurate massively parallel sequencing, enabling NGS from samples with small amounts of starting material. This will decrease costs by increasing the number of samples that may be multiplexed, ultimately facilitating efforts to better understand mitochondria-related diseases.

  2. Application of Hplc-Pda Method Using Two Different Extraction Procedures for the Determination of Alkylresorcinols in Cereals

    Directory of Open Access Journals (Sweden)

    Gailāne Natālija

    2015-09-01

    Full Text Available Cereals, especially barley, are an important source of vitamins, minerals, dietary fibre and various phytochemicals, such as alkylresorcinols (ARs. Cereal ARs are a group of phenolic lipids located in the outer parts of grain, particularly in rye and wheat, but not found in refined flour or in refined products from cereals. This study focuses on the comparison of different extraction procedures applied for the determination of the content of ARs (C15:0 - C23:0 in grain of Latvian barley genotypes. The content of ARs in 1 rye and 16 barley samples grown with different amounts of fertilier was determined by High Performance Liquid Chromatography method with Photodiode Array detection (HPLC-PDA developed by us. Two different extraction methods were compared: accelerated Soxhlet extraction and 24-hour extraction. Aside from validation of the extraction procedures, validation parameters for the HPLC-PDA based quantitation method were provided. The coefficients of variation for repeatability and intermediate precision were < 9% and < 3%, respectively. The content of ARs determined with the HPLC-PDA method in conjunction with accelerated Soxhlet extraction was up to 1.5 times higher than using 24-hour extraction. AR content varied from 2.11 ± 0.04 to 3.80 ± 0.10 mg·100 g-1 for 24-hour extraction and from 2.66 ± 0.06 to 5.70 ± 0.20 mg·100 g-1 for accelerated Soxhlet extraction, indicating the increased efficiency of this procedure in analysis of ARs.

  3. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction

    Directory of Open Access Journals (Sweden)

    Jitendra Kumar

    2016-12-01

    Full Text Available Microbes are ubiquitously distributed in nature, and recent culture-independent studies have highlighted the significance of gut microbiota in human health and disease. Fecal DNA is the primary source for the majority of human gut microbiome studies. However, further improvement is needed to obtain fecal metagenomic DNA with sufficient amount and good quality but low host genomic DNA contamination. In the current study, we demonstrate a quick, robust, unbiased, and cost-effective method for the isolation of high molecular weight (>23 kb metagenomic DNA (260/280 ratio >1.8 with a good yield (55.8 ± 3.8 ng/mg of feces. We also confirm that there is very low human genomic DNA contamination (eubacterial: human genomic DNA marker genes = 227.9:1 in the human feces. The newly-developed method robustly performs for fresh as well as stored fecal samples as demonstrated by 16S rRNA gene sequencing using 454 FLX+. Moreover, 16S rRNA gene analysis indicated that compared to other DNA extraction methods tested, the fecal metagenomic DNA isolated with current methodology retains species richness and does not show microbial diversity biases, which is further confirmed by qPCR with a known quantity of spike-in genomes. Overall, our data highlight a protocol with a balance between quality, amount, user-friendliness, and cost effectiveness for its suitability toward usage for culture-independent analysis of the human gut microbiome, which provides a robust solution to overcome key issues associated with fecal metagenomic DNA isolation in human gut microbiome studies.

  4. Procedure for extraction of disparate data from maps into computerized data bases

    Science.gov (United States)

    Junkin, B. G.

    1979-01-01

    A procedure is presented for extracting disparate sources of data from geographic maps and for the conversion of these data into a suitable format for processing on a computer-oriented information system. Several graphic digitizing considerations are included and related to the NASA Earth Resources Laboratory's Digitizer System. Current operating procedures for the Digitizer System are given in a simplified and logical manner. The report serves as a guide to those organizations interested in converting map-based data by using a comparable map digitizing system.

  5. Camptosorus sibiricus rupr aqueous extract prevents lung tumorigenesis via dual effects against ROS and DNA damage.

    Science.gov (United States)

    He, Shugui; Ou, Rilan; Wang, Wensheng; Ji, Liyan; Gao, Hui; Zhu, Yuanfeng; Liu, Xiaomin; Zheng, Hongming; Liu, Zhongqiu; Wu, Peng; Lu, Linlin

    2018-06-28

    Camptosorus sibiricus Rupr (CSR) is a widely used herbal medicine with antivasculitis, antitrauma, and antitumor effects. However, the effect of CSR aqueous extract on B[a]P-initiated tumorigenesis and the underlying mechanism remain unclear. Moreover, the compounds in CSR aqueous extract need to be identified and structurally characterized. We aim to investigate the chemopreventive effect of CSR and the underlying molecular mechanism. A B[a]P-stimulated normal cell model (BEAS.2B) and lung adenocarcinoma animal model were established on A/J mice. In B[a]P-treated BEAS.2B cells, the protective effects of CSR aqueous extract on B[a]P-induced DNA damage and ROS production were evaluated through flow cytometry, Western blot, real-time quantitative PCR, single-cell gel electrophoresis, and immunofluorescence. Moreover, a model of B[a]P-initiated lung adenocarcinoma was established on A/J mice to determine the chemopreventive effect of CSR in vivo. The underlying mechanism was analyzed via immunohistochemistry and microscopy. Furthermore, the new compounds in CSR aqueous extract were isolated and structurally characterized using IR, HR-ESI-MS, and 1D and 2D NMR spectroscopy. CSR effectively suppressed ROS production by re-activating Nrf2-mediated reductases HO-1 and NQO-1. Simultaneously, CSR attenuated the DNA damage of BEAS.2B cells in the presence of B[a]P. Moreover, CSR at 1.5 and 3 g/kg significantly suppressed tumorigenesis with tumor inhibition ratios of 36.65% and 65.80%, respectively. The tumor volume, tumor size, and multiplicity of B[a]P-induced lung adenocarcinoma were effectively decreased by CSR in vivo. After extracting and identifying the compounds in CSR aqueous extract, three new triterpene saponins were isolated and characterized structurally. CSR aqueous extract prevents lung tumorigenesis by exerting dual effects against ROS and DNA damage, suggesting that CSR is a novel and effective agent for B[a]P-induced carcinogenesis. Moreover, by isolating

  6. Selection of the most suitable method for the extraction of DNA from foods and feeds for species identification

    Directory of Open Access Journals (Sweden)

    Michaela Nesvadbová

    2010-01-01

    Full Text Available High quality and purity of DNA isolated from food and feed is essential for species identification and has unpredictable influences an effect of analysis. In this study, the efficiency of eight different methods for DNA isolation was investigated. For DNA extraction, the raw chicken meet, ham, sausages, tinned lunch meat, pate, tinned feeds for dogs, complete granulated feeds for dogs and chicken flour were used. Kits of several different producers, i.e.: NucleoSpin Food (Marchery-Nagel, Wizard Genomic DNA Purification Kit (Promega, Invisorb Spin Food Kit I (Invitek, Wizard SV Genomic DNA Purification System (Promega, JetQuick Tissue DNA Spin Kit (Genomed, RNA Blue (Top-Bio, JetQuick Blood & Cell Culture Kit (Genomed, QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit (Qiagen were employed in the study. Gel agarose electrophoresis for primary verification of DNA quality was performed. The isolates were subsequently assessed for quantity and quality using by spectrophotometer Nanodrop 2000 (Thermo Scientific. To verify of template usability and quality of isolated DNA, the polymerase chain reaction (PCR was used.Differences between isolated DNA from tinned products and meat, ham, sausage, granulated dog feed and chicken flour were found. In tinned food and feed, the DNA was more degraded, DNA content and DNA purity was lower and also PCR amplification was the most difficult. Overall DNA yield and quality have important influence on PCR products amplification. The best results were obtained with NucleoSpin Food and JetQuick Tissue DNA Spin Kit. DNA extracted by these methods proved highest yields, purity and template quality in all foods and feeds and the results of PCR analysis are excellent reproducible. Analyses showed that results depended on different food or feed using and dif­fe­rent isolation system.The results of this work will be utilized to choose the suitable isolating kit for educational course, which is designed for students and

  7. A Bayesian decision procedure for testing multiple hypotheses in DNA microarray experiments.

    Science.gov (United States)

    Gómez-Villegas, Miguel A; Salazar, Isabel; Sanz, Luis

    2014-02-01

    DNA microarray experiments require the use of multiple hypothesis testing procedures because thousands of hypotheses are simultaneously tested. We deal with this problem from a Bayesian decision theory perspective. We propose a decision criterion based on an estimation of the number of false null hypotheses (FNH), taking as an error measure the proportion of the posterior expected number of false positives with respect to the estimated number of true null hypotheses. The methodology is applied to a Gaussian model when testing bilateral hypotheses. The procedure is illustrated with both simulated and real data examples and the results are compared to those obtained by the Bayes rule when an additive loss function is considered for each joint action and the generalized loss 0-1 function for each individual action. Our procedure significantly reduced the percentage of false negatives whereas the percentage of false positives remains at an acceptable level.

  8. Selenium speciation in phosphate mine soils and evaluation of a sequential extraction procedure using XAFS

    International Nuclear Information System (INIS)

    Favorito, Jessica E.; Luxton, Todd P.; Eick, Matthew J.; Grossl, Paul R.

    2017-01-01

    Selenium is a trace element found in western US soils, where ingestion of Se-accumulating plants has resulted in livestock fatalities. Therefore, a reliable understanding of Se speciation and bioavailability is critical for effective mitigation. Sequential extraction procedures (SEP) are often employed to examine Se phases and speciation in contaminated soils but may be limited by experimental conditions. We examined the validity of a SEP using X-ray absorption spectroscopy (XAS) for both whole and a sequence of extracted soils. The sequence included removal of soluble, PO 4 -extractable, carbonate, amorphous Fe-oxide, crystalline Fe-oxide, organic, and residual Se forms. For whole soils, XANES analyses indicated Se(0) and Se(-II) predominated, with lower amounts of Se(IV) present, related to carbonates and Fe-oxides. Oxidized Se species were more elevated and residual/elemental Se was lower than previous SEP results from ICP-AES suggested. For soils from the SEP sequence, XANES results indicated only partial recovery of carbonate, Fe-oxide and organic Se. This suggests Se was incompletely removed during designated extractions, possibly due to lack of mineral solubilization or reagent specificity. Selenium fractions associated with Fe-oxides were reduced in amount or removed after using hydroxylamine HCl for most soils examined. XANES results indicate partial dissolution of solid-phases may occur during extraction processes. This study demonstrates why precautions should be taken to improve the validity of SEPs. Mineralogical and chemical characterizations should be completed prior to SEP implementation to identify extractable phases or mineral components that may influence extraction effectiveness. Sequential extraction procedures can be appropriately tailored for reliable quantification of speciation in contaminated soils. - Highlights: • XANES spectra indicated whole soils consisted of mostly elemental and organic Se and lower amounts of sorbed oxidized Se.

  9. Seasonal distribution of Legionella spp. and L. pneumophila in a river in Taiwan evaluated with culture-confirmed and direct DNA extraction methods

    Science.gov (United States)

    Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li

    2013-07-01

    In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.

  10. Recovery of DNA from latent fingerprint tape lifts archived against matte acetate.

    Science.gov (United States)

    Steadman, Shelly A; Hoofer, Steven R; Geering, Sarah C; King, Stephanie; Bennett, Marc A

    2015-05-01

    This study was driven by court order to examine methods to remove, extract, and STR-type potential DNA entrapped between latent fingerprint lifting tape and matte acetate that was collected from a 1977 crime scene. Results indicate that recovery of appreciable quantities of DNA is more challenging once adhesive is attached to matte acetate cards and even more difficult when fixed following black powder enhancement. STR amplification of extracts from entrapped fingermarks collected following the dusting/lifting procedure did not produce robust profiles, and extraneous peaks not expressed by print donors were detected for some samples. A hearing was set to argue whether there was DNA remaining to be tested, and if so, whether that DNA could be exculpatory in this postconviction matter. The studies herein provided the basis for the court's decision to not require the testing. © 2015 American Academy of Forensic Sciences.

  11. Myricitrin and bioactive extract of Albizia amara leaves: DNA protection and modulation of fertility and antioxidant-related genes expression.

    Science.gov (United States)

    Kassem, Mona El Said; Ibrahim, Lamya Fawzy; Hussein, Sameh Reda; El-Sharawy, Reham; El-Ansari, Mohamed Amin; Hassanane, Mahrousa Mohamed; Booles, Hoda Fahime

    2016-11-01

    Albizia species are reported to exhibit many biological activities including antiovulatory properties in female rats and antispermatogenic and antiandrogenic activities in male rats. The present study investigates the flavonoids of Albizia amara (Roxb.) B. Boivin (Fabaceae) leaves and evaluates their activity on gene expression of fertility and antioxidant glutathione-S-transferase-related genes of treated female mice in addition to their effect on DNA damage. Plant materials were extracted by using 70% methanol for 48 h, the extract was chromatographed on a polyamide 6S column, each isolated compound was purified by using Sephadex LH-20 column; its structure was elucidated by chemical and spectral methods. Both the leaves extract and myricitrin (200, 30 mg/kg bw/d, respectively) were assayed for their effect on DNA damage in female mice after four weeks treatment using Comet assay. Their modulatory activity on gene expression of fertility (aromatase CYP19 and luteinizing hormone LH) and antioxidant glutathione-S-transferase (GST)-related genes of treated female mice were investigated by real-time PCR (qPCR). Quercetin-3-O-gentiobioside, myricitrin, quercetin-3-O-α-rhamnopyranoside, myricetin, quercetin and kaempferol were isolated and identified from the studied taxa. Myricitrin and the extract induced low rate of DNA damage (4.8% and 5%, respectively), compared with the untreated control (4.2%) and significantly down-regulated the expression of CYP19 and LH genes and up-regulated GST gene. Our results highlight the potential effect of the leaves extract of Albizia amara and myricitrin as fertility-regulating phytoconstituents with ability to protect DNA from damage and cells from oxidative stress.

  12. A new method to extract dental pulp DNA: application to universal detection of bacteria.

    Directory of Open Access Journals (Sweden)

    Lam Tran-Hung

    Full Text Available BACKGROUND: Dental pulp is used for PCR-based detection of DNA derived from host and bacteremic microorganims. Current protocols require odontology expertise for proper recovery of the dental pulp. Dental pulp specimen exposed to laboratory environment yields contaminants detected using universal 16S rDNA-based detection of bacteria. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new protocol by encasing decontaminated tooth into sterile resin, extracting DNA into the dental pulp chamber itself and decontaminating PCR reagents by filtration and double restriction enzyme digestion. Application to 16S rDNA-based detection of bacteria in 144 teeth collected in 86 healthy people yielded a unique sequence in only 14 teeth (9.7% from 12 individuals (14%. Each individual yielded a unique 16S rDNA sequence in 1-2 teeth per individual. Negative controls remained negative. Bacterial identifications were all confirmed by amplification and sequencing of specific rpoB sequence. CONCLUSIONS/SIGNIFICANCE: The new protocol prevented laboratory contamination of the dental pulp. It allowed the detection of bacteria responsible for dental pulp colonization from blood and periodontal tissue. Only 10% such samples contained 16S rDNA. It provides a new tool for the retrospective diagnostic of bacteremia by allowing the universal detection of bacterial DNA in animal and human, contemporary or ancient tooth. It could be further applied to identification of host DNA in forensic medicine and anthropology.

  13. Co-isolation of in vivo 32P-labeled specific transcripts and DNA without phenol extraction of nuclease digestion

    International Nuclear Information System (INIS)

    Hayes, S.; Hayes, C.; Brand, L.

    1981-01-01

    A method is described for isolation and quantitation of specific intact transcripts, for which a hybridization probe is available, from 32 P-labeled bacterial cells. The RNA is extracted in the absence of R Nase activity by incorporating an inert, physically removable R Nase inhibitor throughout the spheroplasting, cell lysis, and pronase digestion steps. [/sup 32/P]RNA is separated from [ 32 P]DNA, without recourse to phenol extraction of DNase treatment, on a Cs 2 SO/sub 4-/HCONH 2 step gradient in which the precipitated RNA forms a sharp band. Specific transcripts are purified from [ 32 P]RNA by physical separation of the transcript and hybridization probe using gel-exclusion chromatography. The gentleness of this technique enables the co-isolation of DNA and can facilitate the analysis of covalently joined RNA-DNA replication intermediates

  14. New procedure for extraction of algal lipids from wet biomass: a green clean and scalable process.

    Science.gov (United States)

    Dejoye Tanzi, Celine; Abert Vian, Maryline; Chemat, Farid

    2013-04-01

    A new procedure, called Simultaneous Distillation and Extraction Process (SDEP), for lipid extraction from wet microalgae (Nannochloropsis oculata and Dunaliella salina) was reported. This method does not require a pre-drying of the biomass and employs alternative solvents such as d-limonene, α-pinene and p-cymene. This procedure has been compared with Soxhlet extraction (Sox) and Bligh & Dyer method (B&D). For N. oculata, results showed that SDEP-cymene provided similar lipid yields to B&D (21.45% and 23.78%), while SDEP-limonene and pinene provided lower yields (18.73% and 18.75% respectively). For D. salina, SDEP-pinene provided the maximum lipid yield (3.29%) compared to the other solvents, which is quite close to B&D result (4.03%). No significant differences in terms of distribution of lipid classes and fatty acid composition have been obtained for different techniques. Evaluation of energy consumption indicates a substantial saving in the extraction cost by SDEP compared to the conventional extraction technique, Soxhlet. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Comparison of DNA extraction kits for detection of Burkholderia pseudomallei in spiked human whole blood using real-time PCR.

    Directory of Open Access Journals (Sweden)

    Nicole L Podnecky

    Full Text Available Burkholderia pseudomallei, the etiologic agent of melioidosis, is endemic in northern Australia and Southeast Asia and can cause severe septicemia that may lead to death in 20% to 50% of cases. Rapid detection of B. pseudomallei infection is crucial for timely treatment of septic patients. This study evaluated seven commercially available DNA extraction kits to determine the relative recovery of B. pseudomallei DNA from spiked EDTA-containing human whole blood. The evaluation included three manual kits: the QIAamp DNA Mini kit, the QIAamp DNA Blood Mini kit, and the High Pure PCR Template Preparation kit; and four automated systems: the MagNAPure LC using the DNA Isolation Kit I, the MagNAPure Compact using the Nucleic Acid Isolation Kit I, and the QIAcube using the QIAamp DNA Mini kit and the QIAamp DNA Blood Mini kit. Detection of B. pseudomallei DNA extracted by each kit was performed using the B. pseudomallei specific type III secretion real-time PCR (TTS1 assay. Crossing threshold (C T values were used to compare the limit of detection and reproducibility of each kit. This study also compared the DNA concentrations and DNA purity yielded for each kit. The following kits consistently yielded DNA that produced a detectable signal from blood spiked with 5.5×10(4 colony forming units per mL: the High Pure PCR Template Preparation, QIAamp DNA Mini, MagNA Pure Compact, and the QIAcube running the QIAamp DNA Mini and QIAamp DNA Blood Mini kits. The High Pure PCR Template Preparation kit yielded the lowest limit of detection with spiked blood, but when this kit was used with blood from patients with confirmed cases of melioidosis, the bacteria was not reliably detected indicating blood may not be an optimal specimen.

  16. DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

    Science.gov (United States)

    Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

    2015-01-01

    Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

  17. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits.

    Science.gov (United States)

    Demeke, Tigst; Jenkins, G Ronald

    2010-03-01

    Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.

  18. MCM interference during licensing of DNA replication in Xenopus egg extracts-Possible Role of a C-terminal region of MCM3.

    Science.gov (United States)

    Mimura, Satoru; Kubota, Yumiko; Takisawa, Haruhiko

    2018-01-01

    The minichromosome maintenance (MCM) complex, consisting of six subunits, Mcm2-7, is loaded onto replication origins through loading factors (origin recognition complex [ORC], Cdc6, and Cdt1) and forms an MCM double hexamer that licenses the initiation of DNA replication. Previous studies with Xenopus egg extracts showed that loading factors, especially Cdc6, dissociate from chromatin on MCM loading, but the molecular mechanism and physiological significance remain largely unknown. Using a cell-free system for MCM loading onto plasmid DNA in Xenopus egg extracts, we found that MCM loaded onto DNA prevents DNA binding of the loading factors ORC, Cdc6, and Cdt1. We further report that a peptide of the C-terminal region of MCM3 (MCM3-C), previously implicated in the initial association with ORC/Cdc6 in budding yeast, prevents ORC/Cdc6/Cdt1 binding to DNA in the absence of MCM loading. ATP-γ-S suppresses inhibitory activities of both the MCM loaded onto DNA and the MCM3-C peptide. Other soluble factors in the extract, but neither MCM nor Cdt1, are required for the activity. Conservation of the amino acid sequences of MCM3-C and its activity in vertebrates implies a novel negative autoregulatory mechanism that interferes with MCM loading in the vicinity of licensed origins to ensure proper origin licensing.

  19. Aqueous extract of Crataegus azarolus protects against DNA damage in human lymphoblast Cell K562 and enhances antioxidant activity.

    Science.gov (United States)

    Mustapha, Nadia; Bouhlel, Inès; Chaabane, Fadwa; Bzéouich, Imèn Mokdad; Ghedira, Kamel; Hennebelle, Thierry; Chekir-Ghedira, Leila

    2014-02-01

    The present study was carried out to characterize the cellular antioxidant effect of the aqueous extract of Crataegus azarolus and its antigenotoxic potential using human myelogenous cells, K562. The antioxidant capacity of this extract was evaluated by determining its cellular antioxidant activity (CAA) in K562 cells. Also, preceding antigenotoxicity assessment, its eventual genotoxicity property was investigated by evaluating its capacity to induce the DNA degradation of treated cell nuclei. As no genotoxicity was detected at different exposure times, its ability to protect cell DNA against H2O2 oxidative effect was investigated, using the "comet assay." It appears that 800 μg/mL of extract inhibited the genotoxicity induced by H2O2 with a rate of 41.30 %, after 4 h of incubation. In addition, this extract revealed a significant cellular antioxidant capacity against the reactive oxygen species in K562 cells.

  20. Development of an automated sequential injection on-line solvent extraction-back extraction procedure as demonstrated for the determination of cadmium with detection by electrothermal atomic absorption spectrometry

    DEFF Research Database (Denmark)

    Wang, Jianhua; Hansen, Elo Harald

    2002-01-01

    An automated sequential injection (SI) on-line solvent extraction-back extraction separation/preconcentration procedure is described. Demonstrated for the assay of cadmium by electrothermal atomic absorption spectrometry (ETAAS), the analyte is initially complexed with ammonium pyrrolidinedithioc......An automated sequential injection (SI) on-line solvent extraction-back extraction separation/preconcentration procedure is described. Demonstrated for the assay of cadmium by electrothermal atomic absorption spectrometry (ETAAS), the analyte is initially complexed with ammonium....../preconcentration process of the ensuing sample. An enrichment factor of 21.4, a detection limit of 2.7 ng/l, along with a sampling frequency of 13s/h were obtained at a sample flow rate of 6.0mlmin/sup -1/. The precision (R.S.D.) at the 0.4 mug/l level was 1.8% as compared to 3.2% when quantifying the organic extractant...

  1. Fetal DNA: strategies for optimal recovery

    NARCIS (Netherlands)

    Legler, Tobias J.; Heermann, Klaus-Hinrich; Liu, Zhong; Soussan, Aicha Ait; van der Schoot, C. Ellen

    2008-01-01

    For fetal DNA extraction, in principle each DNA extraction method can be used; however, because most methods have been optimized for genomic DNA from leucocytes, we describe here the methods that have been optimized for the extraction of fetal DNA from maternal plasma and validated for this purpose

  2. Comparison of QIAsymphony Automated and QIAamp Manual DNA Extraction Systems for Measuring Epstein-Barr Virus DNA Load in Whole Blood Using Real-Time PCR

    OpenAIRE

    Laus, Stella; Kingsley, Lawrence A.; Green, Michael; Wadowsky, Robert M.

    2011-01-01

    Automated and manual extraction systems have been used with real-time PCR for quantification of Epstein-Barr virus [human herpesvirus 4 (HHV-4)] DNA in whole blood, but few studies have evaluated relative performances. In the present study, the automated QIAsymphony and manual QIAamp extraction systems (Qiagen, Valencia, CA) were assessed using paired aliquots derived from clinical whole-blood specimens and an in-house, real-time PCR assay. The detection limits using the QIAsymphony and QIAam...

  3. Genotoxic Evaluation of Mikania laevigata Extract on DNA Damage Caused by Acute Coal Dust Exposure

    Energy Technology Data Exchange (ETDEWEB)

    Freitas, T.P.; Heuser, V.D.; Tavares, P.; Leffa, D.D.; da Silva, G.A.; Citadini-Zanette, V.; Romao, P.R.T.; Pinho, R.A.; Streck, E.L.; Andrade,V.M. [University of Extremo Catarinense, Criciuma, SC (Brazil)

    2009-06-15

    We report data on the possible antigenotoxic activity of Mikania laevigata extract (MLE) after acute intratracheal instillation of coal dust using the comet assay in peripheral blood, bone marrow, and liver cells and the micronucleus test in peripheral blood of Wistar rats. The animals were pretreated for 2 weeks with saline solution (groups 1 and 2) or MLE (100 mg/kg) (groups 3 and 4). On day 15, the animals were anesthetized with ketamine (80 mg/kg) and xylazine (20 mg/kg), and gross mineral coal dust (3 mg/0.3 mL saline) (groups 2 and 4) or saline solution (0.3 mL) (groups 1 and 3) was administered directly in the lung by intratracheal administration. Fifteen days after coal dust or saline instillation, the animals were sacrificed, and the femur, liver, and peripheral blood were removed. The results showed a general increase in the DNA damage values at 8 hours for all treatment groups, probably related to surgical procedures that had stressed the animals. Also, liver cells from rats treated with coal dust, pretreated or not with MLE, showed statistically higher comet assay values compared to the control group at 14 days after exposure. These results could be expected because the liver metabolizes a variety of organic compounds to more polar by-products. On the other hand, the micronucleus assay results did not show significant differences among groups. Therefore, our data do not support the antimutagenic activity of M. laevigata as a modulator of DNA damage after acute coal dust instillation.

  4. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  5. The effect of DNA extraction methods on observed microbial communities from fibrous and liquid rumen fractions of dairy cows

    NARCIS (Netherlands)

    Vaidya, Jueeli D.; Bogert, van den Bartholomeus; Boekhorst, Jos; Saccenti, Edoardo; Plugge, Caroline M.; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of

  6. Procedures for extraction and purification of leaf wax biomarkers from peats

    Directory of Open Access Journals (Sweden)

    J.E. Nichols

    2011-12-01

    Full Text Available Palaeoecological and palaeoclimate reconstruction, using leaf wax biomarkers, is a relatively new sub-discipline of peatland science. The ability to process large numbers of samples rapidly for biomarkers makes this type of analysis particularly appealing. This review is a guide to the preparation of leaf waxes for analysis by gas chromatography. The main phases of preparation are extraction of soluble organic compounds from sediment, separation of the total extract into fractions of differing polarity, and the derivatisation of polar functional groups. The procedures described here are not meant be exhaustive of all organic geochemical possibilities in peatlands, but a distillation of methods for the preparation of leaf waxes that are commonly and increasingly being used in palaeoecological and palaeoclimatological studies.

  7. Developmentally Regulated Ribosomal rDNA Genes in Plasmodium vivax: Biological Implications and Practical Applications

    Science.gov (United States)

    1994-08-10

    technological advances, especially DNA polymerase chain reaction (peR), molecular cloning and rapid nuc1eotide sequencing. These advances have allowed...containing 0.15% saponin and set on ice for 2· minutes. After washing and centrifugation twice, as described above, the pellets were dissolved in...incubated at 370C for 60 minutes. DNA was further processed by standard procedures [Maniatis et al., 1982]. Briefly, the lysed sample was extracted

  8. A two-stage extraction procedure for insensitive munition (IM) explosive compounds in soils.

    Science.gov (United States)

    Felt, Deborah; Gurtowski, Luke; Nestler, Catherine C; Johnson, Jared; Larson, Steven

    2016-12-01

    The Department of Defense (DoD) is developing a new category of insensitive munitions (IMs) that are more resistant to detonation or promulgation from external stimuli than traditional munition formulations. The new explosive constituent compounds are 2,4-dinitroanisole (DNAN), nitroguanidine (NQ), and nitrotriazolone (NTO). The production and use of IM formulations may result in interaction of IM component compounds with soil. The chemical properties of these IM compounds present unique challenges for extraction from environmental matrices such as soil. A two-stage extraction procedure was developed and tested using several soil types amended with known concentrations of IM compounds. This procedure incorporates both an acidified phase and an organic phase to account for the chemical properties of the IM compounds. The method detection limits (MDLs) for all IM compounds in all soil types were regulatory risk-based Regional Screening Level (RSL) criteria for soil proposed by the U.S. Army Public Health Center. At defined environmentally relevant concentrations, the average recovery of each IM compound in each soil type was consistent and greater than 85%. The two-stage extraction method decreased the influence of soil composition on IM compound recovery. UV analysis of NTO established an isosbestic point based on varied pH at a detection wavelength of 341 nm. The two-stage soil extraction method is equally effective for traditional munition compounds, a potentially important point when examining soils exposed to both traditional and insensitive munitions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Mercury and trace element fractionation in Almaden soils by application of different sequential extraction procedures

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, D.M.; Quejido, A.J.; Fernandez, M.; Hernandez, C.; Schmid, T.; Millan, R.; Gonzalez, M.; Aldea, M.; Martin, R.; Morante, R. [CIEMAT, Madrid (Spain)

    2005-04-01

    A comparative evaluation of the mercury distribution in a soil sample from Almaden (Spain) has been performed by applying three different sequential extraction procedures, namely, modified BCR (three steps in sequence), Di Giulio-Ryan (four steps in sequence), and a specific SEP developed at CIEMAT (six steps in sequence). There were important differences in the mercury extraction results obtained by the three procedures according to the reagents applied and the sequence of their application. These findings highlight the difficulty of setting a universal SEP to obtain information on metal fractions of different mobility for any soil sample, as well as the requirement for knowledge about the mineralogical and chemical characteristics of the samples. The specific six-step CIEMAT sequential extraction procedure was applied to a soil profile (Ap, Ah, Bt1, and Bt2 horizons). The distribution of mercury and major, minor, and trace elements in the different fractions were determined. The results indicate that mercury is mainly released with 6 M HCl. The strong association of mercury with crystalline iron oxyhydroxides, present in all the horizons of the profile, and/or the solubility of some mercury compounds in such acid can explain this fact. Minor mercury is found in the fraction assigned to oxidizable matter and in the final insoluble residue (cinnabar). (orig.)

  10. Determination of available phosphorus in soils by using a new extraction procedure and a flow injection amperometric system.

    Science.gov (United States)

    Jakmunee, Jaroon; Junsomboon, Jaroon

    2009-09-15

    A new extraction procedure based on an off-line extraction column was proposed for extracting of available phosphorus from soils. The column was fabricated from a plastic syringe fitted at the bottom with a cotton wool and a piece of filter paper to support a soil sample. An aliquot (50 mL) of extracting solution (0.05 M HCl+0.0125 M H(2)SO(4)) was used to extract the sample under gravity flow and the eluate was collected in a polyethylene bottle. The extract was then analyzed for phosphorus contents by a simple flow injection amperometric system, employing a set of three-way solenoid valves as an injection valve. The method is based on the electrochemical reduction of 12-molybdophosphate which is produced on-line by the reaction of orthophosphate with acidic molybdate and the electrical current produced was directly proportional to the concentration of phosphate in range of 0.1-10.0 mg L(-1) PO(4)-P, with a detection limit of 0.02 mg L(-1). Relative standard for 11 replicate injections of 5 mg L(-1) PO(4)-P was 0.5%. A sample through put of 35 h(-1) was achieved, with consumption of 14 mg KCl, 10mg ammonium molybdate and 0.05 mL H(2)SO(4) per analysis. The detection system does not suffer from the interferences that are encountered in the photometric method such as colored substances, colloids, metal ions, silicate and refractive index effect (Schlieren effect). The results obtained by the column extraction procedure were well correlated with those obtained by the steady-state extraction procedure, but showed slightly higher extraction efficiency.

  11. Use of Moringa oleifera Flower Pod Extract as Natural Preservative and Development of SCAR Marker for Its DNA Based Identification.

    Science.gov (United States)

    Gull, Iram; Javed, Attia; Aslam, Muhammad Shahbaz; Mushtaq, Roohi; Athar, Muhammad Amin

    2016-01-01

    The use of Moringa oleifera as natural food preservative has been evaluated in the present study. In addition, for quality assurance, the study has also been focused on the shelf life of product to authenticate the identification of plant by development of DNA based marker. Among the different extracts prepared from flower pods of Moringa oleifera, methanol and aqueous extract exhibited high antibacterial and antioxidant activity, respectively. The high phenolic contents (53.5 ± 0.169 mg GAE/g) and flavonoid contents (10.9 ± 0.094 mg QE/g) were also recorded in methanol and aqueous extract, respectively. Due to instability of bioactive compounds in aqueous extract, methanol extract is considered as potent natural preservative. The shelf life of methanol extract was observed for two months at 4°C under dark conditions. The developed SCAR primers (MOF217/317/MOR317) specifically amplified a fragment of 317 bp from DNA of Moringa oleifera samples collected from different regions of Punjab province of Pakistan. The methanol extract of Moringa oleifera flower pods has great potential to be used as natural preservative and nutraceutical in food industry.

  12. Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions.

    Science.gov (United States)

    Nakayama, Yuki; Yamaguchi, Hiromi; Einaga, Naoki; Esumi, Mariko

    2016-01-01

    The Qubit fluorometer is a DNA quantification device based on the fluorescence intensity of fluorescent dye binding to double-stranded DNA (dsDNA). Qubit is generally considered useful for checking DNA quality before next-generation sequencing because it measures intact dsDNA. To examine the most accurate and suitable methods for quantifying DNA for quality assessment, we compared three quantification methods: NanoDrop, which measures UV absorbance; Qubit; and quantitative PCR (qPCR), which measures the abundance of a target gene. For the comparison, we used three types of DNA: 1) DNA extracted from fresh frozen liver tissues (Frozen-DNA); 2) DNA extracted from formalin-fixed, paraffin-embedded liver tissues comparable to those used for Frozen-DNA (FFPE-DNA); and 3) DNA extracted from the remaining fractions after RNA extraction with Trizol reagent (Trizol-DNA). These DNAs were serially diluted with distilled water and measured using three quantification methods. For Frozen-DNA, the Qubit values were not proportional to the dilution ratio, in contrast with the NanoDrop and qPCR values. This non-proportional decrease in Qubit values was dependent on a lower salt concentration, and over 1 mM NaCl in the DNA solution was required for the Qubit measurement. For FFPE-DNA, the Qubit values were proportional to the dilution ratio and were lower than the NanoDrop values. However, electrophoresis revealed that qPCR reflected the degree of DNA fragmentation more accurately than Qubit. Thus, qPCR is superior to Qubit for checking the quality of FFPE-DNA. For Trizol-DNA, the Qubit values were proportional to the dilution ratio and were consistently lower than the NanoDrop values, similar to FFPE-DNA. However, the qPCR values were higher than the NanoDrop values. Electrophoresis with SYBR Green I and single-stranded DNA (ssDNA) quantification demonstrated that Trizol-DNA consisted mostly of non-fragmented ssDNA. Therefore, Qubit is not always the most accurate method for

  13. Selenium speciation in phosphate mine soils and evaluation of a sequential extraction procedure using XAFS

    Energy Technology Data Exchange (ETDEWEB)

    Favorito, Jessica E.; Luxton, Todd P.; Eick, Matthew J.; Grossl, Paul R. (VP); (Utah SU); (EPA)

    2017-10-01

    Selenium is a trace element found in western US soils, where ingestion of Se-accumulating plants has resulted in livestock fatalities. Therefore, a reliable understanding of Se speciation and bioavailability is critical for effective mitigation. Sequential extraction procedures (SEP) are often employed to examine Se phases and speciation in contaminated soils but may be limited by experimental conditions. We examined the validity of a SEP using X-ray absorption spectroscopy (XAS) for both whole and a sequence of extracted soils. The sequence included removal of soluble, PO4-extractable, carbonate, amorphous Fe-oxide, crystalline Fe-oxide, organic, and residual Se forms. For whole soils, XANES analyses indicated Se(0) and Se(-II) predominated, with lower amounts of Se(IV) present, related to carbonates and Fe-oxides. Oxidized Se species were more elevated and residual/elemental Se was lower than previous SEP results from ICP-AES suggested. For soils from the SEP sequence, XANES results indicated only partial recovery of carbonate, Fe-oxide and organic Se. This suggests Se was incompletely removed during designated extractions, possibly due to lack of mineral solubilization or reagent specificity. Selenium fractions associated with Fe-oxides were reduced in amount or removed after using hydroxylamine HCl for most soils examined. XANES results indicate partial dissolution of solid-phases may occur during extraction processes. This study demonstrates why precautions should be taken to improve the validity of SEPs. Mineralogical and chemical characterizations should be completed prior to SEP implementation to identify extractable phases or mineral components that may influence extraction effectiveness. Sequential extraction procedures can be appropriately tailored for reliable quantification of speciation in contaminated soils.

  14. Effects of a Mangifera indica L. stem bark extract and mangiferin on radiation-induced DNA damage in human lymphocytes and lymphoblastoid cells.

    Science.gov (United States)

    Rodeiro, I; Delgado, R; Garrido, G

    2014-02-01

    Mangifera indica L. (mango) stem bark aqueous extract (MSBE) that has antioxidant, anti-inflammatory and immunomodulatory properties, can be obtained in Cuba. It is rich in polyphenols, where mangiferin is the main component. In this study, we have tested DNA damage and protection effects of MSBE and mangiferin on primary human lymphocytes and lymphoblastoid cells. Cell suspensions were incubated with the products (50-1000 μg/ml) for experiments on damage induction, and evaluation of any potential protective effects (5-100 μg/ml) for 60 min at 37 °C. Irradiation was performed using a γ-ray source, absorbed dose 5 Gy. At the end of exposure, DNA damage, protection and repair processes were evaluated using the comet assay. MSBE (100-1000 μg/ml) induced DNA damage in a concentration dependent manner in both cell types tested, primary cells being more sensitive. Mangiferin (200 μg/ml) only induced light DNA damage at higher concentrations. DNA repair capacity was not affected after MSBE or mangiferin exposure. On the other hand, MSBE (25 and 50 μg/ml) and mangiferin (5-25 ug/ml) protected against gamma radiation-induced DNA damage. These results show MSBE has protector or harmful effects on DNA in vitro depending on the experimental conditions, which suggest that the extract could be acting as an antioxidant or pro-oxidant product. Mangiferin was involved in protective effects of the extract. © 2013 John Wiley & Sons Ltd.

  15. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food.

    Science.gov (United States)

    Pacheco Coello, Ricardo; Pestana Justo, Jorge; Factos Mendoza, Andrés; Santos Ordoñez, Efrén

    2017-12-20

    In Ecuador, food products need to be labeled if exceeded 0.9% of transgenic content in whole products. For the detection of genetically modified organisms (GMOs), three DNA extraction methods were tested in 35 food products commercialized in Ecuador. Samples with positive amplification of endogenous genes were screened for the presence of the Cauliflower mosaic virus 35S-promoter (P35S) and the nopaline synthase-terminator (Tnos). TaqMan™ probes were used for determination of transgenic content of the GTS 40-3-2 and MON810 events through quantitative PCR (qPCR). Twenty-six processed food samples were positive for the P35S alone and eight samples for the Tnos and P35S. Absolute qPCR results indicated that eleven samples were positive for GTS 40-3-2 specific event and two for MON810 specific event. A total of nine samples for events GTS 40-3-2 and MON810 exceeded the umbral allowed of transgenic content in the whole food product with the specific events. Different food products may require different DNA extraction protocols for GMO detection through PCR. Among the three methods tested, the DNeasy mericon food kit DNA extraction method obtained higher proportion of amplified endogenous genes through PCR. Finally, event-specific GMOs were detected in food products in Ecuador.

  16. Evaluation by latent class analysis of a magnetic capture based DNA extraction followed by real-time qPCR as a new diagnostic method for detection of Echinococcus multilocularis in definitive hosts.

    Science.gov (United States)

    Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke

    2016-10-30

    A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  18. DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products.

    Science.gov (United States)

    Turkec, Aydin; Kazan, Hande; Karacanli, Burçin; Lucas, Stuart J

    2015-08-01

    In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

  19. A combined method for DNA analysis and radiocarbon dating from a single sample.

    Science.gov (United States)

    Korlević, Petra; Talamo, Sahra; Meyer, Matthias

    2018-03-07

    Current protocols for ancient DNA and radiocarbon analysis of ancient bones and teeth call for multiple destructive samplings of a given specimen, thereby increasing the extent of undesirable damage to precious archaeological material. Here we present a method that makes it possible to obtain both ancient DNA sequences and radiocarbon dates from the same sample material. This is achieved by releasing DNA from the bone matrix through incubation with either EDTA or phosphate buffer prior to complete demineralization and collagen extraction utilizing the acid-base-acid-gelatinization and ultrafiltration procedure established in most radiocarbon dating laboratories. Using a set of 12 bones of different ages and preservation conditions we demonstrate that on average 89% of the DNA can be released from sample powder with minimal, or 38% without any, detectable collagen loss. We also detect no skews in radiocarbon dates compared to untreated samples. Given the different material demands for radiocarbon dating (500 mg of bone/dentine) and DNA analysis (10-100 mg), combined DNA and collagen extraction not only streamlines the sampling process but also drastically increases the amount of DNA that can be recovered from limited sample material.

  20. Chamomile flower extract-directed CuO nanoparticle formation for its antioxidant and DNA cleavage properties

    Energy Technology Data Exchange (ETDEWEB)

    Duman, Fatih, E-mail: fduman@erciyes.edu.tr [Erciyes University, Science Faculty, Biology Department, Kayseri 38039, Kayseri (Turkey); Ocsoy, Ismail [Department of Analytical Chemistry, Faculty of Pharmacy, Erciyes University, 38039, Kayseri (Turkey); Erciyes University, Nanotechnology Research Center, 38039, Kayseri (Turkey); Kup, Fatma Ozturk [Erciyes University, Science Faculty, Biology Department, Kayseri 38039, Kayseri (Turkey)

    2016-03-01

    In this study, we report the synthesis of copper oxide nanoparticles (CuO NPs) using a medicinal plant (Matricaria chamomilla) flower extract as both reducing and capping agent and investigate their antioxidant activity and interaction with plasmid DNA (pBR322).The CuO NPs were characterized using Uv–Vis spectroscopy, FT-IR (Fourier transform infrared spectroscopy), DLS (dynamic light scattering), XRD (X-ray diffraction), EDX (energy-dispersive X-ray) spectroscopy and SEM (scanning electron microscopy). The CuO NPs exhibited nearly mono-distributed and spherical shapes with diameters of 140 nm size. UV–Vis absorption spectrum of CuO NPs gave a broad peak around 285 and 320 nm. The existence of functional groups on the surface of CuO NPs was characterized with FT-IR analysis. XRD pattern showed that the NPs are in the form of a face-centered cubic crystal. Zeta potential value was measured as − 20 mV due to the presence of negatively charged functional groups in plant extract. Additionally, we demonstrated concentration-dependent antioxidant activity of CuO NPs and their interaction with plasmid DNA. We assumed that the CuO NPs both cleave and break DNA double helix structure. - Highlights: • The synthesis of microwave assisted green synthesis of CuO nanoparticles • The synthesized nanoparticles were analyzed by FT-IR, DLS, XRD, EDX and SEM. • Concentration-dependent antioxidant activity of CuO NPs was determined. • CuO NPs cause both cleavage in the DNA double helix structure and breaks as well.

  1. Assessment of bleeding during minor oral surgical procedures and extraction in patients on anticoagulant therapy

    Directory of Open Access Journals (Sweden)

    S Jimson

    2015-01-01

    Full Text Available Introduction: The risk of postoperative hemorrhage from oral surgical procedures has been a concern in the treatment of patients who are receiving long-term anticoagulation therapy. A study undertaken in our institution to address questions about the amount and severity of bleeding associated with minor outpatient oral surgery procedures by assessing bleeding in patients who did not alter their anticoagulant regimen. Subjects and Methods: Eighty-three patients receiving long-term anticoagulant therapy visited Department of Oral and Maxillofacial Surgery from May 2010 to October 2011 for extractions and minor oral surgical procedures. Each patient was required to undergo preoperative assessment of prothrombin time (PT and measurement of the international normalized ratio. Fifty-six patients with preoperative PT values within the therapeutic range 3-4 were included in the study. The patients′ age ranged between 30 and 75 years. Application of surgispon was done following the procedure. Extraction of teeth performed with minimal trauma to the surrounding tissues, the socket margins sutured, and sutures removed after 5 days. Results: There was no significant incidence of prolonged or excessive hemorrhage and wound infection and the healing process was normal.

  2. Direct-acting DNA alkylating agents present in aqueous extracts of areca nut and its products.

    Science.gov (United States)

    Hu, Chiung-Wen; Chao, Mu-Rong

    2012-11-19

    Areca nut is a carcinogen to humans and has been strongly associated with oral premalignant and malignant diseases. Previous studies speculated the presence of unknown direct-acting mutagens present in aqueous extracts of areca nut. We hypothesized whether any direct-acting alkylating agents are present in areca nut and its commercial products. In this study, calf thymus DNA was treated with four different aqueous extracts obtained from unripe and ripe areca nuts or their commercial products, namely, pan masala (without tobacco) and gutkha (with tobacco). Three N-alkylated purines including N7-methylguanine (N7-MeG), N3-methyladenine (N3-MeA), and N7-ethylguanine (N7-EtG) were detected using sensitive and specific isotope-dilution liquid chromatography-tandem-mass spectrometry (LC-MS/MS) methods. The results showed that four types of aqueous extracts significantly induced the formation of N7-MeG and N3-MeA in a linear dose-response manner. Extracts from unripe areca nut exhibited higher methylating potency than those of ripe areca nut, while gutkha had higher methylating potency than pan masala. Meanwhile, gutkha made with areca nut and tobacco, was the only extract found to induce the formation of N7-EtG. Overall, this study first demonstrated that the presence of direct-acting alkylating agents in areca nut and its commercial products exist at a level that is able to cause significant DNA damage. Our findings may provide another mechanistic rationale for areca nut-mediated oral carcinogenesis and also highlight the importance and necessity of the identification of these direct-acting alkylating agents.

  3. Analysis of current and alternative phenol based RNA extraction methodologies for cyanobacteria

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2009-08-01

    Full Text Available Abstract Background The validity and reproducibility of gene expression studies depend on the quality of extracted RNA and the degree of genomic DNA contamination. Cyanobacteria are gram-negative prokaryotes that synthesize chlorophyll a and carry out photosynthetic water oxidation. These organisms possess an extended array of secondary metabolites that impair cell lysis, presenting particular challenges when it comes to nucleic acid isolation. Therefore, we used the NHM5 strain of Nostoc punctiforme ATCC 29133 to compare and improve existing phenol based chemistry and procedures for RNA extraction. Results With this work we identify and explore strategies for improved and lower cost high quality RNA isolation from cyanobacteria. All the methods studied are suitable for RNA isolation and its use for downstream applications. We analyse different Trizol based protocols, introduce procedural changes and describe an alternative RNA extraction solution. Conclusion It was possible to improve purity of isolated RNA by modifying protocol procedures. Further improvements, both in RNA purity and experimental cost, were achieved by using a new extraction solution, PGTX.

  4. Development of a bi-functional silica monolith for electro-osmotic pumping and DNA clean-up/extraction using gel-supported reagents in a microfluidic device.

    Science.gov (United States)

    Oakley, Jennifer A; Shaw, Kirsty J; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-06-07

    A silica monolith used to support both electro-osmotic pumping (EOP) and the extraction/elution of DNA coupled with gel-supported reagents is described. The benefits of the combined EOP extraction/elution system were illustrated by combining DNA extraction and gene amplification using the polymerase chain reaction (PCR) process. All the reagents necessary for both processes were supported within pre-loaded gels that allow the reagents to be stored at 4 degrees C for up to four weeks in the microfluidic device. When carrying out an analysis the crude sample only needed to be hydrodynamically introduced into the device which was connected to an external computer controlled power supply via platinum wire electrodes. DNA was extracted with 65% efficiency after loading lysed cells onto a silica monolith. Ethanol contained within an agarose gel matrix was then used to wash unwanted debris away from the sample by EOP (100 V cm(-1) for 5 min). The retained DNA was subsequently eluted from the monolith by water contained in a second agarose gel, again by EOP using an electric field of 100 V cm(-1) for 5 min, and transferred into the PCR reagent containing gel. The eluted DNA in solution was successfully amplified by PCR, confirming that the concept of a complete self-contained microfluidic device could be realised for DNA sample clean up and amplification, using a simple pumping and on-chip reagent storage methodology.

  5. Effects of humic substances on fluorometric DNA quantification and DNA hybridization

    NARCIS (Netherlands)

    Bachoon, DS; Otero, E; Hodson, RE

    2001-01-01

    DNA extracts from sediment and water samples are often contaminated with coextracted humic-like impurities, Estuarine humic substances and vascular plant extract were used to evaluate the effect of the presence of such impurities on DNA hybridization and quantification. The presence of humic

  6. Improved Yield of High Molecular Weight DNA Coincides with Increased Microbial Diversity Access from Iron Oxide Cemented Sub-Surface Clay Environments

    Science.gov (United States)

    Hurt, Richard A.; Robeson, Michael S.; Shakya, Migun; Moberly, James G.; Vishnivetskaya, Tatiana A.; Gu, Baohua; Elias, Dwayne A.

    2014-01-01

    Despite over three decades of progress, extraction of high molecular weight (HMW) DNA from high clay soils or iron oxide cemented clay has remained challenging. HMW DNA is desirable for next generation sequencing as it yields the most comprehensive coverage. Several DNA extraction procedures were compared from samples that exhibit strong nucleic acid adsorption. pH manipulation or use of alternative ion solutions offered no improvement in nucleic acid recovery. Lysis by liquid N2 grinding in concentrated guanidine followed by concentrated sodium phosphate extraction supported HMW DNA recovery from clays high in iron oxides. DNA recovered using 1 M sodium phosphate buffer (PB) as a competitive desorptive wash was 15.22±2.33 µg DNA/g clay, with most DNA consisting of >20 Kb fragments, compared to 2.46±0.25 µg DNA/g clay with the Powerlyzer system (MoBio). Increasing PB concentration in the lysis reagent coincided with increasing DNA fragment length during initial extraction. Rarefaction plots of 16S rRNA (V1–V3 region) pyrosequencing from A-horizon and clay soils showed an ∼80% and ∼400% larger accessed diversity compared to the Powerlyzer soil DNA system, respectively. The observed diversity from the Firmicutes showed the strongest increase with >3-fold more operational taxonomic units (OTU) recovered. PMID:25033199

  7. DNA typing for personal identification of urine after long-term preservation for testing in doping control.

    Science.gov (United States)

    Aoki, Kimiko; Tanaka, Hiroyuki; Ueki, Makoto

    2017-08-01

    When the tampering of a urine sample is suspected in doping control, personal identification of the sample needs to be determined by short tandem repeat (STR) analysis using DNA. We established a method for extracting DNA from urine samples stored at -20 °C without using any additives or procedures, which is consistent with how samples are required to be managed for doping control. The method, using the Puregene® Blood Core kit followed by NucleoSpin® gDNA Clean-up or NucleoSpin® gDNA Clean-up XS kit, does not need any special instrument and can provide a purified extract with high-quality DNA from up to 40 mL of urine suitable for STR analysis using an AmpFlSTR® Identifiler® PCR amplification kit. Storing urine at -20 °C is detrimental to the stability of DNA. The DNA concentration of preserved urine could not be predicted by specific gravity or creatinine level at the time of urine collection. The DNA concentration of a purified extract (10 μL) was required to be >0.06 ng/μL to ensure a successful STR analysis. Thus, the required extraction volumes of urine preserved for 3-7 years at -20 °C were estimated to be 30 mL and 20 mL to succeed in at least 86% of men and 91% of women, respectively. Considering the long half-life of DNA during long-term preservation, our extraction method is applicable to urine samples stored even for 10 years, which is currently the storage duration allowed (increased from 8 years) before re-examination in doping control. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. Evaluation of Global Genomic DNA Methylation in Human Whole Blood by Capillary Electrophoresis UV Detection

    Directory of Open Access Journals (Sweden)

    Angelo Zinellu

    2017-01-01

    Full Text Available Alterations in global DNA methylation are implicated in various pathophysiological processes. The development of simple and quick, yet robust, methods to assess DNA methylation is required to facilitate its measurement and interpretation in clinical practice. We describe a highly sensitive and reproducible capillary electrophoresis method with UV detection for the separation and detection of cytosine and methylcytosine, after formic acid hydrolysis of DNA extracted from human whole blood. Hydrolysed samples were dried and resuspended with water and directly injected into the capillary without sample derivatization procedures. The use of a run buffer containing 50 mmol/L BIS-TRIS propane (BTP phosphate buffer at pH 3.25 and 60 mmol/L sodium acetate buffer at pH 3.60 (4 : 1, v/v allowed full analyte identification within 11 min. Precision tests indicated an elevated reproducibility with an interassay CV of 1.98% when starting from 2 μg of the extracted DNA. The method was successfully tested by measuring the DNA methylation degree both in healthy volunteers and in reference calf thymus DNA.

  9. DNA polymerase beta participates in mitochondrial DNA repair

    DEFF Research Database (Denmark)

    Sykora, P; Kanno, S; Akbari, M

    2017-01-01

    We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

  10. Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases ? and ? for nonhomologous end joining in human whole-cell extracts

    OpenAIRE

    Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P.; Lee, Kyung-Jong; Chen, David J.; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F.

    2009-01-01

    XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5? or 3? overhangs, and no joining at all of partially complementary 3? overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped us...

  11. Comparative evaluation of three automated systems for DNA extraction in conjunction with three commercially available real-time PCR assays for quantitation of plasma Cytomegalovirus DNAemia in allogeneic stem cell transplant recipients.

    Science.gov (United States)

    Bravo, Dayana; Clari, María Ángeles; Costa, Elisa; Muñoz-Cobo, Beatriz; Solano, Carlos; José Remigia, María; Navarro, David

    2011-08-01

    Limited data are available on the performance of different automated extraction platforms and commercially available quantitative real-time PCR (QRT-PCR) methods for the quantitation of cytomegalovirus (CMV) DNA in plasma. We compared the performance characteristics of the Abbott mSample preparation system DNA kit on the m24 SP instrument (Abbott), the High Pure viral nucleic acid kit on the COBAS AmpliPrep system (Roche), and the EZ1 Virus 2.0 kit on the BioRobot EZ1 extraction platform (Qiagen) coupled with the Abbott CMV PCR kit, the LightCycler CMV Quant kit (Roche), and the Q-CMV complete kit (Nanogen), for both plasma specimens from allogeneic stem cell transplant (Allo-SCT) recipients (n = 42) and the OptiQuant CMV DNA panel (AcroMetrix). The EZ1 system displayed the highest extraction efficiency over a wide range of CMV plasma DNA loads, followed by the m24 and the AmpliPrep methods. The Nanogen PCR assay yielded higher mean CMV plasma DNA values than the Abbott and the Roche PCR assays, regardless of the platform used for DNA extraction. Overall, the effects of the extraction method and the QRT-PCR used on CMV plasma DNA load measurements were less pronounced for specimens with high CMV DNA content (>10,000 copies/ml). The performance characteristics of the extraction methods and QRT-PCR assays evaluated herein for clinical samples were extensible at cell-based standards from AcroMetrix. In conclusion, different automated systems are not equally efficient for CMV DNA extraction from plasma specimens, and the plasma CMV DNA loads measured by commercially available QRT-PCRs can differ significantly. The above findings should be taken into consideration for the establishment of cutoff values for the initiation or cessation of preemptive antiviral therapies and for the interpretation of data from clinical studies in the Allo-SCT setting.

  12. DNA-PK dependent targeting of DNA-ends to a protein complex assembled on matrix attachment region DNA sequences

    International Nuclear Information System (INIS)

    Mauldin, S.K.; Getts, R.C.; Perez, M.L.; DiRienzo, S.; Stamato, T.D.

    2003-01-01

    Full text: We find that nuclear protein extracts from mammalian cells contain an activity that allows DNA ends to associate with circular pUC18 plasmid DNA. This activity requires the catalytic subunit of DNA-PK (DNA-PKcs) and Ku since it was not observed in mutants lacking Ku or DNA-PKcs but was observed when purified Ku/DNA-PKcs was added to these mutant extracts. Competition experiments between pUC18 and pUC18 plasmids containing various nuclear matrix attachment region (MAR) sequences suggest that DNA ends preferentially associate with plasmids containing MAR DNA sequences. At a 1:5 mass ratio of MAR to pUC18, approximately equal amounts of DNA end binding to the two plasmids were observed, while at a 1:1 ratio no pUC18 end-binding was observed. Calculation of relative binding activities indicates that DNA-end binding activities to MAR sequences was 7 to 21 fold higher than pUC18. Western analysis of proteins bound to pUC18 and MAR plasmids indicates that XRCC4, DNA ligase IV, scaffold attachment factor A, topoisomerase II, and poly(ADP-ribose) polymerase preferentially associate with the MAR plasmid in the absence or presence of DNA ends. In contrast, Ku and DNA-PKcs were found on the MAR plasmid only in the presence of DNA ends. After electroporation of a 32P-labeled DNA probe into human cells and cell fractionation, 87% of the total intercellular radioactivity remained in nuclei after a 0.5M NaCl extraction suggesting the probe was strongly bound in the nucleus. The above observations raise the possibility that DNA-PK targets DNA-ends to a repair and/or DNA damage signaling complex which is assembled on MAR sites in the nucleus

  13. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    OpenAIRE

    Luis E. Rojas; Maritza Reyes; Naivy Pérez-Alonso; María I. Olóriz; Laisyn Posada-Pérez; Bárbara Ocaña; Orelvis Portal; Borys Chong-Pérez; Jorge L. Pérez Pérez

    2014-01-01

    The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol). In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR). From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend ...

  14. Selectivity assessment of an arsenic sequential extraction procedure for evaluating mobility in mine wastes

    International Nuclear Information System (INIS)

    Drahota, Petr; Grösslová, Zuzana; Kindlová, Helena

    2014-01-01

    Highlights: • Extraction efficiency and selectivity of phosphate and oxalate were tested. • Pure As-bearing mineral phases and mine wastes were used. • The reagents were found to be specific and selective for most major forms of As. • An optimized sequential extraction scheme for mine wastes has been developed. • It has been tested over a model mineral mixtures and natural mine waste materials. - Abstract: An optimized sequential extraction (SE) scheme for mine waste materials has been developed and tested for As partitioning over a range of pure As-bearing mineral phases, their model mixtures, and natural mine waste materials. This optimized SE procedure employs five extraction steps: (1) nitrogen-purged deionized water, 10 h; (2) 0.01 M NH 4 H 2 PO 4 , 16 h; (3) 0.2 M NH 4 -oxalate in the dark, pH3, 2 h; (4) 0.2 M NH 4 -oxalate, pH3/80 °C, 4 h; (5) KClO 3 /HCl/HNO 3 digestion. Selectivity and specificity tests on natural mine wastes and major pure As-bearing mineral phases showed that these As fractions appear to be primarily associated with: (1) readily soluble; (2) adsorbed; (3) amorphous and poorly-crystalline arsenates, oxides and hydroxosulfates of Fe; (4) well-crystalline arsenates, oxides, and hydroxosulfates of Fe; as well as (5) sulfides and arsenides. The specificity and selectivity of extractants, and the reproducibility of the optimized SE procedure were further verified by artificial model mineral mixtures and different natural mine waste materials. Partitioning data for extraction steps 3, 4, and 5 showed good agreement with those calculated in the model mineral mixtures (<15% difference), as well as that expected in different natural mine waste materials. The sum of the As recovered in the different extractant pools was not significantly different (89–112%) than the results for acid digestion. This suggests that the optimized SE scheme can reliably be employed for As partitioning in mine waste materials

  15. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding

    International Nuclear Information System (INIS)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy

    2017-01-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K SV ) were found to be 7.02 × 10 6 Mˉ 1 (ethidium bromide), 4.22 × 10 6 Mˉ 1 (acridine orange) and 7.6 × 10 6 Mˉ 1 (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.

  16. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding

    Energy Technology Data Exchange (ETDEWEB)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India); Sujatha, Venugopal [Department of Chemistry, Periyar University, Salem 636011 (India); Thirunavukkarasu, Chinnasamy, E-mail: tchinnasamy@hotmail.com [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India)

    2017-05-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K{sub SV}) were found to be 7.02 × 10{sup 6} Mˉ{sup 1} (ethidium bromide), 4.22 × 10{sup 6} Mˉ{sup 1} (acridine orange) and 7.6 × 10{sup 6} Mˉ{sup 1} (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.

  17. DNA ligase III is involved in a DNA-PK independent pathway of NHEJ in human cells

    International Nuclear Information System (INIS)

    Wang, H.; Perrault, A.R.; Qin, W.; Wang, H.; Iliakis, G.

    2003-01-01

    Full text: Double strand breaks (DSB) induced by ionizing radiation (IR) and other cytotoxic agents in the genome of higher eukaryotes are thought to be repaired either by homologous recombination repair (HRR), or non-homologous endjoining (NHEJ). We previously reported the operation of two components of NHEJ in vivo: a DNA-PK dependent component that operates with fast kinetics (D-NHEJ), and a DNA-PK independent component that acts as a backup (basic or B-NHEJ) and operates with kinetics an order of magnitude slower. To gain further insight into the mechanisms of B-NHEJ, we investigated DNA endjoining in extracts 180BR, a human cell line deficient in DNA ligase IV, using an in vitro plasmid-based DNA endjoining assay. An anti DNA ligase III antibody inhibited almost completely DNA endjoining activity in these extracts. On the other hand, an anti DNA ligase I antibody had no measurable effect in DNA endjoining activity. Immunodepletion of DNA ligase III from 180BR cell extracts abolished the DNA endjoining activity, which could be restored by addition of purified human DNA ligase IIIb. Full-length DNA ligase III bound to double stranded DNA and stimulated DNA endjoining in both intermolecular and intramolecular ligation. Furthermore, fractionation of HeLa cell extracts demonstrated the presence of an activity stimulating the function of DNA ligase III. Based on these observations we propose that DNA ligase III is the ligase operating in B-NHEJ

  18. Evaluation of the Genotoxic Potential against H2O2-Radical-Mediated DNA Damage and Acute Oral Toxicity of Standardized Extract of Polyalthia longifolia Leaf

    Directory of Open Access Journals (Sweden)

    Subramanion L. Jothy

    2013-01-01

    Full Text Available Medicinal plants have been used in medicoculturally diverse countries around the world, where it is a part of a time-honoured tradition that is respected even today. Polyalthia longifolia leaf extract has been previously reported as an efficient antioxidant in vitro. Hence, the genotoxic effects of P. longifolia leaf were investigated by using plasmid relation, comet, and Allium cepa assay. In the presence of  ∙OH radicals, the DNA in supercoil was start nicked into open circular form, which is the product of the single-stranded cleavage of supercoil DNA and quantified as fragmented separate bands on agarose gel in plasmid relation assay. In the plasmid relation and comet assay, the P. longifolia leaf extract exhibited strong inhibitory effects against H2O2-mediated DNA damage. A dose-dependent increase of chromosome aberrations was also observed in the Allium cepa assay. The abnormalities scored were stickiness, c-mitosis, bridges, and vagrant chromosomes. Micronucleated cells were also observed at the interphase. The results of Allium cepa assay confirmed that the methanol extracts of P. longifolia exerted no significant genotoxic or mitodepressive effects at 100 μg/mL. Thus, this study demonstrated that P. longifolia leaf extract has a beneficial effect against oxidative DNA damage. This experiment is the first report for the protective effect of P. longifolia on DNA damage-induced by hydroxyl radicals. Additionally in acute oral toxicity study, female rats were treated at 5000 mg/kg body weight of P. longifolia leaf extract and observed for signs of toxicity for 14 days. P. longifolia leaf extract did not produce any treatment-related toxic effects in rats.

  19. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    Science.gov (United States)

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan

    2010-01-01

    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  20. Effect of Allium flavum L. and Allium melanantherum Panč. Extracts on Oxidative DNA Damage and Antioxidative Enzymes Superoxide Dismutase and Catalase.

    Science.gov (United States)

    Mitić-Ćulafić, Dragana; Nikolić, Biljana; Simin, Nataša; Jasnić, Nebojša; Četojević-Simin, Dragana; Krstić, Maja; Knežević-Vukčević, Jelena

    2016-03-01

    Allium flavum L. and Allium melanantherum Panč. are wild growing plants used in traditional diet in Balkan region. While chemical composition and some biological activities of A. flavum have been reported, A. melanantherum, as an endemic in the Balkan Peninsula, has never been comprehensively examined. After chemical characterization of A. melanantherum, we examined the protective effect of methanol extracts of both species against t-butyl hydro-peroxide (t-BOOH)-induced DNA damage and mutagenesis. The bacterial reverse mutation assay was performed on Escherichia coli WP2 oxyR strain. DNA damage was monitored in human fetal lung fibroblasts (MRC-5) with alkaline comet assay. Obtained results indicated that extracts reduced t-BOOH-induced DNA damage up to 70 and 72% for A. flavum and A. melanantherum extract, respectively, and showed no effect on t-BOOH-induced mutagenesis. Since the results indicated modulatory effect on cell-mediated antioxidative defense, the effect of extracts on total protein content, and superoxide dismutase (SOD) and catalase (CAT) amounts and activities were monitored. Both extracts increased total protein content, while the increase of enzyme amount and activity was obtained only with A. melanantherum extract and restricted to CAT. The activity of CuZnSOD family was not affected, while SOD1 and SOD2 amounts were significantly decreased, indicating potential involvement of extracellular CuZnSOD. Obtained results strongly support the traditional use of A. flavum and A. melanantherum in nutrition and recommend them for further study.

  1. Use of Antibiotic Prophylaxis for Tooth Extractions, Dental Implants, and Periodontal Surgical Procedures.

    Science.gov (United States)

    Suda, Katie J; Henschel, Heather; Patel, Ursula; Fitzpatrick, Margaret A; Evans, Charlesnika T

    2018-01-01

    Guidelines for antibiotics prior to dental procedures for patients with specific cardiac conditions and prosthetic joints have changed, reducing indications for antibiotic prophylaxis. In addition to guidelines focused on patient comorbidities, systematic reviews specific to dental extractions and implants support preprocedure antibiotics for all patients. However, data on dentist adherence to these recommendations are scarce. This was a cross-sectional study of veterans undergoing tooth extractions, dental implants, and periodontal procedures. Patients receiving antibiotics for oral or nonoral infections were excluded. Data were collected through manual review of the health record. Of 183 veterans (mean age, 62 years; 94.5% male) undergoing the included procedures, 82.5% received antibiotic prophylaxis (mean duration, 7.1 ± 1.6 days). Amoxicillin (71.3% of antibiotics) and clindamycin (23.8%) were prescribed most frequently; 44.7% of patients prescribed clindamycin were not labeled as penicillin allergic. Of those who received prophylaxis, 92.1% received postprocedure antibiotics only, 2.6% received preprocedural antibiotics only, and 5.3% received pre- and postprocedure antibiotics. When prophylaxis was indicated, 87.3% of patients received an antibiotic. However, 84.9% received postprocedure antibiotics when preprocedure administration was indicated. While the majority of antibiotics were indicated, only 8.2% of patients received antibiotics appropriately. The primary reason was secondary to prolonged duration. Three months postprocedure, there were no occurrences of Clostridium difficile infection, infective endocarditis, prosthetic joint infections, or postprocedure oral infections. The majority of patients undergoing a dental procedure received antibiotic prophylaxis as indicated. Although patients for whom antibiotic prophylaxis was indicated should have received a single preprocedure dose, most antibiotics were prescribed postprocedure. Dental stewardship

  2. A simple procedure for the purification of active fractions in aqueous extracts of plants with allelopathic properties

    Directory of Open Access Journals (Sweden)

    Fabian Borghetti

    2013-03-01

    Full Text Available Most studies conducted to test the allelopathic activity of plant parts have made use of water as solvent. However, the presence of polar, water-soluble substances, such as proteins and carbohydrates, tends to hamper the purification of active compounds. In this study, we present a simple purification procedure that separates the active fraction of the extract from the undesirable substances, thus facilitating the search for active molecules through standard chromatographic methods. Aqueous leaf extracts of three Cerrado species (Caryocar brasiliense, Qualea parviflora and Eugenia dysenterica were prepared at 5% concentration (w/v and stored at 4ºC (crude extracts. After 24 h, these solutions were filtered and freeze-dried. The powder obtained was dissolved in methanol, filtered again, evaporated and dissolved in water for bioassays (purified extracts. For the bioassays, seedlings of Sesamum indicum were grown for five days in aqueous solutions prepared from crude and purified extracts at concentrations ranging from 0.1% to 1.0% (w/v. Seedling growth in distilled water was set as a control. In comparison with the control, we found that test solutions prepared from both crude and purified extracts significantly inhibited sesame seedling growth. However, solutions prepared from purified extracts were two to ten times more inhibitory to seedling growth than were those prepared from crude extracts. The inhibition of root growth ranged from 35% to 77%, depending on the plant species, at a concentration as low as 0.1%. Roots were more affected than were shoots. The effects of purified extracts on seedling morphology were similar to those observed when crude extracts were employed, indicating that the procedure of purification of crude extracts did not interfere with the mode of action of the active substances

  3. Identification of the proteins responsible for SAR DNA binding in nuclear matrix of ''Cucurbita pepo''

    International Nuclear Information System (INIS)

    Rzepecki, R.; Markiewicz, E.; Szopa, J.

    1995-01-01

    The nuclear matrices from White bush (''Cucurbita pepo var. patisonina'') cell nuclei have been isolated using three methods: I, standard procedure involving extraction of cell nuclei with 2 M NaCl and 1% Triton X-100; II, the same with pre-treatment of cell nuclei with 0.5 mM CuSO 4 (stabilisation step); and III, method with extraction by lithium diiodosalicylate (LIS), and compared the polypeptide pattern. The isolated matrices specifically bind SAR DNA derived from human β-interferon gene in the exogenous SAR binding assay and in the gel mobility shift assay. Using IgG against the 32 kDa endonuclease we have found in the DNA-protein blot assay that this protein is one of the proteins binding SAR DNA. We have identified three proteins with molecular mass of 65 kDa, 60 kDa and 32 kDa which are responsible for SAR DNA binding in the gel mobility shift assay experiments. (author). 21 refs, 3 figs

  4. Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing.

    Science.gov (United States)

    Feehan, Joanna M; Scheibel, Katherine E; Bourras, Salim; Underwood, William; Keller, Beat; Somerville, Shauna C

    2017-03-31

    The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics of these pathogens, in part due to a lack of well-developed genetic and genomic resources. These organisms have large, repetitive genomes, which have made genome sequencing and assembly prohibitively difficult. Here, we describe methods for the collection, extraction, purification and quality control assessment of high molecular weight genomic DNA from one powdery mildew species, Golovinomyces cichoracearum. The protocol described includes mechanical disruption of spores followed by an optimized phenol/chloroform genomic DNA extraction. A typical yield was 7 µg DNA per 150 mg conidia. The genomic DNA that is isolated using this procedure is suitable for long-read sequencing (i.e., > 48.5 kbp). Quality control measures to ensure the size, yield, and purity of the genomic DNA are also described in this method. Sequencing of the genomic DNA of the quality described here will allow for the assembly and comparison of multiple powdery mildew genomes, which in turn will lead to a better understanding and improved control of this agricultural pathogen.

  5. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  6. Assessment of DNA quality in processed tuna muscle tissues

    Directory of Open Access Journals (Sweden)

    Zora Piskatá

    2016-06-01

    Full Text Available Authentication of tuna fish products is necessary to assure consumers of accurate labelling of food products. The quality of species specific DNA crucially affects the efficiency of amplification during the subsequent PCR. The problem in DNA detection in canned products lies in the possibility of the fragmentation of DNA during the processing technologies and the use of ingredients (oil, salt, spice, that may inhibit the PCR reaction. In this study three DNA extraction methods were compared: DNeasy Blood and Tissue Kit, DNeasy mericon Food Kit and Chemagic DNA tissue 10 Kit. The quantity and quality of DNA were evaluated by measuring DNA concentration and ratios A260/A280. Several parameters were estimated: the effect of whole and mechanically treated muscle, sterilization procedure used in canned process (high temperature in combination with high pressure and addition of raw materials. The highest DNA concentrations were observed in non-processed muscle that is not influenced by the sterilization process. Canned whole muscle demonstrated lower DNA yield, and furthermore, the mechanical treatment (canned ground resulted in lower values of DNA concentration that was registered by using all three types of DNA extraction kits. DNeasy mericon Food Kit produced DNA of higher concentration in non-processed sample, Chemagic DNA tissue 10 Kit delivered higher DNA yields than kits DNeasy Blood and Tissue Kit and DNeasy mericon Food Kit in canned samples, although the purity was lower, but still within the range 1.7 - 2.0. DNA was considered to be satisfactorily pure in all three types of samples and using all three types of DNA isolation. In case of the samples enriched of ingredients and treated with sterilization process as whole or ground muscle Chemagic DNA tissue 10 Kit produced in all samples (whole and ground muscle the highest values of DNA concentration, but almost all values of A260/A280 were lower than 1.7. Therefore DNeasy mericon Food Kit

  7. Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

    Science.gov (United States)

    Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

    2009-07-01

    XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

  8. Procedure for normalization of cDNA libraries

    Science.gov (United States)

    Bonaldo, Maria DeFatima; Soares, Marcelo Bento

    1997-01-01

    This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

  9. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  10. eCTG: an automatic procedure to extract digital cardiotocographic signals from digital images.

    Science.gov (United States)

    Sbrollini, Agnese; Agostinelli, Angela; Marcantoni, Ilaria; Morettini, Micaela; Burattini, Luca; Di Nardo, Francesco; Fioretti, Sandro; Burattini, Laura

    2018-03-01

    Cardiotocography (CTG), consisting in the simultaneous recording of fetal heart rate (FHR) and maternal uterine contractions (UC), is a popular clinical test to assess fetal health status. Typically, CTG machines provide paper reports that are visually interpreted by clinicians. Consequently, visual CTG interpretation depends on clinician's experience and has a poor reproducibility. The lack of databases containing digital CTG signals has limited number and importance of retrospective studies finalized to set up procedures for automatic CTG analysis that could contrast visual CTG interpretation subjectivity. In order to help overcoming this problem, this study proposes an electronic procedure, termed eCTG, to extract digital CTG signals from digital CTG images, possibly obtainable by scanning paper CTG reports. eCTG was specifically designed to extract digital CTG signals from digital CTG images. It includes four main steps: pre-processing, Otsu's global thresholding, signal extraction and signal calibration. Its validation was performed by means of the "CTU-UHB Intrapartum Cardiotocography Database" by Physionet, that contains digital signals of 552 CTG recordings. Using MATLAB, each signal was plotted and saved as a digital image that was then submitted to eCTG. Digital CTG signals extracted by eCTG were eventually compared to corresponding signals directly available in the database. Comparison occurred in terms of signal similarity (evaluated by the correlation coefficient ρ, and the mean signal error MSE) and clinical features (including FHR baseline and variability; number, amplitude and duration of tachycardia, bradycardia, acceleration and deceleration episodes; number of early, variable, late and prolonged decelerations; and UC number, amplitude, duration and period). The value of ρ between eCTG and reference signals was 0.85 (P digital FHR and UC signals from digital CTG images. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Chemopreventive activity of compounds extracted from Casearia sylvestris (Salicaceae) Sw against DNA damage induced by particulate matter emitted by sugarcane burning near Araraquara, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Prieto, A.M. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil); Santos, A.G. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Natural Principles and Toxicology, Rodovia Araraquara-Jau, km 01, Araraquara (Brazil); Csipak, A.R.; Caliri, C.M.; Silva, I.C. [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil); Arbex, M.A. [UNIFESP — Federal University of São Paulo, Paulista College of Medicine, Department of Internal Medicine, Rua Pedro de Toledo, 720, São Paulo (Brazil); Silva, F.S.; Marchi, M.R.R. [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Analytical Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil); Cavalheiro, A.J.; Silva, D.H.S.; Bolzani, V.S. [UNESP — Univ. Estadual Paulista, Chemistry Institute, Department of Organic Chemistry, Rua Francisco Degni, S/N, Araraquara (Brazil); Soares, C.P., E-mail: soarescp@hotmail.com [UNESP — Univ. Estadual Paulista, College of Pharmaceutical Sciences, Department of Clinical Analysis, Rua Expedicionários do Brasil, 1621, Araraquara (Brazil)

    2012-12-15

    Ethanolic extract of Casearia sylvestris is thought to be antimutagenic. In this study, we attempted to determine whether this extract and casearin X (a clerodane diterpene from C. sylvestris) are protective against the harmful effects of airborne pollutants from sugarcane burning. To that end, we used the Tradescantia micronucleus test in meiotic pollen cells of Tradescantia pallida, the micronucleus test in mouse bone marrow cells, and the comet assay in mouse blood cells. The mutagenic compound was total suspended particulate (TSP) from air. For the Tradescantia micronucleus test, T. pallida cuttings were treated with the extract at 0.13, 0.25, or 0.50 mg/ml. Subsequently, TSP was added at 0.3 mg/ml, and tetrads from the inflorescences were examined for micronuclei. For the micronucleus test in mouse bone marrow cells and the comet assay in mouse blood cells, Balb/c mice were treated for 15 days with the extract—3.9, 7.5, or 15.0 mg/kg body weight (BW)—or with casearin X—0.3, 0.25, or 1.2 mg/kg BW—after which they received TSP (3.75 mg/kg BW). In T. pallida and mouse bone marrow cells, the extract was antimutagenic at all concentrations tested. In mouse blood cells, the extract was antigenotoxic at all concentrations, whereas casearin X was not antimutagenic but was antigenotoxic at all concentrations. We conclude that C. sylvestris ethanolic extract and casearin X protect DNA from damage induced by airborne pollutants from sugarcane burning. -- Highlights: ► We assessed DNA protection of C. sylvestris ethanolic extract. ► We assessed DNA protection of casearin X. ► We used Tradescantia pallida micronucleus test as screening. ► We used comet assay and micronucleus test in mice. ► The compounds protected DNA against sugar cane burning pollutants.

  12. [DNA quantification of blood samples pre-treated with pyramidon].

    Science.gov (United States)

    Zhu, Chuan-Hong; Zheng, Dao-Li; Ni, Rao-Zhi; Wang, Hai-Sheng; Ning, Ping; Fang, Hui; Liu, Yan

    2014-06-01

    To study DNA quantification and STR typing of samples pre-treated with pyramidon. The blood samples of ten unrelated individuals were anticoagulated in EDTA. The blood stains were made on the filter paper. The experimental groups were divided into six groups in accordance with the storage time, 30 min, 1 h, 3 h, 6 h, 12 h and 24h after pre-treated with pyramidon. DNA was extracted by three methods: magnetic bead-based extraction, QIAcube DNA purification method and Chelex-100 method. The quantification of DNA was made by fluorescent quantitative PCR. STR typing was detected by PCR-STR fluorescent technology. In the same DNA extraction method, the sample DNA decreased gradually with times after pre-treatment with pyramidon. In the same storage time, the DNA quantification in different extraction methods had significant differences. Sixteen loci DNA typing were detected in 90.56% of samples. Pyramidon pre-treatment could cause DNA degradation, but effective STR typing can be achieved within 24 h. The magnetic bead-based extraction is the best method for STR profiling and DNA extraction.

  13. Extraction of High Molecular Weight DNA from Fungal Rust Spores for Long Read Sequencing.

    Science.gov (United States)

    Schwessinger, Benjamin; Rathjen, John P

    2017-01-01

    Wheat rust fungi are complex organisms with a complete life cycle that involves two different host plants and five different spore types. During the asexual infection cycle on wheat, rusts produce massive amounts of dikaryotic urediniospores. These spores are dikaryotic (two nuclei) with each nucleus containing one haploid genome. This dikaryotic state is likely to contribute to their evolutionary success, making them some of the major wheat pathogens globally. Despite this, most published wheat rust genomes are highly fragmented and contain very little haplotype-specific sequence information. Current long-read sequencing technologies hold great promise to provide more contiguous and haplotype-phased genome assemblies. Long reads are able to span repetitive regions and phase structural differences between the haplomes. This increased genome resolution enables the identification of complex loci and the study of genome evolution beyond simple nucleotide polymorphisms. Long-read technologies require pure high molecular weight DNA as an input for sequencing. Here, we describe a DNA extraction protocol for rust spores that yields pure double-stranded DNA molecules with molecular weight of >50 kilo-base pairs (kbp). The isolated DNA is of sufficient purity for PacBio long-read sequencing, but may require additional purification for other sequencing technologies such as Nanopore and 10× Genomics.

  14. A Simple Thermoplastic Substrate Containing Hierarchical Silica Lamellae for High-Molecular-Weight DNA Extraction.

    Science.gov (United States)

    Zhang, Ye; Zhang, Yi; Burke, Jeffrey M; Gleitsman, Kristin; Friedrich, Sarah M; Liu, Kelvin J; Wang, Tza-Huei

    2016-12-01

    An inexpensive, magnetic thermoplastic nanomaterial is developed utilizing a hierarchical layering of micro- and nanoscale silica lamellae to create a high-surface-area and low-shear substrate capable of capturing vast amounts of ultrahigh-molecular-weight DNA. Extraction is performed via a simple 45 min process and is capable of achieving binding capacities up to 1 000 000 times greater than silica microparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Piper nigrum ethanolic extract rich in piperamides causes ROS overproduction, oxidative damage in DNA leading to cell cycle arrest and apoptosis in cancer cells.

    Science.gov (United States)

    de Souza Grinevicius, Valdelúcia Maria Alves; Kviecinski, Maicon Roberto; Santos Mota, Nádia Sandrini Ramos; Ourique, Fabiana; Porfirio Will Castro, Luiza Sheyla Evenni; Andreguetti, Rafaela Rafognato; Gomes Correia, João Francisco; Filho, Danilo Wilhem; Pich, Claus Tröger; Pedrosa, Rozangela Curi

    2016-08-02

    Ayurvedic and Chinese traditional medicine and tribal people use herbal preparations containing Piper nigrum fruits for the treatment of many health disorders like inflammation, fever, asthma and cancer. In Brazil, traditional maroon culture associates the spice Piper nigrum to health recovery and inflammation attenuation. The aim of the current work was to evaluate the relationship between reactive oxygen species (ROS) overproduction, DNA fragmentation, cell cycle arrest and apoptosis induced by Piper nigrum ethanolic extract and its antitumor activity. The plant was macerated in ethanol. Extract constitution was assessed by TLC, UV-vis and ESI-IT-MS/MS spectrometry. The cytotoxicity, proliferation and intracellular ROS generation was evaluated in MCF-7 cells. DNA damage effects were evaluated through intercalation into CT-DNA, plasmid DNA cleavage and oxidative damage in CT-DNA. Tumor growth inhibition, survival time increase, apoptosis, cell cycle arrest and oxidative stress were assessed in Ehrlich ascites carcinoma-bearing mice. Extraction yielded 64mg/g (36% piperine and 4.2% piperyline). Treatments caused DNA damage and reduced cell viability (EC50=27.1±2.0 and 80.5±6.6µg/ml in MCF-7 and HT-29 cells, respectively), inhibiting cell proliferation by 57% and increased ROS generation in MCF-7 cells (65%). Ehrlich carcinoma was inhibited by the extract, which caused reduction of tumor growth (60%), elevated survival time (76%), cell cycle arrest and induced apoptosis. The treatment with extract increased Bax and p53 and inhibited Bcl-xL and cyclin A expression. It also induced an oxidative stress in vivo verified as enhanced lipid peroxidation and carbonyl proteins content and increased activities of glutathione reductase, superoxide dismutase and catalase. GSH concentration was decreased in tumor tissue from mice. The ethanolic extract has cytotoxic and antiproliferative effect on MCF-7 cells and antitumor effect in vivo probably due to ROS overproduction

  16. Description of design and operating procedures of small scale pulsed columns for experimental study on extraction process under abnormal conditions

    International Nuclear Information System (INIS)

    Wakamatsu, Sachio; Sato, Makoto; Kubo, Nobuo; Sakurai, Satoshi; Ami, Norio

    1990-09-01

    To study transient phenomena in a pulsed column co-decontamination process under abnormal conditions, a pair of small scale pulsed columns (effective extraction section; I.D: 25 mm, H.: 2260 mm) for extraction and scrub were installed in the laboratory. An evaporator of aqueous uranium solution was also equipped to reuse concentrated solution as the feed. This report describes several items to have been carefully treated in design, specification and operating procedure of the apparatuses for the experiments. Also described are the procedures for preparation of the feed solutions and treatments of the solutions after the experiments; back-extraction of uranium, diluent washing, alkaline washing and concentration of uranium solution. (author)

  17. Two efficient methods for isolation of high-quality genomic DNA from entomopathogenic fungi.

    Science.gov (United States)

    Serna-Domínguez, María G; Andrade-Michel, Gilda Y; Arredondo-Bernal, Hugo C; Gallou, Adrien

    2018-03-27

    Conventional and commercial methods for isolation of nucleic acids are available for fungal samples including entomopathogenic fungi (EPF). However, there is not a unique optimal method for all organisms. The cell wall structure and the wide range of secondary metabolites of EPF can broadly interfere with the efficiency of the DNA extraction protocol. This study compares three commercial protocols: DNeasy® Plant Mini Kit (Qiagen), Wizard® Genomic DNA Purification Kit (Promega), and Axygen™ Multisource Genomic DNA Miniprep Kit (Axygen) and three conventional methods based on different buffers: SDS, CTAB/PVPP, and CTAB/β-mercaptoethanol versus three cell lysis procedures: liquid nitrogen homogenization and two bead-beating materials (i.e., tungsten-carbide and stainless-steel) for four representative species of EPF (i.e., Beauveria bassiana, Hirsutella citriformis, Isaria javanica, and Metarhizium anisopliae). Liquid nitrogen homogenization combined with DNeasy® Plant Mini Kit (i.e., QN) or SDS buffer (i.e., SN) significantly improved the yield with a good purity (~1.8) and high integrity (>20,000 bp) of genomic DNA in contrast with other methods, also, these results were better when compared with the two bead-beating materials. The purified DNA was evaluated by PCR-based techniques: amplification of translation elongation factor 1-α (TEF) and two highly sensitive molecular markers (i.e., ISSR and AFLP) with reliable and reproducible results. Despite a variation in yield, purity, and integrity of extracted DNA across the four species of EPF with the different DNA extraction methods, the SN and QN protocols maintained a high-quality of DNA which is required for downstream molecular applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  19. Observing dynamics of chromatin fibers in Xenopus egg extracts by single DNA manipulation using a transverse magnetic tweezer setup

    Science.gov (United States)

    Yan, Jie; Skoko, Dunja; Marko, John; Maresca, Tom; Heald, Rebecca

    2005-03-01

    We have studied assembly of chromatin on single DNAs using Xenopus egg extracts and a specially designed magnetic tweezer setup which generates controlled force in the focal plane of the objective, allowing us to visualize and measure DNA extension under a wide range of constant tensions. We found, in the absence of ATP, interphase extracts assembled nucleosomes against DNA tensions of up to 3.5 piconewtons (pN). We observed force-induced disassembly and opening-closing fluctuations indicating our experiments were in mechano-chemical equilibrium. We found that the ATP-depleted reaction can do mechanical work of 27 kcal/mol per nucleosome, providing a measurement of the free energy difference between core histone octamers on and off DNA. Addition of ATP leads to highly dynamic behavior: time courses show processive runs of assembly and disassembly of not observed in the -ATP case, with forces of 2 pN leading to nearly complete fiber disassembly. Our study shows that ATP hydrolysis plays a major role in nucleosome rearrangement and removal, and suggests that chromatin in vivo may be subject to continual assembly and disassembly.

  20. KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.

    Science.gov (United States)

    Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J

    2011-12-01

    DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.

  1. Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR Methods of DNA extraction from archived materials and rare sources for utilization in polymer chain reaction

    Directory of Open Access Journals (Sweden)

    Jaqueline A. Barea

    2004-12-01

    , the Factor V Leiden gene (220 bp and the Abelson gene (106 bp. According to the gene fragment length studied, the DNA potential source and the extraction method used, the results characterized the best way to standardize technical procedures to be included in the Standard Operational Procedure Manual of the Molecular Biology Laboratory of the Blood Center in the Medicine School of Unesp, Botucatu, Brazil.

  2. Amelioration of radiation induced DNA damage and biochemical alterations by Punica Granatum (L) extracts and synthetic ellagic acid in Swiss albino mice

    International Nuclear Information System (INIS)

    Satheesh Kumar Bhandary, B.; Sharmila, K.P.; Suchetha Kumari, N.; Vadisha Bhat, S.; Sherly, Sharmila; Sanjeev, Ganesh

    2013-01-01

    Radiation therapy has been used in cancer treatment for many decades; Although effective in killing tumor cells, ROS produced in radiotherapy threaten the integrity and survival of surrounding normal cells. ROS are scavenged by radioprotectors before they can interact with biochemical molecules, thus reducing harmful effects of radiation. The pomegranate, Punica granatum L., an ancient, mystical, and highly distinctive fruit, is the predominant member of the Punicaceae family. It is used in several systems of medicine for a variety of ailments. The objective of the present study was to investigate the protective effects of ethanolic extracts of pomegranate whole fruit (EPWF) and seeds (EPS) and Synthetic Ellagic acid (EA) against Electron Beam Radiation (EBR) induced DNA damage and biochemical alterations in Swiss Albino mice. The extracts and synthetic compound were assessed for its radical scavenging property by DPPH radical scavenging and Ferric Reducing Antioxidant Power assays. The animals were treated with 200 mg/kg body wt. of pomegranate extracts and Ellagic acid for 15 days before exposure to 6 Gy of EBR. Radiation induced DNA damage was assessed by comet assay in the peripheral blood lymphocytes of mice. The biochemical estimations were carried out in the serum and RBC lysate of the animals. The plant extracts and synthetic compound exhibited good radical scavenging and reducing properties.The pretreated animals before irradiation caused a reduction in the comet length, olive tail moment, % DNA in tail when compared to irradiated group. The biochemical parameters such as lipid peroxidation was significantly depleted in the treated groups when compared to irradiated group followed by significant elevation in reduced glutathione. Our findings indicate the ameliorating effects of pomegranate extracts and synthetic ellagic acid on radiation induced DNA damage and biochemical changes in mice may be due to its free radical scavenging and increased antioxidant

  3. Enzymatic determination of photoproducts in DNA molecules damaged by UV radiation

    Energy Technology Data Exchange (ETDEWEB)

    Kleibl, K; Brozmanova, J [Slovenska Akademia Vied, Bratislava (Czechoslovakia). Ustav Experimentalnej Onkologie

    1981-01-01

    Two basic analytical procedures are described for the detection of photoproducts in UV-irradiated DNA. In the former, the selective release of thymine dimers of the cyclobutane type (TT) from the UV-irradiated DNA during excision repair can be measured by chromatographic analysis of radioactive DNA hydrolysis products. The technique allows studying TT irrespective of other products. It is only reliable for UV doses higher than 5 Jm/sup -2/. In the latter, a Micrococcus luteus extract containing specific enzymes, ie., endonucleases, for the repair of UV-induced damage of DNA is used for the enzyme determination of pyrimidine dimers. The endonucleotide analysis of DNA damage can be applied both in vitro and in vivo. In the in-vitro detection, the efficacy of photoproduct determination attains almost 100% while in the in-vivo detection it ranges between 30% and 70% in dependence on the method used. 31 references are given.

  4. A new procedure for extraction of collagen from modern and archaeological bones for 14C dating.

    Science.gov (United States)

    Maspero, F; Sala, S; Fedi, M E; Martini, M; Papagni, A

    2011-10-01

    Bones are potentially the best age indicators in a stratigraphic study, because they are closely related to the layer in which they are found. Collagen is the most suitable fraction and is the material normally used in radiocarbon dating. Bone contaminants can strongly alter the carbon isotopic fraction values of the samples, so chemical pretreatment for (14)C dating by accelerator mass spectrometry (AMS) is essential. The most widespread method for collagen extraction is based on the Longin procedure, which consists in HCl demineralization to dissolve the inorganic phase of the samples, followed by dissolution of collagen in a weak acid solution. In this work the possible side effects of this procedure on a modern bone are presented; the extracted collagen was analyzed by ATR-IR spectroscopy. An alternative procedure, based on use of HF instead of HCl, to minimize unwanted degradation of the organic fraction, is also given. A study by ATR-IR spectroscopic analysis of collagen collected after different demineralization times and with different acid volumes, and a study of an archaeological sample, are also presented.

  5. Application of a modified BCR sequential extraction (three-step) procedure for the determination of extractable trace metal contents in a sewage sludge amended soil reference material (CRM 483), complemented by a three-year stability study of acetic acid and EDTA extractable metal content.

    Science.gov (United States)

    Rauret, G; López-Sánchez, J F; Sahuquillo, A; Barahona, E; Lachica, M; Ure, A M; Davidson, C M; Gomez, A; Lück, D; Bacon, J; Yli-Halla, M; Muntau, H; Quevauviller, P

    2000-06-01

    This paper provides additional data on a sewage sludge amended soil certified reference material, CRM 483, which was certified in 1997 for its EDTA and acetic acid extractable contents of some trace metals, following standardised extraction procedures. The additional work aimed to test the long-term stability of the material and the applicability of an improved version of the BCR three-step sequential extraction procedure on the sewage sludge amended soil (CRM 483). The paper demonstrates the CRM 483 long-term stability for EDTA and acetic acid extractable contents of Cd, Cr, Cu, Ni, Pb and Zn and gives the results (obtained in the framework of an interlaboratory study) for the extractable contents of the same elements in the CRM 483, following the BCR three-step sequential extraction scheme. The aqua regia extractable contents following the ISO 11466 Standard are also given. The data are given as indicative (not certified) values.

  6. Distributions and concentrations of thallium in Korean soils determined by single and sequential extraction procedures.

    Science.gov (United States)

    Lee, Jin-Ho; Kim, Dong-Jin; Ahn, Byung-Koo

    2015-06-01

    The objectives of this study were to investigate the distribution of thallium in soils collected near suspected areas such as cement plants, active and closed mines, and smelters and to examine the extraction of thallium in the soils using 19 single chemical and sequential chemical extraction procedures. Thallium concentrations in soils near cement plants were distributed between 1.20 and 12.91 mg kg(-1). However, soils near mines and smelters contained relatively low thallium concentrations ranging from 0.18 to 1.09 mg kg(-1). Thallium extractability with 19 single chemical extractants from selected soils near cement plants ranged from 0.10% to 8.20% of the total thallium concentration. In particular, 1.0 M NH4Cl, 1.0 M (NH4)2SO4, and 1.0 M CH3COONH4 extracted more thallium than other extractants. Sequential fractionation results of thallium from different soils such as industrially and artificially contaminated soils varied with the soil properties, especially soil pH and the duration of thallium contamination.

  7. Lipofection: a highly efficient, lipid-mediated DNA-transfection procedure.

    OpenAIRE

    Felgner, P L; Gadek, T R; Holm, M; Roman, R; Chan, H W; Wenz, M; Northrop, J P; Ringold, G M; Danielsen, M

    1987-01-01

    A DNA-transfection protocol has been developed that makes use of a synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA). Small unilamellar liposomes containing DOTMA interact spontaneously with DNA to form lipid-DNA complexes with 100% entrapment of the DNA, DOTMA facilitates fusion of the complex with the plasma membrane of tissue culture cells, resulting in both uptake and expression of the DNA. The technique is simple, highly reproducible, and eff...

  8. Ligation bias in Illumina next-generation DNA libraries

    DEFF Research Database (Denmark)

    Seguin-Orlando, Andaine; Schubert, Mikkel; Clary, Joel

    2013-01-01

    Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by-products,...... for authenticating ancient sequence data. Consequently, we show that models adequate for estimating post-mortem DNA damage levels must be robust to the molecular tools used for building ancient DNA libraries.......Ancient DNA extracts consist of a mixture of endogenous molecules and contaminant DNA templates, often originating from environmental microbes. These two populations of templates exhibit different chemical characteristics, with the former showing depurination and cytosine deamination by......-products, resulting from post-mortem DNA damage. Such chemical modifications can interfere with the molecular tools used for building second-generation DNA libraries, and limit our ability to fully characterize the true complexity of ancient DNA extracts. In this study, we first use fresh DNA extracts to demonstrate...

  9. Evaluation of raw nepodin extraction from Rumex japonicus and R. obtusifolius and their DNA polymorphisms.

    Science.gov (United States)

    Minami, Motoyasu; Mori, Takako; Yonezawa, Takayuki; Saito, Yukiko; Teruya, Toshiaki; Woo, Je-Tae

    2018-01-01

    Nepodin, found in the roots of Rumex japonicus Houtt. (Polygonaceae), inhibits osteoclast differentiation and has an antidiabetic effect. We propose nepodin as an ingredient of new functional foods or as a drug candidate for reducing the risk of reduced locomotion resulting from diseases such as osteoporosis. Although there are no previous reports of R. obtusifolius L., which is found throughout Japan, having roots containing nepodin, we found nepodin in the roots of this species. Therefore, R. obtusifolius as well as R. japonicus was considered a candidate raw material for nepodin extraction. We also discuss the suitability of R. japonicus and R. obtusifolius as sources of raw nepodin for cultivation on the Ryukyu Islands. In this study, all specimens on the Ryukyu Islands were identified as R. japonicus. Conversely, all specimens on mainland Japan were R. obtusifolius. The DNA sequence of the chloroplast trnL-trnF intergenic spacer region and partial nuclear internal transcribed spacer was consistent with the identification of R. japonicus and R. obtusifolius by morphological characteristics of the perianth segments. Therefore, to avoid erroneous identification and misuse of the plant species used for extraction of raw materials, it is preferable to develop DNA markers for these two regions. The content of nepodin varied from undetectable to 0.34% of the fresh weight (%FW) in R. japonicus and from undetectable to 0.21%FW in R. obtusifolius. From a pharmacological perspective, as plants that might be suitable as raw materials for nepodin extraction, it became clear that both R. japonicus and R. obtusifolius can be used with the same expected extraction efficiency. Based on our findings, R. obtusifolius could not be confirmed as inhabiting the Ryukyu Islands. For this reason, to conserve the endemic genetic characteristics of the Ryukyu Islands and to prevent genetic pollution by R. obtusifolius, only R. japonicus should be cultivated on the Ryukyu Islands.

  10. Comparison of QIAsymphony automated and QIAamp manual DNA extraction systems for measuring Epstein-Barr virus DNA load in whole blood using real-time PCR.

    Science.gov (United States)

    Laus, Stella; Kingsley, Lawrence A; Green, Michael; Wadowsky, Robert M

    2011-11-01

    Automated and manual extraction systems have been used with real-time PCR for quantification of Epstein-Barr virus [human herpesvirus 4 (HHV-4)] DNA in whole blood, but few studies have evaluated relative performances. In the present study, the automated QIAsymphony and manual QIAamp extraction systems (Qiagen, Valencia, CA) were assessed using paired aliquots derived from clinical whole-blood specimens and an in-house, real-time PCR assay. The detection limits using the QIAsymphony and QIAamp systems were similar (270 and 560 copies/mL, respectively). For samples estimated as having ≥10,000 copies/mL, the intrarun and interrun variations were significantly lower using QIAsymphony (10.0% and 6.8%, respectively), compared with QIAamp (18.6% and 15.2%, respectively); for samples having ≤1000 copies/mL, the two variations ranged from 27.9% to 43.9% and were not significantly different between the two systems. Among 68 paired clinical samples, 48 pairs yielded viral loads ≥1000 copies/mL under both extraction systems. Although the logarithmic linear correlation from these positive samples was high (r(2) = 0.957), the values obtained using QIAsymphony were on average 0.2 log copies/mL higher than those obtained using QIAamp. Thus, the QIAsymphony and QIAamp systems provide similar EBV DNA load values in whole blood. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  11. Lipofection: A Highly Efficient, Lipid-Mediated DNA-Transfection Procedure

    Science.gov (United States)

    Felgner, Philip L.; Gadek, Thomas R.; Holm, Marilyn; Roman, Richard; Chan, Hardy W.; Wenz, Michael; Northrop, Jeffrey P.; Ringold, Gordon M.; Danielsen, Mark

    1987-11-01

    A DNA-transfection protocol has been developed that makes use of a synthetic cationic lipid, N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA). Small unilamellar liposomes containing DOTMA interact spontaneously with DNA to form lipid-DNA complexes with 100% entrapment of the DNA. DOTMA facilitates fusion of the complex with the plasma membrane of tissue culture cells, resulting in both uptake and expression of the DNA. The technique is simple, highly reproducible, and effective for both transient and stable expression of transfected DNA. Depending upon the cell line, lipofection is from 5- to >100-fold more effective than either the calcium phosphate or the DEAE-dextran transfection technique.

  12. Feasibility of RNA and DNA Extraction from Fresh Pipelle and Archival Endometrial Tissues for Use in Gene Expression and SNP Arrays

    Directory of Open Access Journals (Sweden)

    Heather D. Kissel

    2013-01-01

    Full Text Available Identifying molecular markers of endometrial hyperplasia (neoplasia progression is critical to cancer prevention. To assess RNA and DNA quantity and quality from routinely collected endometrial samples and evaluate the performance of RNA- and DNA-based arrays across endometrial tissue types, we collected fresh frozen (FF Pipelle, FF curettage, and formalin-fixed paraffin-embedded (FFPE hysterectomy specimens (benign indications from eight women. Additionally, neoplastic and uninvolved tissues from 24 FFPE archival hysterectomy specimens with endometrial hyperplasias and carcinomas were assessed. RNA was extracted from 15 of 16 FF and 51 of 51 FFPE samples, with yields >1.2 μg for 13/15 (87% FF and 50/51 (98% FFPE samples. Extracted RNA was of high quality; all samples performed successfully on the Illumina whole-genome cDNA-mediated annealing, selection, extension, and ligation (WG-DASL array and performance did not vary by tissue type. While DNA quantity from FFPE samples was excellent, quality was not sufficient for successful performance on the Affymetrix SNP Array 6.0. In conclusion, FF Pipelle samples, which are minimally invasive, yielded excellent quantity and quality of RNA for gene expression arrays (similar to FF curettage and should be considered for use in genomic studies. FFPE-derived DNA should be evaluated on new rapidly evolving sequencing platforms.

  13. Comparação de três protocolos de extração de DNA a partir de tecido fixado em formol e incluído em parafina Comparison of three DNA extraction protocols from formaldehyde-fixed and paraffin-embedded tissues

    Directory of Open Access Journals (Sweden)

    José Veríssimo Fernandes

    2004-06-01

    Full Text Available OBJETIVO: Padronizar um método alternativo para extração de DNA a partir de tecido fixado em formol e conservado em arquivos de blocos de parafina, visando à realização de estudos retrospectivos. MÉTODOS: Comparou-se a eficiência de protocolos de extração de DNA a partir de tecido parafinado, para análise por reação em cadeia de polimerase (PCR, tomando-se como parâmetro um protocolo baseado em um kit comercial. Foram feitas extrações do DNA de 60 espécimes por três métodos: o protocolo A, baseado no kit GlassMAX; o B, utilizando-se o kit GFX TM; e o C, tendo como base o método de Banerjee et al.(2. A integridade e a suficiência do DNA presente na amostra foram avaliadas pela amplificação por PCR de um segmento de 110pb do gene da beta-globina humana, com visualização por meio de eletroforese em gel de poliacrilamida, corado pela prata. Resultados: Das 60 amostras analisadas, 45 apresentaram resultado positivo na PCR quando o DNA foi extraído por qualquer um dos três protocolos. Em seis amostras, a amplificação foi positiva apenas para o DNA extraído pelos protocolos A e C. Em três amostras, o resultado foi positivo apenas para o DNA extraído pelo protocolo A, e em duas, apenas para o DNA extraído pelo protocolo C. CONCLUSÕES: O protocolo C apresentou desempenho semelhante ao do protocolo A, com as vantagens de apresentar menor custo, dispensar o uso de kit comercial, além de não utilizar solventes orgânicos, revelando-se uma alternativa viável para a obtenção de DNA a partir de tecido fixado em formol e incluído em parafina.OBJECTIVE: To set up a method for DNA extraction from paraffin embedded cervical cancer specimens, previously formalin-fixed, aiming to accomplish retrospective analysis. METHODS: Sixty specimens were submitted to DNA extraction by three different methods. All of them involved digestion of the tissues by proteinase K, followed by DNA purification, based in three different approaches

  14. Comparison of fastsure tb dna and mgit 960 for the detection of mycobacterium tuberculosis complex in clinical specimens

    International Nuclear Information System (INIS)

    Hussain, A.; Mirza, I.A.; Abbasi, S.A.; Ali, S.; Zia, F.; Ahmed, Z.

    2013-01-01

    Objective: To compare the efficacy of Fastsure TB DNA with fully automated MGIT 960 method for detection of Mycobacterium tuberculosis complex (MTB) in clinical specimens. Study Design: Comparative cross sectional study. Methodology: After decontamination procedure, the clinical specimens were subjected to DNA extraction and amplification. Extracted DNA was separated in a separate tube provided with fastsure TB DNA kit and was then inserted into the cartridge provided and results were observed within 30 minutes. For Processing in MGIT 960, OADC and PANTA were added to the clinical specimens after decontamination and then the tubes were processed in MGIT 960. Results: A total of 80 specimens were tested by both MGIT 960 and fastsure TB DNA. On MGIT 960 system, 57 specimens showed growth of MTB while 23 were negative. On Fastsure TB DNA, 47 Specimens were tested as positive and 33 specimens showed negative result. Sensitivity and specificity of Fastsure TB DNA method was calculated to be 82.45 % and 100 % respectively, while positive and negative predictive values were 100 % and 69.69 % respectively. Conclusion: Fast sure TB DNA is a rapid and accurate method for the detection of Mycobacterium tuberculosis complex (MTB) from clinical specimens. (author)

  15. Comparing different post-mortem human samples as DNA sources for downstream genotyping and identification.

    Science.gov (United States)

    Calacal, Gayvelline C; Apaga, Dame Loveliness T; Salvador, Jazelyn M; Jimenez, Joseph Andrew D; Lagat, Ludivino J; Villacorta, Renato Pio F; Lim, Maria Cecilia F; Fortun, Raquel D R; Datar, Francisco A; De Ungria, Maria Corazon A

    2015-11-01

    The capability of DNA laboratories to perform genotyping procedures from post-mortem remains, including those that had undergone putrefaction, continues to be a challenge in the Philippines, a country characterized by very humid and warm conditions all year round. These environmental conditions accelerate the decomposition of human remains that were recovered after a disaster and those that were left abandoned after a crime. When considerable tissue decomposition of human remains has taken place, there is no other option but to extract DNA from bone and/or teeth samples. Routinely, femur shafts are obtained from recovered bodies for human identification because the calcium matrix protects the DNA contained in the osteocytes. In the Philippines, there is difficulty in collecting femur samples after natural disasters or even human-made disasters, because these events are usually characterized by a large number of fatalities. Identification of casualties is further delayed by limitation in human and material resources. Hence, it is imperative to test other types of biological samples that are easier to collect, transport, process and store. We analyzed DNA that were obtained from body fluid, bone marrow, muscle tissue, clavicle, femur, metatarsal, patella, rib and vertebral samples from five recently deceased untreated male cadavers and seven male human remains that were embalmed, buried for ∼ 1 month and then exhumed. The bodies had undergone different environmental conditions and were in various stages of putrefaction. A DNA extraction method utilizing a detergent-washing step followed by an organic procedure was used. The utility of bone marrow and vitreous fluid including bone marrow and vitreous fluid that was transferred on FTA(®) cards and subjected to autosomal STR and Y-STR DNA typing were also evaluated. DNA yield was measured and the presence or absence of PCR inhibitors in DNA extracts was assessed using Plexor(®)HY. All samples were amplified using

  16. Direct PCR amplification of forensic touch and other challenging DNA samples: A review.

    Science.gov (United States)

    Cavanaugh, Sarah E; Bathrick, Abigail S

    2018-01-01

    DNA evidence sample processing typically involves DNA extraction, quantification, and STR amplification; however, DNA loss can occur at both the DNA extraction and quantification steps, which is not ideal for forensic evidence containing low levels of DNA. Direct PCR amplification of forensic unknown samples has been suggested as a means to circumvent extraction and quantification, thereby retaining the DNA typically lost during those procedures. Direct PCR amplification is a method in which a sample is added directly to an amplification reaction without being subjected to prior DNA extraction, purification, or quantification. It allows for maximum quantities of DNA to be targeted, minimizes opportunities for error and contamination, and reduces the time and monetary resources required to process samples, although data analysis may take longer as the increased DNA detection sensitivity of direct PCR may lead to more instances of complex mixtures. ISO 17025 accredited laboratories have successfully implemented direct PCR for limited purposes (e.g., high-throughput databanking analysis), and recent studies indicate that direct PCR can be an effective method for processing low-yield evidence samples. Despite its benefits, direct PCR has yet to be widely implemented across laboratories for the processing of evidentiary items. While forensic DNA laboratories are always interested in new methods that will maximize the quantity and quality of genetic information obtained from evidentiary items, there is often a lag between the advent of useful methodologies and their integration into laboratories. Delayed implementation of direct PCR of evidentiary items can be attributed to a variety of factors, including regulatory guidelines that prevent laboratories from omitting the quantification step when processing forensic unknown samples, as is the case in the United States, and, more broadly, a reluctance to validate a technique that is not widely used for evidence samples. The

  17. DNA preservation in silk.

    Science.gov (United States)

    Liu, Yawen; Zheng, Zhaozhu; Gong, He; Liu, Meng; Guo, Shaozhe; Li, Gang; Wang, Xiaoqin; Kaplan, David L

    2017-06-27

    The structure of DNA is susceptible to alterations at high temperature and on changing pH, irradiation and exposure to DNase. Options to protect and preserve DNA during storage are important for applications in genetic diagnosis, identity authentication, drug development and bioresearch. In the present study, the stability of total DNA purified from human dermal fibroblast cells, as well as that of plasmid DNA, was studied in silk protein materials. The DNA/silk mixtures were stabilized on filter paper (silk/DNA + filter) or filter paper pre-coated with silk and treated with methanol (silk/DNA + PT-filter) as a route to practical utility. After air-drying and water extraction, 50-70% of the DNA and silk could be retrieved and showed a single band on electrophoretic gels. 6% silk/DNA + PT-filter samples provided improved stability in comparison with 3% silk/DNA + filter samples and DNA + filter samples for DNA preservation, with ∼40% of the band intensity remaining at 37 °C after 40 days and ∼10% after exposure to UV light for 10 hours. Quantitative analysis using the PicoGreen assay confirmed the results. The use of Tris/borate/EDTA (TBE) buffer enhanced the preservation and/or extraction of the DNA. The DNA extracted after storage maintained integrity and function based on serving as a functional template for PCR amplification of the gene for zinc finger protein 750 (ZNF750) and for transgene expression of red fluorescence protein (dsRed) in HEK293 cells. The high molecular weight and high content of a crystalline beta-sheet structure formed on the coated surfaces likely accounted for the preservation effects observed for the silk/DNA + PT-filter samples. Although similar preservation effects were also obtained for lyophilized silk/DNA samples, the rapid and simple processing available with the silk-DNA-filter membrane system makes it appealing for future applications.

  18. High-thr