WorldWideScience

Sample records for dna extraction methods

  1. Methods for microbial DNA extraction from soil for PCR amplification

    Directory of Open Access Journals (Sweden)

    Yeates C

    1998-01-01

    Full Text Available Amplification of DNA from soil is often inhibited by co-purified contaminants. A rapid, inexpensive, large-scale DNA extraction method involving minimal purification has been developed that is applicable to various soil types (1. DNA is also suitable for PCR amplification using various DNA targets. DNA was extracted from 100g of soil using direct lysis with glass beads and SDS followed by potassium acetate precipitation, polyethylene glycol precipitation, phenol extraction and isopropanol precipitation. This method was compared to other DNA extraction methods with regard to DNA purity and size.

  2. Microbial diversity in fecal samples depends on DNA extraction method

    DEFF Research Database (Denmark)

    Mirsepasi, Hengameh; Persson, Søren; Struve, Carsten

    2014-01-01

    was to evaluate two different DNA extraction methods in order to choose the most efficient method for studying intestinal bacterial diversity using Denaturing Gradient Gel Electrophoresis (DGGE). FINDINGS: In this study, a semi-automatic DNA extraction system (easyMag®, BioMérieux, Marcy I'Etoile, France......BACKGROUND: There are challenges, when extracting bacterial DNA from specimens for molecular diagnostics, since fecal samples also contain DNA from human cells and many different substances derived from food, cell residues and medication that can inhibit downstream PCR. The purpose of the study...... by easyMag® from the same fecal samples. Furthermore, DNA extracts obtained using easyMag® seemed to contain inhibitory compounds, since in order to perform a successful PCR-analysis, the sample should be diluted at least 10 times. DGGE performed on PCR from DNA extracted by QIAamp DNA Stool Mini Kit DNA...

  3. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  4. An efficient method for DNA extraction from Cladosporioid fungi

    OpenAIRE

    Moslem, M.A.; Bahkali, A.H.; Abd-Elsalam, K.A.; Wit, de, P.J.G.M.

    2010-01-01

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A260/A280 ratio ranging between 1.6 and 2.0. Isolated genomic DNA w...

  5. Genomic DNA extraction method from pearl millet ( Pennisetum ...

    African Journals Online (AJOL)

    DNA extraction is difficult in a variety of plants because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, amplification, and cloning. Here we describe a modified procedure based on the hexadecyltrimethylammonium bromide (CTAB) method to ...

  6. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    Extraction of DNA in many plants is difficult because of the presence of metabolites that interfere with DNA isolation procedures and downstream applications such as DNA restriction, replications, amplification, as well as cloning. Modified procedure based on the hexadecyltrimethyl ammoniumbromide (CTAB) method is ...

  7. DNA extraction method for PCR in mycorrhizal fungi.

    Science.gov (United States)

    Manian, S; Sreenivasaprasad, S; Mills, P R

    2001-10-01

    To develop a simple and rapid DNA extraction protocol for PCR in mycorrhizal fungi. The protocol combines the application of rapid freezing and boiling cycles and passage of the extracts through DNA purification columns. PCR amplifiable DNA was obtained from a number of endo- and ecto-mycorrhizal fungi using minute quantities of spores and mycelium, respectively. DNA extracted following the method, was used to successfully amplify regions of interest from high as well as low copy number genes. The amplicons were suitable for further downstream applications such as sequencing and PCR-RFLPs. The protocol described is simple, short and facilitates rapid isolation of PCR amplifiable genomic DNA from a large number of fungal isolates in a single day. The method requires only minute quantities of starting material and is suitable for mycorrhizal fungi as well as a range of other fungi.

  8. A novel method of genomic DNA extraction for Cactaceae1

    Science.gov (United States)

    Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen

    2013-01-01

    • Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521

  9. Highly efficient DNA extraction method from skeletal remains

    Directory of Open Access Journals (Sweden)

    Irena Zupanič Pajnič

    2011-03-01

    Full Text Available Background: This paper precisely describes the method of DNA extraction developed to acquire high quality DNA from the Second World War skeletal remains. The same method is also used for molecular genetic identification of unknown decomposed bodies in routine forensic casework where only bones and teeth are suitable for DNA typing. We analysed 109 bones and two teeth from WWII mass graves in Slovenia. Methods: We cleaned the bones and teeth, removed surface contaminants and ground the bones into powder, using liquid nitrogen . Prior to isolating the DNA in parallel using the BioRobot EZ1 (Qiagen, the powder was decalcified for three days. The nuclear DNA of the samples were quantified by real-time PCR method. We acquired autosomal genetic profiles and Y-chromosome haplotypes of the bones and teeth with PCR amplification of microsatellites, and mtDNA haplotypes 99. For the purpose of traceability in the event of contamination, we prepared elimination data bases including genetic profiles of the nuclear and mtDNA of all persons who have been in touch with the skeletal remains in any way. Results: We extracted up to 55 ng DNA/g of the teeth, up to 100 ng DNA/g of the femurs, up to 30 ng DNA/g of the tibias and up to 0.5 ng DNA/g of the humerus. The typing of autosomal and YSTR loci was successful in all of the teeth, in 98 % dekalof the femurs, and in 75 % to 81 % of the tibias and humerus. The typing of mtDNA was successful in all of the teeth, and in 96 % to 98 % of the bones. Conclusions: We managed to obtain nuclear DNA for successful STR typing from skeletal remains that were over 60 years old . The method of DNA extraction described here has proved to be highly efficient. We obtained 0.8 to 100 ng DNA/g of teeth or bones and complete genetic profiles of autosomal DNA, Y-STR haplotypes, and mtDNA haplotypes from only 0.5g bone and teeth samples.

  10. Genomic DNA extraction method from Annona senegalensis Pers ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-02-05

    SDS) or cetyl-methyl ammonium bromide (CTAB). The released DNA should be protected from endogenous nuclease. Ethylenediaminetetra acetate. (EDTA) is often included in the extraction buffer to chelate magnesium ions ...

  11. An improved method of DNA extraction from plants for pathogen ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.

  12. Efficient method for the extraction of genomic DNA from wormwood ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-09-17

    Sep 17, 2008 ... DNA is extracted from plant material it will also contain. *Corresponding author. ... an important issue in the field of plant molecular biology. Various plants ..... An excellent guide to over 500 of the more well known medicinal ...

  13. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  14. Comparison of DNA extraction methods for detection of citrus huanglongbing in Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Evelio Ángel

    2014-04-01

    Full Text Available Four DNA citrus plant tissue extraction protocols and three methods of DNA extraction from vector psyllid Diaphorina citri Kuwayama (Hemiptera: Psyllidae were compared as part of the validation process and standardization for detection of huanglongbing (HLB. The comparison was done using several criterias such as integrity, purity and concentration. The best quality parameters presented in terms of extraction of DNA from plant midribs tissue of citrus, were cited by Murray and Thompson (1980 and Rodríguez et al. (2010, while for the DNA extraction from psyllid vectors of HLB, the best extraction method was suggested by Manjunath et al.(2008.

  15. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...

  16. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    Science.gov (United States)

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  17. Evaluation of DNA Extraction Methods Suitable for PCR-based Detection and Genotyping of Clostridium botulinum

    DEFF Research Database (Denmark)

    Auricchio, Bruna; Anniballi, Fabrizio; Fiore, Alfonsina

    2013-01-01

    in terms of cost, time, labor, and supplies. Eleven botulinum toxin–producing clostridia strains and 25 samples (10 food, 13 clinical, and 2 environmental samples) naturally contaminated with botulinum toxin–producing clostridia were used to compare 4 DNA extraction procedures: Chelex® 100 matrix, Phenol......Sufficient quality and quantity of extracted DNA is critical to detecting and performing genotyping of Clostridium botulinum by means of PCR-based methods. An ideal extraction method has to optimize DNA yield, minimize DNA degradation, allow multiple samples to be extracted, and be efficient...

  18. Evaluation of five methods for total DNA extraction from western corn rootworm beetles.

    Directory of Open Access Journals (Sweden)

    Hong Chen

    Full Text Available BACKGROUND: DNA extraction is a routine step in many insect molecular studies. A variety of methods have been used to isolate DNA molecules from insects, and many commercial kits are available. Extraction methods need to be evaluated for their efficiency, cost, and side effects such as DNA degradation during extraction. METHODOLOGY/PRINCIPAL FINDINGS: From individual western corn rootworm beetles, Diabrotica virgifera virgifera, DNA extractions by the SDS method, CTAB method, DNAzol reagent, Puregene solutions and DNeasy column were compared in terms of DNA quantity and quality, cost of materials, and time consumed. Although all five methods resulted in acceptable DNA concentrations and absorbance ratios, the SDS and CTAB methods resulted in higher DNA yield (ng DNA vs. mg tissue at much lower cost and less degradation as revealed on agarose gels. The DNeasy kit was most time-efficient but was the costliest among the methods tested. The effects of ethanol volume, temperature and incubation time on precipitation of DNA were also investigated. The DNA samples obtained by the five methods were tested in PCR for six microsatellites located in various positions of the beetle's genome, and all samples showed successful amplifications. CONCLUSION/SIGNIFICANCE: These evaluations provide a guide for choosing methods of DNA extraction from western corn rootworm beetles based on expected DNA yield and quality, extraction time, cost, and waste control. The extraction conditions for this mid-size insect were optimized. The DNA extracted by the five methods was suitable for further molecular applications such as PCR and sequencing by synthesis.

  19. Evaluation of DNA extraction methods for the detection of Cytomegalovirus in dried blood spots

    Science.gov (United States)

    Koontz, D.; Baecher, K.; Amin, M.; Nikolova, S.; Gallagher, M.; Dollard, S.

    2015-01-01

    Background Dried blood spots (DBS) are collected universally from newborns and may be valuable for the diagnosis of congenital Cytomegalovirus (CMV) infection. The reported analytical sensitivity for DBS testing compared to urine or saliva varies greatly across CMV studies. The purpose of this study was to directly compare the performance of various DNA extraction methods for identification of CMV in DBS including those used most often in CMV studies. Study design Whatman® Grade 903 filter paper cards were spotted with blood samples from 25 organ transplant recipients who had confirmed CMV viremia. Six DNA extraction methods were compared for relative yield of viral and cellular DNA: 2 manual solution-based methods (Gentra Puregene, thermal shock), 2 manual silica column-based methods (QIAamp DNA Mini, QIAamp DNA Investigator), and 2 automated methods (M48 MagAttract Mini, QIAcube Investigator). DBS extractions were performed in triplicate followed by real-time quantitative PCR (qPCR). Results For extraction of both viral and cellular DNA, two methods (QIAamp DNA Investigator and thermal shock) consistently gave the highest yields, and two methods (M48 MagAttract Mini and QIAamp DNA Mini) consistently gave the lowest yields. There was an average 3-fold difference in DNA yield between the highest and lowest yield methods. Conclusion The choice of DNA extraction method is a major factor in the ability to detect low levels of CMV in DBS and can largely account for the wide range of DBS sensitivities reported in studies to date. PMID:25866346

  20. Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.

    Science.gov (United States)

    Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y

    2015-12-28

    Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.

  1. Comparison of Six DNA Extraction Procedures and the Application of Plastid DNA Enrichment Methods in Selected Non-photosynthetic Plants

    Directory of Open Access Journals (Sweden)

    Shin-Yi Shyu

    2013-12-01

    Full Text Available Genomic DNA was isolated using three DNA extraction commercial kits and three CTAB-based methods for two non-photosynthetic plants, Balanophora japonica and Mitrastemon kanehirai. The quality of the isolated DNA was evaluated and subjected to following restriction enzyme digestions. All six procedures yielded DNA of sufficient quality for PCR, and the method described by Barnwell et al. (1998 performed well in isolating DNA from both species for restriction enzyme digestion. In addition, we succeeded to enrich plastid DNA content by using the methods depending on a high salt buffer to deplete nuclear material. The ‘high salt’ methods based on protocol presented by Milligan (1989 were able to increase plastid DNA effectively and significantly reduce nuclear DNA from M. kanehirai. The plastid DNA enrichment protocols are inexpensive and not time-consuming, and may be applicable to other non-photosynthetic plants.

  2. A RAPID DNA EXTRACTION METHOD FOR PCR IDENTIFICATION OF FUNGAL INDOOR AIR CONTAMINANTS

    Science.gov (United States)

    Following air sampling, fungal DNA needs to be extracted and purified to a state suitable for laboratory use. Our laboratory has developed a simple method of extraction and purification of fungal DNA appropriate for enzymatic manipulation and polymerase chain reaction (PCR) appli...

  3. A Rapid and Cost-Effective Method for DNA Extraction from Archival Herbarium Specimens.

    Science.gov (United States)

    Krinitsina, A A; Sizova, T V; Zaika, M A; Speranskaya, A S; Sukhorukov, A P

    2015-11-01

    Here we report a rapid and cost-effective method for the extraction of total DNA from herbarium specimens up to 50-90-year-old. The method takes about 2 h, uses AMPure XP magnetic beads diluted by PEG-8000- containing buffer, and does not require use of traditional volatile components like chloroform, phenol, and liquid nitrogen. It yields up to 4 µg of total nucleic acid with high purity from about 30 mg of dry material. The quality of the extracted DNA was tested by PCR amplification of 5S rRNA and rbcL genes (nuclear and chloroplast DNA markers) and compared against the traditional chloroform/isoamyl alcohol method. Our results demonstrate that the use of the magnetic beads is crucial for extraction of DNA suitable for subsequent PCR from herbarium samples due to the decreasing inhibitor concentrations, reducing short fragments of degraded DNA, and increasing median DNA fragment sizes.

  4. Comparison of DNA extraction methods for human gut microbial community profiling.

    Science.gov (United States)

    Lim, Mi Young; Song, Eun-Ji; Kim, Sang Ho; Lee, Jangwon; Nam, Young-Do

    2018-03-01

    The human gut harbors a vast range of microbes that have significant impact on health and disease. Therefore, gut microbiome profiling holds promise for use in early diagnosis and precision medicine development. Accurate profiling of the highly complex gut microbiome requires DNA extraction methods that provide sufficient coverage of the original community as well as adequate quality and quantity. We tested nine different DNA extraction methods using three commercial kits (TianLong Stool DNA/RNA Extraction Kit (TS), QIAamp DNA Stool Mini Kit (QS), and QIAamp PowerFecal DNA Kit (QP)) with or without additional bead-beating step using manual or automated methods and compared them in terms of DNA extraction ability from human fecal sample. All methods produced DNA in sufficient concentration and quality for use in sequencing, and the samples were clustered according to the DNA extraction method. Inclusion of bead-beating step especially resulted in higher degrees of microbial diversity and had the greatest effect on gut microbiome composition. Among the samples subjected to bead-beating method, TS kit samples were more similar to QP kit samples than QS kit samples. Our results emphasize the importance of mechanical disruption step for a more comprehensive profiling of the human gut microbiome. Copyright © 2017 The Authors. Published by Elsevier GmbH.. All rights reserved.

  5. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.

    Science.gov (United States)

    Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A

    2017-02-01

    An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.

  6. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  7. DNA extraction methods for detecting genetically modified foods: A comparative study.

    Science.gov (United States)

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

    2011-06-15

    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    Directory of Open Access Journals (Sweden)

    Shirleny Monserrat Sandoval-Arias

    2014-11-01

    Full Text Available The identification of suspects in criminal investigations has been facilitated since DNA test are executed on different samples. The application of this technology for forensic typification from human fecal samples still presents complications therefore this research evaluated two DNA extraction protocols with modifications to determine that of major efficiency. Organic extractions and extractions using the commercial kit “IQTM DNA Casework Sample Kit for Maxwell ® 16” on FTA portions of 4cm2 and 1cm2 impregnated with feces from the same individual were done to accomplish the objective. In all the assays the results were useful, however; the best forensic typification (by the electropherogram characteristics was obtained by using the commercial kit in an area of 1 cm2 of FTA paper impregnated in a 1:4 dilution.

  9. Efficient method for extracting DNA of parasites causing bovine babesiosis from tick vectors

    Science.gov (United States)

    The southern cattle tick, Rhipicephalus (Boophilus) microplus, is an economically important pest costing animal agriculture billions of dollars worldwide. This research focuses on a comparison of three different tick DNA extraction methods: phenol-chloroform extraction (method 1), a modified version...

  10. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  11. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Comparison of Three Different DNA Extraction Methods for Linguatula serrata as a Food Born Pathogen

    Directory of Open Access Journals (Sweden)

    Gilda ESLAMI

    2017-06-01

    Full Text Available Background: One of the most important items in molecular characterization of food-borne pathogens is high quality genomic DNA. In this study, we investigated three protocols and compared their simplicity, duration and costs for extracting genomic DNA from Linguatula serrata.Methods: The larvae were collected from the sheep’s visceral organs from the Yazd Slaughterhouse during May 2013. DNA extraction was done in three different methods, including commercial DNA extraction kit, Phenol Chloroform Isoamylalcohol (PCI, and salting out. Extracted DNA in each method was assessed for quantity and quality using spectrophotometery and agarose gel electrophoresis, respectively.Results: The less duration was regarding to commercial DNA extraction kit and then salting out protocol. The cost benefit one was salting out and then PCI method. The best quantity was regarding to PCI with 72.20±29.20 ng/μl, and purity of OD260/OD280 in 1.76±0.947. Agarose gel electrophoresis for assessing the quality found all the same.Conclusion: Salting out is introduced as the best method for DNA extraction from L. seratta as a food-borne pathogen with the least costand appropriate purity. Although, the best purity was regarding to PCI but PCI is not safe as salting out. In addition, the duration of salting out was less than PCI. The least duration was seen in commercial DNA extraction kit, but it is expensive and therefore is not recommended for developing countries where consumption of offal is common.

  13. Comparison of two silica-based extraction methods for DNA isolation from bones.

    Science.gov (United States)

    Rothe, Jessica; Nagy, Marion

    2016-09-01

    One of the most demanding DNA extractions is from bones and teeth due to the robustness of the material and the relatively low DNA content. The greatest challenge is due to the manifold nature of the material, which is defined by various factors, including age, storage, environmental conditions, and contamination with inhibitors. However, most published protocols do not distinguish between different types or qualities of bone material, but are described as being generally applicable. Our laboratory works with two different extraction methods based on silica membranes or the use of silica beads. We compared the amplification success of the two methods from bone samples with different qualities and in the presence of inhibitors. We found that the DNA extraction using the silica membrane method results an in higher DNA yield but also in a higher risk of co-extracting impurities, which can act as inhibitors. In contrast the silica beads method shows decreased co-extraction of inhibitors but also less DNA yield. Related to our own experiences it has to be considered that each bone material should be reviewed independently regarding the analysis and extraction method. Therefore, the most ambitious task is determining the quality of the bone material, which requires substantial experience. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. A simple method of genomic DNA extraction suitable for analysis of bulk fungal strains.

    Science.gov (United States)

    Zhang, Y J; Zhang, S; Liu, X Z; Wen, H A; Wang, M

    2010-07-01

    A simple and rapid method (designated thermolysis) for extracting genomic DNA from bulk fungal strains was described. In the thermolysis method, a few mycelia or yeast cells were first rinsed with pure water to remove potential PCR inhibitors and then incubated in a lysis buffer at 85 degrees C to break down cell walls and membranes. This method was used to extract genomic DNA from large numbers of fungal strains (more than 92 species, 35 genera of three phyla) isolated from different sections of natural Ophiocordyceps sinensis specimens. Regions of interest from high as well as single-copy number genes were successfully amplified from the extracted DNA samples. The DNA samples obtained by this method can be stored at -20 degrees C for over 1 year. The method was effective, easy and fast and allowed batch DNA extraction from multiple fungal isolates. Use of the thermolysis method will allow researchers to obtain DNA from fungi quickly for use in molecular assays. This method requires only minute quantities of starting material and is suitable for diverse fungal species.

  15. A Suitable Method for DNA Extraction from Bones for Forensic Applications: A Case Study

    Directory of Open Access Journals (Sweden)

    Aqeela S. Abuidrees

    2016-06-01

    Full Text Available Human identification techniques are constantly developing. Before the discovery of DNA, anthropology accompanied with odontology was the most applicable technique for human identification. With the new era of molecular biology and the revolution of DNA and PCR techniques, DNA profiling has become the core of the human forensic identification process. Different types of samples can be exploited in forensic DNA analysis. In some extreme cases, bone samples are the only accessible samples of DNA due to the bad conditions of putrefaction or degradation of other biological materials and tissues. Therefore, an appropriate method should be determined to yield a full and clean profile. A case study is presented here in order to identify human remains and conclude the most appropriate method of DNA extraction from human remains. In addition, this study looks at the best part of the skeletal remains to be considered in the extraction of DNA for the purposes of identification. A suspect admitted that he buried his aborted son six months ago. The remains were recovered and DNA analysis was performed in order to determine any genetic link of the remains to the suspect and the female who delivered the baby. Two extraction methods were compared, the standard organic (phenol:chloroform:isoamyl alcohol and automated extraction using magnetic beads coated with silica (Qiagen EZ1 Advanced XL. Two bone parts, femur and clavicle, were also compared in terms of DNA yield. The efficiency of the two methods of DNA extraction from bones is illustrated quantitatively and qualitatively. Paternity testing was performed and the suspect was excluded from being the alleged father.

  16. Evaluation of methods for the extraction and purification of DNA from the human microbiome.

    Directory of Open Access Journals (Sweden)

    Sanqing Yuan

    Full Text Available DNA extraction is an essential step in all cultivation-independent approaches to characterize microbial diversity, including that associated with the human body. A fundamental challenge in using these approaches has been to isolate DNA that is representative of the microbial community sampled.In this study, we statistically evaluated six commonly used DNA extraction procedures using eleven human-associated bacterial species and a mock community that contained equal numbers of those eleven species. These methods were compared on the basis of DNA yield, DNA shearing, reproducibility, and most importantly representation of microbial diversity. The analysis of 16S rRNA gene sequences from a mock community showed that the observed species abundances were significantly different from the expected species abundances for all six DNA extraction methods used.Protocols that included bead beating and/or mutanolysin produced significantly better bacterial community structure representation than methods without both of them. The reproducibility of all six methods was similar, and results from different experimenters and different times were in good agreement. Based on the evaluations done it appears that DNA extraction procedures for bacterial community analysis of human associated samples should include bead beating and/or mutanolysin to effectively lyse cells.

  17. A high throughput DNA extraction method with high yield and quality

    Directory of Open Access Journals (Sweden)

    Xin Zhanguo

    2012-07-01

    Full Text Available Abstract Background Preparation of large quantity and high quality genomic DNA from a large number of plant samples is a major bottleneck for most genetic and genomic analyses, such as, genetic mapping, TILLING (Targeting Induced Local Lesion IN Genome, and next-generation sequencing directly from sheared genomic DNA. A variety of DNA preparation methods and commercial kits are available. However, they are either low throughput, low yield, or costly. Here, we describe a method for high throughput genomic DNA isolation from sorghum [Sorghum bicolor (L. Moench] leaves and dry seeds with high yield, high quality, and affordable cost. Results We developed a high throughput DNA isolation method by combining a high yield CTAB extraction method with an improved cleanup procedure based on MagAttract kit. The method yielded large quantity and high quality DNA from both lyophilized sorghum leaves and dry seeds. The DNA yield was improved by nearly 30 fold with 4 times less consumption of MagAttract beads. The method can also be used in other plant species, including cotton leaves and pine needles. Conclusion A high throughput system for DNA extraction from sorghum leaves and seeds was developed and validated. The main advantages of the method are low cost, high yield, high quality, and high throughput. One person can process two 96-well plates in a working day at a cost of $0.10 per sample of magnetic beads plus other consumables that other methods will also need.

  18. Effect of DNA extraction and sample preservation method on rumen bacterial population.

    Science.gov (United States)

    Fliegerova, Katerina; Tapio, Ilma; Bonin, Aurelie; Mrazek, Jakub; Callegari, Maria Luisa; Bani, Paolo; Bayat, Alireza; Vilkki, Johanna; Kopečný, Jan; Shingfield, Kevin J; Boyer, Frederic; Coissac, Eric; Taberlet, Pierre; Wallace, R John

    2014-10-01

    The comparison of the bacterial profile of intracellular (iDNA) and extracellular DNA (eDNA) isolated from cow rumen content stored under different conditions was conducted. The influence of rumen fluid treatment (cheesecloth squeezed, centrifuged, filtered), storage temperature (RT, -80 °C) and cryoprotectants (PBS-glycerol, ethanol) on quality and quantity parameters of extracted DNA was evaluated by bacterial DGGE analysis, real-time PCR quantification and metabarcoding approach using high-throughput sequencing. Samples clustered according to the type of extracted DNA due to considerable differences between iDNA and eDNA bacterial profiles, while storage temperature and cryoprotectants additives had little effect on sample clustering. The numbers of Firmicutes and Bacteroidetes were lower (P rumen fluid subjected to the eDNA isolation procedure considerably changed the ratio of molecular operational taxonomic units (MOTUs) of Bacteroidetes and Firmicutes. Intracellular DNA extraction using bead-beating method from cheesecloth sieved rumen content mixed with PBS-glycerol and stored at -80 °C was found as the optimal method to study ruminal bacterial profile. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay

    Directory of Open Access Journals (Sweden)

    Khandaker Shadia

    2012-01-01

    Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11

  20. An Improved Method for High Quality Metagenomics DNA Extraction from Human and Environmental Samples

    DEFF Research Database (Denmark)

    Bag, Satyabrata; Saha, Bipasa; Mehta, Ojasvi

    2016-01-01

    and human origin samples. We introduced a combination of physical, chemical and mechanical lysis methods for proper lysis of microbial inhabitants. The community microbial DNA was precipitated by using salt and organic solvent. Both the quality and quantity of isolated DNA was compared with the existing...... methodologies and the supremacy of our method was confirmed. Maximum recovery of genomic DNA in the absence of substantial amount of impurities made the method convenient for nucleic acid extraction. The nucleic acids obtained using this method are suitable for different downstream applications. This improved...

  1. Comparison of six simple methods for extracting ribosomal and mitochondrial DNA from Toxocara and Toxascaris nematodes.

    Science.gov (United States)

    Mikaeili, F; Kia, E B; Sharbatkhori, M; Sharifdini, M; Jalalizand, N; Heidari, Z; Zarei, Z; Stensvold, C R; Mirhendi, H

    2013-06-01

    Six simple methods for extraction of ribosomal and mitochondrial DNA from Toxocara canis, Toxocara cati and Toxascaris leonina were compared by evaluating the presence, appearance and intensity of PCR products visualized on agarose gels and amplified from DNA extracted by each of the methods. For each species, two isolates were obtained from the intestines of their respective hosts: T. canis and T. leonina from dogs, and T. cati from cats. For all isolates, total DNA was extracted using six different methods, including grinding, boiling, crushing, beating, freeze-thawing and the use of a commercial kit. To evaluate the efficacy of each method, the internal transcribed spacer (ITS) region and the cytochrome c oxidase subunit 1 (cox1) gene were chosen as representative markers for ribosomal and mitochondrial DNA, respectively. Among the six DNA extraction methods, the beating method was the most cost effective for all three species, followed by the commercial kit. Both methods produced high intensity bands on agarose gels and were characterized by no or minimal smear formation, depending on gene target; however, beating was less expensive. We therefore recommend the beating method for studies where costs need to be kept at low levels. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa 1

    OpenAIRE

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)?based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer?s protocol. In parallel, CTAB-based extractions were done using the a...

  3. INVESTIGATION OF METHODS OF DNA EXTRACTION FROM PLANT ORIGIN OBJECTS AND FOODS BASED ON THEM

    Directory of Open Access Journals (Sweden)

    L. S. Dyshlyuk

    2014-01-01

    Full Text Available For the last decades modern and highly efficient methods of determining the quality and safety of food products, based on the application of the latest scientific achievements were developed in the world. A special place is given to the methods based on achievements of molecular biology and genetics. At the present stage of development in the field of assessing the quality of raw materials and processed food products much attention is given to highly accurate, sensitive and specific research methods, the method of polymerase chain reaction (PCR occupying a leading place among them. PCR is a sophisticated method that simulates the natural DNA replication and allows to detect a single specific DNA molecule in the presence of millions of other molecules. The key point in the preparation of material for PCR is the extraction of nucleic acids. The low content of DNA in plant material and the high concentration of secondary metabolites complicate the process of extraction. The key solution to this problem is highly effective method of extraction, which allows to obtain the DNA of adequate quality and purity. Comparative analysis of methods for the extraction of nucleic acids from fruit raw materials and products based on them was carried out in the study. General analysis of the experimental data allowed us to determine the most efficient method for DNA extracting. In the comparative analysis it was found out that to extract DNA from plant raw materials and food products prepared on their basis it is the most suitable to use "Sorb-GMO-A" reactants kit (set. The approach described gives us a brilliant opportunity to obtain deoxyribonucleic acid proper quality and purity.

  4. A rapid and simple method for DNA extraction from yeasts and fungi isolated from Agave fourcroydes.

    Science.gov (United States)

    Tapia-Tussell, Raul; Lappe, Patricia; Ulloa, Miguel; Quijano-Ramayo, Andrés; Cáceres-Farfán, Mirbella; Larqué-Saavedra, Alfonso; Perez-Brito, Daisy

    2006-05-01

    A simple and easy protocol for extracting high-quality DNA from different yeast and filamentous fungal species is described. This method involves two important steps: first, the disruption of cell walls by mechanical means and freezing; and second, the extraction, isolation, and precipitation of genomic DNA. The absorbance ratios (A(260)/A(280)) obtained ranged from 1.6 to 2.0. The main objective of this procedure is to extract pure DNA from yeast and filamentous fungi, including those with high contents of proteins, polysaccharides, and other complex compounds in their cell walls. The yield and quality of the DNAs obtained were suitable for micro/minisatellite primer-polymerase chain reaction (MSP-PCR) fingerprinting as well as for the sequence of the D1/D2 domain of the 26S rDNA.

  5. Rapid and efficient method to extract metagenomic DNA from estuarine sediments.

    Science.gov (United States)

    Shamim, Kashif; Sharma, Jaya; Dubey, Santosh Kumar

    2017-07-01

    Metagenomic DNA from sediments of selective estuaries of Goa, India was extracted using a simple, fast, efficient and environment friendly method. The recovery of pure metagenomic DNA from our method was significantly high as compared to other well-known methods since the concentration of recovered metagenomic DNA ranged from 1185.1 to 4579.7 µg/g of sediment. The purity of metagenomic DNA was also considerably high as the ratio of absorbance at 260 and 280 nm ranged from 1.88 to 1.94. Therefore, the recovered metagenomic DNA was directly used to perform various molecular biology experiments viz. restriction digestion, PCR amplification, cloning and metagenomic library construction. This clearly proved that our protocol for metagenomic DNA extraction using silica gel efficiently removed the contaminants and prevented shearing of the metagenomic DNA. Thus, this modified method can be used to recover pure metagenomic DNA from various estuarine sediments in a rapid, efficient and eco-friendly manner.

  6. Identifikasi bite marks dengan ekstraksi DNA metode Chelex (Bite marks identification with Chelex methods in DNA extraction

    Directory of Open Access Journals (Sweden)

    Imelda Kristina Sutrisno

    2013-06-01

    Full Text Available Background: In the case of crime often encountered evidence in bite marks form that was found on the victim’s body. Generally, bitemarks identification use standard techniques that compare the interpretation picture with the tooth model of suspected person. However, sometimes the techniques do not obtain accurate results. Therefore another technique is needed to support the identification process,such as DNA analysis that use the remaining epithelium attached in saliva to identify the DNA of the suspected person. In this processes a limited DNA material could be met, not only less in quantity but also less in quality. Chelex known as one of an effective DNA extraction method in DNA forensic case is needed to overcome this problem. Purpose: The study was aimed to examine the use of Chelex as DNA extraction method on a bitemarks sample models. Methods: The blood and bitemarks of 5 persons with were taken. The DNA of each subject was exctracted with Chelex and quantified the quantity with UV Spechtrophotometer. The DNA results was amplified by PCR at locus vWA and TH01 then vizualised by electrophoresis. Results: The electrophoresis’s results showed band at locus vWA and TH01 for blood sample and bite marks with no significant differences. Conclusion: The study showed that Chelex method could be use to extract DNA from bitemarks.Latar belakang: Dalam kasus kejahatan sering dijumpai bukti dalam bentuk bekas gigitan (bitemarks yang ditemukan pada tubuh korban. Umumnya, untuk mengidentifikasi bite marks menggunakan teknik standar yaitu membandingkan foto interpretasi dengan model gigi dari orang yang dicurigai. Namun demikian teknik ini terkadang tidak mendapatkan hasil yang akurat, sehingga diperlukan teknik lain untuk menunjang keberhasilan proses identifikasi pelaku, yakni melalui analisis DNA bitemarks, yang diperoleh dari saliva yang mengandung sisa epitel tersangka pelaku. Sampel DNA yang berasal dari bitemarks umumnya terbatas, tidak hanya

  7. Impact of two different commercial DNA extraction methods on BK virus viral load

    Directory of Open Access Journals (Sweden)

    Massimiliano Bergallo

    2016-03-01

    Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.

  8. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... The effects of three different grinding methods in DNA extraction of cowpea .... 100 mg of the leaf tissues were weighed in an electronic balance. CTAB method .... The primers were synthesized by Life Technologies (AB & Invitrogen). .... This work was supported by 'Shuang-Zhi Plan' of Sichuan. Agricultural ...

  9. An Improved DNA Extraction Method for Efficient and Quantitative Recovery of Phytoplankton Diversity in Natural Assemblages.

    Directory of Open Access Journals (Sweden)

    Jian Yuan

    Full Text Available Marine phytoplankton are highly diverse with different species possessing different cell coverings, posing challenges for thoroughly breaking the cells in DNA extraction yet preserving DNA integrity. While quantitative molecular techniques have been increasingly used in phytoplankton research, an effective and simple method broadly applicable to different lineages and natural assemblages is still lacking. In this study, we developed a bead-beating protocol based on our previous experience and tested it against 9 species of phytoplankton representing different lineages and different cell covering rigidities. We found the bead-beating method enhanced the final yield of DNA (highest as 2 folds in comparison with the non-bead-beating method, while also preserving the DNA integrity. When our method was applied to a field sample collected at a subtropical bay located in Xiamen, China, the resultant ITS clone library revealed a highly diverse assemblage of phytoplankton and other micro-eukaryotes, including Archaea, Amoebozoa, Chlorophyta, Ciliphora, Bacillariophyta, Dinophyta, Fungi, Metazoa, etc. The appearance of thecate dinoflagellates, thin-walled phytoplankton and "naked" unicellular organisms indicates that our method could obtain the intact DNA of organisms with different cell coverings. All the results demonstrate that our method is useful for DNA extraction of phytoplankton and environmental surveys of their diversity and abundance.

  10. Rapid methods for the extraction and archiving of molecular grade fungal genomic DNA.

    Science.gov (United States)

    Borman, Andrew M; Palmer, Michael; Johnson, Elizabeth M

    2013-01-01

    The rapid and inexpensive extraction of fungal genomic DNA that is of sufficient quality for molecular approaches is central to the molecular identification, epidemiological analysis, taxonomy, and strain typing of pathogenic fungi. Although many commercially available and in-house extraction procedures do eliminate the majority of contaminants that commonly inhibit molecular approaches, the inherent difficulties in breaking fungal cell walls lead to protocols that are labor intensive and that routinely take several hours to complete. Here we describe several methods that we have developed in our laboratory that allow the extremely rapid and inexpensive preparation of fungal genomic DNA.

  11. DNA extraction methods for panbacterial and panfungal PCR detection in intraocular fluids.

    Science.gov (United States)

    Mazoteras, Paloma; Bispo, Paulo José Martins; Höfling-Lima, Ana Luisa; Casaroli-Marano, Ricardo P

    2015-07-01

    Three different methods of DNA extraction from intraocular fluids were compared with subsequent detection for bacterial and fungal DNA by universal PCR amplification. Three DNA extraction methods, from aqueous and vitreous humors, were evaluated to compare their relative efficiency. Bacterial (Gram positive and negative) and fungal strains were used in this study: Escherichia coli, Staphylococcus epidermidis and Candida albicans. The quality, quantification, and detection limit for DNA extraction and PCR amplification were analyzed. Validation procedures for 13 aqueous humor and 14 vitreous samples, from 20 patients with clinically suspected endophthalmitis were carried out. The column-based extraction method was the most time-effective, achieving DNA detection limits ≥10(2) and 10(3 )CFU/100 µL for bacteria and fungi, respectively. PCR amplification detected 100 fg, 1 pg and 10 pg of genomic DNA of E. coli, S. epidermidis and C. albicans respectively. PCR detected 90.0% of the causative agents from 27 intraocular samples collected from 20 patients with clinically suspected endophthalmitis, while standard microbiological techniques could detect only 60.0%. The most frequently found organisms were Streptococcus spp. in 38.9% (n = 7) of patients and Staphylococcus spp. found in 22.2% (n = 4). The column-based extraction method for very small inocula in small volume samples (50-100 µL) of aqueous and/or vitreous humors allowed PCR amplification in all samples with sufficient quality for subsequent sequencing and identification of the microorganism in the majority of them.

  12. Efficient recovery of environmental DNA for expression cloning by indirect extraction methods

    NARCIS (Netherlands)

    Gabor, Esther; de Vries, Erik; Janssen, DB

    2003-01-01

    Using direct and cell extraction-based (indirect) isolation methods, DNA was obtained from environmental samples with largely differing characteristics (loam soil, sand soil, sediment, activated sludge, and compost) and evaluated with respect to the comprised bacterial diversity and its suitability

  13. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... This makes coffee seed as one of the important material for molecular marker ... homogenised in 10 ml of freshly prepared extraction buffer (200. mM Tris-HCl pH 8.0, .... DNA material for particular molecular analysis. This method will be ... Pharmawati M, Yan G, Sedgley R, Finnegan PM (2004). Chloroplast.

  14. Bacterial community analysis of activated sludge: an evaluation of four commonly used DNA extraction methods

    NARCIS (Netherlands)

    Vanysacker, L.; Declerck, S.A.J.; Hellemans, B.; De Meester, L.; Vankelecom, I.; Declerck, P.

    2010-01-01

    The effectiveness of three commercially available direct DNA isolation kits (Mobio, Fast, Qiagen) and one published direct DNA extraction protocol (Bead) for extracting bacterial DNA from different types of activated sludge was investigated and mutually compared. The DNA quantity and purity were

  15. Filtration Isolation of Nucleic Acids: A Simple and Rapid DNA Extraction Method.

    Science.gov (United States)

    McFall, Sally M; Neto, Mário F; Reed, Jennifer L; Wagner, Robin L

    2016-08-06

    FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 µl whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

  16. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    Science.gov (United States)

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014

  17. Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs

    Directory of Open Access Journals (Sweden)

    Ana Cristina dos Reis Ferreira

    2015-06-01

    Full Text Available ABSTRACT. Ferreira A.C.dosR. & dos Santos B.M. [Evaluation of dna extraction methods of the Salmonella sp. bacterium in artificially infected chickens eggs.] Avaliação de três métodos de extração de DNA de Salmonella sp. em ovos de galinhas contaminados artificialmente. Revista Brasileira de Medicina Veterinária, 37(2:115-119, 2015. Departamento de Veterinária, Universidade Federal de Viçosa, Campus Universitário, Av. Peter Henry Rolfs, s/n, Viçosa, MG 36571-000, Brasil. E-mail: bmsantos@ufv.br The present study evaluated the efficiency of different protocols for the genomic DNA extraction of Salmonella bacteria in chicken eggs free of specific pathogens – SPF. Seventy-five eggs were used and divided into five groups with fifteen eggs each. Three of the five groups of eggs were inoculated with enteric Salmonella cultures. One of the five groups was inoculated with Escherichia coli bacterium culture. And another group of eggs was the negative control that received saline solution 0.85% infertile. The eggs were incubated on a temperature that varied from 20 to 25°C during 24, 48 and 72 hours. Five yolks of each group were collected every 24 hours. These yolks were homogenized and centrifuged during 10 minutes. The supernatant was rejected. After the discard, PBS ph 7.2 was added and centrifuged again. The sediment obtained of each group was used for the extraction of bacterial genomic DNA. Silica particles and a commercial kit were utilized as the extraction methods. The extracted DNA was kept on a temperature of 20°C until the evaluation through PCR. The primers utilized were related with the invA gene and they were the following: 5’ GTA AAA TTA TCG CCA CGT TCG GGC AA 3’ and 5’ TCA TCG CAC CGT CAA AGG AAC C 3’. The amplification products were visualized in transilluminator with ultraviolet light. The obtained results through the bacterial DNA extractions demonstrated that the extraction method utilizing silica particles was

  18. Comparison of eight methods for the extraction of Bacillus atrophaeus spore DNA from eleven common interferents and a common swab.

    Directory of Open Access Journals (Sweden)

    Helen L Rose

    Full Text Available Eight DNA extraction products or methods (Applied Biosystems PrepFiler Forensic DNA Extraction Kit; Bio-Rad Instagene Only, Bio-Rad Instagene & Spin Column Purification; EpiCentre MasterPure DNA & RNA Kit; FujiFilm QuickGene Mini80; Idaho Technologies 1-2-3 Q-Flow Kit; MoBio UltraClean Microbial DNA Isolation Kit; Sigma Extract-N-Amp Plant and Seed Kit were adapted to facilitate extraction of DNA under BSL3 containment conditions. DNA was extracted from 12 common interferents or sample types, spiked with spores of Bacillus atropheaus. Resulting extracts were tested by real-time PCR. No one method was the best, in terms of DNA extraction, across all sample types. Statistical analysis indicated that the PrepFiler method was the best method from six dry powders (baking, biological washing, milk, plain flour, filler and talcum and one solid (Underarm deodorant, the UltraClean method was the best from four liquids (aftershave, cola, nutrient broth, vinegar, and the MasterPure method was the best from the swab sample type. The best overall method, in terms of DNA extraction, across all sample types evaluated was the UltraClean method.

  19. Evaluation of simplified dna extraction methods for EMM typing of group a streptococci

    Directory of Open Access Journals (Sweden)

    Jose JJM

    2006-01-01

    Full Text Available Simplified methods of DNA extraction for amplification and sequencing for emm typing of group A streptococci (GAS can save valuable time and cost in resource crunch situations. To evaluate this, we compared two methods of DNA extraction directly from colonies with the standard CDC cell lysate method for emm typing of 50 GAS strains isolated from children with pharyngitis and impetigo. For this, GAS colonies were transferred into two sets of PCR tubes. One set was preheated at 94oC for two minutes in the thermal cycler and cooled while the other set was frozen overnight at -20oC and then thawed before adding the PCR mix. For the cell lysate method, cells were treated with mutanolysin and hyaluronidase before heating at 100oC for 10 minutes and cooling immediately as recommended in the CDC method. All 50 strains could be typed by sequencing the hyper variable region of the emm gene after amplification. The quality of sequences and the emm types identified were also identical. Our study shows that the two simplified DNA extraction methods directly from colonies can conveniently be used for typing a large number of GAS strains easily in relatively short time.

  20. A simple and efficient total genomic DNA extraction method for individual zooplankton.

    Science.gov (United States)

    Fazhan, Hanafiah; Waiho, Khor; Shahreza, Md Sheriff

    2016-01-01

    Molecular approaches are widely applied in species identification and taxonomic studies of minute zooplankton. One of the most focused zooplankton nowadays is from Subclass Copepoda. Accurate species identification of all life stages of the generally small sized copepods through molecular analysis is important, especially in taxonomic and systematic assessment of harpacticoid copepod populations and to understand their dynamics within the marine community. However, total genomic DNA (TGDNA) extraction from individual harpacticoid copepods can be problematic due to their small size and epibenthic behavior. In this research, six TGDNA extraction methods done on individual harpacticoid copepods were compared. The first new simple, feasible, efficient and consistent TGDNA extraction method was designed and compared with the commercial kit and modified available TGDNA extraction methods. The newly described TGDNA extraction method, "Incubation in PCR buffer" method, yielded good and consistent results based on the high success rate of PCR amplification (82%) compared to other methods. Coupled with its relatively consistent and economical method the "Incubation in PCR buffer" method is highly recommended in the TGDNA extraction of other minute zooplankton species.

  1. Effect of DNA extraction methods and sampling techniques on the apparent structure of cow and sheep rumen microbial communities.

    Directory of Open Access Journals (Sweden)

    Gemma Henderson

    Full Text Available Molecular microbial ecology techniques are widely used to study the composition of the rumen microbiota and to increase understanding of the roles they play. Therefore, sampling and DNA extraction methods that result in adequate yields of microbial DNA that also accurately represents the microbial community are crucial. Fifteen different methods were used to extract DNA from cow and sheep rumen samples. The DNA yield and quality, and its suitability for downstream PCR amplifications varied considerably, depending on the DNA extraction method used. DNA extracts from nine extraction methods that passed these first quality criteria were evaluated further by quantitative PCR enumeration of microbial marker loci. Absolute microbial numbers, determined on the same rumen samples, differed by more than 100-fold, depending on the DNA extraction method used. The apparent compositions of the archaeal, bacterial, ciliate protozoal, and fungal communities in identical rumen samples were assessed using 454 Titanium pyrosequencing. Significant differences in microbial community composition were observed between extraction methods, for example in the relative abundances of members of the phyla Bacteroidetes and Firmicutes. Microbial communities in parallel samples collected from cows by oral stomach-tubing or through a rumen fistula, and in liquid and solid rumen digesta fractions, were compared using one of the DNA extraction methods. Community representations were generally similar, regardless of the rumen sampling technique used, but significant differences in the abundances of some microbial taxa such as the Clostridiales and the Methanobrevibacter ruminantium clade were observed. The apparent microbial community composition differed between rumen sample fractions, and Prevotellaceae were most abundant in the liquid fraction. DNA extraction methods that involved phenol-chloroform extraction and mechanical lysis steps tended to be more comparable. However

  2. Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

    Science.gov (United States)

    Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

    2016-01-01

    FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

  3. Repeated extraction of DNA from FTA cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Ferrero, Laura; Børsting, Claus

    2011-01-01

    Extraction of DNA using magnetic bead based techniques on automated DNA extraction instruments provides a fast, reliable and reproducible method for DNA extraction from various matrices. However, the yield of extracted DNA from FTA-cards is typically low. Here, we demonstrate that it is possible...... to repeatedly extract DNA from the processed FTA-disk. The method increases the yield from the nanogram range to the microgram range....

  4. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  5. Comparison of methods of DNA extraction for real-time PCR in a model of pleural tuberculosis.

    Science.gov (United States)

    Santos, Ana; Cremades, Rosa; Rodríguez, Juan Carlos; García-Pachón, Eduardo; Ruiz, Montserrat; Royo, Gloria

    2010-01-01

    Molecular methods have been reported to have different sensitivities in the diagnosis of pleural tuberculosis and this may in part be caused by the use of different methods of DNA extraction. Our study compares nine DNA extraction systems in an experimental model of pleural tuberculosis. An inoculum of Mycobacterium tuberculosis was added to 23 pleural liquid samples with different characteristics. DNA was subsequently extracted using nine different methods (seven manual and two automatic) for analysis with real-time PCR. Only two methods were able to detect the presence of M. tuberculosis DNA in all the samples: extraction using columns (Qiagen) and automated extraction with the TNAI system (Roche). The automatic method is more expensive, but requires less time. Almost all the false negatives were because of the difficulty involved in extracting M. tuberculosis DNA, as in general, all the methods studied are capable of eliminating inhibitory substances that block the amplification reaction. The method of M. tuberculosis DNA extraction used affects the results of the diagnosis of pleural tuberculosis by molecular methods. DNA extraction systems that have been shown to be effective in pleural liquid should be used.

  6. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  7. To beat or not to beat a tick: comparison of DNA extraction methods for ticks (Ixodes scapularis

    Directory of Open Access Journals (Sweden)

    Alyssa D. Ammazzalorso

    2015-08-01

    Full Text Available Background. Blacklegged ticks (Ixodes scapularis are important disease vectors in the United States, known to transmit a variety of pathogens to humans, including bacteria, protozoa, and viruses. Their importance as a disease vector necessitates reliable and comparable methods for extracting microbial DNA from ticks. Furthermore, to explore the population genetics or genomics of this tick, appropriate DNA extraction techniques are needed for both the vector and its microbes. Although a few studies have investigated different methods of DNA isolation from ticks, they are limited in the number and types of DNA extraction and lack species-specific quantification of DNA yield.Methods. Here we determined the most efficient and consistent method of DNA extraction from two different developmental stages of I. scapularis—nymph and adult—that are the most important for disease transmission. We used various methods of physical disruption of the hard, chitinous exoskeleton, as well as commercial and non-commercial DNA isolation kits. To gauge the effectiveness of these methods, we quantified the DNA yield and confirmed the DNA quality via PCR of both tick and microbial genetic material.Results. DNA extraction using the Thermo GeneJET Genomic DNA Purification Kit resulted in the highest DNA yields and the most consistent PCR amplification when combined with either cutting or bead beating with select matrices across life stages. DNA isolation methods using ammonium hydroxide as well as the MoBio PowerSoil kit also produced strong and successful PCR amplification, but only for females.Discussion. We contrasted a variety of readily available methods of DNA extraction from single individual blacklegged ticks and presented the results through a quantitative and qualitative assessment.

  8. Comparative analysis of environmental DNA extraction and purification methods from different humic acid rich soils

    CSIR Research Space (South Africa)

    Lakay, FM

    2007-01-01

    Full Text Available Three different soil DNA isolation and four purification strategies were compared on different soil samples with variable rates of success. Bead beating extraction gave significantly higher DNA yields than microwave-based and liquid nitrogen...

  9. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    NARCIS (Netherlands)

    Schwartz, A.; Baidjoe, A.Y.; Rosenthal, P.J.; Dorsey, G.; Bousema, T.; Greenhouse, B.

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We

  10. Microbial food safety: Potential of DNA extraction methods for use in diagnostic metagenomics

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Andersen, Sandra Christine; Christensen, Julia

    2015-01-01

    ) yielding protocols. The PowerLyzer PowerSoil DNA Isolation Kit performed significantly better than all other protocols tested. Selected protocols were modified, i.e., extended heating and homogenization, resulting in increased yields of total DNA. For QIAamp Fast DNA Stool Mini Kit (Qiagen) a 7-fold...... of the protocols to extract DNA was observed. The highest DNA yield was obtained with the PowerLyzer PowerSoil DNA Isolation Kit, whereas the FastDNA SPIN Kit for Feces (MP Biomedicals) resulted in the highest amount of PCR-amplifiable C. jejuni DNA....

  11. Establishing a novel automated magnetic bead-based method for the extraction of DNA from a variety of forensic samples.

    Science.gov (United States)

    Witt, Sebastian; Neumann, Jan; Zierdt, Holger; Gébel, Gabriella; Röscheisen, Christiane

    2012-09-01

    Automated systems have been increasingly utilized for DNA extraction by many forensic laboratories to handle growing numbers of forensic casework samples while minimizing the risk of human errors and assuring high reproducibility. The step towards automation however is not easy: The automated extraction method has to be very versatile to reliably prepare high yields of pure genomic DNA from a broad variety of sample types on different carrier materials. To prevent possible cross-contamination of samples or the loss of DNA, the components of the kit have to be designed in a way that allows for the automated handling of the samples with no manual intervention necessary. DNA extraction using paramagnetic particles coated with a DNA-binding surface is predestined for an automated approach. For this study, we tested different DNA extraction kits using DNA-binding paramagnetic particles with regard to DNA yield and handling by a Freedom EVO(®)150 extraction robot (Tecan) equipped with a Te-MagS magnetic separator. Among others, the extraction kits tested were the ChargeSwitch(®)Forensic DNA Purification Kit (Invitrogen), the PrepFiler™Automated Forensic DNA Extraction Kit (Applied Biosystems) and NucleoMag™96 Trace (Macherey-Nagel). After an extensive test phase, we established a novel magnetic bead extraction method based upon the NucleoMag™ extraction kit (Macherey-Nagel). The new method is readily automatable and produces high yields of DNA from different sample types (blood, saliva, sperm, contact stains) on various substrates (filter paper, swabs, cigarette butts) with no evidence of a loss of magnetic beads or sample cross-contamination. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  12. Evaluation of two methods DNA extraction from formalin-fixed, paraffin-embedded tissues on non-optimal conditions

    International Nuclear Information System (INIS)

    Bustamante, Javier Andres; Astudillo, Miryam; Pazos, Alvaro Jairo; Bravo, Luis Eduardo

    2011-01-01

    Paraffin wax embedded tissues are an invaluable material for retrospective studies requiring the application of molecular analysis. Multiple methods are available to extract DNA from these kinds of samples. However, the most common methods are slow and the reagents often contribute to the fragmentation of genetic material. In order to optimize the procedure, two methods for DNA extraction from paraffin embedded tissue non-optimal conditions were used. 47 blocks containing paraffin-embedded biopsies of pleura, lung and pericardium from 24 patients (66.6% males) older than 18 years, with biopsy proven chronic granulomatous inflammation referred to the department of pathology at University Hospital of Valle between 2002 and 2007 were selected. Each sample was subjected to 10 cuts and was to two methods of DNA extraction: 1. conventional and 2. QIAamp - DNA mini kit. The efficiency of the extracted DNA was assessed by spectrophotometry and PCR amplification of a fragment of the housekeeping gene GAPDH. The concentration of DNA samples extracted by the conventional method was of 65.52 ng/Mu l ± 11.47 (mean ± SE) and the 260/280 absorbance ratio ranged between 0.52 and 2.30 the average concentration of DNA of the samples extracted by the commercial method was 60.89 ng/Mu l ± 6.02 (mean ± SE), with an absorbance that fluctuated between 0 and 2.64. The DNA obtained was amplified by PCR, of 47 samples extracted by methods, 25 and 23 respectively the GAPDH gene amplified successfully. The methods used to obtain DNA showed similar performance, highlighting the potential utility of both extraction methods for the retrospective studies from paraffin embedded tissues in unsuitable conditions.

  13. A rapid and low-cost DNA extraction method for isolating ...

    African Journals Online (AJOL)

    user

    2011-02-21

    Feb 21, 2011 ... Available online at http://www.academicjournals.org/AJB ... α-casein, produces PCR ready DNA at a fraction of the cost of commercial DNA extraction kits. Key words: DNA .... This experiment was performed to evaluate the efficiency of the ..... Zoetendal EG, Ben-Amor K, Akkermans AD, Abee T, De Vos WM.

  14. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    Rapid DNA extraction is a prerequisite for molecular studies. Generally, plant tissue is ground in liquid nitrogen to isolate DNA; but, liquid nitrogen is dangerous and volatile. Besides, liquid nitrogen is not always available in many developing countries. To investigate if high quality DNA could be obtained for downstream ...

  15. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    Rhubarb is an important traditional Chinese herbal drug with high secondary metabolites that interfere with DNA extraction procedures and downstream applications, such as DNA restriction and amplification. An effective and low-cost protocol for isolating genomic DNA from root of Rheum tanguticum is described in this ...

  16. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Directory of Open Access Journals (Sweden)

    Christina Gill

    Full Text Available Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating prior to chemical and enzyme-based DNA extraction with a commercial kit.After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering.An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of

  17. Evaluation of Lysis Methods for the Extraction of Bacterial DNA for Analysis of the Vaginal Microbiota.

    Science.gov (United States)

    Gill, Christina; van de Wijgert, Janneke H H M; Blow, Frances; Darby, Alistair C

    2016-01-01

    Recent studies on the vaginal microbiota have employed molecular techniques such as 16S rRNA gene sequencing to describe the bacterial community as a whole. These techniques require the lysis of bacterial cells to release DNA before purification and PCR amplification of the 16S rRNA gene. Currently, methods for the lysis of bacterial cells are not standardised and there is potential for introducing bias into the results if some bacterial species are lysed less efficiently than others. This study aimed to compare the results of vaginal microbiota profiling using four different pretreatment methods for the lysis of bacterial samples (30 min of lysis with lysozyme, 16 hours of lysis with lysozyme, 60 min of lysis with a mixture of lysozyme, mutanolysin and lysostaphin and 30 min of lysis with lysozyme followed by bead beating) prior to chemical and enzyme-based DNA extraction with a commercial kit. After extraction, DNA yield did not significantly differ between methods with the exception of lysis with lysozyme combined with bead beating which produced significantly lower yields when compared to lysis with the enzyme cocktail or 30 min lysis with lysozyme only. However, this did not result in a statistically significant difference in the observed alpha diversity of samples. The beta diversity (Bray-Curtis dissimilarity) between different lysis methods was statistically significantly different, but this difference was small compared to differences between samples, and did not affect the grouping of samples with similar vaginal bacterial community structure by hierarchical clustering. An understanding of how laboratory methods affect the results of microbiota studies is vital in order to accurately interpret the results and make valid comparisons between studies. Our results indicate that the choice of lysis method does not prevent the detection of effects relating to the type of vaginal bacterial community one of the main outcome measures of epidemiological studies

  18. The effect of DNA extraction methods on observed microbial communities from fibrous and liquid rumen fractions of dairy cows

    NARCIS (Netherlands)

    Vaidya, Jueeli D.; Bogert, van den Bartholomeus; Boekhorst, Jos; Saccenti, Edoardo; Plugge, Caroline M.; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of

  19. A novel reliable method of DNA extraction from olive oil suitable for molecular traceability.

    Science.gov (United States)

    Raieta, Katia; Muccillo, Livio; Colantuoni, Vittorio

    2015-04-01

    Extra virgin olive oil production has a worldwide economic impact. The use of this brand, however, is of great concern to Institutions and private industries because of the increasing number of fraud and adulteration attempts to the market products. Here, we present a novel, reliable and not expensive method for extracting the DNA from commercial virgin and extra virgin olive oils. The DNA is stable overtime and amenable for molecular analyses; in fact, by carrying out simple sequence repeats (SSRs) markers analysis, we characterise the genetic profile of monovarietal olive oils. By comparing the oil-derived pattern with that of the corresponding tree, we can unambiguously identify four cultivars from Samnium, a region of Southern Italy, and distinguish them from reference and more widely used varieties. Through a parentage statistical analysis, we also identify the putative pollinators, establishing an unprecedented and powerful tool for olive oil traceability. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Extraction Methods, Variability Encountered in

    NARCIS (Netherlands)

    Bodelier, P.L.E.; Nelson, K.E.

    2014-01-01

    Synonyms Bias in DNA extractions methods; Variation in DNA extraction methods Definition The variability in extraction methods is defined as differences in quality and quantity of DNA observed using various extraction protocols, leading to differences in outcome of microbial community composition

  1. Human DNA Extraction by Two Extraction Methods for Forensic Typification from Human Feces on FTA Paper

    OpenAIRE

    Sandoval-Arias, Shirleny Monserrat

    2014-01-01

    La identificación de sospechosos en casos criminales se ha facilitado desde la aplicación de pruebas de ADN a diferentes muestras. El uso de esta técnica para la tipificación forense a partir de muestras fecales humanas aún presenta complicaciones, por lo que en esta investigación se evaluaron dos protocolos de extracción de ADN con ciertas modificaciones para determinar el de mayor efectividad. Se realizaron extracciones orgánicas y mediante el kit comercial “DNA IQTM Casework Sample Kit par...

  2. A rapid mini-prep DNA extraction method in rice (Oryza sativa)

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... homogenizer with a plastic tip is incomplete, since the leaves of these plants .... mortar and pestle with liquid nitrogen and transferred to a tube. ... rapid DNA extraction protocols for gymnosperms for application in population ...

  3. Optimization of conditions to extract high quality DNA for PCR analysis from whole blood using SDS-proteinase K method

    Directory of Open Access Journals (Sweden)

    Wajhul Qamar

    2017-11-01

    Full Text Available In case of studies associated with human genetics, genomics, and pharmacogenetics the genomic DNA is extracted from the buccal cells, whole blood etc. Several methods are exploited by the researchers to extract DNA from the whole blood. One of these methods, which utilizes cell lysis and proteolytic properties of sodium dodecyl sulfate (SDS and proteinase K respectively, might also be called SDS-PK method. It does not include any hazardous chemicals such as phenol or chloroform and is inexpensive. However, several researchers report the same method with different formulas and conditions. During our experiments with whole blood DNA extraction we experienced problems such as protein contamination, DNA purity and yield when followed some SDS-PK protocols reported elsewhere. A260/A280 and A260/A230 ratios along with PCR amplification give a clear idea about the procedure that was followed to extract the DNA. In an effort to increase the DNA purity from human whole blood, we pointed out some steps of the protocol that play a crucial role in determining the extraction of high quality DNA.

  4. Rapid and reliable high-throughput methods of DNA extraction for use in barcoding and molecular systematics of mushrooms.

    Science.gov (United States)

    Dentinger, Bryn T M; Margaritescu, Simona; Moncalvo, Jean-Marc

    2010-07-01

    We present two methods for DNA extraction from fresh and dried mushrooms that are adaptable to high-throughput sequencing initiatives, such as DNA barcoding. Our results show that these protocols yield ∼85% sequencing success from recently collected materials. Tests with both recent (100 years) specimens reveal that older collections have low success rates and may be an inefficient resource for populating a barcode database. However, our method of extracting DNA from herbarium samples using small amount of tissue is reliable and could be used for important historical specimens. The application of these protocols greatly reduces time, and therefore cost, of generating DNA sequences from mushrooms and other fungi vs. traditional extraction methods. The efficiency of these methods illustrates that standardization and streamlining of sample processing should be shifted from the laboratory to the field. © 2009 Blackwell Publishing Ltd.

  5. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Science.gov (United States)

    Yamagishi, Junya; Sato, Yukuto; Shinozaki, Natsuko; Ye, Bin; Tsuboi, Akito; Nagasaki, Masao; Yamashita, Riu

    2016-01-01

    The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field), QIAsymphony (a robotics method), and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  6. Comparison of Boiling and Robotics Automation Method in DNA Extraction for Metagenomic Sequencing of Human Oral Microbes.

    Directory of Open Access Journals (Sweden)

    Junya Yamagishi

    Full Text Available The rapid improvement of next-generation sequencing performance now enables us to analyze huge sample sets with more than ten thousand specimens. However, DNA extraction can still be a limiting step in such metagenomic approaches. In this study, we analyzed human oral microbes to compare the performance of three DNA extraction methods: PowerSoil (a method widely used in this field, QIAsymphony (a robotics method, and a simple boiling method. Dental plaque was initially collected from three volunteers in the pilot study and then expanded to 12 volunteers in the follow-up study. Bacterial flora was estimated by sequencing the V4 region of 16S rRNA following species-level profiling. Our results indicate that the efficiency of PowerSoil and QIAsymphony was comparable to the boiling method. Therefore, the boiling method may be a promising alternative because of its simplicity, cost effectiveness, and short handling time. Moreover, this method was reliable for estimating bacterial species and could be used in the future to examine the correlation between oral flora and health status. Despite this, differences in the efficiency of DNA extraction for various bacterial species were observed among the three methods. Based on these findings, there is no "gold standard" for DNA extraction. In future, we suggest that the DNA extraction method should be selected on a case-by-case basis considering the aims and specimens of the study.

  7. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows.

    Science.gov (United States)

    Vaidya, Jueeli D; van den Bogert, Bartholomeus; Edwards, Joan E; Boekhorst, Jos; van Gastelen, Sanne; Saccenti, Edoardo; Plugge, Caroline M; Smidt, Hauke

    2018-01-01

    DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF) and fibrous content (FC) fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini) differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100), 67% GS and 33% maize silage (GS67MS33), 33% GS and 67% MS (GS33MS67), or 100% MS (MS100). An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method ( p anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA) of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction ( p = 0.012), and that PBB ( p = 0.012) and FDSS ( p = 0.024) also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In summary, the comprehensive assessment of observed communities of bacteria, archaea and anaerobic fungi described here provides insight into a rational basis for selecting an optimal methodology to obtain a representative picture of the rumen microbiota.

  8. Improved Methods of Carnivore Faecal Sample Preservation, DNA Extraction and Quantification for Accurate Genotyping of Wild Tigers

    Science.gov (United States)

    Harika, Katakam; Mahla, Ranjeet Singh; Shivaji, Sisinthy

    2012-01-01

    Background Non-invasively collected samples allow a variety of genetic studies on endangered and elusive species. However due to low amplification success and high genotyping error rates fewer samples can be identified up to the individual level. Number of PCRs needed to obtain reliable genotypes also noticeably increase. Methods We developed a quantitative PCR assay to measure and grade amplifiable nuclear DNA in feline faecal extracts. We determined DNA degradation in experimentally aged faecal samples and tested a suite of pre-PCR protocols to considerably improve DNA retrieval. Results Average DNA concentrations of Grade I, II and III extracts were 982pg/µl, 9.5pg/µl and 0.4pg/µl respectively. Nearly 10% of extracts had no amplifiable DNA. Microsatellite PCR success and allelic dropout rates were 92% and 1.5% in Grade I, 79% and 5% in Grade II, and 54% and 16% in Grade III respectively. Our results on experimentally aged faecal samples showed that ageing has a significant effect on quantity and quality of amplifiable DNA (pDNA degradation occurs within 3 days of exposure to direct sunlight. DNA concentrations of Day 1 samples stored by ethanol and silica methods for a month varied significantly from fresh Day 1 extracts (p0.05). DNA concentrations of fresh tiger and leopard faecal extracts without addition of carrier RNA were 816.5pg/µl (±115.5) and 690.1pg/µl (±207.1), while concentrations with addition of carrier RNA were 49414.5pg/µl (±9370.6) and 20982.7pg/µl (±6835.8) respectively. Conclusions Our results indicate that carnivore faecal samples should be collected as freshly as possible, are better preserved by two-step method and should be extracted with addition of carrier RNA. We recommend quantification of template DNA as this facilitates several downstream protocols. PMID:23071624

  9. Selection of the most suitable method for the extraction of DNA from foods and feeds for species identification

    Directory of Open Access Journals (Sweden)

    Michaela Nesvadbová

    2010-01-01

    Full Text Available High quality and purity of DNA isolated from food and feed is essential for species identification and has unpredictable influences an effect of analysis. In this study, the efficiency of eight different methods for DNA isolation was investigated. For DNA extraction, the raw chicken meet, ham, sausages, tinned lunch meat, pate, tinned feeds for dogs, complete granulated feeds for dogs and chicken flour were used. Kits of several different producers, i.e.: NucleoSpin Food (Marchery-Nagel, Wizard Genomic DNA Purification Kit (Promega, Invisorb Spin Food Kit I (Invitek, Wizard SV Genomic DNA Purification System (Promega, JetQuick Tissue DNA Spin Kit (Genomed, RNA Blue (Top-Bio, JetQuick Blood & Cell Culture Kit (Genomed, QIAamp DNA Mini Kit and QIAamp DNA Blood Mini Kit (Qiagen were employed in the study. Gel agarose electrophoresis for primary verification of DNA quality was performed. The isolates were subsequently assessed for quantity and quality using by spectrophotometer Nanodrop 2000 (Thermo Scientific. To verify of template usability and quality of isolated DNA, the polymerase chain reaction (PCR was used.Differences between isolated DNA from tinned products and meat, ham, sausage, granulated dog feed and chicken flour were found. In tinned food and feed, the DNA was more degraded, DNA content and DNA purity was lower and also PCR amplification was the most difficult. Overall DNA yield and quality have important influence on PCR products amplification. The best results were obtained with NucleoSpin Food and JetQuick Tissue DNA Spin Kit. DNA extracted by these methods proved highest yields, purity and template quality in all foods and feeds and the results of PCR analysis are excellent reproducible. Analyses showed that results depended on different food or feed using and dif­fe­rent isolation system.The results of this work will be utilized to choose the suitable isolating kit for educational course, which is designed for students and

  10. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Science.gov (United States)

    Adamowicz, Michael S; Stasulli, Dominique M; Sobestanovich, Emily M; Bille, Todd W

    2014-01-01

    Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C) as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  11. Evaluation of methods to improve the extraction and recovery of DNA from cotton swabs for forensic analysis.

    Directory of Open Access Journals (Sweden)

    Michael S Adamowicz

    Full Text Available Samples for forensic DNA analysis are often collected from a wide variety of objects using cotton or nylon tipped swabs. Testing has shown that significant quantities of DNA are retained on the swab, however, and subsequently lost. When processing evidentiary samples, the recovery of the maximum amount of available DNA is critical, potentially dictating whether a usable profile can be derived from a piece of evidence or not. The QIAamp DNA Investigator extraction kit was used with its recommended protocol for swabs (one hour incubation at 56°C as a baseline. Results indicate that over 50% of the recoverable DNA may be retained on the cotton swab tip, or otherwise lost, for both blood and buccal cell samples when using this protocol. The protocol's incubation time and temperature were altered, as was incubating while shaking or stationary to test for increases in recovery efficiency. An additional step was then tested that included periodic re-suspension of the swab tip in the extraction buffer during incubation. Aliquots of liquid blood or a buccal cell suspension were deposited and dried on cotton swabs and compared with swab-less controls. The concentration of DNA in each extract was quantified and STR analysis was performed to assess the quality of the extracted DNA. Stationary incubations and those performed at 65°C did not result in significant gains in DNA yield. Samples incubated for 24 hours yielded less DNA. Increased yields were observed with three and 18 hour incubation periods. Increases in DNA yields were also observed using a swab re-suspension method for both cell types. The swab re-suspension method yielded an average two-fold increase in recovered DNA yield with buccal cells and an average three-fold increase with blood cells. These findings demonstrate that more of the DNA collected on swabs can be recovered with specific protocol alterations.

  12. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  13. The Effect of DNA Extraction Methods on Observed Microbial Communities from Fibrous and Liquid Rumen Fractions of Dairy Cows

    Directory of Open Access Journals (Sweden)

    Jueeli D. Vaidya

    2018-01-01

    Full Text Available DNA based methods have been widely used to study the complexity of the rumen microbiota, and it is well known that the method of DNA extraction is a critical step in enabling accurate assessment of this complexity. Rumen fluid (RF and fibrous content (FC fractions differ substantially in terms of their physical nature and associated microorganisms. The aim of this study was therefore to assess the effect of four DNA extraction methods (RBB, PBB, FDSS, PQIAmini differing in cell lysis and/or DNA recovery methods on the observed microbial diversity in RF and FC fractions using samples from four rumen cannulated dairy cows fed 100% grass silage (GS100, 67% GS and 33% maize silage (GS67MS33, 33% GS and 67% MS (GS33MS67, or 100% MS (MS100. An ANOVA statistical test was applied on DNA quality and yield measurements, and it was found that the DNA yield was significantly affected by extraction method (p < 0.001 and fraction (p < 0.001. The 260/280 ratio was not affected by extraction (p = 0.08 but was affected by fraction (p = 0.03. On the other hand, the 260/230 ratio was affected by extraction method (p < 0.001 but not affected by fraction (p = 0.8. However, all four extraction procedures yielded DNA suitable for further analysis of bacterial, archaeal and anaerobic fungal communities using quantitative PCR and pyrosequencing of relevant taxonomic markers. Redundancy analysis (RDA of bacterial 16S rRNA gene sequence data at the family level showed that there was a significant effect of rumen fraction (p = 0.012, and that PBB (p = 0.012 and FDSS (p = 0.024 also significantly contributed to explaining the observed variation in bacterial community composition. Whilst the DNA extraction method affected the apparent bacterial community composition, no single extraction method could be concluded to be ineffective. No obvious effect of DNA extraction method on the anaerobic fungi or archaea was observed, although fraction effects were evident for both. In

  14. An inexpensive and rapid method for extracting papilionoid genomic DNA from herbarium specimens.

    Science.gov (United States)

    Riahi, M; Zarre, S; Maassoumi, A A; Attar, F; Kazempour Osaloo, S

    2010-07-13

    Three DNA extraction protocols were compared for their ability to yield DNA from the leaves of herbarium specimens of nine species from nine genera of the Papilionoideae. We tested two protocols that use classic procedures for lysis and purification with cetyl trimethylammonium bromide (CTAB); a third protocol used a Nucleospin Plant kit. DNA obtained from all three procedures was quantified and tested by PCR. Test results indicated the superiority of one of the CTAB protocols. We made some modifications, developing a protocol that produced high-quality DNA from all nine species. The modification involved the use of a lower EDTA concentration (20 mM instead of 50 mM) and a higher beta-mercaptoethanol concentration (1% instead of 0.4%) in the extraction buffer. The modified protocol avoids the necessity for a second DNA precipitation step. This new CTAB protocol includes the use of 1.4 M NaCl, 20 mM EDTA and 1% beta-mercaptoethanol in the extraction; DNA precipitation time is reduced. A reduction in contaminating metabolites (such as PCR inhibitors) in the sample mixtures and lower costs for reagents are characteristics of this modified protocol; the cost of analysis per sample was lowered, compared to previous options. The quality of DNA was suitable for PCR amplification. This is a practical alternative to more difficult, time-consuming and expensive protocols.

  15. Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1

    Science.gov (United States)

    Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.

    2017-01-01

    Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056

  16. Automated extraction of DNA from clothing

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin Benn; Nøhr Hansen, Thomas

    2011-01-01

    Presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. We have compared three automated DNA extraction methods based on magnetic beads with a manual method with the aim of reducing...

  17. DNA extraction from herbarium specimens.

    Science.gov (United States)

    Drábková, Lenka Záveská

    2014-01-01

    With the expansion of molecular techniques, the historical collections have become widely used. Studying plant DNA using modern molecular techniques such as DNA sequencing plays an important role in understanding evolutionary relationships, identification through DNA barcoding, conservation status, and many other aspects of plant biology. Enormous herbarium collections are an important source of material especially for specimens from areas difficult to access or from taxa that are now extinct. The ability to utilize these specimens greatly enhances the research. However, the process of extracting DNA from herbarium specimens is often fraught with difficulty related to such variables as plant chemistry, drying method of the specimen, and chemical treatment of the specimen. Although many methods have been developed for extraction of DNA from herbarium specimens, the most frequently used are modified CTAB and DNeasy Plant Mini Kit protocols. Nine selected protocols in this chapter have been successfully used for high-quality DNA extraction from different kinds of plant herbarium tissues. These methods differ primarily with respect to their requirements for input material (from algae to vascular plants), type of the plant tissue (leaves with incrustations, sclerenchyma strands, mucilaginous tissues, needles, seeds), and further possible applications (PCR-based methods or microsatellites, AFLP).

  18. Evaluation and In-House Validation of Five DNA Extraction Methods for PCR-based STR Analysis of Bloodstained Denims

    Directory of Open Access Journals (Sweden)

    Henry Perdigon

    2004-06-01

    Full Text Available One type of crime scene evidence commonly submitted for analysis is bloodstain on denim. However, chemicals (e.g., indigo used to produce denim materials may co-purify with DNA and hence, affect subsequent DNA analysis. The present study compared five methods (e.g., standard organic, organic with hydrogen peroxide (H2O2, modified FTA™, organic/Chelex®-Centricon®, and QIAamp® DNA Mini Kit-based procedures for the isolation of blood DNA from denim. A Short Tandem Repeat (STR-based analysis across two to nine STR markers, namely, HUMvWA, HUMTH01, D8S306, HUMFES/FPS, HUMDHFRP2, HUMF13A01, HUMFGA, HUMTPOX, and HUMCSF1PO, was used to evaluate successful amplification of blood DNA extracted from light indigo, dark indigo, indigo-sulfur, pure indigo, sulfur-top, and sulfur-bottom denim materials. The results of the present study support the utility of organic/Chelex®-Centricon® and QIAamp® Kit procedures in extracting PCR-amplifiable DNA from five different types of denim materials for STR analysis. Furthermore, a solid-based method using FTA™ classic cards was modified to provide a simple, rapid, safe, and cost-effective procedure for extracting blood DNA from light, dark indigo and pure indigo denim materials. However, DNA eluted from bloodstained sulfur-dyed denims (e.g., sulfur-top and sulfur-bottom using FTA™ procedure was not readily amplifiable.

  19. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences.

    Science.gov (United States)

    Wagner Mackenzie, Brett; Waite, David W; Taylor, Michael W

    2015-01-01

    The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation) were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation), with a smaller proportion of variation associated with DNA extraction method (technical variation) and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  20. Evaluating variation in human gut microbiota profiles due to DNA extraction method and inter-subject differences

    Directory of Open Access Journals (Sweden)

    Brett eWagner Mackenzie

    2015-02-01

    Full Text Available The human gut contains dense and diverse microbial communities which have profound influences on human health. Gaining meaningful insights into these communities requires provision of high quality microbial nucleic acids from human fecal samples, as well as an understanding of the sources of variation and their impacts on the experimental model. We present here a systematic analysis of commonly used microbial DNA extraction methods, and identify significant sources of variation. Five extraction methods (Human Microbiome Project protocol, MoBio PowerSoil DNA Isolation Kit, QIAamp DNA Stool Mini Kit, ZR Fecal DNA MiniPrep, phenol:chloroform-based DNA isolation were evaluated based on the following criteria: DNA yield, quality and integrity, and microbial community structure based on Illumina amplicon sequencing of the V4 region of bacterial and archaeal 16S rRNA genes. Our results indicate that the largest portion of variation within the model was attributed to differences between subjects (biological variation, with a smaller proportion of variation associated with DNA extraction method (technical variation and intra-subject variation. A comprehensive understanding of the potential impact of technical variation on the human gut microbiota will help limit preventable bias, enabling more accurate diversity estimates.

  1. Evaluation of three methods of DNA extraction from paraffin-embedded material for the amplification of genomic DNA by means of the PCR technique

    Directory of Open Access Journals (Sweden)

    MESQUITA Ricardo Alves

    2001-01-01

    Full Text Available There are several protocols reported in the literature for the extraction of genomic DNA from formalin-fixed paraffin-embedded samples. Genomic DNA is utilized in molecular analyses, including PCR. This study compares three different methods for the extraction of genomic DNA from formalin-fixed paraffin-embedded (inflammatory fibrous hyperplasia and non-formalin-fixed (normal oral mucosa samples: phenol with enzymatic digestion, and silica with and without enzymatic digestion. The amplification of DNA by means of the PCR technique was carried out with primers for the exon 7 of human keratin type 14. Amplicons were analyzed by means of electrophoresis in an 8% polyacrylamide gel with 5% glycerol, followed by silver-staining visualization. The phenol/enzymatic digestion and the silica/enzymatic digestion methods provided amplicons from both tissue samples. The method described is a potential aid in the establishment of the histopathologic diagnosis and in retrospective studies with archival paraffin-embedded samples.

  2. A new method to extract dental pulp DNA: application to universal detection of bacteria.

    Directory of Open Access Journals (Sweden)

    Lam Tran-Hung

    Full Text Available BACKGROUND: Dental pulp is used for PCR-based detection of DNA derived from host and bacteremic microorganims. Current protocols require odontology expertise for proper recovery of the dental pulp. Dental pulp specimen exposed to laboratory environment yields contaminants detected using universal 16S rDNA-based detection of bacteria. METHODOLOGY/PRINCIPAL FINDINGS: We developed a new protocol by encasing decontaminated tooth into sterile resin, extracting DNA into the dental pulp chamber itself and decontaminating PCR reagents by filtration and double restriction enzyme digestion. Application to 16S rDNA-based detection of bacteria in 144 teeth collected in 86 healthy people yielded a unique sequence in only 14 teeth (9.7% from 12 individuals (14%. Each individual yielded a unique 16S rDNA sequence in 1-2 teeth per individual. Negative controls remained negative. Bacterial identifications were all confirmed by amplification and sequencing of specific rpoB sequence. CONCLUSIONS/SIGNIFICANCE: The new protocol prevented laboratory contamination of the dental pulp. It allowed the detection of bacteria responsible for dental pulp colonization from blood and periodontal tissue. Only 10% such samples contained 16S rDNA. It provides a new tool for the retrospective diagnostic of bacteremia by allowing the universal detection of bacterial DNA in animal and human, contemporary or ancient tooth. It could be further applied to identification of host DNA in forensic medicine and anthropology.

  3. Comparison of four DNA extraction methods for the detection of Mycobacterium leprae from Ziehl-Neelsen-stained microscopic slides.

    Science.gov (United States)

    Ruiz-Fuentes, Jenny Laura; Díaz, Alexis; Entenza, Anayma Elena; Frión, Yahima; Suárez, Odelaisy; Torres, Pedro; de Armas, Yaxsier; Acosta, Lucrecia

    2015-12-01

    The diagnosis of leprosy has been a challenge due to the low sensibility of the conventional methods and the impossibility of culturing the causative organism. In this study, four methods for Mycobacterium leprae nucleic-acid extraction from Ziehl-Neelsen-stained slides (ZNS slides) were compared: Phenol/chloroform, Chelex 100 resin, and two commercial kits (Wizard Genomic DNA Purification Kit and QIAamp DNA Mini Kit). DNA was extracted from four groups of slides: a high-codification-slide group (bacteriological index [BI]⩾4), a low-codification-slide group (BI=1), a negative-slide group (BI=0), and a negative-control-slide group (BI=0). Quality DNA was evidenced by the amplification of specific repetitive element present in M. leprae genomic DNA (RLEP) using a nested polymerase chain reaction. This is the first report comparing four different extraction methods for obtaining M. leprae DNA from ZNS slides in Cuban patients, and applied in molecular diagnosis. Good-quality DNA and positive amplification were detected in the high-codification-slide group with the four methods, while from the low-codification-slide group only the QIAGEN and phenol-chloroform methods obtained amplification of M. leprae. In the negative-slide group, only the QIAGEN method was able to obtain DNA with sufficient quality for positive amplification of the RLEP region. No amplification was observed in the negative-control-slide group by any method. Patients with ZNS negative slides can still transmit the infection, and molecular methods can help identify and treat them, interrupting the chain of transmission and preventing the onset of disabilities. The ZNS slides can be sent easily to reference laboratories for later molecular analysis that can be useful not only to improve the diagnosis, but also for the application of other molecular techniques. Copyright © 2015 Asian-African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  4. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  5. Efficiency of boiling and four other methods for genomic DNA extraction of deteriorating spore-forming bacteria from milk

    Directory of Open Access Journals (Sweden)

    Jose Carlos Ribeiro Junior

    2016-10-01

    Full Text Available The spore-forming microbiota is mainly responsible for the deterioration of pasteurized milk with long shelf life in the United States. The identification of these microorganisms, using molecular tools, is of particular importance for the maintenance of the quality of milk. However, these molecular techniques are not only costly but also labor-intensive and time-consuming. The aim of this study was to compare the efficiency of boiling in conjunction with four other methods for the genomic DNA extraction of sporulated bacteria with proteolytic and lipolytic potential isolated from raw milk in the states of Paraná and Maranhão, Brazil. Protocols based on cellular lysis by enzymatic digestion, phenolic extraction, microwave-heating, as well as the use of guanidine isothiocyanate were used. This study proposes a method involving simple boiling for the extraction of genomic DNA from these microorganisms. Variations in the quality and yield of the extracted DNA among these methods were observed. However, both the cell lysis protocol by enzymatic digestion (commercial kit and the simple boiling method proposed in this study yielded sufficient DNA for successfully carrying out the Polymerase Chain Reaction (PCR of the rpoB and 16S rRNA genes for all 11 strains of microorganisms tested. Other protocols failed to yield sufficient quantity and quality of DNA from all microorganisms tested, since only a few strains have showed positive results by PCR, thereby hindering the search for new microorganisms. Thus, the simple boiling method for DNA extraction from sporulated bacteria in spoiled milk showed the same efficacy as that of the commercial kit. Moreover, the method is inexpensive, easy to perform, and much less time-consuming.

  6. A simple method for extracting DNA from rhododendron plants infected with Phytophthora spp. for use in PCR

    Directory of Open Access Journals (Sweden)

    Trzewik Aleksandra

    2016-01-01

    Full Text Available Among the numerous protocols that describe the extraction of DNA, those relating to the isolation of DNA from infected plants, are rare. This study describes a rapid and reliable method of extracting a high quality and quantity of DNA from rhododendron leaves artificially infected with Phytophthora cactorum, P. cambivora, P. cinnamomi, P. citrophthora, and P. plurivora. The use of the modified Doyle and Doyle protocol (1987 allowed us to obtain high quantity and quality DNA (18.26 μg from 100 mg of the fresh weight of infected leaves at the ratios of A260/280 and A260/230 - 1.83 and 1.72, respectively, suitable for conventional polymerase chain reaction (PCR and real-time PCR amplifications.

  7. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    Science.gov (United States)

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  8. Evaluation of five DNA extraction methods for purification of DNA from atherosclerotic tissue and estimation of prevalence of Chlamydia pneumoniae in tissue from a Danish population undergoing vascular repair

    Directory of Open Access Journals (Sweden)

    Lindholt Jes S

    2003-09-01

    Full Text Available Abstract Background To date PCR detection of Chlamydia pneumoniae DNA in atherosclerotic lesions from Danish patients has been unsuccessful. To establish whether non-detection was caused by a suboptimal DNA extraction method, we tested five different DNA extraction methods for purification of DNA from atherosclerotic tissue. Results The five different DNA extraction methods were tested on homogenate of atherosclerotic tissue spiked with C. pneumoniae DNA or EB, on pure C. pneumoniae DNA samples and on whole C. pneumoniae EB. Recovery of DNA was measured with a C. pneumoniae-specific quantitative real-time PCR. A DNA extraction method based on DNA-binding to spin columns with a silica-gel membrane (DNeasy Tissue kit showed the highest recovery rate for the tissue samples and pure DNA samples. However, an automated extraction method based on magnetic glass particles (MagNA Pure performed best on intact EB and atherosclerotic tissue spiked with EB. The DNeasy Tissue kit and MagNA Pure methods and the highly sensitive real-time PCR were subsequently used on 78 atherosclerotic tissue samples from Danish patients undergoing vascular repair. None of the samples were positive for C. pneumoniae DNA. The atherosclerotic samples were tested for inhibition by spiking with two different, known amounts of C. pneumoniae DNA and no samples showed inhibition. Conclusion As a highly sensitive PCR method and an optimised DNA extraction method were used, non-detection in atherosclerotic tissue from the Danish population was probably not caused by use of inappropriate methods. However, more samples may need to be analysed per patient to be completely certain on this. Possible methodological and epidemiological reasons for non-detection of C. pneumoniae DNA in atherosclerotic tissue from the Danish population are discussed. Further testing of DNA extraction methods is needed as this study has shown considerable intra- and inter-method variation in DNA recovery.

  9. A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR.

    Science.gov (United States)

    Li, M; Ishiguro, Y; Kageyama, K; Zhu, Z

    2015-08-01

    Most of the current research into the quantification of soil-borne pathogenic oomycetes lacks determination of DNA extraction efficiency, probably leading to an incorrect estimation of DNA quantity. In this study, we developed a convenient method by using a 100 bp artificially synthesized DNA sequence derived from the mitochondrion NADH dehydrogenase subunit 2 gene of Thunnus thynnus as a control to determine the DNA extraction efficiency. The control DNA was added to soils and then co-extracted along with soil genomic DNA. DNA extraction efficiency was determined by the control DNA. Two different DNA extraction methods were compared and evaluated using different types of soils, and the commercial kit was proved to give more consistent results. We used the control DNA combined with real-time PCR to quantify the oomycete DNAs from 12 naturally infested soils. Detectable target DNA concentrations were three to five times higher after normalization. Our tests also showed that the extraction efficiencies varied on a sample-to-sample basis and were simple and useful for the accurate quantification of soil-borne pathogenic oomycetes. Oomycetes include many important plant pathogens. Accurate quantification of these pathogens is essential in the management of diseases. This study reports an easy method utilizing an external DNA control for the normalization of DNA extraction by real-time PCR. By combining two different efficient soil DNA extraction methods, the developed quantification method dramatically improved the results. This study also proves that the developed normalization method is necessary and useful for the accurate quantification of soil-borne plant pathogenic oomycetes. © 2015 The Society for Applied Microbiology.

  10. A simple and cost-effective method of DNA extraction from small formalin-fixed paraffin-embedded tissue for molecular oncologic testing.

    Science.gov (United States)

    Snow, Anthony N; Stence, Aaron A; Pruessner, Jonathan A; Bossler, Aaron D; Ma, Deqin

    2014-01-01

    Extraction of DNA from formalin-fixed, paraffin-embedded (FFPE) tissue is a critical step in molecular oncologic testing. As molecular oncology testing becomes more important for prognostic and therapeutic decision making and tissue specimens become smaller due to earlier detection of suspicious lesions and the use of fine needle aspiration methods for tissue collection, it becomes more challenging for the typical molecular pathology laboratory to obtain reliable test results. We developed a DNA extraction method to obtain sufficient quantity and high quality genomic DNA from limited FFPE tissue for molecular oncology testing using a combination of H&E stained slides, a matrix capture method and the Qiagen DNA column. THREE DNA EXTRACTION METHODS WERE COMPARED: our standard procedure of manually scraping tissue from unstained slides followed by DNA extraction using the QIAamp FFPE column (Qiagen, Valencia, CA), a glue capture method (Pinpoint Solution, Zymo Research Corp, Inc) on H&E stained slides followed by DNA extraction using either the QIAamp column or the column included with the Pinpoint kit (Zymo Research). The DNA extraction protocol was optimized. Statistical analysis was performed using the paired two-sample student's t-test. The combination of the matrix capture method with the QIAamp column gave an equivalent amount of DNA as our standard extraction method using the unstained slides and a 4.6-fold higher DNA yield than using the Zymo column included in the Pinpoint Slide Solution kit. Several molecular tests were performed and DNA purified using the new method gave the same results as for the previous methods. Using H&E stained slides allows visual confirmation of tumor cells during microdissection. The Pinpoint solution made removal of specific tissue from the slides easier and reduced the risk of contamination and tissue loss. This DNA extraction method is simple, cost-effective, and blends with our current workflow requiring no additional equipment.

  11. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Directory of Open Access Journals (Sweden)

    Žel Jana

    2006-08-01

    Full Text Available Abstract Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was

  12. Critical points of DNA quantification by real-time PCR--effects of DNA extraction method and sample matrix on quantification of genetically modified organisms.

    Science.gov (United States)

    Cankar, Katarina; Stebih, Dejan; Dreo, Tanja; Zel, Jana; Gruden, Kristina

    2006-08-14

    Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary criterion by which to

  13. Critical points of DNA quantification by real-time PCR – effects of DNA extraction method and sample matrix on quantification of genetically modified organisms

    Science.gov (United States)

    Cankar, Katarina; Štebih, Dejan; Dreo, Tanja; Žel, Jana; Gruden, Kristina

    2006-01-01

    Background Real-time PCR is the technique of choice for nucleic acid quantification. In the field of detection of genetically modified organisms (GMOs) quantification of biotech products may be required to fulfil legislative requirements. However, successful quantification depends crucially on the quality of the sample DNA analyzed. Methods for GMO detection are generally validated on certified reference materials that are in the form of powdered grain material, while detection in routine laboratories must be performed on a wide variety of sample matrixes. Due to food processing, the DNA in sample matrixes can be present in low amounts and also degraded. In addition, molecules of plant origin or from other sources that affect PCR amplification of samples will influence the reliability of the quantification. Further, the wide variety of sample matrixes presents a challenge for detection laboratories. The extraction method must ensure high yield and quality of the DNA obtained and must be carefully selected, since even components of DNA extraction solutions can influence PCR reactions. GMO quantification is based on a standard curve, therefore similarity of PCR efficiency for the sample and standard reference material is a prerequisite for exact quantification. Little information on the performance of real-time PCR on samples of different matrixes is available. Results Five commonly used DNA extraction techniques were compared and their suitability for quantitative analysis was assessed. The effect of sample matrix on nucleic acid quantification was assessed by comparing 4 maize and 4 soybean matrixes. In addition 205 maize and soybean samples from routine analysis were analyzed for PCR efficiency to assess variability of PCR performance within each sample matrix. Together with the amount of DNA needed for reliable quantification, PCR efficiency is the crucial parameter determining the reliability of quantitative results, therefore it was chosen as the primary

  14. A sensitive method to extract DNA from biological traces present on ammunition for the purpose of genetic profiling.

    Science.gov (United States)

    Dieltjes, Patrick; Mieremet, René; Zuniga, Sofia; Kraaijenbrink, Thirsa; Pijpe, Jeroen; de Knijff, Peter

    2011-07-01

    Exploring technological limits is a common practice in forensic DNA research. Reliable genetic profiling based on only a few cells isolated from trace material retrieved from a crime scene is nowadays more and more the rule rather than the exception. On many crime scenes, cartridges, bullets, and casings (jointly abbreviated as CBCs) are regularly found, and even after firing, these potentially carry trace amounts of biological material. Since 2003, the Forensic Laboratory for DNA Research is routinely involved in the forensic investigation of CBCs in the Netherlands. Reliable DNA profiles were frequently obtained from CBCs and used to match suspects, victims, or other crime scene-related DNA traces. In this paper, we describe the sensitive method developed by us to extract DNA from CBCs. Using PCR-based genotyping of autosomal short tandem repeats, we were able to obtain reliable and reproducible DNA profiles in 163 out of 616 criminal cases (26.5%) and in 283 out of 4,085 individual CBC items (6.9%) during the period January 2003-December 2009. We discuss practical aspects of the method and the sometimes unexpected effects of using cell lysis buffer on the subsequent investigation of striation patterns on CBCs.

  15. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food.

    Science.gov (United States)

    Pacheco Coello, Ricardo; Pestana Justo, Jorge; Factos Mendoza, Andrés; Santos Ordoñez, Efrén

    2017-12-20

    In Ecuador, food products need to be labeled if exceeded 0.9% of transgenic content in whole products. For the detection of genetically modified organisms (GMOs), three DNA extraction methods were tested in 35 food products commercialized in Ecuador. Samples with positive amplification of endogenous genes were screened for the presence of the Cauliflower mosaic virus 35S-promoter (P35S) and the nopaline synthase-terminator (Tnos). TaqMan™ probes were used for determination of transgenic content of the GTS 40-3-2 and MON810 events through quantitative PCR (qPCR). Twenty-six processed food samples were positive for the P35S alone and eight samples for the Tnos and P35S. Absolute qPCR results indicated that eleven samples were positive for GTS 40-3-2 specific event and two for MON810 specific event. A total of nine samples for events GTS 40-3-2 and MON810 exceeded the umbral allowed of transgenic content in the whole food product with the specific events. Different food products may require different DNA extraction protocols for GMO detection through PCR. Among the three methods tested, the DNeasy mericon food kit DNA extraction method obtained higher proportion of amplified endogenous genes through PCR. Finally, event-specific GMOs were detected in food products in Ecuador.

  16. Comparison of Methods of Extracting Salmonella enterica Serovar Enteritidis DNA from Environmental Substrates and Quantification of Organisms by Using a General Internal Procedural Control

    NARCIS (Netherlands)

    Klerks, M.M.; Bruggen, van A.H.C.; Zijlstra, C.; Donnikov, M.; Vos, de R.

    2006-01-01

    This paper compares five commercially available DNA extraction methods with respect to DNA extraction efficiency of Salmonella enterica serovar Enteritidis from soil, manure, and compost and uses an Escherichia coli strain harboring a plasmid expressing green fluorescent protein as a general

  17. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods.

    Science.gov (United States)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N; Hoflund, Anders; Mogensen, Helle S; Hansen, Anders J; Morling, Niels

    2013-05-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors that may be co-extracted with the DNA. Using 120 forensic trace evidence samples consisting of various types of fabric, we compared three automated DNA extraction methods based on magnetic beads (PrepFiler Express Forensic DNA Extraction Kit on an AutoMate Express, QIAsyphony DNA Investigator kit either with the sample pre-treatment recommended by Qiagen or an in-house optimized sample pre-treatment on a QIAsymphony SP) and one manual method (Chelex) with the aim of reducing the amount of PCR inhibitors in the DNA extracts and increasing the proportion of reportable STR-profiles. A total of 480 samples were processed. The highest DNA recovery was obtained with the PrepFiler Express kit on an AutoMate Express while the lowest DNA recovery was obtained using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen. Extraction using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen resulted in the lowest percentage of PCR inhibition (0%) while extraction using manual Chelex resulted in the highest percentage of PCR inhibition (51%). The largest number of reportable STR-profiles was obtained with DNA from samples extracted with the PrepFiler Express kit (75%) while the lowest number was obtained with DNA from samples extracted using a QIAsymphony SP with the sample pre-treatment recommended by Qiagen (41%). Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Extraction method

    International Nuclear Information System (INIS)

    Stary, J.; Kyrs, M.; Navratil, J.; Havelka, S.; Hala, J.

    1975-01-01

    Definitions of the basic terms and of relations are given and the knowledge is described of the possibilities of the extraction of elements, oxides, covalent-bound halogenides and heteropolyacids. Greatest attention is devoted to the detailed analysis of the extraction of chelates and ion associates using diverse agents. For both types of compounds detailed conditions are given of the separation and the effects of the individual factors are listed. Attention is also devoted to extractions using mixtures of organic agents, the synergic effects thereof, and to extractions in non-aqueous solvents. The effects of radiation on extraction and the main types of apparatus used for extractions carried out in the laboratory are described. (L.K.)

  19. Influence of DNA extraction methods, PCR inhibitors and quantification methods on real-time PCR assay of biotechnology-derived traits.

    Science.gov (United States)

    Demeke, Tigst; Jenkins, G Ronald

    2010-03-01

    Biotechnology-derived varieties of canola, cotton, corn and soybean are being grown in the USA, Canada and other predominantly grain exporting countries. Although the amount of farmland devoted to production of biotechnology-derived crops continues to increase, lingering concerns that unintended consequences may occur provide the EU and most grain-importing countries with justification to regulate these crops. Legislation in the EU requires traceability of grains/oilseeds, food and feed products, and labelling, when a threshold level of 0.9% w/w of genetically engineered trait is demonstrated to be present in an analytical sample. The GE content is routinely determined by quantitative PCR (qPCR) and plant genomic DNA provides the template for the initial steps in this process. A plethora of DNA extraction methods exist for qPCR applications. Implementing standardized methods for detection of genetically engineered traits is necessary to facilitate grain marketing. The International Organization for Standardization draft standard 21571 identifies detergent-based methods and commercially available kits that are widely used for DNA extraction, but also indicates that adaptations may be necessary depending upon the sample matrix. This review assesses advantages and disadvantages of various commercially available DNA extraction kits, as well as modifications to published cetyltrimethylammonium bromide methods. Inhibitors are a major obstacle for efficient amplification in qPCR. The types of PCR inhibitors and techniques to minimize inhibition are discussed. Finally, accurate quantification of DNA for applications in qPCR is not trivial. Many confounders contribute to differences in analytical measurements when a particular DNA quantification method is applied and different methods do not always provide concordant results on the same DNA sample. How these differences impact measurement uncertainty in qPCR is considered.

  20. The currently used commercial DNA-extraction methods give different results of clostridial and actinobacterial populations derived from human fecal samples.

    Science.gov (United States)

    Maukonen, Johanna; Simões, Catarina; Saarela, Maria

    2012-03-01

    Recently several human health-related microbiota studies have had partly contradictory results. As some differences may be explained by methodologies applied, we evaluated how different storage conditions and commonly used DNA-extraction kits affect bacterial composition, diversity, and numbers of human fecal microbiota. According to our results, the DNA-extraction did not affect the diversity, composition, or quantity of Bacteroides spp., whereas after a week's storage at -20 °C, the numbers of Bacteroides spp. were 1.6-2.5 log units lower (P Eubacterium rectale (Erec)-group, Clostridium leptum group, bifidobacteria, and Atopobium group were 0.5-4 log units higher (P < 0.05) after mechanical DNA-extraction as detected with qPCR, regardless of storage. Furthermore, the bacterial composition of Erec-group differed significantly after different DNA-extractions; after enzymatic DNA-extraction, the most prevalent genera detected were Roseburia (39% of clones) and Coprococcus (10%), whereas after mechanical DNA-extraction, the most prevalent genera were Blautia (30%), Coprococcus (13%), and Dorea (10%). According to our results, rigorous mechanical lysis enables detection of higher bacterial numbers and diversity from human fecal samples. As it was shown that the results of clostridial and actinobacterial populations are highly dependent on the DNA-extraction methods applied, the use of different DNA-extraction protocols may explain the contradictory results previously obtained. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  1. Validation of a DNA IQ-based extraction method for TECAN robotic liquid handling workstations for processing casework.

    Science.gov (United States)

    Frégeau, Chantal J; Lett, C Marc; Fourney, Ron M

    2010-10-01

    A semi-automated DNA extraction process for casework samples based on the Promega DNA IQ™ system was optimized and validated on TECAN Genesis 150/8 and Freedom EVO robotic liquid handling stations configured with fixed tips and a TECAN TE-Shake™ unit. The use of an orbital shaker during the extraction process promoted efficiency with respect to DNA capture, magnetic bead/DNA complex washes and DNA elution. Validation studies determined the reliability and limitations of this shaker-based process. Reproducibility with regards to DNA yields for the tested robotic workstations proved to be excellent and not significantly different than that offered by the manual phenol/chloroform extraction. DNA extraction of animal:human blood mixtures contaminated with soil demonstrated that a human profile was detectable even in the presence of abundant animal blood. For exhibits containing small amounts of biological material, concordance studies confirmed that DNA yields for this shaker-based extraction process are equivalent or greater to those observed with phenol/chloroform extraction as well as our original validated automated magnetic bead percolation-based extraction process. Our data further supports the increasing use of robotics for the processing of casework samples. Crown Copyright © 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  2. Whole genome amplification of Chelex-extracted DNA from a single mite: a method for studying genetics of the predatory mite Phytoseiulus persimilis.

    Science.gov (United States)

    Konakandla, Bhanu; Park, Yoonseong; Margolies, David

    2006-01-01

    We developed and optimized a method using Chelex DNA extraction followed by whole genome amplification (WGA) to overcome problems conducting molecular genetic studies due to the limited amount of DNA obtainable from individual small organisms such as predatory mites. The DNA from a single mite, Phytoseiulus persimilis Athias-Henrot (Acari: Phytoseiidae), isolated in Chelex suspension was subjected to WGA. More than 1000-fold amplification of the DNA was achieved using as little as 0.03 ng genomic DNA template. The DNA obtained by the WGA was used for polymerase chain reaction followed by direct sequencing. From WGA DNA, nuclear DNA intergenic spacers ITS1 and ITS2 and a mitochondrial DNA 12S marker were tested in three different geographical populations of the predatory mite: California, the Netherlands, and Sicily. We found a total of four different alleles of the 12S in the Sicilian population, but no polymorphism was identified in the ITS marker. The combination of Chelex DNA extraction and WGA is thus shown to be a simple and robust technique for examining molecular markers for multiple loci by using individual mites. We conclude that the methods, Chelex extraction of DNA followed by WGA, provide a large quantity of DNA template that can be used for multiple PCR reactions useful for genetic studies requiring the genotypes of individual mites.

  3. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Science.gov (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  4. Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae)

    OpenAIRE

    Waldschmidt, Ana Maria; Salomão, Tânia Maria Fernandes; Barros, Everaldo Gonçalves de; Campos, Lúcio de Antônio Oliveira

    1997-01-01

    The objective of the present study was to test three different procedures for DNA extraction of Melipona quadrifasciata based on existing methods for DNA extraction of Apis, plants and fungi. These methods differ in the concentrations of specific substances in the extraction buffer. The results demonstrate that the method used for Apis is not adequate for DNA extraction from M. quadrifasciata. On the other hand, with minor modifications this method and the methods for plants and fungi were ad...

  5. Effect of DNA extraction and sample preservation method on rumen bacterial population

    Czech Academy of Sciences Publication Activity Database

    Fliegerová, Kateřina; Tapio, I.; Bonin, A.; Mrázek, Jakub; Callegari, M. L.; Bani, P.; Bayat, A.; Vilkki, J.; Kopečný, Jan; Shingfield, K.; Boyer, F.; Coissac, E.; Taberlet, P.; Wallace, R. J.

    2014-01-01

    Roč. 29, č. 1 (2014), s. 80-84 ISSN 1075-9964. [International Symposium on Anaerobic Microbiology /8./. Innsbruck, 12.06.2013-15.06.2013] EU Projects: European Commission(XE) 289319 - RUMINOMICS Keywords : intracellular DNA * extracellular DNA * storage conditions Subject RIV: EE - Microbiology, Virology Impact factor: 2.479, year: 2014

  6. Comparison of manual methods of extracting genomic DNA from dried blood spots collected on different cards: implications for clinical practice.

    Science.gov (United States)

    Molteni, C G; Terranova, L; Zampiero, A; Galeone, C; Principi, N; Esposito, S

    2013-01-01

    Isolating genomic DNA from blood samples is essential when studying the associations between genetic variants and susceptibility to a given clinical condition, or its severity. This study of three extraction techniques and two types of commercially available cards involved 219 children attending our outpatient pediatric clinic for follow-up laboratory tests after they had been hospitalised. An aliquot of venous blood was drawn into plastic tubes without additives and, after several inversions, 80 microL were put on circles of common paper cards and Whatman FTA-treated cards. Three extraction methods were compared: the Qiagen Investigator, Gensolve, and Masterpure. The best method in terms of final DNA yield was Masterpure, which led to a significantly higher yield regardless of the type of card (p less than 0.001), followed by Qiagen Investigator and Gensolve. Masterpure was also the best in terms of price, seemed to be simple and reliable, and required less hands-on time than other techniques. These conclusions support the use of Masterpure in studies that evaluate the associations between genetic variants and the severity or prevalence of infectious diseases.

  7. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  8. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, where collection of needle tissues is extremely difficult has been standardized. The extracted DNA was comparable to that obtained from the needle tissue in terms of yield and purity. The yield of extracted DNA ranged ...

  9. Effects of storage temperature on the quantity and integrity of genomic DNA extracted from mice tissues: A comparison of recovery methods

    Directory of Open Access Journals (Sweden)

    Huda H. Al-Griw

    2017-08-01

    Full Text Available Efficient extraction of genomic DNA (gDNA from biological materials found in harsh environments is the first step for successful forensic DNA profiling. This study aimed to evaluate two methods for DNA recovery from animal tissues (livers, muscles, focusing on the best storage temperature for DNA yield in term of quality, quantity, and integrity for use in several downstream molecular techniques. Six male Swiss albino mice were sacrificed, liver and muscle tissues (n=32 were then harvested and stored for one week in different temperatures, -20C, 4C, 25C and 40C. The conditioned animal tissues were used for DNA extraction by Chelex-100 method or NucleoSpin Blood and Tissue kit. The extracted gDNA was visualized on 1.5% agarose gel electrophoresis to determine the quality of gDNA and analysed spectrophotometrically to determine the DNA concentration and the purity. Both methods, Chelex-100 and NucleoSpin Blood and Tissue kit found to be appropriate for yielding high quantity of gDNA, with the Chelex100 method yielding a greater quantity (P < 0.045 than the kit. At -20C, 4C, and 25C temperatures, the concentration of DNA yield was numerically lower than at 40C. The NucleoSpin Blood and Tissue kit produced a higher (P=0.031 purity product than the Chelex-100 method, particularly for muscle tissues. The Chelex-100 method is cheap, fast, effective, and is a crucial tool for yielding DNA from animal tissues (livers, muscles exposed to harsh environment with little limitations.

  10. A modular method for the extraction of DNA and RNA, and the separation of DNA pools from diverse environmental sample types

    DEFF Research Database (Denmark)

    Lever, Mark; Torti, Andrea; Eickenbusch, Philip

    2015-01-01

    tests, in which permutations of all nucleic acid extraction steps were compared. The final modular protocol is suitable for extractions from igneous rock, air, water, and sediments. Sediments range from high-biomass, organic rich coastal samples to samples from the most oligotrophic region of the world...... DNA pools without cell lysis from intracellular and particle-complexed DNA pools may enable new insights into the cycling and preservation of DNA in environmental samples in the future. A general protocol is outlined, along with recommendations for optimizing this general protocol for specific sample...

  11. Extraction of ultrashort DNA molecules from herbarium specimens.

    Science.gov (United States)

    Gutaker, Rafal M; Reiter, Ella; Furtwängler, Anja; Schuenemann, Verena J; Burbano, Hernán A

    2017-02-01

    DNA extracted from herbarium specimens is highly fragmented; therefore, it is crucial to use extraction protocols that retrieve short DNA molecules. Improvements in extraction and DNA library preparation protocols for animal remains have allowed efficient retrieval of molecules shorter than 50 bp. Here, we applied these improvements to DNA extraction protocols for herbarium specimens and evaluated extraction performance by shotgun sequencing, which allows an accurate estimation of the distribution of DNA fragment lengths. Extraction with N-phenacylthiazolium bromide (PTB) buffer decreased median fragment length by 35% when compared with cetyl-trimethyl ammonium bromide (CTAB); modifying the binding conditions of DNA to silica allowed for an additional decrease of 10%. We did not observe a further decrease in length for single-stranded DNA (ssDNA) versus double-stranded DNA (dsDNA) library preparation methods. Our protocol enables the retrieval of ultrashort molecules from herbarium specimens, which will help to unlock the genetic information stored in herbaria.

  12. Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

    Science.gov (United States)

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

  13. DNA Extraction Techniques for Use in Education

    Science.gov (United States)

    Hearn, R. P.; Arblaster, K. E.

    2010-01-01

    DNA extraction provides a hands-on introduction to DNA and enables students to gain real life experience and practical knowledge of DNA. Students gain a sense of ownership and are more enthusiastic when they use their own DNA. A cost effective, simple protocol for DNA extraction and visualization was devised. Buccal mucosal epithelia provide a…

  14. Direct Quantification of Campylobacter jejuni in Chicken Fecal Samples Using Real-Time PCR: Evaluation of Six Rapid DNA Extraction Methods

    DEFF Research Database (Denmark)

    Garcia Clavero, Ana Belén; Kamara, Judy N.; Vigre, Håkan

    2013-01-01

    of this study, the Easy-DNA (Invitrogen) method generated lower Ct values, the best amplification efficiency (AE = 93.2 %) and good precision (R squared = 0.996). The method NucleoSpin® Tissue was able to detect samples spiked with the lowest Campylobacter concentration level (10 CFU/ml) but the amplification...... efficiency was not optimal (AE = 139.5 %). DNA extraction methods Easy-DNA Invitrogen, MiniMAG® and NucleoSpin® Tissue produced good real-time PCR reproducibility generating standard deviations from 0.3 to 0.8 between replicates....

  15. Seasonal distribution of Legionella spp. and L. pneumophila in a river in Taiwan evaluated with culture-confirmed and direct DNA extraction methods

    Science.gov (United States)

    Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li

    2013-07-01

    In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.

  16. An effective and low-cost method for DNA extraction from herbal ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... Rhubarb is an important traditional Chinese herbal drug with high ... It involved a modified CTAB method with distilled water ... polyphenols and tannins contaminants, ranged from 1.85 to 2.0 within the high level of purity.

  17. Comparison of DNA Extraction Methods in Terms of Yield, Purity, Long-Term Storage, and Downstream Manipulation with Brewer's Yeast Chromosomal DNA

    Czech Academy of Sciences Publication Activity Database

    Kopecká, J.; Matoulková, D.; Němec, M.; Jelínková, Markéta; Felsberg, Jürgen

    2014-01-01

    Roč. 72, č. 1 (2014), s. 1-5 ISSN 0361-0470 Institutional support: RVO:61388971 Keywords : Brewer's yeast * Isolation of DNA * Phenol/chloroform extraction Subject RIV: EE - Microbiology, Virology Impact factor: 0.886, year: 2014

  18. Comparative analysis of protocols for DNA extraction from soybean caterpillars.

    Science.gov (United States)

    Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C

    2016-04-07

    Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.

  19. Acceleration of direct identification of S.aureus versus Coagulase Negative Staphylococci from blood culture material: a comparison of six bacterial DNA extraction methods

    NARCIS (Netherlands)

    Prof. Dr. C.A. Bruggeman; Drs H. Kreeftenberg; Dr. Ir. P.F.G. Wolffs; Drs A.J.M. Loonen; Dr. A.J.C. van den Brule, van den; Drs A.R. Jansz

    2010-01-01

    To accelerate differentiation between Staphylococcus aureus and Coagulase Negative Staphylococci (CNS), this study aimed to compare six different DNA extraction methods from 2 commonly used blood culture materials, i.e. BACTEC and Bact/ALERT. Furthermore, we analyzed the effect of reduced blood

  20. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  1. Method evaluation of Fusarium DNA extraction from mycelia and wheat for down-stream real-time PCR quantification and correlation to mycotoxin levels.

    Science.gov (United States)

    Fredlund, Elisabeth; Gidlund, Ann; Olsen, Monica; Börjesson, Thomas; Spliid, Niels Henrik Hytte; Simonsson, Magnus

    2008-04-01

    Identification of Fusarium species by traditional methods requires specific skill and experience and there is an increased interest for new molecular methods for identification and quantification of Fusarium from food and feed samples. Real-time PCR with probe technology (Taqman) can be used for the identification and quantification of several species of Fusarium from cereal grain samples. There are several critical steps that need to be considered when establishing a real-time PCR-based method for DNA quantification, including extraction of DNA from the samples. In this study, several DNA extraction methods were evaluated, including the DNeasy Plant Mini Spin Columns (Qiagen), the Bio robot EZ1 (Qiagen) with the DNeasy Blood and Tissue Kit (Qiagen), and the Fast-DNA Spin Kit for Soil (Qbiogene). Parameters such as DNA quality and stability, PCR inhibitors, and PCR efficiency were investigated. Our results showed that all methods gave good PCR efficiency (above 90%) and DNA stability whereas the DNeasy Plant Mini Spin Columns in combination with sonication gave the best results with respect to Fusarium DNA yield. The modified DNeasy Plant Mini Spin protocol was used to analyse 31 wheat samples for the presence of F. graminearum and F. culmorum. The DNA level of F. graminearum could be correlated to the level of DON (r(2) = 0.9) and ZEN (r(2) = 0.6) whereas no correlation was found between F. culmorum and DON/ZEA. This shows that F. graminearum and not F. culmorum, was the main producer of DON in Swedish wheat during 2006.

  2. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Yomi

    2012-01-03

    Jan 3, 2012 ... Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa ...

  3. Rapid DNA extraction of bacterial genome using laundry detergents ...

    African Journals Online (AJOL)

    Genomic DNA extraction from bacterial cells involves processes normally performed in most biological laboratories. Therefore, various methods have been offered, manually and kit, but these methods may be time consuming and costly. In this paper, genomic DNA extraction of Pseudomonas aeruginosa was investigated ...

  4. Automated extraction of DNA from biological stains on fabric from crime cases. A comparison of a manual and three automated methods

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Hjort, Benjamin B; Hansen, Thomas N

    2013-01-01

    The presence of PCR inhibitors in extracted DNA may interfere with the subsequent quantification and short tandem repeat (STR) reactions used in forensic genetic DNA typing. DNA extraction from fabric for forensic genetic purposes may be challenging due to the occasional presence of PCR inhibitors...

  5. DNA Extraction from Chorionic Villi for Prenatal Diagnosis of Foetal ...

    African Journals Online (AJOL)

    BACKGROUND: Extraction of DNA from the chorionic villi is the first major step in the molecular determination of foetal haemoglobin genotype. There are few reports on DNA extraction from the chorionic villi. A desired method should be simple to conduct, reliable and cost effective. OBJECTIVE: The aim of the study was to ...

  6. A Simple Method for DNA Extraction from Mature Date Palm Leaves: Impact of Sand Grinding and Composition of Lysis Buffer

    Science.gov (United States)

    Arif, Ibrahim A.; Bakir, Mohammad A.; Khan, Haseeb A.; Ahamed, Anis; Al Farhan, Ahmad H.; Al Homaidan, Ali A.; Al Sadoon, Mohammad; Bahkali, Ali H.; Shobrak, Mohammad

    2010-01-01

    Molecular marker techniques have been widely used for cultivar identification of inbred date palms (Phoenix dactylifera L.; Arecaceae) and biodiversity conservation. Isolation of highly pure DNA is the prerequisite for PCR amplification and subsequent use such as DNA fingerprinting and sequencing of genes that have recently been developed for barcoding. To avoid problems related to the preservation and use of liquid nitrogen, we examined sterile sand for grinding the date palm leaves. Individual and combined effects of sodium chloride (NaCl), polyvinylpyrrolidone (PVP) and lithium chloride (LiCl) with the cetyltrimethylammonium bromide (CTAB) method for a DNA yield of sufficient purity and PCR amplification were evaluated in this study. Presence of LiCl and PVP alone or together in the lysis buffer did not significantly improve the DNA yield and purity compared with the addition of NaCl. Our study suggested that grinding of date palm leaf with sterile sand and inclusion of NaCl (1.4 M) in the lysis buffer without the costly use of liquid nitrogen, PVP and LiCl, provides a DNA yield of sufficient purity, suitable for PCR amplification. PMID:20957085

  7. extraction of high quality dna from polysaccharides-secreting ...

    African Journals Online (AJOL)

    cistvr

    A DNA extraction method using CTAB was used for the isolation of genomic DNA from ten. Xanthomonas campestris pathovars, ten isolates of Xanthomonas albilineans and one isolate of. Pseudomonas rubrisubalbicans. High quality DNA was obtained that was ideal for molecular analy- ses. Extracellular polysaccharides ...

  8. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  9. An easy, rapid, and cost-effective method for DNA extraction from various lichen taxa and specimens suitable for analysis of fungal and algal strains.

    Science.gov (United States)

    Park, Sook-Young; Jang, Seol-Hwa; Oh, Soon-Ok; Kim, Jung A; Hur, Jae-Seoun

    2014-12-01

    Lichen studies, including biodiversity, phylogenetic relationships, and conservation concerns require definitive species identification, however many lichens can be challenging to identify at the species level. Molecular techniques have shown efficacy in discriminating among lichen taxa, however, obtaining genomic DNA from herbarium and fresh lichen thalli by conventional methods has been difficult, because lichens contain high proteins, polysaccharides, and other complex compounds in their cell walls. Here we report a rapid, easy, and inexpensive protocol for extracting PCR-quality DNA from various lichen species. This method involves the following two steps: first, cell breakage using a beadbeater; and second, extraction, isolation, and precipitation of genomic DNA. The procedure requires approximately 10 mg of lichen thalli and can be completed within 20 min. The obtained DNAs were of sufficient quality and quantity to amplify the internal transcribed spacer region from the fungal and algal lichen components, as well as to sequence the amplified products. In addition, 26 different lichen taxa were tested, resulting in successful PCR products. The results of this study validated the experimental protocols, and clearly demonstrated the efficacy and value of our KCl extraction method applied in the fungal and algal samples.

  10. Evaluation by latent class analysis of a magnetic capture based DNA extraction followed by real-time qPCR as a new diagnostic method for detection of Echinococcus multilocularis in definitive hosts.

    Science.gov (United States)

    Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke

    2016-10-30

    A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. A rapid genotyping method for an obligate fungal pathogen, Puccinia striiformis f.sp. tritici, based on DNA extraction from infected leaf and Multiplex PCR genotyping

    Directory of Open Access Journals (Sweden)

    Enjalbert Jérôme

    2011-07-01

    Full Text Available Abstract Background Puccinia striiformis f.sp. tritici (PST, an obligate fungal pathogen causing wheat yellow/stripe rust, a serious disease, has been used to understand the evolution of crop pathogen using molecular markers. However, numerous questions regarding its evolutionary history and recent migration routes still remains to be addressed, which need the genotyping of a large number of isolates, a process that is limited by both DNA extraction and genotyping methods. To address the two issues, we developed here a method for direct DNA extraction from infected leaves combined with optimized SSR multiplexing. Findings We report here an efficient protocol for direct fungal DNA extraction from infected leaves, avoiding the costly and time consuming step of spore multiplication. The genotyping strategy we propose, amplified a total of 20 SSRs in three Multiplex PCR reactions, which were highly polymorphic and were able to differentiate different PST populations with high efficiency and accuracy. Conclusion These two developments enabled a genotyping strategy that could contribute to the development of molecular epidemiology of yellow rust disease, both at a regional or worldwide scale.

  12. An improved method for genomic DNA extraction from strawberry leaves Otimização de um método para extração de DNA genômico a partir de folhas de morangueiro

    Directory of Open Access Journals (Sweden)

    Claudinéia Ferreira Nunes

    2011-08-01

    Full Text Available Several extraction methods of genomic DNA for identification and characterization of genetic diversity in different plant species are routinely applied during molecular analysis. However, the presence of undesirable compounds such as polyphenols and polysaccharides is one of the biggest problems faced during the isolation and purification of high quality DNA in plants. Therefore, achievement of fast and accurate methods for DNA extraction is crucial in order to produce pure samples. Leaves of strawberry genotypes (Fragaria ananassa have high contents of polysaccharides and polyphenols which increase the sample viscosity and decrease the DNA quality, interfering with the PCR performance. Thereby, in this study we evaluated the quality and amount of genomic DNA extracted from young leaves of strawberry after tissue lyophilization and maceration in presence of polivinilpirrolidone (PVP. The CTAB method was used as reference procedure and it was modified to improve the DNA extraction. The modifications consisted of tissue lyophilization overnight until it was completely freeze-dried and addition of PVP during the tissue maceration in liquid nitrogen. The results showed the efficiency and reliability of the modified method compared to the unmodified method, indicating that combination of lyophilization and PVP improve the quality and amount of the DNA extracted from strawberry leaves.Vários métodos de extração de DNA genômico para a identificação e caracterização da diversidade genética em diferentes espécies de plantas são rotineiramente aplicados durante a análise molecular. Entretanto, a presença de compostos indesejáveis, tais como polifenóis e polissacarídeos, é um dos maiores problemas que ocorrem durante o isolamento e purificação de DNA de alta qualidade em plantas. Dessa forma, o sucesso no desenvolvimento de métodos de extração de DNA rápidos e acurados é crucial para produzir amostras puras. Folhas de genótipos de

  13. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    OpenAIRE

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-01-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cell...

  14. DNA extraction and barcode identification of development stages of forensically important flies in the Czech Republic.

    Science.gov (United States)

    Olekšáková, Tereza; Žurovcová, Martina; Klimešová, Vanda; Barták, Miroslav; Šuláková, Hana

    2018-04-01

    Several methods of DNA extraction, coupled with 'DNA barcoding' species identification, were compared using specimens from early developmental stages of forensically important flies from the Calliphoridae and Sarcophagidae families. DNA was extracted at three immature stages - eggs, the first instar larvae, and empty pupal cases (puparia) - using four different extraction methods, namely, one simple 'homemade' extraction buffer protocol and three commercial kits. The extraction conditions, including the amount of proteinase K and incubation times, were optimized. The simple extraction buffer method was successful for half of the eggs and for the first instar larval samples. The DNA Lego Kit and DEP-25 DNA Extraction Kit were useful for DNA extractions from the first instar larvae samples, and the DNA Lego Kit was also successful regarding the extraction from eggs. The QIAamp DNA mini kit was the most effective; the extraction was successful with regard to all sample types - eggs, larvae, and pupari.

  15. Extraction of DNA from plant and fungus tissues in situ

    Directory of Open Access Journals (Sweden)

    Abu Almakarem Amal S

    2012-06-01

    Full Text Available Abstract Background When samples are collected in the field and transported to the lab, degradation of the nucleic acids contained in the samples is frequently observed. Immediate extraction and precipitation of the nucleic acids reduces degradation to a minimum, thus preserving accurate sequence information. An extraction method to obtain high quality DNA in field studies is described. Findings DNA extracted immediately after sampling was compared to DNA extracted after allowing the sampled tissues to air dry at 21°C for 48 or 72 hours. While DNA extracted from fresh tissues exhibited little degradation, DNA extracted from all tissues exposed to 21°C air for 48 or 72 hours exhibited varying degrees of degradation. Yield was higher for extractions from fresh tissues in most cases. Four microcentrifuges were compared for DNA yield: one standard electric laboratory microcentrifuge (max rcf = 16,000×g, two battery-operated microcentrifuges (max rcf = 5,000 and 3,000 ×g, and one manually-operated microcentrifuge (max rcf = 120×g. Yields for all centrifuges were similar. DNA extracted under simulated field conditions was similar in yield and quality to DNA extracted in the laboratory using the same equipment. Conclusions This CTAB (cetyltrimethylammonium bromide DNA extraction method employs battery-operated and manually-operated equipment to isolate high quality DNA in the field. The method was tested on plant and fungus tissues, and may be adapted for other types of organisms. The method produced high quality DNA in laboratory tests and under simulated field conditions. The field extraction method should prove useful for working in remote sites, where ice, dry ice, and liquid nitrogen are unavailable; where degradation is likely to occur due to the long distances between the sample site and the laboratory; and in instances where other DNA preservation and transportation methods have been unsuccessful. It may be possible to adapt

  16. Introduction to DNA methods

    International Nuclear Information System (INIS)

    Delincee, H.

    1991-01-01

    The purpose of this session is to discuss the various possibilities for detecting modifications in DNA after irradiation and whether these changes can be utilized as an indicator for the irradiation treatment of foods. The requirement to be fulfilled is that the method be able to distinguish irradiated food without the presence of a control sample, thus the measured response after irradiation must be large enough to supersede background levels from other treatments. Much work has been performed on the effects of radiation on DNA, particularly due to its importance in radiation biology. The main lesions of DNA as a result of irradiation are base damage, damage of the sugar moiety, single strand and double strand breaks. Crosslinking between bases also occurs, e.g. production of thymine dimers, or between DNA and protein. A valuable review on how to utilize these DNA changes for detection purposes has already appeared. Tables 1, 2 and 3 list the proposed methods of detecting changes in irradiated DNA, some identified products as examples for a possible irradiation indicator, in the case of immunoassay the substance used as antigen, and some selected literature references. In this short review, it is not intended to provide a complete literature survey

  17. Comparative study of methods for extraction and purification of ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... and or enzymatic lysis for direct or indirect extraction of. DNA followed by ... strength wastewater sludge in order to determine the best. DNA extraction protocol ... Ammonium acetate purification method was used to remove the.

  18. Necessity of purification during bacterial DNA extraction with environmental soils

    Directory of Open Access Journals (Sweden)

    Hyun Jeong Lim

    2017-08-01

    Full Text Available Complexity and heterogeneity of soil samples have often implied the inclusion of purification steps in conventional DNA extraction for polymerase chain reaction (PCR assays. Unfortunately the purification steps are also time and labor intensive. Therefore the necessity of DNA purification was re-visited and investigated for a variety of environmental soil samples that contained various amounts of PCR inhibitors. Bead beating and centrifugation was used as the baseline (without purification method for DNA extraction. Its performance was compared with that of conventional DNA extraction kit (with purification. The necessity criteria for DNA purification were established with environmental soil samples. Using lysis conditions at 3000 rpm for 3 minutes with 0.1 mm glass beads, centrifugation time of 10 minutes and 1:10 dilution ratio, the baseline method outperformed conventional DNA extraction on cell seeded sand samples. Further investigation with PCR inhibitors (i.e., humic acids, clay, and magnesium [Mg] showed that sand samples containing less than 10 μg/g humic acids and 70% clay may not require purifications. Interestingly, the inhibition pattern of Mg ion was different from other inhibitors due to the complexation interaction of Mg ion with DNA fragments. It was concluded that DNA extraction method without purification is suitable for soil samples that have less than 10 μg/g of humic acids, less than 70% clay content and less than 0.01% Mg ion content.

  19. Comparison of direct boiling method with commercial kits for extracting fecal microbiome DNA by Illumina sequencing of 16S rRNA tags.

    Science.gov (United States)

    Peng, Xin; Yu, Ke-Qiang; Deng, Guan-Hua; Jiang, Yun-Xia; Wang, Yu; Zhang, Guo-Xia; Zhou, Hong-Wei

    2013-12-01

    Low cost and high throughput capacity are major advantages of using next generation sequencing (NGS) techniques to determine metagenomic 16S rRNA tag sequences. These methods have significantly changed our view of microorganisms in the fields of human health and environmental science. However, DNA extraction using commercial kits has shortcomings of high cost and time constraint. In the present study, we evaluated the determination of fecal microbiomes using a direct boiling method compared with 5 different commercial extraction methods, e.g., Qiagen and MO BIO kits. Principal coordinate analysis (PCoA) using UniFrac distances and clustering showed that direct boiling of a wide range of feces concentrations gave a similar pattern of bacterial communities as those obtained from most of the commercial kits, with the exception of the MO BIO method. Fecal concentration by boiling method affected the estimation of α-diversity indices, otherwise results were generally comparable between boiling and commercial methods. The operational taxonomic units (OTUs) determined through direct boiling showed highly consistent frequencies with those determined through most of the commercial methods. Even those for the MO BIO kit were also obtained by the direct boiling method with high confidence. The present study suggested that direct boiling could be used to determine the fecal microbiome and using this method would significantly reduce the cost and improve the efficiency of the sample preparation for studying gut microbiome diversity. © 2013 Elsevier B.V. All rights reserved.

  20. Development of rapid and simple method for DNA extraction from cannabis resin based on the evaluation of relative PCR amplification ability.

    Science.gov (United States)

    Yamamuro, Tadashi; Iwata, Yuko T; Segawa, Hiroki; Kuwayama, Kenji; Tsujikawa, Kenji; Kanamori, Tatsuyuki; Inoue, Hiroyuki

    2018-04-04

    In recent years, analysis of cannabis DNA has been increasingly used in forensic drug tests. However, in the case of cannabis resin, a processed marijuana product, complicated procedures are required for the extraction of clean DNA, as the presence of various impurities inhibits PCR amplification. Therefore, in this study, we attempted to identify the factors that would allow quick and simple DNA extraction from cannabis resin with a commercially available kit. We also constructed a simple assay system for comparing relative amplification efficiencies by end-point PCR and used it to evaluate the purity of the obtained DNA solutions. For extraction with a kit that contains a silica column, reducing the starting amount of resin, using the residue remaining after methanol extraction, dilution of the final solution, extraction with an equal amount of powdered activated carbon or an excess amount of polyvinylpolypyrrolidone, and the addition of an appropriate amount of polyvinylpyrrolidone to the solution after extraction were effective measures that improved amplification efficiency. Furthermore, the use of the most rapid alkaline extraction kit combined with the addition of powdered activated carbon allowed obtaining DNA solutions with sufficient amplification efficiency in about 10min. These findings should be useful for routine DNA analysis of cannabis resin during forensic examination. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Genomic DNA extraction from sapwood of Pinus roxburghii for ...

    African Journals Online (AJOL)

    Ashish

    2013-02-22

    Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...

  2. Comparison of capture and storage methods for aqueous macrobial eDNA using an optimized extraction protocol

    DEFF Research Database (Denmark)

    Spens, Johan; Evans, Alice Ruth; Halfmaerten, David

    2017-01-01

    Aqueous environmental DNA (eDNA) is an emerging efficient non-invasive tool for species inventory studies. To maximize performance of downstream quantitative PCR (qPCR) and next-generation sequencing (NGS) applications, quality and quantity of the starting material is crucial, calling for optimized...

  3. Genomic DNA extraction protocols from ovine hair

    Directory of Open Access Journals (Sweden)

    Jennifer Nonato da Silva Prate

    2013-12-01

    Full Text Available Genomic DNA extracted from animal cells can be used for several purposes, for example, to know genetic variability and genetic relationships between individuals, breeds and/or species, paternity tests, to describe the genetic profile for registration of the animal at association of breeders, detect genetic polymorphisms (SNP related to characteristics of commercial interest, disease diagnose, assess resistance or susceptibility to pathogens, etc. For such evaluations, in general, DNA is amplified by PCR (polymerase chain reaction, and then subjected to various techniques as RFLP (restriction fragments length polymorphism, SSCP (single strand conformation polymorphism, and sequencing. The DNA may be obtained from blood, buccal swabs, meat, cartilage or hair bulb. Among all, the last biological material has been preferred by farmers for its ease acquisition. Several methods for extracting DNA from hair bulb were reported without any consensus for its implementation. This study aimed to optimize a protocol for efficient DNA extraction for use in PCR-RFLP analysis of the Prion gene. For this study, were collected hair samples containing hair bulb from 131 Santa Inês sheep belonging to the Institute of Zootechny, Nova Odessa - SP. Two DNA extraction protocols were evaluated. The first, called phenol-chloroform-isoamyl alcohol (PCIA has long been used by Animal Genetic Laboratories, whose procedures are described below: in each microtube (1.5 mL containing 500 µL of TE-Tween solution (Tris-HCl 50 mM, EDTA 1 mM and 0.5% Tween 20 were added to approximately 30 hair bulb per animal which was incubated at 65°C with shaking at 170 rpm for 2 hours. Then was added 15 µL of proteinase K [10 mg mL-1] and incubated at 55°C at 170 rpm for 6-12 hours. At the end of digestion was added 1 volume of solution phenol-chloroform-isoamyl alcohol (25:24:1 followed by vigorous shaking for 10 seconds and centrifuged at 8000 rpm and 4°C for 10 minutes. The upper phase

  4. Acceleration of the direct identification of Staphylococcus aureus versus coagulase-negative staphylococci from blood culture material: a comparison of six bacterial DNA extraction methods.

    Science.gov (United States)

    Loonen, A J M; Jansz, A R; Kreeftenberg, H; Bruggeman, C A; Wolffs, P F G; van den Brule, A J C

    2011-03-01

    To accelerate differentiation between Staphylococcus aureus and coagulase-negative staphylococci (CNS), this study aimed to compare six different DNA extraction methods from two commonly used blood culture materials, i.e. BACTEC and BacT/ALERT. Furthermore, we analysed the effect of reduced blood culture incubation for the detection of staphylococci directly from blood culture material. A real-time polymerase chain reaction (PCR) duplex assay was used to compare the six different DNA isolation protocols on two different blood culture systems. Negative blood culture material was spiked with methicillin-resistant S. aureus (MRSA). Bacterial DNA was isolated with automated extractor easyMAG (three protocols), automated extractor MagNA Pure LC (LC Microbiology Kit M(Grade)), a manual kit MolYsis Plus and a combination of MolYsis Plus and the easyMAG. The most optimal isolation method was used to evaluate reduced bacterial incubation times. Bacterial DNA isolation with the MolYsis Plus kit in combination with the specific B protocol on the easyMAG resulted in the most sensitive detection of S. aureus, with a detection limit of 10 CFU/ml, in BacT/ALERT material, whereas using BACTEC resulted in a detection limit of 100 CFU/ml. An initial S. aureus or CNS load of 1 CFU/ml blood can be detected after 5 h of incubation in BacT/ALERT 3D by combining the sensitive isolation method and the tuf LightCycler assay.

  5. Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

    Science.gov (United States)

    Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

    2006-01-01

    A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the

  6. Optimization of DNA extraction for ISSR studies in Tectona grandis Lf

    African Journals Online (AJOL)

    GRACE

    2006-07-03

    Jul 3, 2006 ... genomic DNA, emphasizing screening of inexpensive, rapid and simple DNA extraction methods (Weishing et al., 1995). Yield and quality of DNA often varies among tree tissue types (Henry, 2001). Besides, purification of genomic DNA in trees is difficult due to co-extraction of high quantities of tannins, ...

  7. Improved method for extraction and detection of Helicobacter pylori DNA in formalin-fixed paraffin embedded gastric biopsies using laser micro-dissection

    Directory of Open Access Journals (Sweden)

    María Fernanda Loayza

    2015-01-01

    • The use of thin purification columns with 35 μL of elution buffer. The mean of DNA concentration obtained from 25 LM cut sections was 1.94± 0 .16 ng/μL, and it was efficiently amplified with qPCR in a Bio Rad iCycler instrument. The LM can improve the sample selection and DNA extraction for molecular analysis of H. pylori associated with human gastric epithelium.

  8. Extraction of Chromosomal DNA from Schizosaccharomyces pombe.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-05-02

    Extraction of DNA from Schizosaccharomyces pombe cells is required for various uses, including templating polymerase chain reactions (PCRs), Southern blotting, library construction, and high-throughput sequencing. To purify high-quality DNA, the cell wall is removed by digestion with Zymolyase or Lyticase and the resulting spheroplasts lysed using sodium dodecyl sulfate (SDS). Cell debris, SDS, and SDS-protein complexes are subsequently precipitated by the addition of potassium acetate and removed by centrifugation. Finally, DNA is precipitated using isopropanol. At this stage, purity is usually sufficient for PCR. However, for more sensitive procedures, such as restriction enzyme digestion, additional purification steps, including proteinase K digestion and phenol-chloroform extraction, are recommended. All of these steps are described in detail here. © 2016 Cold Spring Harbor Laboratory Press.

  9. Extraction of DNA from Forensic Biological Samples for Genotyping.

    Science.gov (United States)

    Stray, J E; Liu, J Y; Brevnov, M G; Shewale, J G

    2010-07-01

    Biological forensic samples constitute evidence with probative organic matter. Evidence believed to contain DNA is typically processed for extraction and purification of its nucleic acid content. Forensic DNA samples are composed of two things, a tissue and the substrate it resides on. Compositionally, a sample may contain almost anything and for each, the type, integrity, and content of both tissue and substrate will vary, as will the contaminant levels. This fact makes the success of extraction one of the most unpredictable steps in genotypic analysis. The development of robust genotyping systems and analysis platforms for short tandem repeat (STR) and mitochondrial DNA sequencing and the acceptance of results generated by these methods in the court system, resulted in a high demand for DNA testing. The increasing variety of sample submissions created a need to isolate DNA from forensic samples that may be compromised or contain low levels of biological material. In the past decade, several robust chemistries and isolation methods have been developed to safely and reliably recover DNA from a wide array of sample types in high yield and free of PCR inhibitors. In addition, high-throughput automated workflows have been developed to meet the demand for processing increasing numbers of samples. This review summarizes a number of the most widely adopted methods and the best practices for DNA isolation from forensic biological samples, including manual, semiautomated, and fully automated platforms. Copyright © 2010 Central Police University.

  10. Evaluation of four automated protocols for extraction of DNA from FTA cards.

    Science.gov (United States)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura; Frank-Hansen, Rune; Poulsen, Lena; Hansen, Anders J; Morling, Niels

    2013-10-01

    Extraction of DNA using magnetic bead-based techniques on automated DNA extraction instruments provides a fast, reliable, and reproducible method for DNA extraction from various matrices. Here, we have compared the yield and quality of DNA extracted from FTA cards using four automated extraction protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already extracted from the FTA cards.

  11. Comparison of three rapid and easy bacterial DNA extraction methods for use with quantitative real-time PCR

    NARCIS (Netherlands)

    van Tongeren, S. P.; Degener, J. E.; Harmsen, H. J. M.

    The development of fast and easy on-site molecular detection and quantification methods for hazardous microbes on solid surfaces is desirable for several applications where specialised laboratory facilities are absent. The quantification of bacterial contamination necessitates the assessment of the

  12. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  13. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  14. [Study on a collagenase protocol to extract DNA from remnant feathers in edible bird's nest].

    Science.gov (United States)

    Wang, Ling-Li; Chen, Nian; Zhang, Wei-Wei; Wu, Guo-Hong; Lai, Xiao-Ping

    2013-08-01

    To establish a method for extracting genomic DNA from rudimental bird feather from the precious edible bird's nest (EBN) harvested from the swiftlet cave. Observed the EBN using endoscopic and studied the influence of adding collagenase on the extracting yield of DNA. PCR amplification and sequencing for the extraction was also conducted. Collagenase was used in addition to protease K which could substantively increase the DNA yield. The DNA extracted by this method could be used for PCR and other molecular biology analyses. This method can be applied to identify the species types in biological products, especially for animal tissue materials that rich in collagen.

  15. DNA extraction from sea anemone (Cnidaria: Actiniaria tissues for molecular analyses

    Directory of Open Access Journals (Sweden)

    Pinto S.M.

    2000-01-01

    Full Text Available A specific DNA extraction method for sea anemones is described in which extraction of total DNA from eight species of sea anemones and one species of corallimorpharian was achieved by changing the standard extraction protocols. DNA extraction from sea anemone tissue is made more difficult both by the tissue consistency and the presence of symbiotic zooxanthellae. The technique described here is an efficient way to avoid problems of DNA contamination and obtain large amounts of purified and integral DNA which can be used in different kinds of molecular analyses.

  16. 大豆种子DNA快速提取方法的改良及应用%Improvement and application of the rapid DNA extraction method from Soybean Seeds

    Institute of Scientific and Technical Information of China (English)

    朱振雷; 束永俊; 李勇; 柏锡; 才华; 纪巍; 朱延明

    2009-01-01

    High-quality DNA is an important base of molecular biology manipulation, such as gene cloning. There are lots of protein and fat in the soybean seeds, so the DNA extracted from them by using traditional methods is very difficult to achieve quality requirements of experiments. This study improved the SDS extraction buffer by adding NP-40 and Tween-20, and established a rapid DNA extraction method that is suitable for soybean seeds. The DNA extraction by the optimized SDS extraction method has high-quality, and the values of OD_(260)/OD_(280) ranged from 1.809 to 1.916, that means non-protein and RNA pollution. The DNA extraction method was validated by gene cloning and genotyping, and the results showed that it could be used for soybean gene cloning and molecular markers.%高质量的DNA是进行基因克隆等分子生物学试验的前提条件.因大豆种子中蛋白质和油脂含量丰富,利用传统方法提取DNA质量很难达到试验要求.研究在SDS提取液的基础上.通过添加表面活性剂NP-40和Tween-20,优化出一种适合于大豆种子DNA快速提取的方法.优化后的SDS方法提取的DNA质量较高.OD_(260)/OD_(280)在1.809~1.916之间,无蛋白质和RNA污染.对该方法提取的DNA进行了基因克隆和分子标记的试验验证,结果表明,它们能够用于大豆基因克隆、分子标记.

  17. Rapid and reliable extraction of genomic DNA from various wild-type and transgenic plants

    Directory of Open Access Journals (Sweden)

    Yang Moon-Sik

    2004-09-01

    Full Text Available Abstract Background DNA extraction methods for PCR-quality DNA from calluses and plants are not time efficient, since they require that the tissues be ground in liquid nitrogen, followed by precipitation of the DNA pellet in ethanol, washing and drying the pellet, etc. The need for a rapid and simple procedure is urgent, especially when hundreds of samples need to be analyzed. Here, we describe a simple and efficient method of isolating high-quality genomic DNA for PCR amplification and enzyme digestion from calluses, various wild-type and transgenic plants. Results We developed new rapid and reliable genomic DNA extraction method. With our developed method, plant genomic DNA extraction could be performed within 30 min. The method was as follows. Plant tissue was homogenized with salt DNA extraction buffer using hand-operated homogenizer and extracted by phenol:chloroform:isoamyl alcohol (25:24:1. After centrifugation, the supernatant was directly used for DNA template for PCR, resulting in successful amplification for RAPD from various sources of plants and specific foreign genes from transgenic plants. After precipitating the supernatant, the DNA was completely digested by restriction enzymes. Conclusion This DNA extraction procedure promises simplicity, speed, and efficiency, both in terms of time and the amount of plant sample required. In addition, this method does not require expensive facilities for plant genomic DNA extraction.

  18. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    Energy Technology Data Exchange (ETDEWEB)

    Pecora, Gabrielle N. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Reid, Francine C. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Tom, Lauren M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Piceno, Yvette M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Andersen, Gary L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in the world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.

  19. Improved method for extraction and detection of Helicobacter pylori DNA in formalin-fixed paraffin embedded gastric biopsies using laser micro-dissection.

    Science.gov (United States)

    Loayza, María Fernanda; Villavicencio, Fernando Xavier; Santander, Stephanie Carolina; Baldeón, Manuel; Ponce, Lourdes Karina; Salvador, Iván; Vivar Díaz, Nicolás

    2015-01-01

    To assess the molecular events exerted by Helicobacter pylori interacting directly with gastric epithelial cells, an improved procedure for microbial DNA isolation from stained hematoxilin-eosin gastric biopsies was developed based on laser micro-dissection (LM) [1]. Few articles have described the use of LM to select and detect H. pylori genome from formalin-fixed paraffin embedded gastric tissue [2]. To improve the yield and quality of DNA isolated from H. pylori contacting intestinal epithelial cells, the following conditions were established after modification of the QIAamp DNA Micro kit. •Use of at least 25 cut sections of 10-20 μm of diameter and 3 μm thick with more than 10 bacteria in each cut.•Lysis with 30 μL of tissue lysis buffer and 20 μL of proteinase K (PK) with the tube in an upside-down position.•The use of thin purification columns with 35 μL of elution buffer. The mean of DNA concentration obtained from 25 LM cut sections was 1.94± 0 .16 ng/μL, and it was efficiently amplified with qPCR in a Bio Rad iCycler instrument. The LM can improve the sample selection and DNA extraction for molecular analysis of H. pylori associated with human gastric epithelium.

  20. Alkaline Extraction of DNA from Pathogenic Fungi for PCR-RFLP Analysis

    OpenAIRE

    Matsumoto, Masaru; Mishima, Shinobu; Matsuyama, Nobuaki; 松元, 賢; 松山, 宣明

    1997-01-01

    For the preparation of DNA samples from fungal mycelia alkaline extraction method was applied and assessed its usefulness for PCR-RFLP analysis. Using alkaline treatment protocols, 18S ribosomal DNAs (rDNA) derived from fungal genomic DNA of Pyricularia oryzae, P. zingiberi, Rhizoctonia solani and R. oryzae were PCR-amplified and digested with Hha I, Msp I and Hae ill. RFLP analysis with HhaI showed the divergent polymorphism between genus Pyricularia and Rhizoctonia. The alkaline DNA extract...

  1. Comparison of different methodologies for DNA extraction from Aegla longirostri

    Directory of Open Access Journals (Sweden)

    João Vitor Trindade Bitencourt

    2007-11-01

    Full Text Available The aim of this study was to compare some DNA extraction methodologies for Aegla longirostri. The protocols were based on the traditional phenol-chloroform DNA extraction methodology and using a commercial kit for DNA extraction. They differed in tissues used, the addition - or not - of beta-mercaptoethanol to the lysis buffer, times and methods for the animal's conservation (frozen, in ethanol or fresh. Individuals stored at -20°C for a long time supplied lower molecular weight DNA than those stored for a short time. The best yield for the specimens preserved in ethanol was obtained for 15 days storage in 95% ethanol. The kit resulted in a low quantity of high molecular weight DNA. The best protocol for DNA extraction from Aeglidae, and probably for other crustaceans should, therefore, utilize fresh specimens, with addition of beta-mercaptoethanol to the lysis buffer.Marcadores moleculares são ferramentas úteis para esclarecer dúvidas a respeito dos Aeglidae, único grupo de crustáceos Anomura de água doce. Essas técnicas dependem da obtenção de DNA de boa qualidade e sem contaminantes. O objetivo deste estudo foi comparar algumas metodologias de extração de DNA de Aegla longirostri. Quatorze protocolos foram analisados, baseados na metodologia tradicional de extração de DNA com fenol-clorofórmio, exceto o protocolo K no qual se utilizou um Kit. Os procedimentos diferiram quanto aos tecidos utilizados e a adição de beta-mercaptoetanol ao tampão de lise. Avaliaram-se também diferentes tempos e maneiras de conservação. Indivíduos congelados apresentaram maior degradação do material obtido conforme o tempo em que ficaram congelados. Para os indivíduos conservados em álcool, aqueles mantidos em etanol 95% forneceram material de melhor qualidade. A utilização do Mini Kit resultou em uma quantidade muito pequena de DNA de alto peso molecular. O melhor protocolo para extração de DNA de Aeglidae utilizou músculos e br

  2. Food Fish Identification from DNA Extraction through Sequence Analysis

    Science.gov (United States)

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  3. Overcoming DNA extraction problems from carnivorous plants

    Directory of Open Access Journals (Sweden)

    Fleischmann, Andreas

    2009-12-01

    Full Text Available We tested previously published protocols for DNA isolation from plants with high contents of polyphenols and polysaccharides for several taxa of carnivorous plants. However, we did not get satisfying results with fresh or silica dried leaf tissue obtained from field collected or greenhouse grown plants, nor from herbarium specimens. Therefore, we have developed a simple modified protocol of the commercially available Macherey- Nagel NucleoSpin® Plant kit for rapid, effective and reproducible isolation of high quality genomic DNA suitable for PCR reactions. DNA extraction can be conducted from both fresh and dried leaf tissue of various carnivorous plant taxa, irrespective of high contents of polysaccharides, phenolic compounds and other secondary plant metabolites that interfere with DNA isolation and amplification.

    Probamos algunos protocolos publicados previamente para el aislamiento del ADN de plantas con alto contenido de polifenoles y polisacáridos para varios táxones de plantas carnívoras. Sin embargo, no conseguimos muy buenos resultados ni con tejidos de hojas frescas, ni con tejidos de hojas secadas en gel de sílice obtenidas de plantas colectadas en el campo o cultivadas en los invernaderos, ni de especímenes de herbario. Por lo tanto, hemos desarrollado un protocolo sencillo, modificado del Macherey- Nagel NucleoSpin® Plant kit disponible en el mercado para el aislamiento rápido, eficaz y reproducible de ADN genómico de alta calidad conveniente para la reacción en cadena de la polimerasa. La extracción del ADN se puede realizar en tejidos de hojas frescas o secas de varios táxones de plantas carnívoras, sin importar el grado de contenido de polisacáridos, compuestos fenólicos u otros metabolitos secundarios que interfieren con el aislamiento y la amplificación del ADN.

  4. A Simple Method for DNA Extraction from Mature Date Palm Leaves: Impact of Sand Grinding and Composition of Lysis Buffer

    Directory of Open Access Journals (Sweden)

    Mohammad Al Sadoon

    2010-09-01

    Full Text Available Molecular marker techniques have been widely used for cultivar identification of inbred date palms (Phoenix dactylifera L.; Arecaceae and biodiversity conservation. Isolation of highly pure DNA is the prerequisite for PCR amplification and subsequent use such as DNA fingerprinting and sequencing of genes that have recently been developed for barcoding. To avoid problems related to the preservation and use of liquid nitrogen, we examined sterile sand for grinding the date palm leaves. Individual and combined effects of sodium chloride (NaCl, polyvinylpyrrolidone (PVP and lithium chloride (LiCl with the cetyltrimethylammonium bromide (CTAB method for a DNA yield of sufficient purity and PCR amplification were evaluated in this study. Presence of LiCl and PVP alone or together in the lysis buffer did not significantly improve the DNA yield and purity compared with the addition of NaCl. Our study suggested that grinding of date palm leaf with sterile sand and inclusion of NaCl (1.4 M in the lysis buffer without the costly use of liquid nitrogen, PVP and LiCl, provides a DNA yield of sufficient purity, suitable for PCR amplification.

  5. Two mini-preparation protocols to DNA extraction from plants with ...

    African Journals Online (AJOL)

    Were standardized two previously reported standard plant DNA extraction methods, but improved them on mini preparations to use the samples for population genetic analysis. The combination of CTAB lysis procedure-solvent extraction and DNA column purification (DNeasy plant mini kit modification) enables a faster and ...

  6. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Directory of Open Access Journals (Sweden)

    D.C.A. Leite

    2014-01-01

    Full Text Available Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit, the PowerSoil® DNA Isolation Kit (PS kit and the ZR Soil Microbe DNA Kit MiniprepTM (ZR kit, for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples.

  7. Comparison of DNA extraction protocols for microbial communities from soil treated with biochar

    Science.gov (United States)

    Leite, D.C.A.; Balieiro, F.C.; Pires, C.A.; Madari, B.E.; Rosado, A.S.; Coutinho, H.L.C.; Peixoto, R.S.

    2014-01-01

    Many studies have evaluated the effects of biochar application on soil structure and plant growth. However, there are very few studies describing the effect of biochar on native soil microbial communities. Microbial analysis of environmental samples requires accurate and reproducible methods for the extraction of DNA from samples. Because of the variety among microbial species and the strong adsorption of the phosphate backbone of the DNA molecule to biochar, extracting and purifying high quality microbial DNA from biochar-amended soil is not a trivial process and can be considerably more difficult than the extraction of DNA from other environmental samples. The aim of this study was to compare the relative efficacies of three commercial DNA extraction kits, the FastDNA® SPIN Kit for Soil (FD kit), the PowerSoil® DNA Isolation Kit (PS kit) and the ZR Soil Microbe DNA Kit Miniprep™ (ZR kit), for extracting microbial genomic DNA from sand treated with different types of biochar. The methods were evaluated by comparing the DNA yields and purity and by analysing the bacterial and fungal community profiles generated by PCR-DGGE. Our results showed that the PCR-DGGE profiles for bacterial and fungal communities were highly affected by the purity and yield of the different DNA extracts. Among the tested kits, the PS kit was the most efficient with respect to the amount and purity of recovered DNA and considering the complexity of the generated DGGE microbial fingerprint from the sand-biochar samples. PMID:24948928

  8. Modifying and adapting a plant-based DNA extraction protocol for ...

    African Journals Online (AJOL)

    ... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.

  9. Extraction of DNA from honey and its amplification by PCR for botanical identification

    Directory of Open Access Journals (Sweden)

    Sona Arun Jain

    2013-12-01

    Full Text Available The physiochemical and biological properties of honey are directly associated to its floral origin. Some current commonly used methods for identification of botanical origin of honey involve palynological analysis, chromatographic methods, or direct observation of the bee behavior. However, these methods can be less sensitive and time consuming. DNA-based methods have become popular due to their simplicity, quickness, and reliability. The main objective of this research is to introduce a protocol for the extraction of DNA from honey and demonstrate that the molecular analysis of the extracted DNA can be used for its botanical identification. The original CTAB-based protocol for the extraction of DNA from plants was modified and used in the DNA extraction from honey. DNA extraction was carried out from different honey samples with similar results in each replication. The extracted DNA was amplified by PCR using plant specific primers, confirming that the DNA extracted using the modified protocol is of plant origin and has good quality for analysis of PCR products and that it can be used for botanical identification of honey.

  10. Arduino-based automation of a DNA extraction system.

    Science.gov (United States)

    Kim, Kyung-Won; Lee, Mi-So; Ryu, Mun-Ho; Kim, Jong-Won

    2015-01-01

    There have been many studies to detect infectious diseases with the molecular genetic method. This study presents an automation process for a DNA extraction system based on microfluidics and magnetic bead, which is part of a portable molecular genetic test system. This DNA extraction system consists of a cartridge with chambers, syringes, four linear stepper actuators, and a rotary stepper actuator. The actuators provide a sequence of steps in the DNA extraction process, such as transporting, mixing, and washing for the gene specimen, magnetic bead, and reagent solutions. The proposed automation system consists of a PC-based host application and an Arduino-based controller. The host application compiles a G code sequence file and interfaces with the controller to execute the compiled sequence. The controller executes stepper motor axis motion, time delay, and input-output manipulation. It drives the stepper motor with an open library, which provides a smooth linear acceleration profile. The controller also provides a homing sequence to establish the motor's reference position, and hard limit checking to prevent any over-travelling. The proposed system was implemented and its functionality was investigated, especially regarding positioning accuracy and velocity profile.

  11. A quick DNA extraction protocol: Without liquid nitrogen in ambient ...

    African Journals Online (AJOL)

    Marker assisted selection is an effective technique for quality traits selection in breeding program which are impossible by visual observation. Marker assisted selection in early generation requires rapid DNA extraction protocol for large number of samples in a low cost approach. A rapid and inexpensive DNA extraction ...

  12. An optimized DNA extraction protocol for benthic Didymosphenia geminata.

    Science.gov (United States)

    Uyua, Noelia Mariel; Manrique, Julieta Marina; Jones, Leandro Roberto

    2014-09-01

    Didymosphenia geminata mats display few cells in relation to extracellular material and contain polysaccharides and heavy metals that interfere with molecular studies. We describe an optimized DNA extraction protocol that help to overcome these difficulties. Our protocol outperformed five previously described DNA extraction techniques. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. DNA in ancient bone - where is it located and how should we extract it?

    DEFF Research Database (Denmark)

    Campos, Paula; Craig, Oliver E.; Turner-Walker, Gordon

    2012-01-01

    Despite the widespread use of bones in ancient DNA (aDNA) studies, relatively little concrete information exists in regard to how the DNA in mineralised collagen degrades, or where it survives in the material's architecture. While, at the macrostructural level, physical exclusion of microbes...... and other external contaminants may be an important feature, and, at the ultrastructural level, the adsorption of DNA to hydroxyapatite and/or binding of DNA to Type I collagen may stabilise the DNA, the relative contribution of each, and what other factors may be relevant, are unclear....... The question arises as to whether this may be due to post-collection preservation or just an artefact of the extraction methods used in these different studies? In an attempt to resolve these questions, we examine the efficacy of DNA extraction methods, and the quality and quantity of DNA recovered from both...

  14. COMPARISON OF COMMERCIAL DNA KITS AND TRADITIONAL DNA EXTRACTION PROCEDURE IN PCR DETECTION OF PORK IN DRY/FERMENTED SAUSAGES

    Directory of Open Access Journals (Sweden)

    Ivona Djurkin Kušec

    2015-09-01

    Full Text Available In the present study four commercially available DNA extraction kits (Wizard® Genomic DNA Purification Kit, High Pure PCR Template Kit, DNeasy mericon Food and GeneJET PCR Purification Kit, as well as standard phenol/chloroform isolation technique have been evaluated regarding their concentration, purity and suitability for amplification of porcine DNA in dry/fermented sausages. The isolates were assessed for quantity and quality using spectrophotometer (IMPLEN GmbH, Germany. To verify template usability and quality of isolated DNA, the polymerase chain reaction (PCR targeting at porcine cytochrome b by species specific primers was used. The comparison of extraction methods revealed satisfactory efficiency and purity of all extraction kits, while with standard phenol/chloroform isolation method high concentrations of DNA with low A260/280 were obtained. However, all the investigated techniques proved to be suitable for identification of porcine DNA in dry/fermented sausage. Thus, the standard phenol/chloroform DNA extraction method, as the cost-effective one, can be recommended as a good alternative to more expensive isolation kits when investigating the presence of pork DNA in dry/ fermented meat products.

  15. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques.

    OpenAIRE

    Aljanabi, S M; Martinez, I

    1997-01-01

    A very simple, fast, universally applicable and reproducible method to extract high quality megabase genomic DNA from different organisms is described. We applied the same method to extract high quality complex genomic DNA from different tissues (wheat, barley, potato, beans, pear and almond leaves as well as fungi, insects and shrimps' fresh tissue) without any modification. The method does not require expensive and environmentally hazardous reagents and equipment. It can be performed even i...

  16. Methods to maximise recovery of environmental DNA from water samples.

    Directory of Open Access Journals (Sweden)

    Rheyda Hinlo

    Full Text Available The environmental DNA (eDNA method is a detection technique that is rapidly gaining credibility as a sensitive tool useful in the surveillance and monitoring of invasive and threatened species. Because eDNA analysis often deals with small quantities of short and degraded DNA fragments, methods that maximize eDNA recovery are required to increase detectability. In this study, we performed experiments at different stages of the eDNA analysis to show which combinations of methods give the best recovery rate for eDNA. Using Oriental weatherloach (Misgurnus anguillicaudatus as a study species, we show that various combinations of DNA capture, preservation and extraction methods can significantly affect DNA yield. Filtration using cellulose nitrate filter paper preserved in ethanol or stored in a -20°C freezer and extracted with the Qiagen DNeasy kit outperformed other combinations in terms of cost and efficiency of DNA recovery. Our results support the recommendation to filter water samples within 24hours but if this is not possible, our results suggest that refrigeration may be a better option than freezing for short-term storage (i.e., 3-5 days. This information is useful in designing eDNA detection of low-density invasive or threatened species, where small variations in DNA recovery can signify the difference between detection success or failure.

  17. Rapid and efficient extraction of genomic DNA from different phytopathogenic fungi using DNAzol reagent.

    Science.gov (United States)

    Guo, Jian-Rong; Schnieder, F; Abd-Elsalam, K A; Verreet, J A

    2005-01-01

    A modified procedure using the commercial DNAzol reagent was successfully applied to extract genomic DNA from 25 fungal species. The DNA yield varied from 306 to 1,927 microg g(-1) dry mycelia and the A(260)/A(280) ratio from 1.59 to 1.93. Compared with the method of J.L. Cenis (Nucleic Acids Res. 1992, 20: 2380) this procedure generated a higher DNA yield from 17 species and a higher A(260)/A(280) ratio from 23 species. But for four species, Cenis (1992) method was more suitable. No inhibitor of polymerase chain reaction was evident for the DNA extracted by the modified procedure, whereas some inhibitors remained in DNA of eight species extracted by the previous method.

  18. Effect of DNA extraction in the Rosa canina L. identification under different processing temperature

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2017-01-01

    Full Text Available Rosa canina, L. is widely used for medicinal purposes as well as in food industry where it is a valuable source, bioactive compounds and natural colorants. Actually, no specific method is recommended as suitable one for DNA extraction from rose hips. The aim of the study was to compare three commercial and three non-commercial methods to extract total genomic DNA from rose hips hyphanthium. Four methods are based on the precipitation in principle and two methods are based on resin-binding. Extracted DNA was proved for the effectivity in following PCR. In total, six different DNA isolations was performed for differently heat processes rose hips - fresh hyphanthium, 2-weeks frozen hyphanthium, dried hyphanthium (50 °C and boiled hyphanthium (100 °C. The amplification parameters of 500 bp chloroplast gene amplicon were evaluated. Obtained amounts of extracted DNA was very variable not only for every individual method used but for individual treatment of samples, too. In general, non-commercial method provided higher amount of extracted DNA, but the A260/280 ratio was lower. When regarding the processing treatment of the samples, high differences were found among the samples untreated by heat and those that were dried or boiled for three of the used extraction methods. All the samples were positive for amplification, but different amounts of amplified product were obtained. The comparison of data for concentrations of extracted DNA and concentrations of amplified product showed large differences when regarding the achieved purity of DNA in extraction.

  19. Rapid and simple method by combining FTA™ card DNA extraction with two set multiplex PCR for simultaneous detection of non-O157 Shiga toxin-producing Escherichia coli strains and virulence genes in food samples.

    Science.gov (United States)

    Kim, S A; Park, S H; Lee, S I; Ricke, S C

    2017-12-01

    The aim of this research was to optimize two multiplex polymerase chain reaction (PCR) assays that could simultaneously detect six non-O157 Shiga toxin-producing Escherichia coli (STEC) as well as the three virulence genes. We also investigated the potential of combining the FTA™ card-based DNA extraction with the multiplex PCR assays. Two multiplex PCR assays were optimized using six primer pairs for each non-O157 STEC serogroup and three primer pairs for virulence genes respectively. Each STEC strain specific primer pair only amplified 155, 238, 321, 438, 587 and 750 bp product for O26, O45, O103, O111, O121 and O145 respectively. Three virulence genes were successfully multiplexed: 375 bp for eae, 655 bp for stx1 and 477 bp for stx2. When two multiplex PCR assays were validated with ground beef samples, distinctive bands were also successfully produced. Since the two multiplex PCR examined here can be conducted under the same PCR conditions, the six non-O157 STEC and their virulence genes could be concurrently detected with one run on the thermocycler. In addition, all bands clearly appeared to be amplified by FTA card DNA extraction in the multiplex PCR assay from the ground beef sample, suggesting that an FTA card could be a viable sampling approach for rapid and simple DNA extraction to reduce time and labour and therefore may have practical use for the food industry. Two multiplex polymerase chain reaction (PCR) assays were optimized for discrimination of six non-O157 Shiga toxin-producing Escherichia coli (STEC) and identification of their major virulence genes within a single reaction, simultaneously. This study also determined the successful ability of the FTA™ card as an alternative to commercial DNA extraction method for conducting multiplex STEC PCR assays. The FTA™ card combined with multiplex PCR holds promise for the food industry by offering a simple and rapid DNA sample method for reducing time, cost and labour for detection of STEC in

  20. Noninvasive genetic sampling of endangered muriqui (Primates, Atelidae: efficiency of fecal DNA extraction

    Directory of Open Access Journals (Sweden)

    Paulo B. Chaves

    2006-01-01

    Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.

  1. Comparison of mentha extracts obtained by different extraction methods

    Directory of Open Access Journals (Sweden)

    Milić Slavica

    2006-01-01

    Full Text Available The different methods of mentha extraction, such as steam distillation, extraction by methylene chloride (Soxhlet extraction and supercritical fluid extraction (SFE by carbon dioxide (CO J were investigated. SFE by CO, was performed at pressure of 100 bar and temperature of40°C. The extraction yield, as well as qualitative and quantitative composition of obtained extracts, determined by GC-MS method, were compared.

  2. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    Science.gov (United States)

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

    2014-11-01

    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  3. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples.

    Science.gov (United States)

    Miller, D N; Bryant, J E; Madsen, E L; Ghiorse, W C

    1999-11-01

    We compared and statistically evaluated the effectiveness of nine DNA extraction procedures by using frozen and dried samples of two silt loam soils and a silt loam wetland sediment with different organic matter contents. The effects of different chemical extractants (sodium dodecyl sulfate [SDS], chloroform, phenol, Chelex 100, and guanadinium isothiocyanate), different physical disruption methods (bead mill homogenization and freeze-thaw lysis), and lysozyme digestion were evaluated based on the yield and molecular size of the recovered DNA. Pairwise comparisons of the nine extraction procedures revealed that bead mill homogenization with SDS combined with either chloroform or phenol optimized both the amount of DNA extracted and the molecular size of the DNA (maximum size, 16 to 20 kb). Neither lysozyme digestion before SDS treatment nor guanidine isothiocyanate treatment nor addition of Chelex 100 resin improved the DNA yields. Bead mill homogenization in a lysis mixture containing chloroform, SDS, NaCl, and phosphate-Tris buffer (pH 8) was found to be the best physical lysis technique when DNA yield and cell lysis efficiency were used as criteria. The bead mill homogenization conditions were also optimized for speed and duration with two different homogenizers. Recovery of high-molecular-weight DNA was greatest when we used lower speeds and shorter times (30 to 120 s). We evaluated four different DNA purification methods (silica-based DNA binding, agarose gel electrophoresis, ammonium acetate precipitation, and Sephadex G-200 gel filtration) for DNA recovery and removal of PCR inhibitors from crude extracts. Sephadex G-200 spin column purification was found to be the best method for removing PCR-inhibiting substances while minimizing DNA loss during purification. Our results indicate that for these types of samples, optimum DNA recovery requires brief, low-speed bead mill homogenization in the presence of a phosphate-buffered SDS-chloroform mixture, followed

  4. Simplified extraction of good quality genomic DNA from a variety of ...

    African Journals Online (AJOL)

    Depending on the nature and complexity of plant material, proper method needs to be employed for extraction of genomic DNA, along with its performance evaluation by different molecular techniques. Here, we optimized and employed a simple genomic DNA isolation protocol suitable for a variety of plant materials ...

  5. Comparison of five DNA quantification methods

    DEFF Research Database (Denmark)

    Nielsen, Karsten; Mogensen, Helle Smidt; Hedman, Johannes

    2008-01-01

    Six commercial preparations of human genomic DNA were quantified using five quantification methods: UV spectrometry, SYBR-Green dye staining, slot blot hybridization with the probe D17Z1, Quantifiler Human DNA Quantification kit and RB1 rt-PCR. All methods measured higher DNA concentrations than...... Quantification kit in two experiments. The measured DNA concentrations with Quantifiler were 125 and 160% higher than expected based on the manufacturers' information. When the Quantifiler human DNA standard (Raji cell line) was replaced by the commercial human DNA preparation G147A (Promega) to generate the DNA...... standard curve in the Quantifiler Human DNA Quantification kit, the DNA quantification results of the human DNA preparations were 31% higher than expected based on the manufacturers' information. The results indicate a calibration problem with the Quantifiler human DNA standard for its use...

  6. Comparison of protocols for genomic DNA extraction from 'velame ...

    African Journals Online (AJOL)

    usuario

    2013-07-24

    Jul 24, 2013 ... involving C. linearifolius, we compared the efficiency of six protocols for genomic DNA extraction previously ... phytic, with diverse aspect and floristics, average rainfall between ..... The variation observed for DNA concentrations estimated with .... performed with protocol 1 (data not shown), or still, bands.

  7. Comparison of DNA quantification methodology used in the DNA extraction protocol for the UK Biobank cohort.

    Science.gov (United States)

    Welsh, Samantha; Peakman, Tim; Sheard, Simon; Almond, Rachael

    2017-01-05

    UK Biobank is a large prospective cohort study in the UK established by the Medical Research Council (MRC) and the Wellcome Trust to enable approved researchers to investigate the role of genetic factors, environmental exposures and lifestyle in the causes of major diseases of late and middle age. A wide range of phenotypic data has been collected at recruitment and has recently been enhanced by the UK Biobank Genotyping Project. All UK Biobank participants (500,000) have been genotyped on either the UK Biobank Axiom® Array or the Affymetrix UK BiLEVE Axiom® Array and the workflow for preparing samples for genotyping is described. The genetic data is hoped to provide further insight into the genetics of disease. All data, including the genetic data, is available for access to approved researchers. Data for two methods of DNA quantification (ultraviolet-visible spectroscopy [UV/Vis]) measured on the Trinean DropSense™ 96 and PicoGreen®) were compared by two laboratories (UK Biobank and Affymetrix). The sample processing workflow established at UK Biobank, for genotyping on the custom Affymetrix Axiom® array, resulted in high quality DNA (average DNA concentration 38.13 ng/μL, average 260/280 absorbance 1.91). The DNA generated high quality genotype data (average call rate 99.48% and pass rate 99.45%). The DNA concentration measured on the Trinean DropSense™ 96 at UK Biobank correlated well with DNA concentration measured by PicoGreen® at Affymetrix (r = 0.85). The UK Biobank Genotyping Project demonstrated that the high throughput DNA extraction protocol described generates high quality DNA suitable for genotyping on the Affymetrix Axiom array. The correlation between DNA concentration derived from UV/Vis and PicoGreen® quantification methods suggests, in large-scale genetic studies involving two laboratories, it may be possible to remove the DNA quantification step in one laboratory without affecting downstream analyses. This would result in

  8. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  9. Digital PCR for direct quantification of viruses without DNA extraction

    OpenAIRE

    Pav?i?, Jernej; ?el, Jana; Milavec, Mojca

    2015-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration mat...

  10. A simple Chelex protocol for DNA extraction from Anopheles spp.

    Science.gov (United States)

    Musapa, Mulenga; Kumwenda, Taida; Mkulama, Mtawa; Chishimba, Sandra; Norris, Douglas E; Thuma, Philip E; Mharakurwa, Sungano

    2013-01-09

    Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens. We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km(2) vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol(9,10). The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction(9). Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality, a PCR for identification of Anopheles gambiae sibling species(10) and a nested PCR for typing of Plasmodium falciparum infection

  11. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Fluorescence resonance energy transfer-based real-time polymerase chain reaction method without DNA extraction for the genotyping of F5, F2, F12, MTHFR, and HFE.

    Science.gov (United States)

    Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan

    2014-01-01

    Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.

  13. Microbes on building materials - Evaluation of DNA extraction protocols as common basis for molecular analysis

    Energy Technology Data Exchange (ETDEWEB)

    Ettenauer, Joerg D., E-mail: joerg.ettenauer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Pinar, Guadalupe, E-mail: Guadalupe.Pinar@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Lopandic, Ksenija, E-mail: Ksenija.Lopandic@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Spangl, Bernhard, E-mail: Bernhard.Spangl@boku.ac.at [University of Natural Resources and Life Sciences, Department of Landscape, Spatial and Infrastructure Science, Institute of Applied Statistics and Computing (IASC), Gregor Mendel-Str. 33, A-1180 Vienna (Austria); Ellersdorfer, Guenther, E-mail: Guenther.Ellersdorfer@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Voitl, Christian, E-mail: Christian.Voitl@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria); Sterflinger, Katja, E-mail: Katja.Sterflinger@boku.ac.at [VIBT-BOKU, University of Natural Resources and Life Sciences, Department of Biotechnology, Muthgasse 11, A-1190 Vienna (Austria)

    2012-11-15

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials - common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: Black-Right-Pointing-Pointer Up to thirteen extraction methods were evaluated with three

  14. Microbes on building materials — Evaluation of DNA extraction protocols as common basis for molecular analysis

    International Nuclear Information System (INIS)

    Ettenauer, Jörg D.; Piñar, Guadalupe; Lopandic, Ksenija; Spangl, Bernhard; Ellersdorfer, Günther; Voitl, Christian; Sterflinger, Katja

    2012-01-01

    The study of microbial life in building materials is an emerging topic concerning biodeterioration of materials as well as health risks in houses and at working places. Biodegradation and potential health implications associated with microbial growth in our residues claim for more precise methods for quantification and identification. To date, cultivation experiments are commonly used to gain insight into the microbial diversity. Nowadays, molecular techniques for the identification of microorganisms provide efficient methods that can be applied in this field. The efficiency of DNA extraction is decisive in order to perform a reliable and reproducible quantification of the microorganisms by qPCR or to characterize the structure of the microbial community. In this study we tested thirteen DNA extraction methods and evaluated their efficiency for identifying (1) the quantity of DNA, (2) the quality and purity of DNA and (3) the ability of the DNA to be amplified in a PCR reaction using three universal primer sets for the ITS region of fungi as well as one primer pair targeting the 16S rRNA of bacteria with three typical building materials — common plaster, red brick and gypsum cardboard. DNA concentration measurements showed strong variations among the tested methods and materials. Measurement of the DNA yield showed up to three orders of magnitude variation from the same samples, whereas A260/A280 ratios often prognosticated biases in the PCR amplifications. Visualization of the crude DNA extracts and the comparison of DGGE fingerprints showed additional drawbacks of some methods. The FastDNA Spin kit for soil showed to be the best DNA extraction method and could provide positive results for all tests with the three building materials. Therefore, we suggest this method as a gold standard for quantification of indoor fungi and bacteria in building materials. -- Highlights: ► Up to thirteen extraction methods were evaluated with three building materials.

  15. Digital PCR for direct quantification of viruses without DNA extraction.

    Science.gov (United States)

    Pavšič, Jernej; Žel, Jana; Milavec, Mojca

    2016-01-01

    DNA extraction before amplification is considered an essential step for quantification of viral DNA using real-time PCR (qPCR). However, this can directly affect the final measurements due to variable DNA yields and removal of inhibitors, which leads to increased inter-laboratory variability of qPCR measurements and reduced agreement on viral loads. Digital PCR (dPCR) might be an advantageous methodology for the measurement of virus concentrations, as it does not depend on any calibration material and it has higher tolerance to inhibitors. DNA quantification without an extraction step (i.e. direct quantification) was performed here using dPCR and two different human cytomegalovirus whole-virus materials. Two dPCR platforms were used for this direct quantification of the viral DNA, and these were compared with quantification of the extracted viral DNA in terms of yield and variability. Direct quantification of both whole-virus materials present in simple matrices like cell lysate or Tris-HCl buffer provided repeatable measurements of virus concentrations that were probably in closer agreement with the actual viral load than when estimated through quantification of the extracted DNA. Direct dPCR quantification of other viruses, reference materials and clinically relevant matrices is now needed to show the full versatility of this very promising and cost-efficient development in virus quantification.

  16. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  17. How to open the treasure chest? Optimising DNA extraction from herbarium specimens.

    Science.gov (United States)

    Särkinen, Tiina; Staats, Martijn; Richardson, James E; Cowan, Robyn S; Bakker, Freek T

    2012-01-01

    Herbarium collections are potentially an enormous resource for DNA studies, but the use of herbarium specimens in molecular studies has thus far been slowed down by difficulty in obtaining amplifiable DNA. Here we compare a set of commercially available DNA extraction protocols and their performance in terms of DNA purity and yield, and PCR amplification success as measured by using three differentially sized markers, the rbcL barcoding marker (cpDNA), the LEAFY exon 3 (nrDNA), and the trnL((UAA)) P6 loop (cpDNA). Results reveal large differences between extraction methods, where DNA purity rather than yield is shown to be strongly correlated with PCR success. Amplicon size shows similarly strong correlation with PCR success, with the shortest fragment showing the highest success rate (78%, P6 loop, 10-143 base pairs (bp)) and the largest fragment the lowest success (10%, rbcL, 670 bp). The effect of specimen preparation method on PCR success was also tested. Results show that drying method strongly affects PCR success, especially the availability of fragments longer than 250 bp, where longer fragments are more available for PCR amplification in air dried material compared to alcohol dried specimens. Results from our study indicate that projects relying on poor-quality starting material such as herbarium or scat samples should focus on extracting pure DNA and aim to amplify short target regions (herbarium samples available into barcoding initiatives and other molecular studies.

  18. [DNA Extraction from Old Bones by AutoMate Express™ System].

    Science.gov (United States)

    Li, B; Lü, Z

    2017-08-01

    To establish a method for extracting DNA from old bones by AutoMate Express™ system. Bones were grinded into powder by freeze-mill. After extraction by AutoMate Express™, DNA were amplified and genotyped by Identifiler®Plus and MinFiler™ kits. DNA were extracted from 10 old bone samples, which kept in different environments with the postmortem interval from 10 to 20 years, in 3 hours by AutoMate Express™ system. Complete STR typing results were obtained from 8 samples. AutoMate Express™ system can quickly and efficiently extract DNA from old bones, which can be applied in forensic practice. Copyright© by the Editorial Department of Journal of Forensic Medicine

  19. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    Arachis hypogaea L.) is particularly problematic due to the presence of phenolic compounds and polysaccharides. Inconsistencies in extraction results can be attributed to the age and growth stages of the plant material analyzed. Mature leaves ...

  20. Comparison of Different Drying Methods for Recovery of Mushroom DNA.

    Science.gov (United States)

    Wang, Shouxian; Liu, Yu; Xu, Jianping

    2017-06-07

    Several methods have been reported for drying mushroom specimens for population genetic, taxonomic, and phylogenetic studies. However, most methods have not been directly compared for their effectiveness in preserving mushroom DNA. In this study, we compared silica gel drying at ambient temperature and oven drying at seven different temperatures. Two mushroom species representing two types of fruiting bodies were examined: the fleshy button mushroom Agaricus bisporus and the leathery shelf fungus Trametes versicolor. For each species dried with the eight methods, we assessed the mushroom water loss rate, the quality and quantity of extracted DNA, and the effectiveness of using the extracted DNA as a template for PCR amplification of two DNA fragments (ITS and a single copy gene). Dried specimens from all tested methods yielded sufficient DNA for PCR amplification of the two genes in both species. However, differences among the methods for the two species were found in: (i) the time required by different drying methods for the fresh mushroom tissue to reach a stable weight; and (ii) the relative quality and quantity of the extracted genomic DNA. Among these methods, oven drying at 70 °C for 3-4 h seemed the most efficient for preserving field mushroom samples for subsequent molecular work.

  1. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    Science.gov (United States)

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  2. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    Science.gov (United States)

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  3. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  4. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    Energy Technology Data Exchange (ETDEWEB)

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  5. Automated DNA extraction from genetically modified maize using aminosilane-modified bacterial magnetic particles.

    Science.gov (United States)

    Ota, Hiroyuki; Lim, Tae-Kyu; Tanaka, Tsuyoshi; Yoshino, Tomoko; Harada, Manabu; Matsunaga, Tadashi

    2006-09-18

    A novel, automated system, PNE-1080, equipped with eight automated pestle units and a spectrophotometer was developed for genomic DNA extraction from maize using aminosilane-modified bacterial magnetic particles (BMPs). The use of aminosilane-modified BMPs allowed highly accurate DNA recovery. The (A(260)-A(320)):(A(280)-A(320)) ratio of the extracted DNA was 1.9+/-0.1. The DNA quality was sufficiently pure for PCR analysis. The PNE-1080 offered rapid assay completion (30 min) with high accuracy. Furthermore, the results of real-time PCR confirmed that our proposed method permitted the accurate determination of genetically modified DNA composition and correlated well with results obtained by conventional cetyltrimethylammonium bromide (CTAB)-based methods.

  6. Rapid Extraction of Genomic DNA from Medically Important Yeasts and Filamentous Fungi by High-Speed Cell Disruption

    OpenAIRE

    Müller, Frank-Michael C.; Werner, Katherine E.; Kasai, Miki; Francesconi, Andrea; Chanock, Stephen J.; Walsh, Thomas J.

    1998-01-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolatio...

  7. DNA extraction from wings as a suitable approach for queen bees genotyping

    Directory of Open Access Journals (Sweden)

    Elena Facchini

    2018-06-01

    Full Text Available In livestock, genomics has been used since a decade in combination with phenotypic information for the estimation of breeding values. In honey bees (Apis mellifera, the advantage for including genomics in selective breeding programmes is represented by the possibility to reduce the generation interval and increase the accuracies of estimated breeding values resulting in higher genetic gain (Brascamp et al., 2018. The limit for this application is DNA extraction. Extraction methods for small animals such as insects often rely upon destructive approaches. The challenge is to develop tissue sampling methods that permit the survival of the animal while providing adequate quality DNA for genotyping. Along with previous reports of DNA extraction from several matrices, this study aims to contribute in developing suitable methodologies for genotyping honey bees queens using DNA extracted from wing cuttings (Chaline et al., 2004; Gregory and Rinderer, 2004; Gould et al., 2011. The clipping of the queen wings in beekeeping is a common practice and it ensures the survival and normal activities of the animal (Forster, 1971. A total of 57 queens with known pedigree were enrolled for this study. Wings from each queen were cut and stored at -20°C until processed (Fig. 1. Extractions were carried out using a modified protocol provided by Qiagen (DNeasy® Blood & Tissue. The modification consists in an initial incubation of the samples with proteinase K for 20 minutes, further steps are carried out following the manufacturer’s instructions. To test the suitability of the extracted DNA for genotyping, PCR was performed on Esterase FE4 like gene. Although quantification with NanoDrop™ resulted in <20 ng/μL of DNA in solution, the extracted material was sufficient for PCR amplification of candidate genes for sequencing and genotyping. Our results show that it is possible to extract DNA from wings’ cuttings permitting to implement genomic approaches in honey

  8. Nonhomologous DNA End Joining in Cell-Free Extracts

    Directory of Open Access Journals (Sweden)

    Sheetal Sharma

    2010-01-01

    Full Text Available Among various DNA damages, double-strand breaks (DSBs are considered as most deleterious, as they may lead to chromosomal rearrangements and cancer when unrepaired. Nonhomologous DNA end joining (NHEJ is one of the major DSB repair pathways in higher organisms. A large number of studies on NHEJ are based on in vitro systems using cell-free extracts. In this paper, we summarize the studies on NHEJ performed by various groups in different cell-free repair systems.

  9. Avaliação de dois métodos de extração de DNA de material parafinado para amplificação em PCR Evaluation of two methods of DNA extraction from paraffin-embedded material for PCR amplification

    Directory of Open Access Journals (Sweden)

    Luciana Estevam Simonato

    2007-04-01

    Full Text Available INTRODUÇÃO: Diversos métodos para extração de DNA a partir de tecidos biológicos inclusos em parafina encontram-se descritos na literatura, sendo o sucesso desse procedimento de grande importância para a realização de métodos moleculares de diagnóstico empregando a reação em cadeia da polimerase (PCR. OBJETIVO: Este estudo avaliou dois métodos de extração de DNA de material parafinado, visando à amplificação do DNA genômico pela técnica da PCR. MATERIAL E MÉTODO: Foram utilizadas 35 amostras de casos de carcinoma epidermóide de assoalho bucal diagnosticados e tratados no Centro de Oncologia Bucal da Universidade Estadual Paulista (Unesp. Os métodos de extração de DNA avaliados incluíram: 1. digestão com proteinase K seguida por purificação com Chelex 100® (BioRad; e 2. sistema QIAamp DNA minikit® (Qiagen. O DNA obtido foi quantificado por espectrofotometria e amplificado pela técnica da PCR, utilizando-se oligonucleotídeos iniciadores para betaglobina. RESULTADOS: A concentração de DNA obtido do material extraído com o primeiro método apresentou média de 120,62 ng/µl com razão entre as leituras das absorbâncias 260/280 variando de 0,8 a 1,41. Para as amostras extraídas com o segundo procedimento, o rendimento médio foi de 67,38 ng/µl, no entanto a razão 260/280 variou entre 1,11 e 2,53. O material foi submetido à PCR e, das 35 amostras extraídas com cada método, respectivamente, 29 e 30 apresentaram sinal positivo. CONCLUSÃO: Os dois métodos utilizados para obtenção de DNA de material parafinado apresentaram desempenho semelhante, revelando que ambos têm potencial para auxiliar na prática da biologia molecular diagnóstica, assim como no estudo diagnóstico retrospectivo em material parafinizado.BACKGROUND: There are several methods for DNA extraction from formalin-fixed paraffin-embedded tissues reported in the literature. High success rate on this procedure is important for the use of

  10. An effective method for extraction and polymerase chain reaction ...

    African Journals Online (AJOL)

    The PCR amplification with the NaOH and PBS treatment had a success rate of 30 to 100% for both mitochondrial and nuclear markers. The PBS method is the best method for extraction of DNA from formalin-preserved samples of longer period (two to seven years) because of higher success rate in amplifying mitochondrial ...

  11. Dichlorvos exposure impedes extraction and amplification of DNA from insects in museum collections

    Directory of Open Access Journals (Sweden)

    Åkerlund Monika

    2010-01-01

    Full Text Available Abstract Background The insecticides dichlorvos, paradichlorobenzene and naphthalene have been commonly used to eradicate pest insects from natural history collections. However, it is not known how these chemicals affect the DNA of the specimens in the collections. We thus tested the effect of dichlorvos, paradichlorobenzene and naphthalene on DNA of insects (Musca domestica by extracting and amplifying DNA from specimens exposed to insecticides in two different concentrations over increasing time intervals. Results The results clearly show that dichlorvos impedes both extraction and amplification of mitochondrial and nuclear DNA after relatively short time, whereas paradichlorobenzene and naphthalene do not. Conclusion Collections treated with paradichlorobenzene and naphthalene, are better preserved concerning DNA, than those treated with dichlorvos. Non toxic pest control methods should, however, be preferred due to physical damage of specimens and putative health risks by chemicals.

  12. Fluorescence resonance energy transfer-based real-time polymerase chain reaction method without DNA extraction for the genotyping of F5, F2, F12, MTHFR, and HFE

    Directory of Open Access Journals (Sweden)

    Martinez-Serra J

    2014-06-01

    Full Text Available Jordi Martinez-Serra,1 Juan Robles,2 Antoni Nicolàs,3 Antonio Gutierrez,1 Teresa Ros,1 Juan Carlos Amat,1 Regina Alemany,4 Oliver Vögler,4 Aina Abelló,2 Aina Noguera,2 Joan Besalduch1 1Department of Hematology, 2Department of Clinical Analysis, Hospital Universitary Son Espases, Palma de Mallorca, Spain; 3ECOGEN, Barcelona, 4Department of Cell Biology, University of the Balearic Islands, Palma de Mallorca, Spain Abstract: Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC. In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler® 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE. After testing 34 samples comparing the real-time crossing point (CP values between WBC (5×106 WBC/mL and purified DNA (20 ng/µL, the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×106 WBC/mL instead of DNA (20 ng/µL, we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction

  13. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    A study was conducted to optimize the efficient combination of lysis buffer, proteinase K, incubation time, phenol-chloroform-isoamyl alcohol (PCI) volume, spinning rate (rpm), and precipitation agent on quantity and quality of DNA extracted from various volumes of avian blood. Blood samples were collected in EDTA and ...

  14. Ancient DNA in historical parchments - identifying a procedure for extraction and amplification of genetic material.

    Science.gov (United States)

    Lech, T

    2016-05-06

    Historical parchments in the form of documents, manuscripts, books, or letters, make up a large portion of cultural heritage collections. Their priceless historical value is associated with not only their content, but also the information hidden in the DNA deposited on them. Analyses of ancient DNA (aDNA) retrieved from parchments can be used in various investigations, including, but not limited to, studying their authentication, tracing the development of the culture, diplomacy, and technology, as well as obtaining information on the usage and domestication of animals. This article proposes and verifies a procedure for aDNA recovery from historical parchments and its appropriate preparation for further analyses. This study involved experimental selection of an aDNA extraction method with the highest efficiency and quality of extracted genetic material, from among the multi-stage phenol-chloroform extraction methods, and the modern, column-based techniques that use selective DNA-binding membranes. Moreover, current techniques to amplify entire genetic material were questioned, and the possibility of using mitochondrial DNA for species identification was analyzed. The usefulness of the proposed procedure was successfully confirmed in identification tests of historical parchments dating back to the 13-16th century AD.

  15. Does DNA extraction affect the physical and chemical composition of historical cod (Gadus morhua) otoliths?

    DEFF Research Database (Denmark)

    Therkildsen, Nina Overgaard; Eg Nielsen, Einar; Hüssy, Karin

    2010-01-01

    Archived otoliths constitute an important source of historical DNA for use in temporal genetic studies, but such otoliths are also valuable for other research applications, e.g. growth or microchemistry studies, where information about the past is of relevance. Consequently, there are potentially...... conflicting interests regarding how the limited and irreplaceable otolith collections should be used. To resolve this, it is important to find out whether DNA extraction damages otoliths such that they can no longer be used for other research purposes or whether individual otoliths can be used in multiple...... applications. We examined the effects of three different DNA extraction methods on the elemental composition, the morphology, and the clarity of annual growth increments for successful age estimation of Atlantic cod (Gadus morhua) otoliths that had been archived for 0–31 years. The three extraction methods...

  16. Application of FTA technology to extraction of sperm DNA from mixed body fluids containing semen.

    Science.gov (United States)

    Fujita, Yoshihiko; Kubo, Shin-ichi

    2006-01-01

    FTA technology is a novel method designed to simplify the collection, shipment, archiving and purification of nucleic acids from a wide variety of biological sources. In this study, we report a rapid and simple method of extracting DNA from sperm when body fluids mixed with semen were collected using FTA cards. After proteinase K digestion of the sperm and body fluid mixture, the washed pellet suspension as the sperm fraction and the concentrated supernatant as the epithelial cell fraction were respectively applied to FTA cards containing DTT. The FTA cards were dried, then directly added to a polymerase chain reaction (PCR) mix and processed by PCR. The time required from separation of the mixed fluid into sperm and epithelial origin DNA extractions was only about 2.5-3h. Furthermore, the procedure was extremely simple. It is considered that our designed DNA extraction procedure using an FTA card is available for application to routine work.

  17. Comparison of two commercial DNA extraction kits for the analysis of nasopharyngeal bacterial communities

    Directory of Open Access Journals (Sweden)

    Keith A. Crandall

    2016-04-01

    Full Text Available Characterization of microbial communities via next-generation sequencing (NGS requires an extraction ofmicrobial DNA. Methodological differences in DNA extraction protocols may bias results and complicate inter-study comparisons. Here we compare the effect of two commonly used commercial kits (Norgen and Qiagenfor the extraction of total DNA on estimatingnasopharyngeal microbiome diversity. The nasopharynxis a reservoir for pathogens associated with respiratory illnesses and a key player in understandingairway microbial dynamics. Total DNA from nasal washes corresponding to 30 asthmatic children was extracted using theQiagenQIAamp DNA and NorgenRNA/DNA Purification kits and analyzed via IlluminaMiSeq16S rRNA V4 ampliconsequencing. The Norgen samples included more sequence reads and OTUs per sample than the Qiagen samples, but OTU counts per sample varied proportionallybetween groups (r = 0.732.Microbial profiles varied slightly between sample pairs, but alpha- and beta-diversity indices (PCoAand clustering showed highsimilarity between Norgen and Qiagenmicrobiomes. Moreover, no significant differences in community structure (PERMANOVA and adonis tests and taxa proportions (Kruskal-Wallis test were observed betweenkits. Finally, aProcrustes analysis also showed low dissimilarity (M2 = 0.173; P< 0.001 between the PCoAs of the two DNA extraction kits. Contrary to what has been observed in previous studies comparing DNA extraction methods, our 16S NGS analysis of nasopharyngeal washes did not reveal significant differences in community composition or structure between kits. Our findingssuggest congruence between column-based chromatography kits and supportthe comparison of microbiomeprofilesacross nasopharyngeal metataxonomic studies.

  18. An improved protocol and a new grinding device for extraction of genomic DNA from microorganisms by a two-step extraction procedure.

    Science.gov (United States)

    Zhang, S S; Chen, D; Lu, Q

    2012-05-21

    Current protocols to extract genomic DNA from microorganisms are still laborious, tedious and costly, especially for the species with thick cell walls. In order to improve the effectiveness of extracting DNA from microbial samples, a novel protocol, defined as two-step extraction method, along with an improved tissue-grinding device, was developed. The protocol included two steps, disruption of microbial cells or spores by grinding the sample together with silica sand in a new device and extraction of DNA with an effective buffer containing cell lysis chemicals. The device was prepared by using a commercial electric mini-grinder, adapted with a grinding stone, and a sample cup processed by lathing from a polytetrafluoroethylene rod. We tested the method with vegetative cells of four microbial species and two microbial spores that have thick cell walls and are therefore hard to process; these included Escherichia coli JM109, Bacillus subtilis WB600, Sacchromyces cerevisiae INVSc1, Trichoderma viride AS3.3711, and the spores of S. cerevisiae and T. viride, respectively, representing Gram-positive bacteria, Gram-negative bacteria, yeast, filamentous fungi. We found that this new method and device extracted usable quantities of genomic DNA from the samples. The DNA fragments that were extracted exceeded 23 kb. The target sequences up to about 5 kb were successfully and exclusively amplified by PCR using extracted DNA as the template. In addition, the DNA extraction was finalized within 1.5 h. Thus, we conclude that this two-step extraction method is an effective and improved protocol for extraction of genomic DNA from microbial samples.

  19. Separation/extraction, detection, and interpretation of DNA mixtures in forensic science (review).

    Science.gov (United States)

    Tao, Ruiyang; Wang, Shouyu; Zhang, Jiashuo; Zhang, Jingyi; Yang, Zihao; Sheng, Xiang; Hou, Yiping; Zhang, Suhua; Li, Chengtao

    2018-05-25

    Interpreting mixed DNA samples containing material from multiple contributors has long been considered a major challenge in forensic casework, especially when encountering low-template DNA (LT-DNA) or high-order mixtures that may involve missing alleles (dropout) and unrelated alleles (drop-in), among others. In the last decades, extraordinary progress has been made in the analysis of mixed DNA samples, which has led to increasing attention to this research field. The advent of new methods for the separation and extraction of DNA from mixtures, novel or jointly applied genetic markers for detection and reliable interpretation approaches for estimating the weight of evidence, as well as the powerful massively parallel sequencing (MPS) technology, has greatly extended the range of mixed samples that can be correctly analyzed. Here, we summarized the investigative approaches and progress in the field of forensic DNA mixture analysis, hoping to provide some assistance to forensic practitioners and to promote further development involving this issue.

  20. Extraction and phylogenetic survey of extracellular and intracellular DNA in marine sediments

    DEFF Research Database (Denmark)

    Torti, Andrea

    indeed inflate richness estimates of sediments microbial communities, and point to a role of bioturbation in shaping the prokaryotic diversity of the eDNA pool at the investigated site. Analysis of 18S RNA gene sequences revealed a diverse collection of eukaryotic taxa throughout the sediment column......DNA, and validated for minimal cell lysis during the eDNA extraction process. The optimized method was applied to investigate and compare the bacterial, archaeal, and eukaryotic diversity within iDNA and eDNA pools, in the context of differing geochemical and lithological zones in the Holocene sediment column...... of Aarhus Bay (Demark). Using high-throughput sequencing technologies, I first explored whether, and to what extent, prokaryotic eDNA parallels the phylogenetic composition of the local microbiome. Phylogenetic analyses revealed that, in near-surface sediments influenced by faunal activities, 50% of all...

  1. Automated extraction of DNA and PCR setup using a Tecan Freedom EVO® liquid handler

    DEFF Research Database (Denmark)

    Frøslev, Tobias Guldberg; Hansen, Anders Johannes; Stangegaard, Michael

    2009-01-01

    We have implemented and validated automated protocols for DNA extraction and PCR setup using a Tecan Freedom EVO® liquid handler mounted with the TeMagS magnetic separation device. The methods were validated for accredited, forensic genetic work according to ISO 17025 using the Qiagen Mag...... genetic DNA typing can be implemented on a simple robot leading to the reduction of manual work as well as increased quality and throughput....

  2. A simple method for DNA isolation from Xanthomonas spp.

    Directory of Open Access Journals (Sweden)

    Gomes Luiz Humberto

    2000-01-01

    Full Text Available A simple DNA isolation method was developed with routine chemicals that yields high quality and integrity preparations when compared to some of the most well known protocols. The method described does not require the use of lysing enzymes, water bath and the DNA was obtained within 40 minutes The amount of nucleic acid extracted (measured in terms of absorbancy at 260 nm from strains of Xanthomonas spp., Pseudomonas spp. and Erwinia spp. was two to five times higher than that of the most commonly used method.

  3. Extraction of high quality DNA from seized Moroccan cannabis resin (Hashish.

    Directory of Open Access Journals (Sweden)

    Moulay Abdelaziz El Alaoui

    Full Text Available The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004 adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR amplification of tetrahydrocannabinolic acid (THCA synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances.

  4. Rapid extraction of genomic DNA from medically important yeasts and filamentous fungi by high-speed cell disruption.

    Science.gov (United States)

    Müller, F M; Werner, K E; Kasai, M; Francesconi, A; Chanock, S J; Walsh, T J

    1998-06-01

    Current methods of DNA extraction from different fungal pathogens are often time-consuming and require the use of toxic chemicals. DNA isolation from some fungal organisms is difficult due to cell walls or capsules that are not readily susceptible to lysis. We therefore investigated a new and rapid DNA isolation method using high-speed cell disruption (HSCD) incorporating chaotropic reagents and lysing matrices in comparison to standard phenol-chloroform (PC) extraction protocols for isolation of DNA from three medically important yeasts (Candida albicans, Cryptococcus neoformans, and Trichosporon beigelii) and two filamentous fungi (Aspergillus fumigatus and Fusarium solani). Additional extractions by HSCD were performed on Saccharomyces cerevisiae, Pseudallescheria boydii, and Rhizopus arrhizus. Two different inocula (10(8) and 10(7) CFU) were compared for optimization of obtained yields. The entire extraction procedure was performed on as many as 12 samples within 1 h compared to 6 h for PC extraction. In comparison to the PC procedure, HSCD DNA extraction demonstrated significantly greater yields for 10(8) CFU of C. albicans, T. beigelii, A. fumigatus, and F. solani (P extraction and PC extraction. For 10(7) CFU of T. beigelii, PC extraction resulted in a greater yield than did HSCD (P fungi than for yeasts by the HSCD extraction procedure (P extraction procedure, differences were not significant. For all eight organisms, the rapid extraction procedure resulted in good yield, integrity, and quality of DNA as demonstrated by restriction fragment length polymorphism, PCR, and random amplified polymorphic DNA. We conclude that mechanical disruption of fungal cells by HSCD is a safe, rapid, and efficient procedure for extracting genomic DNA from medically important yeasts and especially from filamentous fungi.

  5. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  6. DNA extraction from hair shafts of wild Brazilian felids and canids.

    Science.gov (United States)

    Alberts, C C; Ribeiro-Paes, J T; Aranda-Selverio, G; Cursino-Santos, J R; Moreno-Cotulio, V R; Oliveira, A L D; Porchia, B F M M; Santos, W F; Souza, E B

    2010-12-21

    Wild felids and canids are usually the main predators in the food chains where they dwell and are almost invisible to behavior and ecology researchers. Due to their grooming behavior, they tend to swallow shed hair, which shows up in the feces. DNA found in hair shafts can be used in molecular studies that can unravel, for instance, genetic variability, reproductive mode and family structure, and in some species, it is even possible to estimate migration and dispersion rates in given populations. First, however, DNA must be extracted from hair. We extracted successfully and dependably hair shaft DNA from eight wild Brazilian felids, ocelot, margay, oncilla, Geoffroy's cat, pampas cat, jaguarundi, puma, and jaguar, as well as the domestic cat and from three wild Brazilian canids, maned wolf, crab-eating fox, and hoary fox, as well as the domestic dog. Hair samples came mostly from feces collected at the São Paulo Zoo and were also gathered from non-sedated pet or from recently dead wild animals and were also collected from museum specimens. Fractions of hair samples were stained before DNA extraction, while most samples were not. Our extraction protocol is based on a feather DNA extraction technique, based in the phenol:chloroform:isoamyl alcohol general method, with proteinase K as digestive enzyme.

  7. DNA purification using dynamic solid-phase extraction on a rotationally-driven polyethylene-terephthalate microdevice

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, K.R. [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Borba, J.C. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Meija, M. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Mills, D.L. [TeGrex Technologies, Sperryville, VA 22740 (United States); Haverstick, D.M. [Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States); Olson, K.E.; Aranda, R. [Office of the Chief Scientist, Defense Forensic Science Center, N 31st Street, Atlanta, GA 30297 (United States); Garner, G.T. [Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Carrilho, E. [Instituto de Química de São Carlos, Universidade de São Paulo, São Carlos-SP (Brazil); Landers, J.P., E-mail: landers@virginia.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States); Department of Mechanical and Aerospace Engineering, University of Virginia, Charlottesville, VA 22904 (United States); Department of Pathology, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-09-21

    We report the development of a disposable polyester toner centrifugal device for semi-automated, dynamic solid phase DNA extraction (dSPE) from whole blood samples. The integration of a novel adhesive and hydrophobic valving with a simple and low cost microfabrication method allowed for sequential addition of reagents without the need for external equipment for fluid flow control. The spin-dSPE method yielded an average extraction efficiency of ∼45% from 0.6 μL of whole blood. The device performed single sample extractions or accommodate up to four samples for simultaneous DNA extraction, with PCR-readiness DNA confirmed by effective amplification of a β-globin gene. The purity of the DNA was challenged by a multiplex amplification with 16 targeted amplification sites. Successful multiplexed amplification could routinely be obtained using the purified DNA collected post an on-chip extraction, with the results comparable to those obtained with commercial DNA extraction methods. This proof-of-principle work represents a significant step towards a fully-automated low cost DNA extraction device. - Highlights: • dSPE design on centrifugal PeT device with a unique mixing strategy was proposed. • Increased fluidic control with novel adhesive tape valves on a PeT device. • Multiplexed spin-dSPE device to run up to 4 samples simultaneously. • Demonstrated strong singleplexed and multiplexed amplification following chip dSPE.

  8. Comparative analysis of different DNA extraction protocols in fresh and herbarium specimens of the genus Dalbergia.

    Science.gov (United States)

    Ribeiro, R A; Lovato, M B

    2007-03-29

    Five published DNA extraction protocols were compared for their ability to produce good quality DNA from fresh and herbarium leaves of several species of the genus Dalbergia. The leaves of these species contain high amounts of secondary metabolites, which make it difficult to perform a clean DNA extraction and thereby interfering with subsequent PCR amplification. The protocol that produced the best DNA quality in most of the Dalbergia species analyzed, utilizes polyvinylpyrrolidone to bind the phenolic compounds, a high molar concentration of NaCl to inhibit co-precipitation of polysaccharides and DNA, and LiCl for removing RNA by selective precipitation. The DNA quality of herbarium specimens was worse than that for fresh leaves, due to collecting conditions and preservation of samples. We analyzed 54 herbarium specimens, but the recovered DNA allowed successful PCR amplification in only eight. For the genus Dalbergia, the herbarium is an important source of material for phylogenetic and evolutionary studies; due to the occurrence of the different species in various geographical regions in Brazil, it is difficult to obtain fresh material in nature. Our results demonstrated that for Dalbergia species the methods used for the collection and preservation of herbarium specimens have a mayor influence on DNA quality and in the success of phylogenetic studies of the species.

  9. Molecular Combing of DNA: Methods and Applications

    DEFF Research Database (Denmark)

    Nazari, Zeniab Esmail; Gurevich, Leonid

    2013-01-01

    studies to nanoelectronics. While molecular combing has been applied in a variety of DNA-related studies, no comprehensive review has been published on different combing methods proposed so far. In this review, the underlying mechanisms of molecular combing of DNA are described followed by discussion...

  10. Comparison of different DNA isolation methods and use of dodecyle trimethyl ammonium bromide (DTAB for the isolation of DNA from meat products

    Directory of Open Access Journals (Sweden)

    Yusuf OZsENSOY

    2016-12-01

    Conclusion: DNA isolation kit, another best method, is recommended due to quality and quantity of DNA for researchers who do not want that phenol/chloroform method have toxic substances. This study is also the first study in which DTAB method is used for DNA extraction from meat products. [J Adv Vet Anim Res 2016; 3(4.000: 368-374

  11. A semi-automated magnetic capture probe based DNA extraction and real-time PCR method applied in the Swedish surveillance of Echinococcus multilocularis in red fox (Vulpes vulpes) faecal samples.

    Science.gov (United States)

    Isaksson, Mats; Hagström, Åsa; Armua-Fernandez, Maria Teresa; Wahlström, Helene; Ågren, Erik Olof; Miller, Andrea; Holmberg, Anders; Lukacs, Morten; Casulli, Adriano; Deplazes, Peter; Juremalm, Mikael

    2014-12-19

    Following the first finding of Echinococcus multilocularis in Sweden in 2011, 2985 red foxes (Vulpes vulpes) were analysed by the segmental sedimentation and counting technique. This is a labour intensive method and requires handling of the whole carcass of the fox, resulting in a costly analysis. In an effort to reduce the cost of labour and sample handling, an alternative method has been developed. The method is sensitive and partially automated for detection of E. multilocularis in faecal samples. The method has been used in the Swedish E. multilocularis monitoring program for 2012-2013 on more than 2000 faecal samples. We describe a new semi-automated magnetic capture probe DNA extraction method and real time hydrolysis probe polymerase chain reaction assay (MC-PCR) for the detection of E. multilocularis DNA in faecal samples from red fox. The diagnostic sensitivity was determined by validating the new method against the sedimentation and counting technique in fox samples collected in Switzerland where E. multilocularis is highly endemic. Of 177 foxes analysed by the sedimentation and counting technique, E. multilocularis was detected in 93 animals. Eighty-two (88%, 95% C.I 79.8-93.9) of these were positive in the MC-PCR. In foxes with more than 100 worms, the MC-PCR was positive in 44 out of 46 (95.7%) cases. The two MC-PCR negative samples originated from foxes with only immature E. multilocularis worms. In foxes with 100 worms or less, (n = 47), 38 (80.9%) were positive in the MC-PCR. The diagnostic specificity of the MC-PCR was evaluated using fox scats collected within the Swedish screening. Of 2158 samples analysed, two were positive. This implies that the specificity is at least 99.9% (C.I. = 99.7-100). The MC-PCR proved to have a high sensitivity and a very high specificity. The test is partially automated but also possible to perform manually if desired. The test is well suited for nationwide E. multilocularis surveillance programs where sampling

  12. Study of microtip-based extraction and purification of DNA from human samples for portable devices

    Science.gov (United States)

    Fotouhi, Gareth

    DNA sample preparation is essential for genetic analysis. However, rapid and easy-to-use methods are a major challenge to obtaining genetic information. Furthermore, DNA sample preparation technology must follow the growing need for point-of-care (POC) diagnostics. The current use of centrifuges, large robots, and laboratory-intensive protocols has to be minimized to meet the global challenge of limited access healthcare by bringing the lab to patients through POC devices. To address these challenges, a novel extraction method of genomic DNA from human samples is presented by using heat-cured polyethyleneimine-coated microtips generating a high electric field. The microtip extraction method is based on recent work using an electric field and capillary action integrated into an automated device. The main challenges to the method are: (1) to obtain a stable microtip surface for the controlled capture and release of DNA and (2) to improve the recovery of DNA from samples with a high concentration of inhibitors, such as human samples. The present study addresses these challenges by investigating the heat curing of polyethyleneimine (PEI) coated on the surface of the microtip. Heat-cured PEI-coated microtips are shown to control the capture and release of DNA. Protocols are developed for the extraction and purification of DNA from human samples. Heat-cured PEI-coated microtip methods of DNA sample preparation are used to extract genomic DNA from human samples. It is discovered through experiment that heat curing of a PEI layer on a gold-coated surface below 150°C could inhibit the signal of polymerase chain reaction (PCR). Below 150°C, the PEI layer is not completely cured and dissolved off the gold-coated surface. Dissolved PEI binds with DNA to inhibit PCR. Heat curing of a PEI layer above 150°C on a gold-coated surface prevents inhibition to PCR and gel electrophoresis. In comparison to gold-coated microtips, the 225°C-cured PEI-coated microtips improve the

  13. Back to basics: an evaluation of NaOH and alternative rapid DNA extraction protocols for DNA barcoding, genotyping, and disease diagnostics from fungal and oomycete samples.

    Science.gov (United States)

    Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M

    2013-01-01

    The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.

  14. DNA extraction from dry museum beetles without conferring external morphological damage

    DEFF Research Database (Denmark)

    Gilbert, M Thomas P; Moore, Wendy; Melchior, Linea

    2007-01-01

    undesirable when dealing with rare species or otherwise important specimens, such as type specimens. METHODOLOGY: We describe a method for the extraction of PCR-amplifiable mitochondrial and nuclear DNA from dry insects without causing external morphological damage. Using PCR to amplify approximately 220 bp...... of the mitochondrial gene cytochrome c oxidase I, and 250-345 bp fragments of the multi-copy, nuclear 28s ribosomal DNA gene, we demonstrate the efficacy of this method on beetles collected up to 50 years ago. CONCLUSIONS: This method offers a means of obtaining useful genetic information from rare insects without...... conferring external morphological damage. Udgivelsesdato: 2007-null...

  15. Two simple techniques for the safe Sarcoptes collection and individual mite DNA extraction.

    Science.gov (United States)

    Soglia, Dominga; Rambozzi, Luisa; Maione, Sandra; Spalenza, Veronica; Sartore, Stefano; Alasaad, Samer; Sacchi, Paola; Rossi, Luca

    2009-10-01

    Availability of mites is a recognized limiting factor of biological and genetic investigations of the genus Sarcoptes. Current methods of deoxyribonucleic acid (DNA) extraction from individual mites also need substantial improvement in efficiency and operator friendliness. We have first developed a technique for efficient and safe extraction of living mites from scabietic skin samples (crusts or deep skin scrapings). Its core device is a large plastic syringe connected with a 1.5-ml Eppendorf tube. The source material is introduced in the syringe and the device in a shoe box with the tip half of the tube emerging. Mites migrate towards a heat source during a minimum of 36 h. Then, the tube is detached and the mites utilized without risks for the operators. A second technique allows operator-friendly manipulation of individual mites for DNA extraction. Fixed mites are isolated by adhesion to a small strip of polyvinyl chloride (PVC) adhesive tape operated with tweezers. Then, mite and strip are plunged in the lyses buffer and the sample twice submitted to thermal shock for disruption of the chitinous exoskeleton. Data show that the tape does not interfere with successive DNA extraction with a commercial kit. The corresponding protocol, that we briefly name "PVC adhesive tape + thermal shock + kit DNA extraction," compares favorably with the available ones.

  16. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  17. Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resource-limited settings.

    Science.gov (United States)

    Jordan, Jeanne A; Ibe, Christine O; Moore, Miranda S; Host, Christel; Simon, Gary L

    2012-05-01

    In resource-limited settings (RLS) dried blood spots (DBS) are collected on infants and transported through provincial laboratories to a central facility where HIV-1 DNA PCR testing is performed using specialized equipment. Implementing a simpler approach not requiring such equipment or skilled personnel could allow the more numerous provincial laboratories to offer testing, improving turn-around-time to identify and treat infected infants sooner. Assess performances of a manual DNA extraction method and helicase-dependent amplification (HDA) assay for detecting HIV-1 DNA from DBS. 60 HIV-1 infected adults were enrolled, blood samples taken and DBS made. DBS extracts were assessed for DNA concentration and beta globin amplification using PCR and melt-curve analysis. These same extracts were then tested for HIV-1 DNA using HDA and compared to results generated by PCR and pyrosequencing. Finally, HDA limit of detection (LOD) studies were performed using DBS extracts prepared with known numbers of 8E5 cells. The manual extraction protocol consistently yielded high concentrations of amplifiable DNA from DBS. LOD assessment demonstrated HDA detected ∼470 copies/ml of HIV-1 DNA extracts in 4/4 replicates. No statistical difference was found using the McNemar's test when comparing HDA to PCR for detecting HIV-1 DNA from DBS. Using just a magnet, heat block and pipettes, the manual extraction protocol and HDA assay detected HIV-1 DNA from DBS at levels that would be useful for early infant diagnosis. Next steps will include assessing HDA for non-B HIV-1 subtypes recognition and comparison to Roche HIV-1 DNA v1.5 PCR assay. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Evaluation of five protocols for DNA extraction from leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris.

    Science.gov (United States)

    Aubakirova, K; Omasheva, M; Ryabushkina, N; Tazhibaev, T; Kampitova, G; Galiakparov, N

    2014-02-27

    Leaves of Malus sieversii, Vitis vinifera, and Armeniaca vulgaris contain substantial amounts of secondary metabolites, which limit the high-quality DNA extraction performance. In this study, five extraction protocols were compared for their ability to produce good quality DNA from fresh and dried (with silica gel) leaves of these species. The modified protocol of Dellaporta et al., using polyvinylpyrrolidone to bind the phenolic compounds and a high molar concentration of potassium acetate to inhibit co-precipitation of polysaccharides with DNA, produced the best DNA quality for all species tested. DNA extracted by this method had a 1.77-1.96 A260/280 nm ratio and successful amplification of the 18S ribosomal DNA gene. DNA concentrations of dried leaves were lower than those obtained from fresh leaves, which was likely due to aspects of the drying procedure. All five methods for grapevine produced DNA of obvious better quality from green canes compared to leaves, due to the relatively low content of secondary metabolites in the former. For grapevine and apricot, three methods can be equally used to obtain DNA of good quality: the Doyle and Doyle modified method using CTAB and high concentration of NaCl, the Jobes et al. modified method, and the sodium dodecyl sulfate mini preparation method of Edwards et al. The protocol of Jobes et al. using LiCl for RNA removal showed the best results for most of the M. sieversii samples examined.

  19. Assessing genetic polymorphisms using DNA extracted from cells present in saliva samples

    Directory of Open Access Journals (Sweden)

    Nemoda Zsofia

    2011-12-01

    Full Text Available Abstract Background Technical advances following the Human Genome Project revealed that high-quality and -quantity DNA may be obtained from whole saliva samples. However, usability of previously collected samples and the effects of environmental conditions on the samples during collection have not been assessed in detail. In five studies we document the effects of sample volume, handling and storage conditions, type of collection device, and oral sampling location, on quantity, quality, and genetic assessment of DNA extracted from cells present in saliva. Methods Saliva samples were collected from ten adults in each study. Saliva volumes from .10-1.0 ml, different saliva collection devices, sampling locations in the mouth, room temperature storage, and multiple freeze-thaw cycles were tested. One representative single nucleotide polymorphism (SNP in the catechol-0-methyltransferase gene (COMT rs4680 and one representative variable number of tandem repeats (VNTR in the serotonin transporter gene (5-HTTLPR: serotonin transporter linked polymorphic region were selected for genetic analyses. Results The smallest tested whole saliva volume of .10 ml yielded, on average, 1.43 ± .77 μg DNA and gave accurate genotype calls in both genetic analyses. The usage of collection devices reduced the amount of DNA extracted from the saliva filtrates compared to the whole saliva sample, as 54-92% of the DNA was retained on the device. An "adhered cell" extraction enabled recovery of this DNA and provided good quality and quantity DNA. The DNA from both the saliva filtrates and the adhered cell recovery provided accurate genotype calls. The effects of storage at room temperature (up to 5 days, repeated freeze-thaw cycles (up to 6 cycles, and oral sampling location on DNA extraction and on genetic analysis from saliva were negligible. Conclusions Whole saliva samples with volumes of at least .10 ml were sufficient to extract good quality and quantity DNA. Using

  20. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Science.gov (United States)

    Sankaranarayanan, Krithivasan; Timofeeff, Michael N; Spathis, Rita; Lowenstein, Tim K; Lum, J Koji

    2011-01-01

    Fluid inclusions in evaporite minerals (halite, gypsum, etc.) potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka), with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  1. Comparison of Suitability of the Most Common Ancient DNA Quantification Methods.

    Science.gov (United States)

    Brzobohatá, Kristýna; Drozdová, Eva; Smutný, Jiří; Zeman, Tomáš; Beňuš, Radoslav

    2017-04-01

    Ancient DNA (aDNA) extracted from historical bones is damaged and fragmented into short segments, present in low quantity, and usually copurified with microbial DNA. A wide range of DNA quantification methods are available. The aim of this study was to compare the five most common DNA quantification methods for aDNA. Quantification methods were tested on DNA extracted from skeletal material originating from an early medieval burial site. The tested methods included ultraviolet (UV) absorbance, real-time quantitative polymerase chain reaction (qPCR) based on SYBR ® green detection, real-time qPCR based on a forensic kit, quantification via fluorescent dyes bonded to DNA, and fragmentary analysis. Differences between groups were tested using a paired t-test. Methods that measure total DNA present in the sample (NanoDrop ™ UV spectrophotometer and Qubit ® fluorometer) showed the highest concentrations. Methods based on real-time qPCR underestimated the quantity of aDNA. The most accurate method of aDNA quantification was fragmentary analysis, which also allows DNA quantification of the desired length and is not affected by PCR inhibitors. Methods based on the quantification of the total amount of DNA in samples are unsuitable for ancient samples as they overestimate the amount of DNA presumably due to the presence of microbial DNA. Real-time qPCR methods give undervalued results due to DNA damage and the presence of PCR inhibitors. DNA quantification methods based on fragment analysis show not only the quantity of DNA but also fragment length.

  2. Use of real-time PCR to evaluate two DNA extraction methods from food Utilização da técnica de PCR em tempo real para avaliação de dois métodos de extração de DNA a partir de alimentos

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.A extração de DNA é uma etapa crítica na análise de organismos geneticamente modificados em alimentos por PCR em tempo real. Neste trabalho, os métodos CTAB e DNeasy forneceram preparações de DNA em quantidade e com qualidade a partir de amostras de proteína texturizada de soja, fórmula infantil e extrato de soja. Em relação ao Material de Referência Certificado contendo 5% de soja RoundupReady® , nenhum dos métodos forneceu DNA de boa qualidade. Entretanto, o teste de diluição realizado nos extratos de CTAB não demonstrou interferência de substâncias inibidoras. As eficiências das amplifica

  3. Extração de DNA de materiais de arquivo e fontes escassas para utilização em reação de polimerização em cadeia (PCR Methods of DNA extraction from archived materials and rare sources for utilization in polymer chain reaction

    Directory of Open Access Journals (Sweden)

    Jaqueline A. Barea

    2004-12-01

    Full Text Available Este trabalho visou a comparação de cinco métodos diferentes de extração de DNA de materiais de arquivo (tecidos incluídos em parafina, esfregaços de sangue periférico - corados e não corados com Leishman, lâminas com mielogramas, gotas de sangue em Guthrie Card e de fontes escassas (células bucais, um e três bulbos capilares e 2 mL de urina, para que fossem avaliadas a facilidade de aplicação e a facilidade de amplificação deste DNA pela técnica da reação de polimerização em cadeia (PCR. Os métodos incluíram digestão por proteinase K, seguida ou não por purificação com fenol/clorofórmio; Chelex 100® (BioRad; Insta Gene® (BioRad e fervura em água estéril. O DNA obtido foi testado para amplificação de três fragmentos gênicos: Brain-derived neutrophic factor (764 pb, Factor V Leiden (220 pb e Abelson (106 pb. De acordo com o comprimento do fragmento gênico estudado, da fonte potencial de DNA e do método de extração utilizado, os resultados caracterizaram o melhor caminho para padronização de procedimentos técnicos a serem incluídos no manual de Procedimentos Operacionais Padrão do Laboratório de Biologia Molecular do Hemocentro - HC - Unesp - Botucatu.The present work aimed at comparing five different methods of DNA extraction of samples from archived materials (paraffin-embedded tissues, peripheral blood smears - stained or not with Leishman, aspired bone marrow smears and Guthrie card bloodspots and from rare sources (oral cells, one and three capillary bulbs, 2 mL of urine, to evaluate the ease of application and the possibility of amplification of this DNA by the polymerization chain reaction (PCR technique. The methods included proteinase K digestion - followed or not by phenol/chloroform purification, Chelex 100® (BioRad, InstaGene® (BioRad and boiling in the sterile water. The DNA obtained was tested for amplification of three genic fragments: the brain-derived neutrophic factor gene (764 bp

  4. Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

    Science.gov (United States)

    Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

    2013-07-01

    Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

  5. Designing easy DNA extraction: Teaching creativity through laboratory practice.

    Science.gov (United States)

    Susantini, Endang; Lisdiana, Lisa; Isnawati; Tanzih Al Haq, Aushia; Trimulyono, Guntur

    2017-05-01

    Subject material concerning Deoxyribose Nucleic Acid (DNA) structure in the format of creativity-driven laboratory practice offers meaningful learning experience to the students. Therefore, a laboratory practice in which utilizes simple procedures and easy-safe-affordable household materials should be promoted to students to develop their creativity. This study aimed to examine whether designing and conducting DNA extraction with household materials could foster students' creative thinking. We also described how this laboratory practice affected students' knowledge and views. A total of 47 students participated in this study. These students were grouped and asked to utilize available household materials and modify procedures using hands-on worksheet. Result showed that this approach encouraged creative thinking as well as improved subject-related knowledge. Students also demonstrated positive views about content knowledge, social skills, and creative thinking skills. This study implies that extracting DNA with household materials is able to develop content knowledge, social skills, and creative thinking of the students. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):216-225, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  6. Toxic reagents and expensive equipment: are they really necessary for the extraction of good quality fungal DNA?

    Science.gov (United States)

    Rodrigues, P; Venâncio, A; Lima, N

    2018-01-01

    The aim of this work was to evaluate a fungal DNA extraction procedure with the lowest inputs in terms of time as well as of expensive and toxic chemicals, but able to consistently produce genomic DNA of good quality for PCR purposes. Two types of fungal biological material were tested - mycelium and conidia - combined with two protocols for DNA extraction using Sodium Dodecyl Sulphate (SDS) and Cetyl Trimethyl Ammonium Bromide as extraction buffers and glass beads for mechanical disruption of cell walls. Our results showed that conidia and SDS buffer was the combination that lead to the best DNA quality and yield, with the lowest variation between samples. This study clearly demonstrates that it is possible to obtain high yield and pure DNA from pigmented conidia without the use of strong cell disrupting procedures and of toxic reagents. There are numerous methods for DNA extraction from fungi. Some rely on expensive commercial kits and/or equipments, unavailable for many laboratories, or make use of toxic chemicals such as chloroform, phenol and mercaptoethanol. This study clearly demonstrates that it is possible to obtain high yields of pure DNA from pigmented conidia without the use of strong and expensive cell disrupting procedures and of toxic reagents. The method herein described is simultaneously inexpensive and adequate to DNA extraction from several different types of fungi. © 2017 The Society for Applied Microbiology.

  7. The Extraction and Partial Purification of Bacterial DNA as a Practical Exercise for GCE Advanced Level Students.

    Science.gov (United States)

    Falconer, A. C.; Hayes, L. J.

    1986-01-01

    Describes a relatively simple method of extraction and purification of bacterial DNA. This technique permits advanced secondary-level science students to obtain adequate amounts of DNA from very small pellets of bacteria and to observe some of its polymer properties. (ML)

  8. DNA extraction in Echinococcus granulosus and Taenia spp. eggs in dogs stool samples applying thermal shock.

    Science.gov (United States)

    Hidalgo, Alejandro; Melo, Angélica; Romero, Fernando; Hidalgo, Víctor; Villanueva, José; Fonseca-Salamanca, Flery

    2018-03-01

    The extraction of DNA in taeniid eggs shows complications attached to the composition of stool samples and the high resistance of eggs to degradation. The objective of this study was to test a method of DNA extraction in taeniid eggs by applying a thermal shock to facilitate the chemical-enzymatic degradation of these elements. A group of six tubes containing 1 ml of dog stool sample was spiked with eggs of Echinococcus granulosus and another group of six with Taenia pisiformis. Samples were floated with supersaturated sugar solution and centrifuged. The upper portion of each tube (500 μl) was aspirated and deposited in 1.5 ml tubes. Three tubes from each group were incubated at -20 °C and then at 90 °C, the remaining three from each group, incubated at room temperature. Proteinase K and lysis buffer were added to each tube and incubated for 12 h at 58 °C. The lysis effect was evaluated by microscopy at 3, 6 and 12 h and integrity by electrophoresis in 1% agarose gels. With the same experimental scheme, the thermal shock effect was evaluated in extractions of 1, 2, 3 and 4 eggs of each species and the DNA was quantified. Additionally, the protocol was applied in samples of 4 dogs diagnosed with natural infection by Taeniidae worms. Finally, all the extractions were tested by PCR amplification. Both E. granulosus and T. pisiformis eggs showed a similar response in the tests. In samples without treatment, the lysis effect was poor and showed no differences over time, but in those subjected to thermal shock, eggs degradation increased with time. In both treatments, there was no DNA loss integrity. The protocol applied to limited amounts of eggs yielded PCR products in 100% of the samples exposed to thermal shock, allowing PCR amplifications up to 1 egg. In non-exposed samples, the results were not replicable. However, DNA quantification showed low values in both treatments. In turn, DNA extractions with thermal shock in infected dog samples

  9. Comparative Study of Seven Commercial Kits for Human DNA Extraction from Urine Samples Suitable for DNA Biomarker-Based Public Health Studies

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H. C.; De Keersmaecker, Sigrid C. J.

    2014-01-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at −20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies. PMID:25365790

  10. Comparative study of seven commercial kits for human DNA extraction from urine samples suitable for DNA biomarker-based public health studies.

    Science.gov (United States)

    El Bali, Latifa; Diman, Aurélie; Bernard, Alfred; Roosens, Nancy H C; De Keersmaecker, Sigrid C J

    2014-12-01

    Human genomic DNA extracted from urine could be an interesting tool for large-scale public health studies involving characterization of genetic variations or DNA biomarkers as a result of the simple and noninvasive collection method. These studies, involving many samples, require a rapid, easy, and standardized extraction protocol. Moreover, for practicability, there is a necessity to collect urine at a moment different from the first void and to store it appropriately until analysis. The present study compared seven commercial kits to select the most appropriate urinary human DNA extraction procedure for epidemiological studies. DNA yield has been determined using different quantification methods: two classical, i.e., NanoDrop and PicoGreen, and two species-specific real-time quantitative (q)PCR assays, as DNA extracted from urine contains, besides human, microbial DNA also, which largely contributes to the total DNA yield. In addition, the kits giving a good yield were also tested for the presence of PCR inhibitors. Further comparisons were performed regarding the sampling time and the storage conditions. Finally, as a proof-of-concept, an important gene related to smoking has been genotyped using the developed tools. We could select one well-performing kit for the human DNA extraction from urine suitable for molecular diagnostic real-time qPCR-based assays targeting genetic variations, applicable to large-scale studies. In addition, successful genotyping was possible using DNA extracted from urine stored at -20°C for several months, and an acceptable yield could also be obtained from urine collected at different moments during the day, which is particularly important for public health studies.

  11. Automated DNA extraction platforms offer solutions to challenges of assessing microbial biofouling in oil production facilities.

    Science.gov (United States)

    Oldham, Athenia L; Drilling, Heather S; Stamps, Blake W; Stevenson, Bradley S; Duncan, Kathleen E

    2012-11-20

    The analysis of microbial assemblages in industrial, marine, and medical systems can inform decisions regarding quality control or mitigation. Modern molecular approaches to detect, characterize, and quantify microorganisms provide rapid and thorough measures unbiased by the need for cultivation. The requirement of timely extraction of high quality nucleic acids for molecular analysis is faced with specific challenges when used to study the influence of microorganisms on oil production. Production facilities are often ill equipped for nucleic acid extraction techniques, making the preservation and transportation of samples off-site a priority. As a potential solution, the possibility of extracting nucleic acids on-site using automated platforms was tested. The performance of two such platforms, the Fujifilm QuickGene-Mini80™ and Promega Maxwell®16 was compared to a widely used manual extraction kit, MOBIO PowerBiofilm™ DNA Isolation Kit, in terms of ease of operation, DNA quality, and microbial community composition. Three pipeline biofilm samples were chosen for these comparisons; two contained crude oil and corrosion products and the third transported seawater. Overall, the two more automated extraction platforms produced higher DNA yields than the manual approach. DNA quality was evaluated for amplification by quantitative PCR (qPCR) and end-point PCR to generate 454 pyrosequencing libraries for 16S rRNA microbial community analysis. Microbial community structure, as assessed by DGGE analysis and pyrosequencing, was comparable among the three extraction methods. Therefore, the use of automated extraction platforms should enhance the feasibility of rapidly evaluating microbial biofouling at remote locations or those with limited resources.

  12. High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

    DEFF Research Database (Denmark)

    Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke

    2013-01-01

    the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

  13. Rapid DNA extraction from dried blood spots on filter paper: potential applications in biobanking.

    Science.gov (United States)

    Choi, Eun-Hye; Lee, Sang Kwang; Ihm, Chunhwa; Sohn, Young-Hak

    2014-12-01

    Dried blood spot (DBS) technology is a microsampling alternative to traditional plasma or serum sampling for pharmaco- or toxicokinetic evaluation. DBS technology has been applied to diagnostic screening in drug discovery, nonclinical, and clinical settings. We have developed an improved elution protocol involving boiling of blood spots dried on Whatman filter paper. The purpose of this study was to compare the quality, purity, and quantity of DNA isolated from frozen blood samples and DBSs. We optimized a method for extraction and estimation of DNA from blood spots dried on filter paper (3-mm FTA card). A single DBS containing 40 μL blood was used. DNA was efficiently extracted in phosphate-buffered saline (PBS) or Tris-EDTA (TE) buffer by incubation at 37°C overnight. DNA was stable in DBSs that were stored at room temperature or frozen. The housekeeping genes GAPDH and beta-actin were used as positive standards for polymerase chain reaction (PCR) validation of general diagnostic screening. Our simple and convenient DBS storage and extraction methods are suitable for diagnostic screening by using very small volumes of blood collected on filter paper, and can be used in biobanks for blood sample storage.

  14. Virgin almond oil: Extraction methods and composition

    Energy Technology Data Exchange (ETDEWEB)

    Roncero, J.M.; Alvarez-Orti, M.; Pardo-Gimenez, A.; Gomez, R.; Rabadan, A.; Pardo, J.E.

    2016-07-01

    In this paper the extraction methods of virgin almond oil and its chemical composition are reviewed. The most common methods for obtaining oil are solvent extraction, extraction with supercritical fluids (CO2) and pressure systems (hydraulic and screw presses). The best industrial performance, but also the worst oil quality is achieved by using solvents. Oils obtained by this method cannot be considered virgin oils as they are obtained by chemical treatments. Supercritical fluid extraction results in higher quality oils but at a very high price. Extraction by pressing becomes the best option to achieve high quality oils at an affordable price. With regards chemical composition, almond oil is characterized by its low content in saturated fatty acids and the predominance of monounsaturated, especially oleic acid. Furthermore, almond oil contains antioxidants and fat-soluble bioactive compounds that make it an oil with interesting nutritional and cosmetic properties.

  15. Virgin almond oil: Extraction methods and composition

    International Nuclear Information System (INIS)

    Roncero, J.M.; Alvarez-Orti, M.; Pardo-Gimenez, A.; Gomez, R.; Rabadan, A.; Pardo, J.E.

    2016-01-01

    In this paper the extraction methods of virgin almond oil and its chemical composition are reviewed. The most common methods for obtaining oil are solvent extraction, extraction with supercritical fluids (CO2) and pressure systems (hydraulic and screw presses). The best industrial performance, but also the worst oil quality is achieved by using solvents. Oils obtained by this method cannot be considered virgin oils as they are obtained by chemical treatments. Supercritical fluid extraction results in higher quality oils but at a very high price. Extraction by pressing becomes the best option to achieve high quality oils at an affordable price. With regards chemical composition, almond oil is characterized by its low content in saturated fatty acids and the predominance of monounsaturated, especially oleic acid. Furthermore, almond oil contains antioxidants and fat-soluble bioactive compounds that make it an oil with interesting nutritional and cosmetic properties.

  16. Effect of gamma-irradiation on rice seed DNA. Pt. 1. Yield and molecular size of DNA extracted from irradiated rice seeds

    International Nuclear Information System (INIS)

    Kawamura, Yoko; Konishi, Akihiro; Yamada, Takashi; Saito, Yukio

    1995-01-01

    The effect of gamma-irradiation on the DNA of hulled rice seeds was investigated. The cetyltrimethylammonium bromide (CTAB) method was preferred for the extraction of DNA from rice seeds because of its high quality and good yield. The yield of DNA that was determined by gel electrophoresis, decreased as the irradiation dose increased from 1 kGy. DNA extracted from rice seeds irradiated with a 30 kGy dose showed a molecular size of less than 20 kb, while that from unirradiated rice showed more than 100 kb in electrophoretic profiles. It can be assumed that the decrease in yield was mainly induced by the crosslinking between protein and DNA, and the reduction in molecular size was induced by double-strand breaks. (J.P.N.)

  17. Evaluation of Four Automated Protocols for Extraction of DNA from FTA Cards

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Børsting, Claus; Ferrero-Miliani, Laura

    2013-01-01

    protocols on three different instruments. The extraction processes were repeated up to six times with the same pieces of FTA cards. The sample material on the FTA cards was either blood or buccal cells. With the QIAamp DNA Investigator and QIAsymphony DNA Investigator kits, it was possible to extract DNA...... from the FTA cards in all six rounds of extractions in sufficient amount and quality to obtain complete short tandem repeat (STR) profiles on a QIAcube and a QIAsymphony SP. With the PrepFiler Express kit, almost all the extractable DNA was extracted in the first two rounds of extractions. Furthermore......, we demonstrated that it was possible to successfully extract sufficient DNA for STR profiling from previously processed FTA card pieces that had been stored at 4 °C for up to 1 year. This showed that rare or precious FTA card samples may be saved for future analyses even though some DNA was already...

  18. Enhanced extraction and purification of plasmid DNA from escherichia coli by applying a hybrid magnetic nanocomposite

    Energy Technology Data Exchange (ETDEWEB)

    Silva, R.J. da; Chavez-Guajardo, A.E.; Medina-llamas, J.C.; Alcaraz-Espinoza, J.J.; Melo, C.P. de [Universidade Federal de Pernambuco (UFPE), PE (Brazil)

    2016-07-01

    Full text: Plasmid DNA (pDNA), a special kind of nucleic acid usually found in bacteria, is a small molecule physically distinct from chromosomal DNA that can replicate independently. This genetic material has been used in a wide set of biotechnological methodologies, such as genetic engineering, production of recombinant drugs and gene therapy, among others. In all these applications, the extraction and purification of pDNA appears as a crucial step. In this work, we describe the synthesis of a polyaniline and maghemite (PANI/?-Fe2O3) magnetic nanocomposite (MNC) and its use in a new Escherichia coli (E. coli) pDNA extraction and purification protocol. We have used transmission electron microscopy (TEM), UV-Vis spectroscopy, infrared spectroscopy (FTIR), X-ray diffraction (XRD), dynamic light scattering (DLS) and magnetic measurements to characterize the MNC, which was synthesized through an emulsion polymerization method. The yield, purity and quality of the pDNA extracted by using our proposed MNC protocol were evaluated through UV-Vis, agarose gel electrophoreses and PCR techniques, respectively. After comparing our results to those obtained by use of a commercial kit (Promega Wizard Plus SV Minipreps), we suggest that the novel protocol here proposed appears as a competitive alternative methodology. Not only the purification step can be completed within only 10 min, but the high adsorption capacity of the MNC results in pDNA yields that are almost twice the best values obtained by using the commercial kit. Hence, this new MNC methodology can be of general interest and find widespread use in different types of biomedical applications. (author)

  19. An Improved Methodology to Overcome Key Issues in Human Fecal Metagenomic DNA Extraction

    Directory of Open Access Journals (Sweden)

    Jitendra Kumar

    2016-12-01

    Full Text Available Microbes are ubiquitously distributed in nature, and recent culture-independent studies have highlighted the significance of gut microbiota in human health and disease. Fecal DNA is the primary source for the majority of human gut microbiome studies. However, further improvement is needed to obtain fecal metagenomic DNA with sufficient amount and good quality but low host genomic DNA contamination. In the current study, we demonstrate a quick, robust, unbiased, and cost-effective method for the isolation of high molecular weight (>23 kb metagenomic DNA (260/280 ratio >1.8 with a good yield (55.8 ± 3.8 ng/mg of feces. We also confirm that there is very low human genomic DNA contamination (eubacterial: human genomic DNA marker genes = 227.9:1 in the human feces. The newly-developed method robustly performs for fresh as well as stored fecal samples as demonstrated by 16S rRNA gene sequencing using 454 FLX+. Moreover, 16S rRNA gene analysis indicated that compared to other DNA extraction methods tested, the fecal metagenomic DNA isolated with current methodology retains species richness and does not show microbial diversity biases, which is further confirmed by qPCR with a known quantity of spike-in genomes. Overall, our data highlight a protocol with a balance between quality, amount, user-friendliness, and cost effectiveness for its suitability toward usage for culture-independent analysis of the human gut microbiome, which provides a robust solution to overcome key issues associated with fecal metagenomic DNA isolation in human gut microbiome studies.

  20. DNA analysis of soil extracts can be used to investigate fine root depth distribution of trees

    Science.gov (United States)

    Bithell, Sean L.; Tran-Nguyen, Lucy T. T.; Hearnden, Mark N.; Hartley, Diana M.

    2015-01-01

    Understanding the root distribution of trees by soil coring is time-consuming as it requires the separation of roots from soil and classification of roots into particular size classes. This labour-intensive process can limit sample throughput and therefore sampling intensity. We investigated the use of quantitative polymerase chain reaction (qPCR) on soil DNA extractions to determine live fine root DNA density (RDD, mg DNA m−2) for mango (Mangifera indica) trees. The specificity of the qPCR was tested against DNA extracted from 10 mango cultivars and 14 weed species. All mango cultivars and no weeds were detected. Mango DNA was successfully quantified from control soil spiked with mango roots and weed species. The DNA yield of mango root sections stored in moist soil at 23–28 °C declined after 15 days to low concentrations as roots decayed, indicating that dead root materials in moist soil would not cause false-positive results. To separate large roots from samples, a root separation method for field samples was used to target the root fragments remaining in sieved (minimum 2 mm aperture) soil for RDD comparisons. Using this method we compared the seasonal RDD values of fine roots for five mango rootstock cultivars in a field trial. The mean cultivar DNA yields by depth from root fragments in the sieved soil samples had the strongest relationship (adjusted multiple R2 = 0.9307, P < 0.001) with the dry matter (g m−2) of fine (diameter <0.64 mm) roots removed from the soil by sieving. This method provides a species-specific and rapid means of comparing the distribution and concentration of live fine roots of trees in orchards using soil samples up to 500 g. PMID:25552675

  1. EXTRACTIVE SPECTROPHOTOMETRIC METHOD FOR THE ...

    African Journals Online (AJOL)

    B. S. Chandravanshi

    The method has been applied to the analysis of carbaryl in its ... The extensive use of this insecticide poses a serious risk to both the environment and the human ... is the second most widely detected insecticide in the environmental samples ...

  2. Evaluation of Sample Stability and Automated DNA Extraction for Fetal Sex Determination Using Cell-Free Fetal DNA in Maternal Plasma

    Directory of Open Access Journals (Sweden)

    Elena Ordoñez

    2013-01-01

    Full Text Available Objective. The detection of paternally inherited sequences in maternal plasma, such as the SRY gene for fetal sexing or RHD for fetal blood group genotyping, is becoming part of daily routine in diagnostic laboratories. Due to the low percentage of fetal DNA, it is crucial to ensure sample stability and the efficiency of DNA extraction. We evaluated blood stability at 4°C for at least 24 hours and automated DNA extraction, for fetal sex determination in maternal plasma. Methods. A total of 158 blood samples were collected, using EDTA-K tubes, from women in their 1st trimester of pregnancy. Samples were kept at 4°C for at least 24 hours before processing. An automated DNA extraction was evaluated, and its efficiency was compared with a standard manual procedure. The SRY marker was used to quantify cfDNA by real-time PCR. Results. Although lower cfDNA amounts were obtained by automated DNA extraction (mean 107,35 GE/mL versus 259,43 GE/mL, the SRY sequence was successfully detected in all 108 samples from pregnancies with male fetuses. Conclusion. We successfully evaluated the suitability of standard blood tubes for the collection of maternal blood and assessed samples to be suitable for analysis at least 24 hours later. This would allow shipping to a central reference laboratory almost from anywhere in Europe.

  3. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties.

    Science.gov (United States)

    Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei

    2018-02-08

    DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.

  4. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  5. DNA is a co-factor for its own replication in Xenopus egg extracts

    NARCIS (Netherlands)

    Lebofsky, Ronald; van Oijen, Antoine M.; Walter, Johannes C.

    Soluble Xenopus egg extracts efficiently replicate added plasmids using a physiological mechanism, and thus represent a powerful system to understand vertebrate DNA replication. Surprisingly, DNA replication in this system is highly sensitive to plasmid concentration, being undetectable below

  6. Robust and effective methodologies for cryopreservation and DNA extraction from anaerobic gut fungi.

    Science.gov (United States)

    Solomon, Kevin V; Henske, John K; Theodorou, Michael K; O'Malley, Michelle A

    2016-04-01

    Cell storage and DNA isolation are essential to developing an expanded suite of microorganisms for biotechnology. However, many features of non-model microbes, such as an anaerobic lifestyle and rigid cell wall, present formidable challenges to creating strain repositories and extracting high quality genomic DNA. Here, we establish accessible, high efficiency, and robust techniques to store lignocellulolytic anaerobic gut fungi long term without specialized equipment. Using glycerol as a cryoprotectant, gut fungal isolates were preserved for a minimum of 23 months at -80 °C. Unlike previously reported approaches, this improved protocol is non-toxic and rapid, with samples surviving twice as long with negligible growth impact. Genomic DNA extraction for these isolates was optimized to yield samples compatible with next generation sequencing platforms (e.g. Illumina, PacBio). Popular DNA isolation kits and precipitation protocols yielded preps that were unsuitable for sequencing due to carbohydrate contaminants from the chitin-rich cell wall and extensive energy reserves of gut fungi. To address this, we identified a proprietary method optimized for hardy plant samples that rapidly yielded DNA fragments in excess of 10 kb with minimal RNA, protein or carbohydrate contamination. Collectively, these techniques serve as fundamental tools to manipulate powerful biomass-degrading gut fungi and improve their accessibility among researchers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Sources of pre-analytical variations in yield of DNA extracted from blood samples: analysis of 50,000 DNA samples in EPIC.

    Directory of Open Access Journals (Sweden)

    Elodie Caboux

    Full Text Available The European Prospective Investigation into Cancer and nutrition (EPIC is a long-term, multi-centric prospective study in Europe investigating the relationships between cancer and nutrition. This study has served as a basis for a number of Genome-Wide Association Studies (GWAS and other types of genetic analyses. Over a period of 5 years, 52,256 EPIC DNA samples have been extracted using an automated DNA extraction platform. Here we have evaluated the pre-analytical factors affecting DNA yield, including anthropometric, epidemiological and technical factors such as center of subject recruitment, age, gender, body-mass index, disease case or control status, tobacco consumption, number of aliquots of buffy coat used for DNA extraction, extraction machine or procedure, DNA quantification method, degree of haemolysis and variations in the timing of sample processing. We show that the largest significant variations in DNA yield were observed with degree of haemolysis and with center of subject recruitment. Age, gender, body-mass index, cancer case or control status and tobacco consumption also significantly impacted DNA yield. Feedback from laboratories which have analyzed DNA with different SNP genotyping technologies demonstrate that the vast majority of samples (approximately 88% performed adequately in different types of assays. To our knowledge this study is the largest to date to evaluate the sources of pre-analytical variations in DNA extracted from peripheral leucocytes. The results provide a strong evidence-based rationale for standardized recommendations on blood collection and processing protocols for large-scale genetic studies.

  8. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties

    Directory of Open Access Journals (Sweden)

    Gaofeng Pan

    2018-02-01

    Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.

  9. Recovery of DNA from agarose gel by trap method

    African Journals Online (AJOL)

    Administrator

    2011-09-05

    Sep 5, 2011 ... gels, which can recover DNA with common laboratory facilities. This way can provide another ... which is difficult for the micro centrifuge. But our DNA could be extracted from n-butanol. ... taken out from the traps to 15 ml centrifuge tubes with a Pasteur pipette. The volume of the buffer extracted was equal to ...

  10. A simple, rapid and efficient method of isolating DNA from ...

    African Journals Online (AJOL)

    Total DNA of Chokanan mango (Mangifera indica L.) was extracted from the leaf for the construction of total genomic library. However, the quality of the extracted DNA was often compromised by the presence of secondary metabolites, thus interfering with the analytical applications. Improvement on the quality of the ...

  11. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    Science.gov (United States)

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. Newer methods of extraction of teeth

    Directory of Open Access Journals (Sweden)

    MHendra Chandha

    2016-06-01

    Full Text Available Atraumatic extraction methods are deemed to be important to minimize alveolar bone loss after tooth extraction. With the advent of such techniques, exodontia is no more a dreaded procedure in anxious patients. Newer system and techniques for extraction of teeth have evolved in the recent few decades. This article reviews and discusses new techniques to make simple and complex exodontias more efficient with improved patient outcomes. This includes physics forceps, powered periotome, piezosurgery, benex extractor, sonic instrument for bone surgery, lasers.

  13. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Samira Mohammadi

    2017-01-01

    Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  14. Methods for determination of extractable complex composition

    International Nuclear Information System (INIS)

    Sergievskij, V.V.

    1984-01-01

    Specific features and restrictions of main methods for determining the extractable complex composition by the distribution data (methods of equilibrium shift, saturation, mathematical models) are considered. Special attention is given to the solution of inverse problems with account for hydration effect on the activity of organic phase components. By example of the systems lithium halides-isoamyl alcohol, thorium nitrate-n-hexyl alcohol, mineral acids tri-n-butyl phosphate (TBP), metal nitrates (uranium lanthanides) - TBP the results on determining stoichiometry of extraction equilibria obtained by various methods are compared

  15. Evaluation of the ISO standard 11063 DNA extraction procedure for assessing soil microbial abundance and community structure.

    Directory of Open Access Journals (Sweden)

    Pierre Plassart

    Full Text Available Soil DNA extraction has become a critical step in describing microbial biodiversity. Historically, ascertaining overarching microbial ecological theories has been hindered as independent studies have used numerous custom and commercial DNA extraction procedures. For that reason, a standardized soil DNA extraction method (ISO-11063 was previously published. However, although this ISO method is suited for molecular tools such as quantitative PCR and community fingerprinting techniques, it has only been optimized for examining soil bacteria. Therefore, the aim of this study was to assess an appropriate soil DNA extraction procedure for examining bacterial, archaeal and fungal diversity in soils of contrasting land-use and physico-chemical properties. Three different procedures were tested: the ISO-11063 standard; a custom procedure (GnS-GII; and a modified ISO procedure (ISOm which includes a different mechanical lysis step (a FastPrep ®-24 lysis step instead of the recommended bead-beating. The efficacy of each method was first assessed by estimating microbial biomass through total DNA quantification. Then, the abundances and community structure of bacteria, archaea and fungi were determined using real-time PCR and terminal restriction fragment length polymorphism approaches. Results showed that DNA yield was improved with the GnS-GII and ISOm procedures, and fungal community patterns were found to be strongly dependent on the extraction method. The main methodological factor responsible for differences between extraction procedure efficiencies was found to be the soil homogenization step. For integrative studies which aim to examine bacteria, archaea and fungi simultaneously, the ISOm procedure results in higher DNA recovery and better represents microbial communities.

  16. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  17. Comparison of DNA extraction protocols to detect Mycobacterium bovis in bovine tissue by PCR

    Directory of Open Access Journals (Sweden)

    Cássia Yumi Ikuta

    2016-11-01

    Full Text Available The current scenario of international beef trading has increased the pressure for better and faster diagnosis of bovine tuberculosis. Although traditional culture remains the gold standard method to confirm Mycobacterium bovis infection, it is exceedingly time consuming, and demands viable mycobacteria. Molecular methods overcome the flaws of the bacteriological methods with faster detection and identification. However, mycobacterial features like a complex cell wall and pathogen–host interaction make the molecular detection a challenge. Three protocols for DNA extraction (A, B and C from bovine tissues were tested to verify the most suitable technique for routine diagnostic assessment of their specificity and sensitivity. Thirty culture-positive and thirty culture-negative granulomatous lesions were included in the trial. From each sample, three tissue suspensions at different dilutions (10-1, 10-2 and 10-3 were prepared and submitted to DNA extraction. PCR procedures targeting IS6110 were performed, employing two volumes of DNA: 5 µL of all three dilutions, and 2.5 µL of the 10-1 dilution. Protocol A was able to detect members of the M. tuberculosis complex in most samples. The sensitivity of the test decreased with increase in tissue-suspension dilution. Although Protocol A presented the highest sensitivity followed by C and B, it showed the lowest specificity, which can be due to a failure in primary isolation caused by the lack of viable organisms or incubation time. Regardless classical bacteriological methods are still recommended by OIE, after evaluating the sensitivity of DNA extraction protocols and PCR procedures, we conclude that the best strategy for M. bovis detection is to follow Protocol A on concentrated tissue suspensions.

  18. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    Science.gov (United States)

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  19. Comparative analysis of five DNA isolation protocols and three drying methods for leaves samples of Nectandra megapotamica (Spreng. Mez

    Directory of Open Access Journals (Sweden)

    Leonardo Severo da Costa

    2016-06-01

    Full Text Available The aim of the study was to establish a DNA isolation protocol Nectandra megapotamica (Spreng. Mez., able to obtain samples of high yield and quality for use in genomic analysis. A commercial kit and four classical methods of DNA extraction were tested, including three cetyltrimethylammonium bromide (CTAB-based and one sodium dodecyl sulfate (SDS-based methods. Three drying methods for leaves samples were also evaluated including drying at room temperature (RT, in an oven at 40ºC (S40, and in a microwave oven (FMO. The DNA solutions obtained from different types of leaves samples using the five protocols were assessed in terms of cost, execution time, and quality and yield of extracted DNA. The commercial kit did not extract DNA with sufficient quantity or quality for successful PCR reactions. Among the classic methods, only the protocols of Dellaporta and of Khanuja yielded DNA extractions for all three types of foliar samples that resulted in successful PCR reactions and subsequent enzyme restriction assays. Based on the evaluated variables, the most appropriate DNA extraction method for Nectandra megapotamica (Spreng. Mez. was that of Dellaporta, regardless of the method used to dry the samples. The selected method has a relatively low cost and total execution time. Moreover, the quality and quantity of DNA extracted using this method was sufficient for DNA sequence amplification using PCR reactions and to get restriction fragments.

  20. Direct extraction of genomic DNA from maize with aqueous ionic liquid buffer systems for applications in genetically modified organisms analysis.

    Science.gov (United States)

    Gonzalez García, Eric; Ressmann, Anna K; Gaertner, Peter; Zirbs, Ronald; Mach, Robert L; Krska, Rudolf; Bica, Katharina; Brunner, Kurt

    2014-12-01

    To date, the extraction of genomic DNA is considered a bottleneck in the process of genetically modified organisms (GMOs) detection. Conventional DNA isolation methods are associated with long extraction times and multiple pipetting and centrifugation steps, which makes the entire procedure not only tedious and complicated but also prone to sample cross-contamination. In recent times, ionic liquids have emerged as innovative solvents for biomass processing, due to their outstanding properties for dissolution of biomass and biopolymers. In this study, a novel, easily applicable, and time-efficient method for the direct extraction of genomic DNA from biomass based on aqueous-ionic liquid solutions was developed. The straightforward protocol relies on extraction of maize in a 10 % solution of ionic liquids in aqueous phosphate buffer for 5 min at room temperature, followed by a denaturation step at 95 °C for 10 min and a simple filtration to remove residual biopolymers. A set of 22 ionic liquids was tested in a buffer system and 1-ethyl-3-methylimidazolium dimethylphosphate, as well as the environmentally benign choline formate, were identified as ideal candidates. With this strategy, the quality of the genomic DNA extracted was significantly improved and the extraction protocol was notably simplified compared with a well-established method.

  1. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    International Nuclear Information System (INIS)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.

    1991-01-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  2. Aqueous extract of Pinus caribaea inhibits the damage induced by ultraviolet radiations, in plasmid DNA

    Directory of Open Access Journals (Sweden)

    Marioly Vernhes Tamayo

    2017-08-01

    Full Text Available Context: The incidence of solar ultraviolet radiation (UV on Earth has increased due to diminish of the ozone layer. This enviromental agent is highly genotoxic causing numerous damage in DNA molecule. Nowadays there is a growing interest in the search of compounds capable to minimize these effects. In particular, phytocompounds have been tested as excelent candidates for their antigenotoxic properties. Aims: To evaluate the protective effect of the aqueous extract of Pinus caribaea (EPC against the damage induced by the UVB and UVC radiation. Methods: The cell-free plasmid DNA assay was employed. The forms of plasmid were separated electrophoretically in agarose gel. For genotoxic and photoprotective evaluation of P. caribaea, different concentrations of the extract (0.1 – 2.0 mg/mL and exposure times were evaluated. The CPD lesions were detected enzymatically. Additionally, the transmittance of the aqueous extract against 254 nm and 312 nm was measured. Results: None of the concentrations were genotoxic in 30 min of treatment, for superior times a clastogenic effect was observed. The EPC despite inhibiting the activity of the enzyme T4 endo V, impedes photolesions formation in DNA at concentrations ≥ 0.1 mg/mL. Conclusions: The EPC has photoprotective properties, this effect could be related with its antioxidants and absorptives capacities.

  3. PROTOCOL FOR EXTRACTION OF BACTERIAL METAGENOME DNA TO PRAWN Macrobrachium carcinus L

    Directory of Open Access Journals (Sweden)

    J U González de la Cruz

    2011-07-01

    Full Text Available In this work we adapted a protocol for the extraction of metagenomic DNA (ADNmg bacteria in the digestive system (intestines, stomach and hepatopancreas of Macrobrachium carcinus L., with reference to the method of extracting bacterial DNA from soils and sediments (Rojas-Herrera et al., 2008. This methodology consisted of enzymatic, physics, mechanics and chemistry after a series of tests was abolished enzymatic lysis. However, the success ADNmg extraction was influenced mainly by the preparation of the samples, in particular the hepatopancreas, where it was necessary to remove the fat by thermal shock temperature and phase separation by centrifugation with the sample frozen.The effectiveness of isolated DNA fragmentation was verified by gel electrophoresis in denaturing gradient (DGGE after amplification with universal primers. In general, it had a low diversity (19 phylotypes between the different organs analyzed of 13.5 ± 1 (intestines to 11.7 ± 0.96 (stomach. The Shannon-Weaver index (2.45, Simpsons (10.88 and equity (0972 obtained from the digitization of the image of the gel, suggested that the phylotypes that form the gut microflora M. carcinus, is distributed unevenly between the different organs analyzed.

  4. Effect of Cassia hirsuta (L) extract on DNA profile of some ...

    African Journals Online (AJOL)

    The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

  5. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA) from Patients with Non-Small Cell Lung Cancer (NSCLC)

    Science.gov (United States)

    Sherwood, James L.; Corcoran, Claire; Brown, Helen; Sharpe, Alan D.; Musilova, Milena; Kohlmann, Alexander

    2016-01-01

    Introduction Non-invasive mutation testing using circulating tumour DNA (ctDNA) is an attractive premise. This could enable patients without available tumour sample to access more treatment options. Materials & Methods Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits. Results 2 hr incubation time and double plasma centrifugation (2000 x g) reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA). Reduced “contamination” and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT) (Streck), after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield. Conclusion This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous. PMID:26918901

  6. Método não-invasivo na obtenção de DNA de búfalos - DOI: 10.4025/actascianimsci.v30i4.4839 Non-invasive method for buffalo DNA extraction - DOI: 10.4025/actascianimsci.v30i4.4839

    Directory of Open Access Journals (Sweden)

    Maria Amélia Menck Soares

    2009-03-01

    Full Text Available O objetivo do trabalho foi comparar dois diferentes protocolos de extração de DNA de pelos de búfalos (Bubalus bubalis e comparar três regiões de coleta de material (nuca, paleta direita e testa. Foram utilizados quatro búfalos com três repetições por animal e por região. No protocolo 1, foi utilizada a técnica do fenol-clorofórmio e no protocolo 2, a técnica de extração com CTAB. O protocolo 2 apresentou maior média de concentração de DNA para as amostras de pelos. Em relação ao local de retirada dos pelos, não foram encontradas diferenças significativas, porém nota-se que a região da testa dos animais apresentou maior concentração de DNA quando extraído com CTAB. Com relação à praticidade de utilização dos dois métodos avaliados, o protocolo 2, além de ter apresentado maior concentração de DNA, apresentou menor tempo de execução, 3h 50 min., além de evitar a utilização de mais um reagente tóxico, como é o caso do fenol. Por esse motivo, sugere-se que a coleta seja efetuada na região da testa, levando-se em consideração a praticidade e a acessibilidade aos pelos e sugere-se também a aplicação do protocolo de extração de DNA com CTAB, pela praticidade e pelo menor tempo de execução.The objective of this paper was to compare two different protocols for DNA extraction from buffalo (Bubalus bubalis fur. Also, three sites for the fur source (back of the head, right shoulder and forehead were compared. For the experiments, four animals were used and three replicates for each site on each animal were performed. For protocol 1, the phenol chloroform technique was used, and the CTAB extraction technique was used for protocol 2. Protocol 2 resulted in a higher average of DNA concentration for the fur samples. Considering the body region from where the fur was extracted, there were no significant differences in DNA concentration. However, the forehead showed a higher concentration when extracted with

  7. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    Science.gov (United States)

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  8. Evaluation of three different DNA extraction methods from blood samples collected in dried filter paper in Plasmodium subpatent infections from the Amazon region in Brazil Avaliação de três métodos de extração de DNA obtidos de amostras de sangue coletadas em papel de filtro em infecções subpatentes de Plasmodium da região Amazônica no Brasil

    Directory of Open Access Journals (Sweden)

    Renata Bortolasse Miguel

    2013-06-01

    Full Text Available Asymptomatic Plasmodium infection is a new challenge for public health in the American region. The polymerase chain reaction (PCR is the best method for diagnosing subpatent parasitemias. In endemic areas, blood collection is hampered by geographical distances and deficient transport and storage conditions of the samples. Because DNA extraction from blood collected on filter paper is an efficient method for molecular studies in high parasitemic individuals, we investigated whether the technique could be an alternative for Plasmodium diagnosis among asymptomatic and pauciparasitemic subjects. In this report we compared three different methods (Chelex®-saponin, methanol and TRIS-EDTA of DNA extraction from blood collected on filter paper from asymptomatic Plasmodium-infected individuals. Polymerase chain reaction assays for detection of Plasmodium species showed the best results when the Chelex®-saponin method was used. Even though the sensitivity of detection was approximately 66% and 31% for P. falciparum and P. vivax, respectively, this method did not show the effectiveness in DNA extraction required for molecular diagnosis of Plasmodium. The development of better methods for extracting DNA from blood collected on filter paper is important for the diagnosis of subpatent malarial infections in remote areas and would contribute to establishing the epidemiology of this form of infection.Infecção assintomática por Plasmodium é um novo desafio para a saúde pública no Brasil. A reação em cadeia da polimerase (PCR é o melhor método para detectar baixas parasitemias presentes em pacientes com infecção assintomática. Nas áreas endêmicas, a coleta de sangue total é dificultada pela distancia geográfica, transporte e adequada armazenagem das amostras. A coleta de sangue em papel de filtro pode ser uma alternativa nessas áreas de difícil acesso. Neste estudo foram comparados três diferentes métodos de extração de ADN a partir de

  9. Evaluation and optimization of nucleic acid extraction methods for the molecular analysis of bacterial communities associated with corrored steel

    NARCIS (Netherlands)

    Marty, F.; Ghiglione, J.-F.; Païsse, S.; Gueuné, H.; Quillet, L.; van Loosdrecht, M.C.M.; Muyzer, G.

    2012-01-01

    Different DNA and RNA extraction approaches were evaluated and protocols optimized on in situ corrosion products from carbon steel in marine environments. Protocols adapted from the PowerSoil DNA/RNA Isolation methods resulted in the best nucleic acid (NA) extraction performances (ie combining high

  10. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    Science.gov (United States)

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  11. Chemically modified DNA : methods and applications

    NARCIS (Netherlands)

    Gjonaj, Lorina

    2013-01-01

    Over het toepassen van DNA in de chemie DNA is een fascinerend biopolymeer dat gemakkelijk gemanipuleerd kan worden. Doel van het onderzoek van Lorina Gjonaj was het ontwikkelen van nieuwe methodologie om DNA chemisch te modificeren. Verschillende functionaliteiten zijn aan DNA gekoppeld. Deze

  12. DNA agarose gel electrophoresis for antioxidant analysis: Development of a quantitative approach for phenolic extracts.

    Science.gov (United States)

    Silva, Sara; Costa, Eduardo M; Vicente, Sandra; Veiga, Mariana; Calhau, Conceição; Morais, Rui M; Pintado, Manuela E

    2017-10-15

    Most of the fast in vitro assays proposed to determine the antioxidant capacity of a compound/extract lack either biological context or employ complex protocols. Therefore, the present work proposes the improvement of an agarose gel DNA electrophoresis in order to allow for a quantitative estimation of the antioxidant capacity of pure phenolic compounds as well as of a phenolic rich extract, while also considering their possible pro-oxidant effects. The result obtained demonstrated that the proposed method allowed for the evaluation of the protection of DNA oxidation [in the presence of hydrogen peroxide (H 2 O 2 ) and an H 2 O 2 /iron (III) chloride (FeCl 3 ) systems] as well as for the observation of pro-oxidant activities, with the measurements registering interclass correlation coefficients above 0.9. Moreover, this method allowed for the characterization of the antioxidant capacity of a blueberry extract while demonstrating that it had no perceived pro-oxidant effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    Directory of Open Access Journals (Sweden)

    Luis E. Rojas

    2014-07-01

    Full Text Available The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol. In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR. From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend different regions of the genome through PCR. Furthermore, it was possible to amplify a fragment of avr-4 gene DNA purified from lyophilized mycelium of Mycosphaerella fijiensis. Additionally, it was possible to amplify the region ap24 transgene inserted into the genome of banana cv. `Grande naine' (Musa AAA. Key words: alkaline lysis, Carica papaya L., Digitalis purpurea L., Musa, Saccharum officinarum L.

  14. Ancient microbes from halite fluid inclusions: optimized surface sterilization and DNA extraction.

    Directory of Open Access Journals (Sweden)

    Krithivasan Sankaranarayanan

    Full Text Available Fluid inclusions in evaporite minerals (halite, gypsum, etc. potentially preserve genetic records of microbial diversity and changing environmental conditions of Earth's hydrosphere for nearly one billion years. Here we describe a robust protocol for surface sterilization and retrieval of DNA from fluid inclusions in halite that, unlike previously published methods, guarantees removal of potentially contaminating surface-bound DNA. The protocol involves microscopic visualization of cell structures, deliberate surface contamination followed by surface sterilization with acid and bleach washes, and DNA extraction using Amicon centrifugal filters. Methods were verified on halite crystals of four different ages from Saline Valley, California (modern, 36 ka, 64 ka, and 150 ka, with retrieval of algal and archaeal DNA, and characterization of the algal community using ITS1 sequences. The protocol we developed opens up new avenues for study of ancient microbial ecosystems in fluid inclusions, understanding microbial evolution across geological time, and investigating the antiquity of life on earth and other parts of the solar system.

  15. Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

    Science.gov (United States)

    Kar, Indrani; Chattopadhyaya, Rajagopal

    2017-11-01

    The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

  16. Optimised Pre-Analytical Methods Improve KRAS Mutation Detection in Circulating Tumour DNA (ctDNA from Patients with Non-Small Cell Lung Cancer (NSCLC.

    Directory of Open Access Journals (Sweden)

    James L Sherwood

    Full Text Available Non-invasive mutation testing using circulating tumour DNA (ctDNA is an attractive premise. This could enable patients without available tumour sample to access more treatment options.Peripheral blood and matched tumours were analysed from 45 NSCLC patients. We investigated the impact of pre-analytical variables on DNA yield and/or KRAS mutation detection: sample collection tube type, incubation time, centrifugation steps, plasma input volume and DNA extraction kits.2 hr incubation time and double plasma centrifugation (2000 x g reduced overall DNA yield resulting in lowered levels of contaminating genomic DNA (gDNA. Reduced "contamination" and increased KRAS mutation detection was observed using cell-free DNA Blood Collection Tubes (cfDNA BCT (Streck, after 72 hrs following blood draw compared to EDTA tubes. Plasma input volume and use of different DNA extraction kits impacted DNA yield.This study demonstrated that successful ctDNA recovery for mutation detection in NSCLC is dependent on pre-analytical steps. Development of standardised methods for the detection of KRAS mutations from ctDNA specimens is recommended to minimise the impact of pre-analytical steps on mutation detection rates. Where rapid sample processing is not possible the use of cfDNA BCT tubes would be advantageous.

  17. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations.

    Science.gov (United States)

    You, David J; Yoon, Jeong-Yeol

    2012-09-04

    A computer numerical control (CNC) apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using "wire-guided" method (a pipette tip was used in this study). This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate). Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction). The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability), in rapid succession (using droplets), and with a high level of

  19. Droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling for simpler and faster PCR assay using wire-guided manipulations

    Directory of Open Access Journals (Sweden)

    You David J

    2012-09-01

    Full Text Available Abstract A computer numerical control (CNC apparatus was used to perform droplet centrifugation, droplet DNA extraction, and rapid droplet thermocycling on a single superhydrophobic surface and a multi-chambered PCB heater. Droplets were manipulated using “wire-guided” method (a pipette tip was used in this study. This methodology can be easily adapted to existing commercial robotic pipetting system, while demonstrated added capabilities such as vibrational mixing, high-speed centrifuging of droplets, simple DNA extraction utilizing the hydrophobicity difference between the tip and the superhydrophobic surface, and rapid thermocycling with a moving droplet, all with wire-guided droplet manipulations on a superhydrophobic surface and a multi-chambered PCB heater (i.e., not on a 96-well plate. Serial dilutions were demonstrated for diluting sample matrix. Centrifuging was demonstrated by rotating a 10 μL droplet at 2300 round per minute, concentrating E. coli by more than 3-fold within 3 min. DNA extraction was demonstrated from E. coli sample utilizing the disposable pipette tip to cleverly attract the extracted DNA from the droplet residing on a superhydrophobic surface, which took less than 10 min. Following extraction, the 1500 bp sequence of Peptidase D from E. coli was amplified using rapid droplet thermocycling, which took 10 min for 30 cycles. The total assay time was 23 min, including droplet centrifugation, droplet DNA extraction and rapid droplet thermocycling. Evaporation from of 10 μL droplets was not significant during these procedures, since the longest time exposure to air and the vibrations was less than 5 min (during DNA extraction. The results of these sequentially executed processes were analyzed using gel electrophoresis. Thus, this work demonstrates the adaptability of the system to replace many common laboratory tasks on a single platform (through re-programmability, in rapid succession (using droplets

  20. DNA extraction techniques compared for accurate detection of genetically modified organisms (GMOs) in maize food and feed products.

    Science.gov (United States)

    Turkec, Aydin; Kazan, Hande; Karacanli, Burçin; Lucas, Stuart J

    2015-08-01

    In this paper, DNA extraction methods have been evaluated to detect the presence of genetically modified organisms (GMOs) in maize food and feed products commercialised in Turkey. All the extraction methods tested performed well for the majority of maize foods and feed products analysed. However, the highest DNA content was achieved by the Wizard, Genespin or the CTAB method, all of which produced optimal DNA yield and purity for different maize food and feed products. The samples were then screened for the presence of GM elements, along with certified reference materials. Of the food and feed samples, 8 % tested positive for the presence of one GM element (NOS terminator), of which half (4 % of the total) also contained a second element (the Cauliflower Mosaic Virus 35S promoter). The results obtained herein clearly demonstrate the presence of GM maize in the Turkish market, and that the Foodproof GMO Screening Kit provides reliable screening of maize food and feed products.

  1. THE FACE EXTRACTION METHOD FOR MOBILE DEVICES

    Directory of Open Access Journals (Sweden)

    Viktor Borodin

    2013-10-01

    Full Text Available Normal 0 false false false MicrosoftInternetExplorer4 The problem of automatic face recognition on images is considered. The method of face ellipse extraction from photo and methods for face special points extraction are proposed /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Обычная таблица"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;}

  2. Method for priming and DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Mugasimangalam, R.C.; Ulanovsky, L.E.

    1997-12-01

    A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

  3. How Severely Is DNA Quantification Hampered by RNA Co-extraction?

    Science.gov (United States)

    Sanchez, Ignacio; Remm, Matthieu; Frasquilho, Sonia; Betsou, Fay; Mathieson, William

    2015-10-01

    The optional RNase digest that is part of many DNA extraction protocols is often omitted, either because RNase is not provided in the kit or because users do not want to risk contaminating their laboratory. Consequently, co-eluting RNA can become a "contaminant" of unknown magnitude in a DNA extraction. We extracted DNA from liver, lung, kidney, and heart tissues and established that 28-52% of the "DNA" as assessed by spectrophotometry is actually RNA (depending on tissue type). Including an RNase digest in the extraction protocol reduced 260:280 purity ratios. Co-eluting RNA drives an overestimation of DNA yield when quantification is carried out using OD 260 nm spectrophotometry, or becomes an unquantified contaminant when spectrofluorometry is used for DNA quantification. This situation is potentially incompatible with the best practice guidelines for biobanks issued by organizations such as the International Society for Biological and Environmental Repositories, which state that biospecimens should be accurately characterized in terms of their identity, purity, concentration, and integrity. Consequently, we conclude that an RNase digest must be included in DNA extractions if pure DNA is required. We also discuss the implications of unquantified RNA contamination in DNA samples in the context of laboratory accreditation schemes.

  4. Norgal: extraction and de novo assembly of mitochondrial DNA from whole-genome sequencing data.

    Science.gov (United States)

    Al-Nakeeb, Kosai; Petersen, Thomas Nordahl; Sicheritz-Pontén, Thomas

    2017-11-21

    Whole-genome sequencing (WGS) projects provide short read nucleotide sequences from nuclear and possibly organelle DNA depending on the source of origin. Mitochondrial DNA is present in animals and fungi, while plants contain DNA from both mitochondria and chloroplasts. Current techniques for separating organelle reads from nuclear reads in WGS data require full reference or partial seed sequences for assembling. Norgal (de Novo ORGAneLle extractor) avoids this requirement by identifying a high frequency subset of k-mers that are predominantly of mitochondrial origin and performing a de novo assembly on a subset of reads that contains these k-mers. The method was applied to WGS data from a panda, brown algae seaweed, butterfly and filamentous fungus. We were able to extract full circular mitochondrial genomes and obtained sequence identities to the reference sequences in the range from 98.5 to 99.5%. We also assembled the chloroplasts of grape vines and cucumbers using Norgal together with seed-based de novo assemblers. Norgal is a pipeline that can extract and assemble full or partial mitochondrial and chloroplast genomes from WGS short reads without prior knowledge. The program is available at: https://bitbucket.org/kosaidtu/norgal .

  5. Simple practical approach for sample loading prior to DNA extraction using a silica monolith in a microfluidic device.

    Science.gov (United States)

    Shaw, Kirsty J; Joyce, Domino A; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-12-07

    A novel DNA loading methodology is presented for performing DNA extraction on a microfluidic system. DNA in a chaotropic salt solution was manually loaded onto a silica monolith orthogonal to the subsequent flow of wash and elution solutions. DNA was successfully extracted from buccal swabs using electro-osmotic pumping (EOP) coupled with in situ reagents contained within a 1.5% agarose gel matrix. The extracted DNA was of sufficient quantity and purity for polymerase chain reaction (PCR) amplification.

  6. RNA preservation agents and nucleic acid extraction method bias perceived bacterial community composition.

    Directory of Open Access Journals (Sweden)

    Ann McCarthy

    Full Text Available Bias is a pervasive problem when characterizing microbial communities. An important source is the difference in lysis efficiencies of different populations, which vary depending on the extraction protocol used. To avoid such biases impacting comparisons between gene and transcript abundances in the environment, the use of one protocol that simultaneously extracts both types of nucleic acids from microbial community samples has gained popularity. However, knowledge regarding tradeoffs to combined nucleic acid extraction protocols is limited, particularly regarding yield and biases in the observed community composition. Here, we evaluated a commercially available protocol for simultaneous extraction of DNA and RNA, which we adapted for freshwater microbial community samples that were collected on filters. DNA and RNA yields were comparable to other commonly used, but independent DNA and RNA extraction protocols. RNA protection agents benefited RNA quality, but decreased DNA yields significantly. Choice of extraction protocol influenced the perceived bacterial community composition, with strong method-dependent biases observed for specific phyla such as the Verrucomicrobia. The combined DNA/RNA extraction protocol detected significantly higher levels of Verrucomicrobia than the other protocols, and those higher numbers were confirmed by microscopic analysis. Use of RNA protection agents as well as independent sequencing runs caused a significant shift in community composition as well, albeit smaller than the shift caused by using different extraction protocols. Despite methodological biases, sample origin was the strongest determinant of community composition. However, when the abundance of specific phylogenetic groups is of interest, researchers need to be aware of the biases their methods introduce. This is particularly relevant if different methods are used for DNA and RNA extraction, in addition to using RNA protection agents only for RNA

  7. Protective effects of aqueous and ethanolic extracts of Portulaca oleracea L. aerial parts on H2O2-induced DNA damage in lymphocytes by comet assay.

    Science.gov (United States)

    Behravan, Javad; Mosafa, Fatemeh; Soudmand, Negar; Taghiabadi, Elahe; Razavi, Bibi Marjan; Karimi, Gholamreza

    2011-09-01

    The comet assay is a standard method for measuring DNA damage. In this study, the protective effects of ethanolic and aqueous extracts of Portulaca oleracea L. (P. oleracea) on human lymphocyte DNA lesions were evaluated with the comet assay. Lymphocytes were isolated from blood samples taken from healthy volunteers. Human lymphocytes were incubated in H(2)O(2) (50,100, and 200 μM), aqueous extract (0.05, 0.1, 0.5, 1, and 2.5mg/ml), and ethanolic extracts (0.05, 0.1, 0.5, 1, and 2.5mg/ml) of P. oleraceae aerial parts alone with a combination of H(2)O(2) (100 μM) with either 1 or 2.5mg/ml of both extracts at 4°C for 30 minutes. The extent of DNA migration was measured using the alkaline single cell gel electrophoresis approach assay, and DNA damage was expressed as percentage tail DNA. We found that the aqueous extract of P. oleracea significantly inhibited DNA damage, while there was no effect of the ethanolic extract. These data suggest that the aqueous extract of P. oleracea can prevent oxidative DNA damage to human lymphocytes, which is likely due to antioxidant constituents in the extract. Copyright © 2011. Published by Elsevier B.V.

  8. Method for Extracting and Sequestering Carbon Dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Rau, Gregory H.; Caldeira, Kenneth G.

    2005-05-10

    A method and apparatus to extract and sequester carbon dioxide (CO2) from a stream or volume of gas wherein said method and apparatus hydrates CO2, and reacts the resulting carbonic acid with carbonate. Suitable carbonates include, but are not limited to, carbonates of alkali metals and alkaline earth metals, preferably carbonates of calcium and magnesium. Waste products are metal cations and bicarbonate in solution or dehydrated metal salts, which when disposed of in a large body of water provide an effective way of sequestering CO2 from a gaseous environment.

  9. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  10. Direct-acting DNA alkylating agents present in aqueous extracts of areca nut and its products.

    Science.gov (United States)

    Hu, Chiung-Wen; Chao, Mu-Rong

    2012-11-19

    Areca nut is a carcinogen to humans and has been strongly associated with oral premalignant and malignant diseases. Previous studies speculated the presence of unknown direct-acting mutagens present in aqueous extracts of areca nut. We hypothesized whether any direct-acting alkylating agents are present in areca nut and its commercial products. In this study, calf thymus DNA was treated with four different aqueous extracts obtained from unripe and ripe areca nuts or their commercial products, namely, pan masala (without tobacco) and gutkha (with tobacco). Three N-alkylated purines including N7-methylguanine (N7-MeG), N3-methyladenine (N3-MeA), and N7-ethylguanine (N7-EtG) were detected using sensitive and specific isotope-dilution liquid chromatography-tandem-mass spectrometry (LC-MS/MS) methods. The results showed that four types of aqueous extracts significantly induced the formation of N7-MeG and N3-MeA in a linear dose-response manner. Extracts from unripe areca nut exhibited higher methylating potency than those of ripe areca nut, while gutkha had higher methylating potency than pan masala. Meanwhile, gutkha made with areca nut and tobacco, was the only extract found to induce the formation of N7-EtG. Overall, this study first demonstrated that the presence of direct-acting alkylating agents in areca nut and its commercial products exist at a level that is able to cause significant DNA damage. Our findings may provide another mechanistic rationale for areca nut-mediated oral carcinogenesis and also highlight the importance and necessity of the identification of these direct-acting alkylating agents.

  11. Comparing transformation methods for DNA microarray data

    Directory of Open Access Journals (Sweden)

    Zwinderman Aeilko H

    2004-06-01

    Full Text Available Abstract Background When DNA microarray data are used for gene clustering, genotype/phenotype correlation studies, or tissue classification the signal intensities are usually transformed and normalized in several steps in order to improve comparability and signal/noise ratio. These steps may include subtraction of an estimated background signal, subtracting the reference signal, smoothing (to account for nonlinear measurement effects, and more. Different authors use different approaches, and it is generally not clear to users which method they should prefer. Results We used the ratio between biological variance and measurement variance (which is an F-like statistic as a quality measure for transformation methods, and we demonstrate a method for maximizing that variance ratio on real data. We explore a number of transformations issues, including Box-Cox transformation, baseline shift, partial subtraction of the log-reference signal and smoothing. It appears that the optimal choice of parameters for the transformation methods depends on the data. Further, the behavior of the variance ratio, under the null hypothesis of zero biological variance, appears to depend on the choice of parameters. Conclusions The use of replicates in microarray experiments is important. Adjustment for the null-hypothesis behavior of the variance ratio is critical to the selection of transformation method.

  12. Simple, miniaturized blood plasma extraction method.

    Science.gov (United States)

    Kim, Jin-Hee; Woenker, Timothy; Adamec, Jiri; Regnier, Fred E

    2013-12-03

    A rapid plasma extraction technology that collects a 2.5 μL aliquot of plasma within three minutes from a finger-stick derived drop of blood was evaluated. The utility of the plasma extraction cards used was that a paper collection disc bearing plasma was produced that could be air-dried in fifteen minutes and placed in a mailing envelop for transport to an analytical laboratory. This circumvents the need for venipuncture and blood collection in specialized vials by a phlebotomist along with centrifugation and refrigerated storage. Plasma extraction was achieved by applying a blood drop to a membrane stack through which plasma was drawn by capillary action. During the course of plasma migration to a collection disc at the bottom of the membrane stack blood cells were removed by a combination of adsorption and filtration. After the collection disc filled with an aliquot of plasma the upper membranes were stripped from the collection card and the collection disc was air-dried. Intercard differences in the volume of plasma collected varied approximately 1% while volume variations of less than 2% were seen with hematocrit levels ranging from 20% to 71%. Dried samples bearing metabolites and proteins were then extracted from the disc and analyzed. 25-Hydroxy vitamin D was quantified by LC-MS/MS analysis following derivatization with a secosteroid signal enhancing tag that imparted a permanent positive charge to the vitamin and reduced the limit of quantification (LOQ) to 1 pg of collected vitamin on the disc; comparable to values observed with liquid-liquid extraction (LLE) of a venipuncture sample. A similar study using conventional proteomics methods and spectral counting for quantification was conducted with yeast enolase added to serum as an internal standard. The LOQ with extracted serum samples for enolase was 1 μM, linear from 1 to 40 μM, the highest concentration examined. In all respects protein quantification with extracted serum samples was comparable to

  13. Radioprotective effect of methanolic root extract of Loeseneriella arnottiana on radiation induced DNA damage in human lymphocytes in vitro

    International Nuclear Information System (INIS)

    Prajna, P.S.

    2012-01-01

    Intense exposure to ionization radiation by accidental, occupational or therapeutical purpose causes cellular damage mainly by formation of excessive reactive oxygen species (ROS) or by free radicals. Humans are intentionally exposed to ionising radiation for diagnostic or therapeutic purposes. The use of ionising radiation in cancer therapy may lead to transient and/or permanent injury to normal tissues within the treatment field. To increase the therapeutic index of radiation therapy, various modes of radioprotection have been developed that selectively reduce cytotoxic effects to normal tissues. Because radiation-induced cellular damage is attributed primarily to the harmful effects of free radicals, molecules with radical scavenging properties are particularly promising as radioprotectors. Loeseneriella arnottiana, a member of family Hippocrateaceae, is a climbing shrub used by traditional medicine practitioners. To study the antioxidant activity and radioprotective effect of methanolic root extract of Loeseneriella arnottiana against electron beam radiation induced DNA damage in human lymphocytes. Loeseneriella arnottiana roots were dried and extracted using methanol by solvent extraction method. Antioxidant activity was measured by DPPH method. DNA damage was assessed by comet assay parameters. The lymphocytes were incubated for one hour with two different concentrations 10 μg and 50 μg of root extract before exposure to 2 Gy electron beam radiation. 30 μg of methanolic root extract of Loeseneriella arnottiana exhibited 96% radical scavenging activity comparable to 15 μg of ascorbic acid. In reducing power assay it showed dose dependent increase in absorbance indicating that extract is capable of donating hydrogen atoms. Pretreatment of lymphocytes with 10 μg and 50 μg of root extract before irradiation resulted in reduction in the Comet length, Olive tail moment, percentage of DNA in tail when compared to the radiation control group. Results of this

  14. Sample preparation methods for quantitative detection of DNA by molecular assays and marine biosensors.

    Science.gov (United States)

    Cox, Annie M; Goodwin, Kelly D

    2013-08-15

    The need for quantitative molecular methods is growing in environmental, food, and medical fields but is hindered by low and variable DNA extraction and by co-extraction of PCR inhibitors. DNA extracts from Enterococcus faecium, seawater, and seawater spiked with E. faecium and Vibrio parahaemolyticus were tested by qPCR for target recovery and inhibition. Conventional and novel methods were tested, including Synchronous Coefficient of Drag Alteration (SCODA) and lysis and purification systems used on an automated genetic sensor (the Environmental Sample Processor, ESP). Variable qPCR target recovery and inhibition were measured, significantly affecting target quantification. An aggressive lysis method that utilized chemical, enzymatic, and mechanical disruption enhanced target recovery compared to commercial kit protocols. SCODA purification did not show marked improvement over commercial spin columns. Overall, data suggested a general need to improve sample preparation and to accurately assess and account for DNA recovery and inhibition in qPCR applications. Published by Elsevier Ltd.

  15. Influence of extraction methods on the hepatotoxicity of Azadirachta ...

    African Journals Online (AJOL)

    The influence of extraction methods: Cold aqueous (CA) hot aqueous (HA) and alcoholic extraction (AE) methods on the hepatotoxic effect of Azadirachta indica bark extract (ABC) was investigated using albino rats. A total of forty eight rats were divided into three groups of sixteen rats equally for the extraction methods.

  16. Critical assessment of extracellular polymeric substances extraction methods from mixed culture biomass

    DEFF Research Database (Denmark)

    Pellicer i Nàcher, Carles; Domingo Felez, Carlos; Mutlu, Ayten Gizem

    2013-01-01

    . This study presents a rigorous and critical assessment of existing physical and chemical EPS extraction methods applied to mixed-culture biomass samples (nitrifying, nitritation-anammox, and activated sludge biomass). A novel fluorescence-based method was developed and calibrated to quantify the lysis...... potential of different EPS extraction protocols. We concluded that commonly used methods to assess cell lysis (DNA concentrations or G6PDH activities in EPS extracts) do not correlate with cell viability. Furthermore, we discovered that the presence of certain chemicals in EPS extracts results in severe...... underestimation of protein and carbohydrate concentrations by using standard analytical methods. Keeping both maximum EPS extraction yields and minimal biomass lysis as criteria, it was identified a sonication-based extraction method as the best to determine and compare tightly-bound EPS fractions in different...

  17. The use of carrier RNA to enhance DNA extraction from microfluidic-based silica monoliths.

    Science.gov (United States)

    Shaw, Kirsty J; Thain, Lauren; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-10-12

    DNA extraction was carried out on silica-based monoliths within a microfluidic device. Solid-phase DNA extraction methodology was applied in which the DNA binds to silica in the presence of a chaotropic salt, such as guanidine hydrochloride, and is eluted in a low ionic strength solution, such as water. The addition of poly-A carrier RNA to the chaotropic salt solution resulted in a marked increase in the effective amount of DNA that could be recovered (25ng) compared to the absence of RNA (5ng) using the silica-based monolith. These findings confirm that techniques utilising nucleic acid carrier molecules can enhance DNA extraction methodologies in microfluidic applications.

  18. Comparison of seven DNA extraction and ampliffication protocols in historical herbarium specimens of Juncaceae

    Czech Academy of Sciences Publication Activity Database

    Drábková, Lenka; Kirschner, Jan; Vlček, Čestmír

    2002-01-01

    Roč. 20, - (2002), s. 161-175 ISSN 0735-9640 R&D Projects: GA MŠk LN00A079; GA ČR GA206/02/0355 Institutional research plan: CEZ:AV0Z6005908 Keywords : cpDNA * DNA extraction * herbarium specimens Subject RIV: EF - Botanics Impact factor: 0.803, year: 2002

  19. Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci

    International Nuclear Information System (INIS)

    Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.

    2004-01-01

    Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis

  20. Co-isolation of in vivo 32P-labeled specific transcripts and DNA without phenol extraction of nuclease digestion

    International Nuclear Information System (INIS)

    Hayes, S.; Hayes, C.; Brand, L.

    1981-01-01

    A method is described for isolation and quantitation of specific intact transcripts, for which a hybridization probe is available, from 32 P-labeled bacterial cells. The RNA is extracted in the absence of R Nase activity by incorporating an inert, physically removable R Nase inhibitor throughout the spheroplasting, cell lysis, and pronase digestion steps. [/sup 32/P]RNA is separated from [ 32 P]DNA, without recourse to phenol extraction of DNase treatment, on a Cs 2 SO/sub 4-/HCONH 2 step gradient in which the precipitated RNA forms a sharp band. Specific transcripts are purified from [ 32 P]RNA by physical separation of the transcript and hybridization probe using gel-exclusion chromatography. The gentleness of this technique enables the co-isolation of DNA and can facilitate the analysis of covalently joined RNA-DNA replication intermediates

  1. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  2. A comparison of five extraction methods for extracellular polymeric ...

    African Journals Online (AJOL)

    Two physical methods (centrifugation and ultrasonication) and 3 chemical methods (extraction with EDTA, extraction with formaldehyde, and extraction with formaldehyde plus NaOH) for extraction of EPS from alga-bacteria biofilm were assessed. Pretreatment with ultrasound at low intensity doubled the EPS yield without ...

  3. Optimization of DNA extraction for RAPD and ISSR analysis of Arbutus unedo L. Leaves.

    Science.gov (United States)

    Sá, Olga; Pereira, José Alberto; Baptista, Paula

    2011-01-01

    Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo) this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds-namely polyvinyl pyrrolidone (PVP), 1,4-dithiothreitol (DTT) and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v) and sodium chloride (2M) concentration; and an extraction with organic solvents (phenol and chloroform) with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 μg/μL and the purity, evaluated by the ratio A(260)/A(280), was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  4. Optimization of DNA Extraction for RAPD and ISSR Analysis of Arbutus unedo L. Leaves

    Directory of Open Access Journals (Sweden)

    Paula Baptista

    2011-06-01

    Full Text Available Genetic analysis of plants relies on high yields of pure DNA. For the strawberry tree (Arbutus unedo this represents a great challenge since leaves can accumulate large amounts of polysaccharides, polyphenols and secondary metabolites, which co-purify with DNA. For this specie, standard protocols do not produce efficient yields of high-quality amplifiable DNA. Here, we present for the first time an improved leaf-tissue protocol, based on the standard cetyl trimethyl ammonium bromide protocol, which yields large amounts of high-quality amplifiable DNA. Key steps in the optimized protocol are the addition of antioxidant compounds—namely polyvinyl pyrrolidone (PVP, 1,4-dithiothreitol (DTT and 2-mercaptoethanol, in the extraction buffer; the increasing of CTAB (3%, w/v and sodium chloride (2M concentration; and an extraction with organic solvents (phenol and chloroform with the incubation of samples on ice. Increasing the temperature for cell lyses to 70 °C also improved both DNA quality and yield. The yield of DNA extracted was 200.0 ± 78.0 µg/µL and the purity, evaluated by the ratio A260/A280, was 1.80 ± 0.021, indicative of minimal levels of contaminating metabolites. The quality of the DNA isolated was confirmed by random amplification polymorphism DNA and by inter-simple sequence repeat amplification, proving that the DNA can be amplified via PCR.

  5. A CTAB Procedure Of Total Genomic DNA Extraction For Medicinal Mushrooms

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hussaini Mohd Mustafa; Muhammad Hanif Azhari Noor; Rosnani Abdul Rashid; Hasan Hamdani Hasan Mutaat; Meswan Meskom; Mat Rasol Awang

    2014-01-01

    Medicinal mushroom is defined as mushrooms used in medicine or medical research. Isolation of intact, high-molecular-mass genomic DNA is essential for many molecular biology applications including Polymerase Chain Reaction (PCR), endonuclease restriction digestion, Southern blot analysis, and genomic library construction. The most important and prerequisite towards reliable molecular biology work is the total genomic DNA of a sample must be in good quality. Five freshly samples of medicinal mushroom were used in this work known as Auriculariapolytricha, Lentinus edode, Pleurotus sayorcaju, Sczhizopyllum commune and Ganodermalucidum. 5 mg of each sample were used to extraction the DNA, prepared in 3 replications and repeated twice. PCR based technique by using ISSR markers were used in checking the amplification ability of the total genomic extraction. A standard Doyle and Doyle protocol for genomic DNA extraction was modified in optimizing the total genomic DNA from the medicinal mushroom.The modification parameters were percentage of CTAB, incubation period and temperature. The results reveal that each sample required a certain combinations of time and period of incubation. Besides, percentage of CTAB in the buffer was found significant in giving a high yielding of extracted total genomic DNA. The extracted total genomic DNA from the medicinal mushroom yielded from 39.7 ng/ μl to 919.1 ng/ μl. The different yield among the samples found to be corresponded to polysaccharide content in the medicinal mushrooms. The objective of this works is to optimize total genomic DNA extraction of medicinal mushrooms towards a high quality intact genomic DNA for molecular activities. (author)

  6. The validation of forensic DNA extraction systems to utilize soil contaminated biological evidence.

    Science.gov (United States)

    Kasu, Mohaimin; Shires, Karen

    2015-07-01

    The production of full DNA profiles from biological evidence found in soil has a high failure rate due largely to the inhibitory substance humic acid (HA). Abundant in various natural soils, HA co-extracts with DNA during extraction and inhibits DNA profiling by binding to the molecular components of the genotyping assay. To successfully utilize traces of soil contaminated evidence, such as that found at many murder and rape crime scenes in South Africa, a reliable HA removal extraction system would often be selected based on previous validation studies. However, for many standard forensic DNA extraction systems, peer-reviewed publications detailing the efficacy on soil evidence is either lacking or is incomplete. Consequently, these sample types are often not collected or fail to yield suitable DNA material due to the use of unsuitable methodology. The aim of this study was to validate the common forensic DNA collection and extraction systems used in South Africa, namely DNA IQ, FTA elute and Nucleosave for processing blood and saliva contaminated with HA. A forensic appropriate volume of biological evidence was spiked with HA (0, 0.5, 1.5 and 2.5 mg/ml) and processed through each extraction protocol for the evaluation of HA removal using QPCR and STR-genotyping. The DNA IQ magnetic bead system effectively removed HA from highly contaminated blood and saliva, and generated consistently acceptable STR profiles from both artificially spiked samples and crude soil samples. This system is highly recommended for use on soil-contaminated evidence over the cellulose card-based systems currently being preferentially used for DNA sample collection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. A DNA based method to detect the grapevine root-rotting fungus Roesleria subterranea in soil and root samples

    Directory of Open Access Journals (Sweden)

    S. Neuhauser

    2009-05-01

    Full Text Available Roesleria subterranea causes root rot in grapevine and fruit trees. The fungus has long been underestimated as a weak parasite, but during the last years it has been reported to cause severe damages in German vineyards. Direct, observation-based detection of the parasite is time consuming and destructive, as large parts of the rootstocks have to be uprooted and screened for the tiny, stipitate, hypogeous ascomata of R. subterranea. To facilitate rapid detection in vineyards, protocols to extract DNA from soil samples and grapevine roots, and R.-subterranea-specific PCR primers were designed. Twelve DNA-extraction protocols for soil samples were tested in small-scale experiments, and selected parameters were optimised. A protocol based on ball-mill homogenization, DNA extraction with SDS, skim milk, chloroform, and isopropanol, and subsequent purifi cation of the raw extracts with PVPP-spin-columns was most effective. This DNA extraction protocol was found to be suitable for a wide range of soil-types including clay, loam and humic-rich soils. For DNA extraction from grapevine roots a CTAB-based protocol was more reliable for various grapevine rootstock varieties. Roesleria-subterranea-specific primers for the ITS1-5.8S-ITS2 rDNA region were developed and tested for their specifi city to DNA extracts from eleven R. subterranea strains isolated from grapevine and fruit trees. No cross reactions were detected with DNA extracts from 44 different species of fungi isolated from vineyard soils. The sensitivity of the species-specifi c primers in combination with the DNA extraction method for soil was high: as little as 100 fg μl-1 R.-subterranea-DNA was suffi cient for a detection in soil samples and plant material. Given that specifi c primers are available, the presented method will also allow quick and large-scale testing for other root pathogens.

  8. A comparative study of Averrhoabilimbi extraction method

    Science.gov (United States)

    Zulhaimi, H. I.; Rosli, I. R.; Kasim, K. F.; Akmal, H. Muhammad; Nuradibah, M. A.; Sam, S. T.

    2017-09-01

    In recent year, bioactive compound in plant has become a limelight in the food and pharmaceutical market, leading to research interest to implement effective technologies for extracting bioactive substance. Therefore, this study is focusing on extraction of Averrhoabilimbi by different extraction technique namely, maceration and ultrasound-assisted extraction. Fewplant partsof Averrhoabilimbiweretaken as extraction samples which are fruits, leaves and twig. Different solvents such as methanol, ethanol and distilled water were utilized in the process. Fruit extractsresult in highest extraction yield compared to other plant parts. Ethanol and distilled water have significant role compared to methanol in all parts and both extraction technique. The result also shows that ultrasound-assisted extraction gave comparable result with maceration. Besides, the shorter period on extraction process gives useful in term of implementation to industries.

  9. Permanganate-assisted removal of PCR inhibitors during the DNA Chelex extraction from stained denim samples.

    Science.gov (United States)

    Pîrlea, Sorina; Puiu, Mihaela; Răducan, Adina; Oancea, Dumitru

    2017-03-01

    In this study, it was demonstrated that the DNA Chelex extraction combined with the permanganate assisted-oxidation is highly efficient in removing the PCR inhibitors often found in clothing materials, such as phthalocyanine. The extraction assays were conducted in saliva, blood and epithelial cells samples mixed with three oxidation-resistant dye copper(II) α-phthalocyanine, copper(II) β-phthalocyanine and tetrasulfonated copper(II) β-phthalocyanine. After DNA amplification, all samples were able to provide full DNA profiles. The permanganate/Chelex system was tested further on denim-stained samples and displayed the same ability to remove the PCR inhibitors from the commercial textile materials.

  10. Development of fluorescent methods for DNA methyltransferase assay

    Science.gov (United States)

    Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang

    2017-03-01

    DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.

  11. Image correlation method for DNA sequence alignment.

    Science.gov (United States)

    Curilem Saldías, Millaray; Villarroel Sassarini, Felipe; Muñoz Poblete, Carlos; Vargas Vásquez, Asticio; Maureira Butler, Iván

    2012-01-01

    The complexity of searches and the volume of genomic data make sequence alignment one of bioinformatics most active research areas. New alignment approaches have incorporated digital signal processing techniques. Among these, correlation methods are highly sensitive. This paper proposes a novel sequence alignment method based on 2-dimensional images, where each nucleic acid base is represented as a fixed gray intensity pixel. Query and known database sequences are coded to their pixel representation and sequence alignment is handled as object recognition in a scene problem. Query and database become object and scene, respectively. An image correlation process is carried out in order to search for the best match between them. Given that this procedure can be implemented in an optical correlator, the correlation could eventually be accomplished at light speed. This paper shows an initial research stage where results were "digitally" obtained by simulating an optical correlation of DNA sequences represented as images. A total of 303 queries (variable lengths from 50 to 4500 base pairs) and 100 scenes represented by 100 x 100 images each (in total, one million base pair database) were considered for the image correlation analysis. The results showed that correlations reached very high sensitivity (99.01%), specificity (98.99%) and outperformed BLAST when mutation numbers increased. However, digital correlation processes were hundred times slower than BLAST. We are currently starting an initiative to evaluate the correlation speed process of a real experimental optical correlator. By doing this, we expect to fully exploit optical correlation light properties. As the optical correlator works jointly with the computer, digital algorithms should also be optimized. The results presented in this paper are encouraging and support the study of image correlation methods on sequence alignment.

  12. Comparison of three methods for recovery of Brucella canis DNA from canine blood samples.

    Science.gov (United States)

    Batinga, Maria Cryskely A; Dos Santos, Jaíne C; Lima, Julia T R; Bigotto, Maria Fernanda D; Muner, Kerstin; Faita, Thalita; Soares, Rodrigo M; da Silva, David A V; Oliveira, Trícia M F S; Ferreira, Helena L; Diniz, Jaqueline A; Keid, Lara B

    2017-12-01

    Brucella canis, a gram-negative, facultative intracellular and zoonotic bacterium causes canine brucellosis. Direct methods are the most appropriate for the detection of canine brucellosis and bacterial isolation from blood samples has been employed as gold-standard method. However, due to the delay in obtaining results and the biological risk of the bacterial culturing, the polymerase chain reaction (PCR) has been successfully used as an alternative method for the diagnosis of the infection. Sample preparation is a key step for successful PCR and protocols that provide high DNA yield and purity are recommended to ensure high diagnostic sensitivity. The objective of this study was to evaluate the performance of PCR for the diagnosis of B. canis infection in 36 dogs by testing DNA of whole blood obtained through different extraction and purification protocols. Methods 1 and 2 were based on a commercial kit, using protocols recommended for DNA purification of whole blood and tissue samples, respectively. Method 3 was an in-house method based on enzymatic lysis and purification using organic solvents. The results of the PCR on samples obtained through three different DNA extraction protocols were compared to the blood culture. Of the 36 dogs, 13 (36.1%) were positive by blood culturing, while nine (25.0%), 14 (38.8%), and 15 (41.6%) were positive by PCR after DNA extraction using methods 1, 2 and 3, respectively. PCR performed on DNA purified by Method 2 was as efficient as blood culturing and PCR performed on DNA purified with in-house method, but had the advantage of being less laborious and, therefore, a suitable alternative for the direct B. canis detection in dogs. Copyright © 2017. Published by Elsevier B.V.

  13. Simple, rapid and cost-effective method for high quality nucleic acids extraction from different strains of Botryococcus braunii.

    Directory of Open Access Journals (Sweden)

    Byung-Hyuk Kim

    Full Text Available This study deals with an effective nucleic acids extraction method from various strains of Botryococcus braunii which possesses an extensive extracellular matrix. A method combining freeze/thaw and bead-beating with heterogeneous diameter of silica/zirconia beads was optimized to isolate DNA and RNA from microalgae, especially from B. braunii. Eukaryotic Microalgal Nucleic Acids Extraction (EMNE method developed in this study showed at least 300 times higher DNA yield in all strains of B. braunii with high integrity and 50 times reduced working volume compared to commercially available DNA extraction kits. High quality RNA was also extracted using this method and more than two times the yield compared to existing methods. Real-time experiments confirmed the quality and quantity of the input DNA and RNA extracted using EMNE method. The method was also applied to other eukaryotic microalgae, such as diatoms, Chlamydomonas sp., Chlorella sp., and Scenedesmus sp. resulting in higher efficiencies. Cost-effectiveness analysis of DNA extraction by various methods revealed that EMNE method was superior to commercial kits and other reported methods by >15%. This method would immensely contribute to area of microalgal genomics.

  14. Design of a titering assay for lentiviral vectors utilizing direct extraction of DNA from transduced cells in microtiter plates

    Directory of Open Access Journals (Sweden)

    Michele E Murphy

    2016-01-01

    Full Text Available Using lentiviral vector products in clinical applications requires an accurate method for measuring transduction titer. For vectors lacking a marker gene, quantitative polymerase chain reaction is used to evaluate the number of vector DNA copies in transduced target cells, from which a transduction titer is calculated. Immune Design previously described an integration-deficient lentiviral vector pseudotyped with a modified Sindbis virus envelope for use in cancer immunotherapy (VP02, of the ZVex platform. Standard protocols for titering integration-competent lentiviral vectors employ commercial spin columns to purify vector DNA from transduced cells, but such columns are not optimized for isolation of extrachromosomal (nonintegrated DNA. Here, we describe a 96-well transduction titer assay in which DNA extraction is performed in situ in the transduction plate, yielding quantitative recovery of extrachromosomal DNA. Vector titers measured by this method were higher than when commercial spin columns were used for DNA isolation. Evaluation of the method's specificity, linear range, and precision demonstrate that it is suitable for use as a lot release assay to support clinical trials with VP02. Finally, the method is compatible with titering both integrating and nonintegrating lentiviral vectors, suggesting that it may be used to evaluate the transduction titer for any lentiviral vector.

  15. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods.

    Science.gov (United States)

    Qu, Kaiyang; Han, Ke; Wu, Song; Wang, Guohua; Wei, Leyi

    2017-09-22

    DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF), is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  16. Identification of DNA-Binding Proteins Using Mixed Feature Representation Methods

    Directory of Open Access Journals (Sweden)

    Kaiyang Qu

    2017-09-01

    Full Text Available DNA-binding proteins play vital roles in cellular processes, such as DNA packaging, replication, transcription, regulation, and other DNA-associated activities. The current main prediction method is based on machine learning, and its accuracy mainly depends on the features extraction method. Therefore, using an efficient feature representation method is important to enhance the classification accuracy. However, existing feature representation methods cannot efficiently distinguish DNA-binding proteins from non-DNA-binding proteins. In this paper, a multi-feature representation method, which combines three feature representation methods, namely, K-Skip-N-Grams, Information theory, and Sequential and structural features (SSF, is used to represent the protein sequences and improve feature representation ability. In addition, the classifier is a support vector machine. The mixed-feature representation method is evaluated using 10-fold cross-validation and a test set. Feature vectors, which are obtained from a combination of three feature extractions, show the best performance in 10-fold cross-validation both under non-dimensional reduction and dimensional reduction by max-relevance-max-distance. Moreover, the reduced mixed feature method performs better than the non-reduced mixed feature technique. The feature vectors, which are a combination of SSF and K-Skip-N-Grams, show the best performance in the test set. Among these methods, mixed features exhibit superiority over the single features.

  17. Sample preparation methods for quantitative detection of DNA by molecular assays and marine biosensors

    International Nuclear Information System (INIS)

    Cox, Annie M.; Goodwin, Kelly D.

    2013-01-01

    Highlights: • DNA extraction methods affected measured qPCR target recovery. • Recovery and variability differed, sometimes by more than an order of magnitude. • SCODA did not offer significant improvement with PCR-inhibited seawater. • Aggressive lysis did appear to improve target recovery. • Reliable and affordable correction methods are needed for quantitative PCR. -- Abstract: The need for quantitative molecular methods is growing in environmental, food, and medical fields but is hindered by low and variable DNA extraction and by co-extraction of PCR inhibitors. DNA extracts from Enterococcus faecium, seawater, and seawater spiked with E. faecium and Vibrio parahaemolyticus were tested by qPCR for target recovery and inhibition. Conventional and novel methods were tested, including Synchronous Coefficient of Drag Alteration (SCODA) and lysis and purification systems used on an automated genetic sensor (the Environmental Sample Processor, ESP). Variable qPCR target recovery and inhibition were measured, significantly affecting target quantification. An aggressive lysis method that utilized chemical, enzymatic, and mechanical disruption enhanced target recovery compared to commercial kit protocols. SCODA purification did not show marked improvement over commercial spin columns. Overall, data suggested a general need to improve sample preparation and to accurately assess and account for DNA recovery and inhibition in qPCR applications

  18. Two efficient methods for isolation of high-quality genomic DNA from entomopathogenic fungi.

    Science.gov (United States)

    Serna-Domínguez, María G; Andrade-Michel, Gilda Y; Arredondo-Bernal, Hugo C; Gallou, Adrien

    2018-03-27

    Conventional and commercial methods for isolation of nucleic acids are available for fungal samples including entomopathogenic fungi (EPF). However, there is not a unique optimal method for all organisms. The cell wall structure and the wide range of secondary metabolites of EPF can broadly interfere with the efficiency of the DNA extraction protocol. This study compares three commercial protocols: DNeasy® Plant Mini Kit (Qiagen), Wizard® Genomic DNA Purification Kit (Promega), and Axygen™ Multisource Genomic DNA Miniprep Kit (Axygen) and three conventional methods based on different buffers: SDS, CTAB/PVPP, and CTAB/β-mercaptoethanol versus three cell lysis procedures: liquid nitrogen homogenization and two bead-beating materials (i.e., tungsten-carbide and stainless-steel) for four representative species of EPF (i.e., Beauveria bassiana, Hirsutella citriformis, Isaria javanica, and Metarhizium anisopliae). Liquid nitrogen homogenization combined with DNeasy® Plant Mini Kit (i.e., QN) or SDS buffer (i.e., SN) significantly improved the yield with a good purity (~1.8) and high integrity (>20,000 bp) of genomic DNA in contrast with other methods, also, these results were better when compared with the two bead-beating materials. The purified DNA was evaluated by PCR-based techniques: amplification of translation elongation factor 1-α (TEF) and two highly sensitive molecular markers (i.e., ISSR and AFLP) with reliable and reproducible results. Despite a variation in yield, purity, and integrity of extracted DNA across the four species of EPF with the different DNA extraction methods, the SN and QN protocols maintained a high-quality of DNA which is required for downstream molecular applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Universal DNA-based methods for assessing the diet of grazing livestock and wildlife from feces.

    Science.gov (United States)

    Pegard, Anthony; Miquel, Christian; Valentini, Alice; Coissac, Eric; Bouvier, Frédéric; François, Dominique; Taberlet, Pierre; Engel, Erwan; Pompanon, François

    2009-07-08

    Because of the demand for controlling livestock diets, two methods that characterize the DNA of plants present in feces were developed. After DNA extraction from fecal samples, a short fragment of the chloroplastic trnL intron was amplified by PCR using a universal primer pair for plants. The first method generates a signature that is the electrophoretic migration pattern of the PCR product. The second method consists of sequencing several hundred DNA fragments from the PCR product through pyrosequencing. These methods were validated with a blind analysis of feces from concentrate- and pasture-fed lambs. The signature method allowed differentiation of the two diets and confirmed the presence of concentrate in one of them. The pyrosequencing method allowed the identification of up to 25 taxa in a diet. These methods are complementary to the chemical methods already used. They could be applied to the control of diets and the study of food preferences.

  20. Introduction to DNA methods for identification of irradiated foods

    International Nuclear Information System (INIS)

    Delincee, H.

    1996-01-01

    This brief introduction sets the scene with respect to the presentations in this ADMIT meeting dealing with DNA changes as a tool to detect the radiation processing of food. The choice to examine DNA seems obvious, since DNA is a sensitive cellular target to irradiation and the changes in DNA are responsible for many effects observed in irradiated foods, such as the inactivation of microorganisms, elimination of insects, inhibition of sprouting in bulbs and tubers and delay of ripening in several fruits. Therefore, these changes in DNA should be discernible in microbial or insect DNA or in the nucleic acids in the food itself. If DNA changes were specific to irradiation, a detection method could be designed which would have wide applicability, since most foods are derived from living organisms which all contain DNA. Such a method could almost be the universal method for detecting the radiation treatment of foods. Radiation-induced changes in DNA can be analysed by a variety of analytical techniques, which have mostly been employed on pure DNA or on DNA in living cells in radiation biology research. Whether or not some of these techniques can be utilised to detect irradiated food has recently been very briefly discussed. (author)

  1. Extraction Methods for the Isolation of Isoflavonoids from Plant Material

    Directory of Open Access Journals (Sweden)

    Blicharski Tomasz

    2017-03-01

    Full Text Available The purpose of this review is to describe and compare selected traditional and modern extraction methods employed in the isolation of isoflavonoids from plants. Conventional methods such as maceration, percolation, or Soxhlet extraction are still frequently used in phytochemical analysis. Despite their flexibility, traditional extraction techniques have significant drawbacks, including the need for a significant investment of time, energy, and starting material, and a requirement for large amounts of potentially toxic solvents. Moreover, these techniques are difficult to automate, produce considerable amount of waste and pose a risk of degradation of thermolabile compounds. Modern extraction methods, such as: ultrasound-assisted extraction, microwave-assisted extraction, accelerated solvent extraction, supercritical fluid extraction, and negative pressure cavitation extraction, can be regarded as remedies for the aforementioned problems. This manuscript discusses the use of the most relevant extraction techniques in the process of isolation of isoflavonoids, secondary metabolites that have been found to have a plethora of biological and pharmacological activities.

  2. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  3. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    Science.gov (United States)

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for

  4. Methods for High-throughput Characterisation of Environmental DNA

    DEFF Research Database (Denmark)

    Andersen, Kenneth

    This PhD thesis examines the potential of describing biodiversity of green plants (Viridiplantae), birds (Aves) and mammals (Mammalia), in the context of next-generation sequencing, from the DNA that all organisms segregate into the environment (eDNA). The research is based on case studies...... of species assemblages described by eDNA recovered from contemporary surface soil and Holocene sediment sequences, to assess the accuracy and limitations of the approach. Biodiversity incorporates two aspects of ecological communities, including both the taxonomic richness and abundance of individual taxa...... inhibition. In chapter four, alternative DNA extraction protocols and pipelines for characterising plant eDNA are tested on samples from contrasting environments including modern, Holocene and Pleistocene sediment samples. These results are compared to pollen and macrofossil records described from earlier...

  5. Rapid and inexpensive method for isolating plasmid DNA

    International Nuclear Information System (INIS)

    Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.

    1997-01-01

    A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs

  6. Nucleic acid extraction, oligonucleotide probes and PCR methods

    International Nuclear Information System (INIS)

    Zhongtang Yu; Forster, R.J.

    2005-01-01

    analysis, and hybridization-based methods, such as RNA-targeted hybridization, fluorescence in situ hybridization (FISH), and microarray, have been employed. The application of these molecular techniques has been changing our perspectives about ruminal and GI microbiota. Except for FISH, all these methods analyse DNA or RNA extracted from samples collected from rumen or GI tracts. Therefore, reliable and efficient DNA/RNA extraction is the pre-requisite of molecular ecological studies of ruminal microbiota

  7. Extraction of PCR-amplifiable genomic DNA from Bacillus anthracisspores

    Energy Technology Data Exchange (ETDEWEB)

    Torok, Tamas

    2003-05-19

    Bacterial endospore disruption and nucleic acid extractionresulting in DNA of PCR-amplifiable quality and quantity are not trivial.Responding to the needs of the Hazardous Materials Response Unit (HMRU),Laboratory Division, Federal Bureau of Investigation, protocols weredeveloped to close these gaps. Effectiveness and reproducibility of thetechniques were validated with laboratory grown pure spores of Bacillusanthracis and its close phylogenetic neighbors, and with spiked soils anddamaged samples.

  8. Antioxidant, cytotoxic and DNA protective properties of Achillea eriophora DC. and Achillea biebersteinii Afan. extracts: A comparative study

    Directory of Open Access Journals (Sweden)

    Maryam Varasteh-kojourian

    2017-02-01

    Full Text Available Objective: Achillea is a traditional medicinal herb which contains different phenol and flavonoid compounds that are responsible for Achillea pharmacological effects. We aimed to determine phenol and flavonoid contents, besides antioxidant activities of different extracts from Achillea eriophoraa (A. eriophora DC. and Achillea biebersteinii (A. biebersteinii Afan. (endemic species in Iran and to investigate their effects on human cells.Materials and Methods: Achillea extracts, were prepared by maceration and shaking methods, from different parts (aerial parts, stem, leaves and inflorescence of two species using methanol and ethanol as solvents. Total phenol and flavonoid contents were measured by spectrophotometry, and antioxidant activities of the extracts were determined by DPPH radical scavenging, BCB and TBARS assays. Cytotoxicity and antioxidant activities of the extracts were investigated in Human Foreskin Fibroblast (HFF3 cells using MTT, comet and H2O2 assays.Results: Methanol extracts of A. biebersteinii prepared from leaves and inflorescence by maceration method exhibited maximum phenol (1657.58 ± 36.45 mg GAE/100 g DW and flavonoid (264.00 ± 62.16 mg QUE/100 g DW contents. Leaf methanol extract showed significantly higher antioxidant activity (0.0276 ± 0.003, 0.16 ± 0.016 and 13.96 ± 0.26 mg/ml for DPPH, BCB and TBARS IC50s, respectively than those of the other extracts. Leaf extract of A. biebersteinii was not cytotoxic even at the highest examined dose (512 µg/ml and inhibited cell toxicity induced by H2O2 (98% viability for the cells pretreated with plant extract in the presence of H2O2. Comet assay also confirmed high DNA protective activity of leaf extracts.Conclusion: Achillea extracts possess remarkable antioxidant activity, and could be good natural alternatives to synthetic antioxidants in pharmaceutical and food industries.

  9. In situ genomic DNA extraction for PCR analysis of regions of interest in four plant species and one filamentous fungi

    OpenAIRE

    Luis E. Rojas; Maritza Reyes; Naivy Pérez-Alonso; María I. Olóriz; Laisyn Posada-Pérez; Bárbara Ocaña; Orelvis Portal; Borys Chong-Pérez; Jorge L. Pérez Pérez

    2014-01-01

    The extraction methods of genomic DNA are usually laborious and hazardous to human health and the environment by the use of organic solvents (chloroform and phenol). In this work a protocol for in situ extraction of genomic DNA by alkaline lysis is validated. It was used in order to amplify regions of DNA in four species of plants and fungi by polymerase chain reaction (PCR). From plant material of Saccharum officinarum L., Carica papaya L. and Digitalis purpurea L. it was possible to extend ...

  10. Optimizing factors influencing DNA extraction from fresh whole avian ...

    African Journals Online (AJOL)

    Administrator

    2007-02-19

    Feb 19, 2007 ... RNA transcription, nucleic acid labeling (random primer labeling) etc. Hence ... form extraction are “tried and true” and nearly always work. Many modified versions of ... Effect (mean ± SE) of starting blood sample (µl) on variables studied. Blood sample ..... PhD Thesis submitted to University of. Agricultural ...

  11. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    Science.gov (United States)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (pextract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (pextract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  12. Fetal DNA: strategies for optimal recovery

    NARCIS (Netherlands)

    Legler, Tobias J.; Heermann, Klaus-Hinrich; Liu, Zhong; Soussan, Aicha Ait; van der Schoot, C. Ellen

    2008-01-01

    For fetal DNA extraction, in principle each DNA extraction method can be used; however, because most methods have been optimized for genomic DNA from leucocytes, we describe here the methods that have been optimized for the extraction of fetal DNA from maternal plasma and validated for this purpose

  13. Extraction of inhibitor-free metagenomic DNA from polluted sediments, compatible with molecular diversity analysis using adsorption and ion-exchange treatments.

    Science.gov (United States)

    Desai, Chirayu; Madamwar, Datta

    2007-03-01

    PCR inhibitor-free metagenomic DNA of high quality and high yield was extracted from highly polluted sediments using a simple remediation strategy of adsorption and ion-exchange chromatography. Extraction procedure was optimized with series of steps, which involved gentle mechanical lysis, treatment with powdered activated charcoal (PAC) and ion-exchange chromatography with amberlite resin. Quality of the extracted DNA for molecular diversity analysis was tested by amplifying bacterial 16S rDNA (16S rRNA gene) with eubacterial specific universal primers (8f and 1492r), cloning of the amplified 16S rDNA and ARDRA (amplified rDNA restriction analysis) of the 16S rDNA clones. The presence of discrete differences in ARDRA banding profiles provided evidence for expediency of the DNA extraction protocol in molecular diversity studies. A comparison of the optimized protocol with commercial Ultraclean Soil DNA isolation kit suggested that method described in this report would be more efficient in removing metallic and organic inhibitors, from polluted sediment samples.

  14. Modified method for combined DNA and RNA isolation from peanut and other oil seeds.

    Science.gov (United States)

    Dang, Phat M; Chen, Charles Y

    2013-02-01

    Isolation of good quality RNA and DNA from seeds is difficult due to high levels of polysaccharides, polyphenols, and lipids that can degrade or co-precipitate with nucleic acids. Standard RNA extraction methods utilizing guanidinium-phenol-chloroform extraction has not shown to be successful. RNA isolation from plant seeds is a prerequisite for many seed specific gene expression studies and DNA is necessary in marker-assisted selection and other genetic studies. We describe a modified method to isolate both RNA and DNA from the same seed tissue and have been successful with several oil seeds including peanut, soybean, sunflower, canola, and oil radish. An additional LiCl precipitation step was added to isolate both RNA and DNA from the same seed tissues. High quality nucleic acids were observed based on A(260)/A(280) and A(260)/A(230) ratios above 2.0 and distinct bands on gel-electrophoresis. RNA was shown to be suitable for reverse transcriptase polymerase chain reaction based on actin or 60S ribosomal primer amplification and DNA was shown to have a single band on gel-electrophoresis analysis. This result shows that RNA and DNA isolated using this method can be appropriate for molecular studies in peanut and other oil containing seeds.

  15. Comparing transformation methods for DNA microarray data

    NARCIS (Netherlands)

    Thygesen, Helene H.; Zwinderman, Aeilko H.

    2004-01-01

    Background: When DNA microarray data are used for gene clustering, genotype/phenotype correlation studies, or tissue classification the signal intensities are usually transformed and normalized in several steps in order to improve comparability and signal/noise ratio. These steps may include

  16. Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

    Science.gov (United States)

    Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

    2007-06-01

    Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

  17. A Universal Fast Colorimetric Method for DNA Signal Detection with DNA Strand Displacement and Gold Nanoparticles

    Directory of Open Access Journals (Sweden)

    Xin Li

    2015-01-01

    Full Text Available DNA or gene signal detection is of great significance in many fields including medical examination, intracellular molecular monitoring, and gene disease signal diagnosis, but detection of DNA or gene signals in a low concentration with instant visual results remains a challenge. In this work, a universal fast and visual colorimetric detection method for DNA signals is proposed. Specifically, a DNA signal amplification “circuit” based on DNA strand displacement is firstly designed to amplify the target DNA signals, and then thiol modified hairpin DNA strands and gold nanoparticles are used to make signal detection results visualized in a colorimetric manner. If the target DNA signal exists, the gold nanoparticles aggregate and settle down with color changing from dark red to grey quickly; otherwise, the gold nanoparticles’ colloids remain stable in dark red. The proposed method provides a novel way to detect quickly DNA or gene signals in low concentrations with instant visual results. When applied in real-life, it may provide a universal colorimetric method for gene disease signal diagnosis.

  18. Ethanol and sodium acetate as a preservation method to delay degradation of environmental DNA

    Science.gov (United States)

    Ladell, Bridget A.; Walleser, Liza R.; McCalla, S. Grace; Erickson, Richard A.; Amberg, Jon J.

    2018-01-01

    Environmental DNA (eDNA) samples that are collected from remote locations depend on rapid stabilization of the DNA. The degradation of eDNA in water samples is minimized when samples are stored at ≤ 4 °C. Developing a preservation technique to maintain eDNA integrity at room temperature would allow a wider range of locations to be sampled. We evaluated an ethanol and sodium acetate solution to maintain the integrity of the DNA samples for the time between collection and lab testing. For this evaluation, replicate water samples taken from a tank housing Asian carp were placed on ice or held at room temperature. At both temperatures, water samples were left untreated or were preserved with an ethanol and sodium acetate solution (EtOH–NaAc). Every day for 6 days following collection, a subset of the samples was removed from each preservation method and DNA was extracted and nuclear and mitochondrial markers were assayed with qPCR. Results showed comparable persistence of DNA between iced samples without the EtOH–NaAc treatment and samples that received EtOH–NaAc treatment that were kept at room temperature. We found that DNA can be amplified from preserved samples using an EtOH–NaAc solution after up to 7 days at room temperature.

  19. Comparative evaluation of total RNA extraction methods in Theobroma cacao using shoot apical meristems.

    Science.gov (United States)

    Silva, D V; Branco, S M J; Holanda, I S A; Royaert, S; Motamayor, J C; Marelli, J P; Corrêa, R X

    2016-03-04

    Theobroma cacao is a species of great economic importance with its beans used for chocolate production. The tree has been a target of various molecular studies. It contains many polyphenols, which complicate the extraction of nucleic acids with the extraction protocols requiring a large amount of plant material. These issues, therefore, necessitate the optimization of the protocols. The aim of the present study was to evaluate different methods for extraction of total RNA from shoot apical meristems of T. cacao 'CCN 51' and to assess the influence of storage conditions for the meristems on the extraction. The study also aimed to identify the most efficient protocol for RNA extraction using a small amount of plant material. Four different protocols were evaluated for RNA extraction using one shoot apical meristem per sample. Among these protocols, one that was more efficient was then tested to extract RNA using four different numbers of shoot apical meristems, subjected to three different storage conditions. The best protocol was tested for cDNA amplification using reverse transcription-polymerase chain reaction; the cDNA quality was determined to be satisfactory for molecular analyses. The study revealed that with the best RNA extraction protocol, one shoot apical meristem was sufficient for extraction of high-quality total RNA. The results obtained might enable advances in genetic analyses and molecular studies using reduced amount of plant material.

  20. DNA Damage Protecting Activity and Antioxidant Potential of Launaea taraxacifolia Leaves Extract.

    Science.gov (United States)

    Adinortey, Michael Buenor; Ansah, Charles; Weremfo, Alexander; Adinortey, Cynthia Ayefoumi; Adukpo, Genevieve Etornam; Ameyaw, Elvis Ofori; Nyarko, Alexander Kwadwo

    2018-01-01

    The leaf extract of Launaea taraxacifolia commonly known as African Lettuce is used locally to treat dyslipidemia and liver diseases, which are associated with oxidative stress. Methanol extract from L. taraxacifolia leaves was tested for its antioxidant activity and its ability to protect DNA from oxidative damage. In vitro antioxidant potential of the leaf extract was evaluated using 1,1-diphenyl-2-picrylhydrazyl (DPPH), nitric oxide (NO), and hydroxyl (OH) radical scavenging assays. Ferric reducing power, total antioxidant capacity (TAC), metal chelating, and anti-lipid peroxidation ability of the extract were also examined using gallic acid, ascorbic acid, citric acid, and ethylenediaminetetraacetic acid as standards. L. taraxacifolia leaves extract showed antioxidant activity with IC 50 values of 16.18 μg/ml (DPPH), 123.3 μg/ml (NO), 128.2 μg/ml (OH radical), 97.94 μg/ml (metal chelating), 80.28 μg/ml (TAC), and 23 μg/ml (anti-lipid peroxidation activity). L. taraxacifolia leaves extract exhibited a strong capability for DNA damage protection at 20 mg/ml concentration. These findings suggest that the methanolic leaf extract of L. taraxacifolia could be used as a natural antioxidant and also as a preventive therapy against diseases such as arteriosclerosis associated with DNA damage.

  1. A combined method for DNA analysis and radiocarbon dating from a single sample.

    Science.gov (United States)

    Korlević, Petra; Talamo, Sahra; Meyer, Matthias

    2018-03-07

    Current protocols for ancient DNA and radiocarbon analysis of ancient bones and teeth call for multiple destructive samplings of a given specimen, thereby increasing the extent of undesirable damage to precious archaeological material. Here we present a method that makes it possible to obtain both ancient DNA sequences and radiocarbon dates from the same sample material. This is achieved by releasing DNA from the bone matrix through incubation with either EDTA or phosphate buffer prior to complete demineralization and collagen extraction utilizing the acid-base-acid-gelatinization and ultrafiltration procedure established in most radiocarbon dating laboratories. Using a set of 12 bones of different ages and preservation conditions we demonstrate that on average 89% of the DNA can be released from sample powder with minimal, or 38% without any, detectable collagen loss. We also detect no skews in radiocarbon dates compared to untreated samples. Given the different material demands for radiocarbon dating (500 mg of bone/dentine) and DNA analysis (10-100 mg), combined DNA and collagen extraction not only streamlines the sampling process but also drastically increases the amount of DNA that can be recovered from limited sample material.

  2. System and method for free-boundary surface extraction

    KAUST Repository

    Algarni, Marei

    2017-10-26

    A method of extracting surfaces in three-dimensional data includes receiving as inputs three-dimensional data and a seed point p located on a surface to be extracted. The method further includes propagating a front outwardly from the seed point p and extracting a plurality of ridge curves based on the propagated front. A surface boundary is detected based on a comparison of distances between adjacent ridge curves and the desired surface is extracted based on the detected surface boundary.

  3. Comparison of five methods for extraction of Legionella pneumophila from respiratory specimens.

    Science.gov (United States)

    Wilson, Deborah; Yen-Lieberman, Belinda; Reischl, Udo; Warshawsky, Ilka; Procop, Gary W

    2004-12-01

    The efficiencies of five commercially available nucleic acid extraction methods were evaluated for the recovery of a standardized inoculum of Legionella pneumophila in respiratory specimens (sputum and bronchoalveolar lavage [BAL] specimens). The concentrations of Legionella DNA recovered from sputa with the automated MagNA Pure (526,200 CFU/ml) and NucliSens (171,800 CFU/ml) extractors were greater than those recovered with the manual methods (i.e., Roche High Pure kit [133,900 CFU/ml], QIAamp DNA Mini kit [46,380 CFU/ml], and ViralXpress kit [13,635 CFU/ml]). The rank order was the same for extracts from BAL specimens, except that for this specimen type the QIAamp DNA Mini kit recovered more than the Roche High Pure kit.

  4. Myricitrin and bioactive extract of Albizia amara leaves: DNA protection and modulation of fertility and antioxidant-related genes expression.

    Science.gov (United States)

    Kassem, Mona El Said; Ibrahim, Lamya Fawzy; Hussein, Sameh Reda; El-Sharawy, Reham; El-Ansari, Mohamed Amin; Hassanane, Mahrousa Mohamed; Booles, Hoda Fahime

    2016-11-01

    Albizia species are reported to exhibit many biological activities including antiovulatory properties in female rats and antispermatogenic and antiandrogenic activities in male rats. The present study investigates the flavonoids of Albizia amara (Roxb.) B. Boivin (Fabaceae) leaves and evaluates their activity on gene expression of fertility and antioxidant glutathione-S-transferase-related genes of treated female mice in addition to their effect on DNA damage. Plant materials were extracted by using 70% methanol for 48 h, the extract was chromatographed on a polyamide 6S column, each isolated compound was purified by using Sephadex LH-20 column; its structure was elucidated by chemical and spectral methods. Both the leaves extract and myricitrin (200, 30 mg/kg bw/d, respectively) were assayed for their effect on DNA damage in female mice after four weeks treatment using Comet assay. Their modulatory activity on gene expression of fertility (aromatase CYP19 and luteinizing hormone LH) and antioxidant glutathione-S-transferase (GST)-related genes of treated female mice were investigated by real-time PCR (qPCR). Quercetin-3-O-gentiobioside, myricitrin, quercetin-3-O-α-rhamnopyranoside, myricetin, quercetin and kaempferol were isolated and identified from the studied taxa. Myricitrin and the extract induced low rate of DNA damage (4.8% and 5%, respectively), compared with the untreated control (4.2%) and significantly down-regulated the expression of CYP19 and LH genes and up-regulated GST gene. Our results highlight the potential effect of the leaves extract of Albizia amara and myricitrin as fertility-regulating phytoconstituents with ability to protect DNA from damage and cells from oxidative stress.

  5. Minimally destructive DNA extraction from archaeological artefacts made from whale baleen

    DEFF Research Database (Denmark)

    Sinding, Mikkel Holger Strander; Gilbert, Tom; Grønnow, Bjarne

    2012-01-01

    Here we demonstrate the successful extraction and amplification of target species DNA from artefacts made of whale baleen collected from excavations of past palaeo-Eskimo and Inuit cultures in Greenland. DNA was successfully extracted and amplified from a single baleen bristle of 1.5 cm length...... genetic studies. We conclude that genetic investigation of historical baleen collections can contribute to our knowledge of the prehistoric population genetics of baleen whales, for example by quantifying the impact of modern whaling on the genetic diversity of bowhead whales....

  6. Extraction of Trypanosoma cruzi DNA from food: a contribution to the elucidation of acute Chagas disease outbreaks

    Directory of Open Access Journals (Sweden)

    Renata Trotta Barroso Ferreira

    2016-04-01

    Full Text Available Abstract: INTRODUCTION: Before 2004, the occurrence of acute Chagas disease (ACD by oral transmission associated with food was scarcely known or investigated. Originally sporadic and circumstantial, ACD occurrences have now become frequent in the Amazon region, with recently related outbreaks spreading to several Brazilian states. These cases are associated with the consumption of açai juice by waste reservoir animals or insect vectors infected with Trypanosoma cruzi in endemic areas. Although guidelines for processing the fruit to minimize contamination through microorganisms and parasites exist, açai-based products must be assessed for quality, for which the demand for appropriate methodologies must be met. METHODS: Dilutions ranging from 5 to 1,000 T. cruzi CL Brener cells were mixed with 2mL of acai juice. Four Extraction of T. cruzi DNA methods were used on the fruit, and the cetyltrimethyl ammonium bromide (CTAB method was selected according to JRC, 2005. RESULTS: DNA extraction by the CTAB method yielded satisfactory results with regard to purity and concentration for use in PCR. Overall, the methods employed proved that not only extraction efficiency but also high sensitivity in amplification was important. CONCLUSIONS: The method for T. cruzi detection in food is a powerful tool in the epidemiological investigation of outbreaks as it turns epidemiological evidence into supporting data that serve to confirm T. cruzi infection in the foods. It also facilitates food quality control and assessment of good manufacturing practices involving acai-based products.

  7. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  8. Genomic DNA extraction and barcoding of endophytic fungi.

    Science.gov (United States)

    Diaz, Patricia L; Hennell, James R; Sucher, Nikolaus J

    2012-01-01

    Endophytes live inter- and/or intracellularly inside healthy aboveground tissues of plants without causing disease. Endophytic fungi are found in virtually every vascular plant species examined. The origins of this symbiotic relationship between endophytes go back to the emergence of vascular plants. Endophytic fungi receive nutrition and protection from their hosts while the plants benefit from the production of fungal secondary metabolites, which enhance the host plants' resistance to herbivores, pathogens, and various abiotic stresses. Endophytic fungi have attracted increased interest as potential sources of secondary metabolites with agricultural, industrial, and medicinal use. This chapter provides detailed protocols for isolation of genomic DNA from fungal endophytes and its use in polymerase chain reaction-based amplification of the internal transcribed spacer region between the conserved flanking regions of the small and large subunit of ribosomal RNA for barcoding purposes.

  9. Ancient DNA extracted from Danish aurochs (Bos primigenius)

    DEFF Research Database (Denmark)

    Nielsen, Peter Gravlund; Aaris-Sørensen, Kim; Hofreiter, Michael

    2012-01-01

    study of genetic variation of Danish aurochs. In addition, for all specimens we address correlations between the ability to obtain DNA sequences and various parameters such as the age of the sample, the collagen content, the museum storage period, Danish geography and whether the specimens were found...... in an archeological or geological context. We find that aurochs from southern Scandinavia display a star-shaped population genetic structure, that is indicative of a local and relatively recent diversification from a few ancestral haplotypes that may have originated in the ancestral Western European population before...... migration northwards during the retreat of the glaciers. Scenarios suggesting several invasions of genetically distinct aurochs are not supported by these analyses. Rather, our results suggest that a single continuous migration northward occurred. Our findings also suggest, although with only limited...

  10. Rapid extraction of genomic DNA from saliva for HLA typing on microarray based on magnetic nanobeads

    Energy Technology Data Exchange (ETDEWEB)

    Xie Xin; Zhang Xu E-mail: shinezhang@hotmail.com; Yu Bingbin; Gao Huafang; Zhang Huan; Fei Weiyang

    2004-09-01

    A series of simplified protocols are developed for extracting genomic DNA from saliva by using the magnetic nanobeads as absorbents. In these protocols, both the enrichment of the target cells and the adsorption of DNA can be achieved simultaneously by our functionally modified magnetic beads in one step, and the DNA-nanobeads complex can be used as PCR templates. HLA typing based on an oligonucleotide array was conducted by hybridization with the PCR products. The result shows that the protocols are robust and sensitive.

  11. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-01-01

    Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

  12. Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

    Science.gov (United States)

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-06-16

    As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  13. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    Directory of Open Access Journals (Sweden)

    Schnabel Robert D

    2009-06-01

    Full Text Available Abstract Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb, and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72 in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  14. Improving Griffith's protocol for co-extraction of microbial DNA and RNA in adsorptive soils

    DEFF Research Database (Denmark)

    Paulin, Mélanie Marie; Nicolaisen, Mette Haubjerg; Jacobsen, Carsten Suhr

    2013-01-01

    Quantification of microbial gene expression is increasingly being used to study key functions in soil microbial communities, yet major limitations still exist for efficient extraction of nucleic acids, especially RNA for transcript analysis, from this complex matrix. We present an improved......-time PCR on both the RNA (after conversion to cDNA) and the DNA fraction of the extracts. Non-adsorptive soils were characterized by low clay content and/or high phosphate content, whereas adsorptive soils had clay contents above 20% and/or a strong presence of divalent Ca in combination with high p......H. Modifications to the co-extraction protocol improved nucleic acid extraction efficiency from all adsorptive soils and were successfully validated by DGGE analysis of the indigenous community based on 16S rRNA gene and transcripts in soils representing low biomass and/or high clay content. This new approach...

  15. Methods of introducing nucleic acids into cellular DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

    2017-06-27

    A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

  16. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    Science.gov (United States)

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan

    2010-01-01

    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  17. Evaluation of urinary cortisol excretion by radioimmunoassay through two methods (extracted and non-extracted)

    International Nuclear Information System (INIS)

    Fonte Kohek, M.B. da; Mendonca, B.B. de; Nicolau, W.

    1993-01-01

    The objective of this paper is to compare the feasibility, sensitivity and specificity of both methods (extracted versus non-extracted) in the hypercortisolism diagnosis. It used Gamma Coat 125 cortisol Kit provided by Clinical Assays, Incstar, USA, for both methods extracting it with methylene chloride in order to measure the extracted cortisol. It was performed 32 assays from which it was obtained from 0.1 to 0.47 u g/d l of sensitivity. The intra-run precision was varied from 8.29 +- 3.38% and 8.19 +-4.72% for high and low levels, respectively for non-extracted cortisol, and 9.72 +- 1.94% and 9.54 +- 44% for high and low levels, respectively, for extracted cortisol. The inter-run precision was 15.98% and 16.15% for high level of non-extracted cortisol, respectively. For the low level it obtained 17.25% and 18.59% for non-extracted and extracted cortisol respectively. It was evaluated 24-hour urine basal samples from 43 normal subjects, and 53 obese (body mass index > 30) and 53 Cushing's syndrome patients. The sensitivity of the methods were similar (100% and 98.1% for non-extracted and extracted methods, respectively) and the specificity was the same for both methods (100%). It was noticed a positive correlation between the two methods in all the groups studied (p s syndrome. (author)

  18. Extraction of Trypanosoma cruzi DNA from food: a contribution to the elucidation of acute Chagas disease outbreaks.

    Science.gov (United States)

    Ferreira, Renata Trotta Barroso; Melandre, Aline Martins; Cabral, Maria Luiza; Branquinho, Maria Regina; Cardarelli-Leite, Paola

    2016-04-01

    Before 2004, the occurrence of acute Chagas disease (ACD) by oral transmission associated with food was scarcely known or investigated. Originally sporadic and circumstantial, ACD occurrences have now become frequent in the Amazon region, with recently related outbreaks spreading to several Brazilian states. These cases are associated with the consumption of açai juice by waste reservoir animals or insect vectors infected with Trypanosoma cruzi in endemic areas. Although guidelines for processing the fruit to minimize contamination through microorganisms and parasites exist, açai-based products must be assessed for quality, for which the demand for appropriate methodologies must be met. Dilutions ranging from 5 to 1,000 T. cruzi CL Brener cells were mixed with 2mL of acai juice. Four Extraction of T. cruzi DNA methods were used on the fruit, and the cetyltrimethyl ammonium bromide (CTAB) method was selected according to JRC, 2005. DNA extraction by the CTAB method yielded satisfactory results with regard to purity and concentration for use in PCR. Overall, the methods employed proved that not only extraction efficiency but also high sensitivity in amplification was important. The method for T. cruzi detection in food is a powerful tool in the epidemiological investigation of outbreaks as it turns epidemiological evidence into supporting data that serve to confirm T. cruzi infection in the foods. It also facilitates food quality control and assessment of good manufacturing practices involving acai-based products.

  19. Low cost extraction and isothermal amplification of DNA for infectious diarrhea diagnosis.

    Directory of Open Access Journals (Sweden)

    Shichu Huang

    Full Text Available In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10(-2 pg of C. difficile DNA while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health.

  20. Low Cost Extraction and Isothermal Amplification of DNA for Infectious Diarrhea Diagnosis

    Science.gov (United States)

    Huang, Shichu; Do, Jaephil; Mahalanabis, Madhumita; Fan, Andy; Zhao, Lei; Jepeal, Lisa; Singh, Satish K.; Klapperich, Catherine M.

    2013-01-01

    In order to counter the common perception that molecular diagnostics are too complicated to work in low resource settings, we have performed a difficult sample preparation and DNA amplification protocol using instrumentation designed to be operated without wall or battery power. In this work we have combined a nearly electricity-free nucleic acid extraction process with an electricity-free isothermal amplification assay to detect the presence of Clostridium difficile (C. difficile) DNA in the stool of infected patients. We used helicase-dependent isothermal amplification (HDA) to amplify the DNA in a low-cost, thermoplastic reaction chip heated with a pair of commercially available toe warmers, while using a simple Styrofoam insulator. DNA was extracted from known positive and negative stool samples. The DNA extraction protocol utilized an air pressure driven solid phase extraction device run using a standard bicycle pump. The simple heater setup required no electricity or battery and was capable of maintaining the temperature at 65°C±2°C for 55 min, suitable for repeatable HDA amplification. Experiments were performed to explore the adaptability of the system for use in a range of ambient conditions. When compared to a traditional centrifuge extraction protocol and a laboratory thermocycler, this disposable, no power platform achieved approximately the same lower limit of detection (1.25×10−2 pg of C. difficile DNA) while requiring much less raw material and a fraction of the lab infrastructure and cost. This proof of concept study could greatly impact the accessibility of molecular assays for applications in global health. PMID:23555883

  1. Natural colorants: Pigment stability and extraction yield enhancement via utilization of appropriate pretreatment and extraction methods.

    Science.gov (United States)

    Ngamwonglumlert, Luxsika; Devahastin, Sakamon; Chiewchan, Naphaporn

    2017-10-13

    Natural colorants from plant-based materials have gained increasing popularity due to health consciousness of consumers. Among the many steps involved in the production of natural colorants, pigment extraction is one of the most important. Soxhlet extraction, maceration, and hydrodistillation are conventional methods that have been widely used in industry and laboratory for such a purpose. Recently, various non-conventional methods, such as supercritical fluid extraction, pressurized liquid extraction, microwave-assisted extraction, ultrasound-assisted extraction, pulsed-electric field extraction, and enzyme-assisted extraction have emerged as alternatives to conventional methods due to the advantages of the former in terms of smaller solvent consumption, shorter extraction time, and more environment-friendliness. Prior to the extraction step, pretreatment of plant materials to enhance the stability of natural pigments is another important step that must be carefully taken care of. In this paper, a comprehensive review of appropriate pretreatment and extraction methods for chlorophylls, carotenoids, betalains, and anthocyanins, which are major classes of plant pigments, is provided by using pigment stability and extraction yield as assessment criteria.

  2. The method for simultaneous extraction and back extraction in liquid three-phase system and equipment for simultaneous extraction and back extraction in liquid three-phase system

    International Nuclear Information System (INIS)

    Palyska, W.; Chmielewski, A.G.

    1992-01-01

    The method for simultaneous extraction and back extraction in liquid three-phase system has been worked out. The equipment designed for that process has been also subject of the patent. The interesting component is extracted first to intermediate phase consists of magnetic solvent keeping two extracting phases separately. The intermediate magnetic liquid has been kept in its position using a stable magnet maintained on the surface of the extraction vessel. Then the component pass from intermediate phase to the third phase as a result of back extraction. Mixing in the extraction and back extraction zones is organized by means of rotating shaft going along the whole apparatus. The extraction and back extraction processes occur simultaneously as a result of continuous flow of solvent in their zones. The single extraction back extraction facilities can be joined in larger batteries. 3 figs

  3. Social network extraction based on Web: 1. Related superficial methods

    Science.gov (United States)

    Khairuddin Matyuso Nasution, Mahyuddin

    2018-01-01

    Often the nature of something affects methods to resolve the related issues about it. Likewise, methods to extract social networks from the Web, but involve the structured data types differently. This paper reveals several methods of social network extraction from the same sources that is Web: the basic superficial method, the underlying superficial method, the description superficial method, and the related superficial methods. In complexity we derive the inequalities between methods and so are their computations. In this case, we find that different results from the same tools make the difference from the more complex to the simpler: Extraction of social network by involving co-occurrence is more complex than using occurrences.

  4. DNA arrays : methods and protocols [Methods in molecular biology, v. 170

    National Research Council Canada - National Science Library

    Rampal, Jang B

    2001-01-01

    "In DNA Arrays: Methods and Protocols, Jang Rampal and a authoritative panel of researchers, engineers, and technologists explain in detail how to design and construct DNA microarrays, as well as how to...

  5. Automated extraction of genomic DNA from medically important yeast species and filamentous fungi by using the MagNA Pure LC system.

    Science.gov (United States)

    Loeffler, Juergen; Schmidt, Kathrin; Hebart, Holger; Schumacher, Ulrike; Einsele, Hermann

    2002-06-01

    A fully automated assay was established for the extraction of DNA from clinically important fungi by using the MagNA Pure LC instrument. The test was evaluated by DNA isolation from 23 species of yeast and filamentous fungi and by extractions (n = 28) of serially diluted Aspergillus fumigatus conidia (10(5) to 0 CFU/ml). Additionally, DNA from 67 clinical specimens was extracted and compared to the manual protocol. The detection limit of the MagNA Pure LC assay of 10 CFU corresponded to the sensitivity when DNA was extracted manually; in 9 of 28 runs, we could achieve a higher sensitivity of 1 CFU/ml blood, which was found to be significant (p DNA from all fungal species analyzed could be extracted and amplified by real-time PCR. Negative controls from all MagNA Pure isolations remained negative. Sixty-three clinical samples showed identical results by both methods, whereas in 4 of 67 samples, discordant results were obtained. Thus, the MagNA Pure LC technique offers a fast protocol for automated DNA isolation from numerous fungi, revealing high sensitivity and purity.

  6. Optimization-based Method for Automated Road Network Extraction

    International Nuclear Information System (INIS)

    Xiong, D

    2001-01-01

    Automated road information extraction has significant applicability in transportation. It provides a means for creating, maintaining, and updating transportation network databases that are needed for purposes ranging from traffic management to automated vehicle navigation and guidance. This paper is to review literature on the subject of road extraction and to describe a study of an optimization-based method for automated road network extraction

  7. Steroid hormones in environmental matrices: extraction method comparison.

    Science.gov (United States)

    Andaluri, Gangadhar; Suri, Rominder P S; Graham, Kendon

    2017-11-09

    The U.S. Environmental Protection Agency (EPA) has developed methods for the analysis of steroid hormones in water, soil, sediment, and municipal biosolids by HRGC/HRMS (EPA Method 1698). Following the guidelines provided in US-EPA Method 1698, the extraction methods were validated with reagent water and applied to municipal wastewater, surface water, and municipal biosolids using GC/MS/MS for the analysis of nine most commonly detected steroid hormones. This is the first reported comparison of the separatory funnel extraction (SFE), continuous liquid-liquid extraction (CLLE), and Soxhlet extraction methods developed by the U.S. EPA. Furthermore, a solid phase extraction (SPE) method was also developed in-house for the extraction of steroid hormones from aquatic environmental samples. This study provides valuable information regarding the robustness of the different extraction methods. Statistical analysis of the data showed that SPE-based methods provided better recovery efficiencies and lower variability of the steroid hormones followed by SFE. The analytical methods developed in-house for extraction of biosolids showed a wide recovery range; however, the variability was low (≤ 7% RSD). Soxhlet extraction and CLLE are lengthy procedures and have been shown to provide highly variably recovery efficiencies. The results of this study are guidance for better sample preparation strategies in analytical methods for steroid hormone analysis, and SPE adds to the choice in environmental sample analysis.

  8. Simple DNA extraction of urine samples: Effects of storage temperature and storage time.

    Science.gov (United States)

    Ng, Huey Hian; Ang, Hwee Chen; Hoe, See Ying; Lim, Mae-Lynn; Tai, Hua Eng; Soh, Richard Choon Hock; Syn, Christopher Kiu-Choong

    2018-06-01

    Urine samples are commonly analysed in cases with suspected illicit drug consumption. In events of alleged sample mishandling, urine sample source identification may be necessary. A simple DNA extraction procedure suitable for STR typing of urine samples was established on the Promega Maxwell ® 16 paramagnetic silica bead platform. A small sample volume of 1.7mL was used. Samples were stored at room temperature, 4°C and -20°C for 100days to investigate the influence of storage temperature and time on extracted DNA quantity and success rate of STR typing. Samples stored at room temperature exhibited a faster decline in DNA yield with time and lower typing success rates as compared to those at 4°C and -20°C. This trend can likely be attributed to DNA degradation. In conclusion, this study presents a quick and effective DNA extraction protocol from a small urine volume stored for up to 100days at 4°C and -20°C. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Evaluation of urinary excretion of cortisol by radioimmunoassay through two methods (extracted and non-extracted)

    International Nuclear Information System (INIS)

    Fonte Kohek, M.B. da.

    1992-01-01

    The radioimmunoassay of urinary cortisol extracted by organic solvent (free cortisol) has been used for along time in the hypercortisolism diagnosis. With the development of more specific antisera it became possible to measure urinary cortisol without extracting it. The objective of this paper is to compare the feasibility, sensitivity and specificity of both methods (extracted versus non-extracted) in the hypercortisolism diagnosis. It was used Gamma Coat 125 I - cortisol kit provided by Clinical Assay, Incstar, US, for both methods extracting it with methylene chloride in order to measure the extracted cortisol. The sensitivity of the methods were similar (100% and 98,1%, for non-extracted and extracted methods, respectively). A positive correlation between the two methods was noticed in all groups studied (p < 0.05). It was concluded that both methods are efficient for the investigation of hypercortisolism. However, it's suggested that non-extracted urinary cortisol measurement should be the method of choice since it's an easy-to-perform and affordable method to diagnose Cushing's syndrome. (author)

  10. Comparative exergy analyses of Jatropha curcas oil extraction methods: Solvent and mechanical extraction processes

    International Nuclear Information System (INIS)

    Ofori-Boateng, Cynthia; Keat Teong, Lee; JitKang, Lim

    2012-01-01

    Highlights: ► Exergy analysis detects locations of resource degradation within a process. ► Solvent extraction is six times exergetically destructive than mechanical extraction. ► Mechanical extraction of jatropha oil is 95.93% exergetically efficient. ► Solvent extraction of jatropha oil is 79.35% exergetically efficient. ► Exergy analysis of oil extraction processes allow room for improvements. - Abstract: Vegetable oil extraction processes are found to be energy intensive. Thermodynamically, any energy intensive process is considered to degrade the most useful part of energy that is available to produce work. This study uses literature values to compare the efficiencies and degradation of the useful energy within Jatropha curcas oil during oil extraction taking into account solvent and mechanical extraction methods. According to this study, J. curcas seeds on processing into J. curcas oil is upgraded with mechanical extraction but degraded with solvent extraction processes. For mechanical extraction, the total internal exergy destroyed is 3006 MJ which is about six times less than that for solvent extraction (18,072 MJ) for 1 ton J. curcas oil produced. The pretreatment processes of the J. curcas seeds recorded a total internal exergy destructions of 5768 MJ accounting for 24% of the total internal exergy destroyed for solvent extraction processes and 66% for mechanical extraction. The exergetic efficiencies recorded are 79.35% and 95.93% for solvent and mechanical extraction processes of J. curcas oil respectively. Hence, mechanical oil extraction processes are exergetically efficient than solvent extraction processes. Possible improvement methods are also elaborated in this study.

  11. An Alternative and Rapid Method for the Extraction of Nucleic Acids from Ixodid Ticks by Potassium Acetate Procedure

    Directory of Open Access Journals (Sweden)

    Islay Rodríguez

    2014-08-01

    Full Text Available Four variants of the potassium acetate procedure for DNA extraction from ixodid ticks at different stage of their life cycles were evaluated and compared with phenol-chloroform and ammonium hydroxide methods. The most rapid and most efficient variant was validated in the DNA extraction procedure from the engorged ticks collected from bovine, canine as well as from house ticks for the screening of Borrelia burgdorferi sensu lato, Anaplasma spp. and Babesia spp. The ammonium hydroxide procedure was used for non-engorged ticks. All the variants were efficient and allowed obtaining PCR-quality material according to the specific amplification of 16S rRNA gene fragment of the original tick. DNA extracted from the ticks under the study was tested by multiplex PCR for the screening of tick-borne pathogens. Anaplasma spp. and Babesia spp. amplification products were obtained from 29/48 extracts. Ammonium hydroxide protocol was not efficient for two extracts. Detection of amplification products from the PCR indicated that DNA had been successfully extracted. The potassium acetate procedure could be an alternative, rapid, and reliable method for DNA extraction from the ixodid ticks, mainly for poorly-resourced laboratories.

  12. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Wang, Z.; Wu, X.; Friedberg, E.C.

    1993-01-01

    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  13. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    Science.gov (United States)

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  14. Grape (Vitis vinifera) extracts protect against radiation-induced oxidative stress and DNA damage

    International Nuclear Information System (INIS)

    Singha, Indrani; Das, Subir Kumar; Saxena, S.; Gautam, S.

    2016-01-01

    Ionizing radiation (IR) causes oxidative stress through the overwhelming generation of reactive oxygen species (ROS) in the living cells leading further to the oxidative damage to biomolecules. Grapes (Vitis vinifera) contain several bioactive phytochemicals and are the richest source of antioxidant. In this study, we investigated and compared in vitro antioxidant activity and DNA damage protective property of the grape extracts of four different cultivars, including the Thompson seedless, Flame seedless, Kishmish chorni and Red globe. The activities of ascorbic acid oxidase and catalase significantly (p<0.01) differed among extracts within the same cultivar, while that of peroxidase and polyphenol oxidase did not differ significantly among extracts of any cultivar. In vitro antioxidant activities were assessed by ferric-reducing antioxidant power (FRAP) assay and ABTS. The superoxide radical-scavenging activity was higher in the seed as compared to the skin or pulp of the same cultivar. DNA damage was evaluated in acellular system using pBR322 plasmid relaxation. Grape extract was able to effectively scavenge free radicals in vitro. It could significantly prevent radiation-induced DNA damage. Furthermore, the protective action of grape depends on the source of extract and type of the cultivars. (author)

  15. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Directory of Open Access Journals (Sweden)

    Tierling Sascha

    2010-06-01

    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  16. DNA-based methods of geochemical prospecting

    Energy Technology Data Exchange (ETDEWEB)

    Ashby, Matthew [Mill Valley, CA

    2011-12-06

    The present invention relates to methods for performing surveys of the genetic diversity of a population. The invention also relates to methods for performing genetic analyses of a population. The invention further relates to methods for the creation of databases comprising the survey information and the databases created by these methods. The invention also relates to methods for analyzing the information to correlate the presence of nucleic acid markers with desired parameters in a sample. These methods have application in the fields of geochemical exploration, agriculture, bioremediation, environmental analysis, clinical microbiology, forensic science and medicine.

  17. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    2012-01-01

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study, DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  18. Freezing fecal samples prior to DNA extraction affects the Firmicutes to Bacteroidetes ratio determined by downstream quantitative PCR analysis

    DEFF Research Database (Denmark)

    Bahl, Martin Iain; Bergström, Anders; Licht, Tine Rask

    Freezing stool samples prior to DNA extraction and downstream analysis is widely used in metagenomic studies of the human microbiota but may affect the inferred community composition. In this study DNA was extracted either directly or following freeze storage of three homogenized human fecal...

  19. Direct DNA Extraction from Mycobacterium tuberculosis Frozen Stocks as a Reculture-Independent Approach to Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Bjorn-Mortensen, K; Zallet, J; Lillebaek, T

    2015-01-01

    Culturing before DNA extraction represents a major time-consuming step in whole-genome sequencing of slow-growing bacteria, such as Mycobacterium tuberculosis. We report a workflow to extract DNA from frozen isolates without reculturing. Prepared libraries and sequence data were comparable...... with results from recultured aliquots of the same stocks....

  20. A direct qPCR method for residual DNA quantification in monoclonal antibody drugs produced in CHO cells.

    Science.gov (United States)

    Hussain, Musaddeq

    2015-11-10

    Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. DNA Dynamics Studied Using the Homogeneous Balance Method

    International Nuclear Information System (INIS)

    Zayed, E. M. E.; Arnous, A. H.

    2012-01-01

    We employ the homogeneous balance method to construct the traveling waves of the nonlinear vibrational dynamics modeling of DNA. Some new explicit forms of traveling waves are given. It is shown that this method provides us with a powerful mathematical tool for solving nonlinear evolution equations in mathematical physics. Strengths and weaknesses of the proposed method are discussed. (general)

  2. Effect of mucin extraction method on some properties of ...

    African Journals Online (AJOL)

    Effect of mucin extraction method on some properties of metronidazole mucoadhesive loaded patches. MI Arhewoh, SO Eraga, PF Builders, MA Ibobiri. Abstract. To evaluate the effects of mucin extraction method and plasticizer concentration on the bioadhesive strength and metronidazole release profile from mucin-based ...

  3. Method of purifying phosphoric acid after solvent extraction

    International Nuclear Information System (INIS)

    Kouloheris, A.P.; Lefever, J.A.

    1979-01-01

    A method of purifying phosphoric acid after solvent extraction is described. The phosphoric acid is contacted with a sorbent which sorbs or takes up the residual amount of organic carrier and the phosphoric acid separated from the organic carrier-laden sorbent. The method is especially suitable for removing residual organic carrier from phosphoric acid after solvent extraction uranium recovery. (author)

  4. Novel DNA sequence detection method based on fluorescence energy transfer

    International Nuclear Information System (INIS)

    Kobayashi, S.; Tamiya, E.; Karube, I.

    1987-01-01

    Recently the detection of specific DNA sequence, DNA analysis, has been becoming more important for diagnosis of viral genomes causing infections disease and human sequences related to inherited disorders. These methods typically involve electrophoresis, the immobilization of DNA on a solid support, hybridization to a complementary probe, the detection using labeled with /sup 32/P or nonisotopically with a biotin-avidin-enzyme system, and so on. These techniques are highly effective, but they are very time-consuming and expensive. A principle of fluorescene energy transfer is that the light energy from an excited donor (fluorophore) is transferred to an acceptor (fluorophore), if the acceptor exists in the vicinity of the donor and the excitation spectrum of donor overlaps the emission spectrum of acceptor. In this study, the fluorescence energy transfer was applied to the detection of specific DNA sequence using the hybridization method. The analyte, single-stranded DNA labeled with the donor fluorophore is hybridized to a probe DNA labeled with the acceptor. Because of the complementary DNA duplex formation, two fluorophores became to be closed to each other, and the fluorescence energy transfer was occurred

  5. International study to evaluate PCR methods for detection of Trypanosoma cruzi DNA in blood samples from Chagas disease patients.

    Directory of Open Access Journals (Sweden)

    Alejandro G Schijman

    Full Text Available BACKGROUND: A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. METHODOLOGY/FINDINGS: An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU I, IV and VI (set A, human blood spiked with parasite cells (set B and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C. Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA, 13 satellite DNA (Sat-DNA and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05-0.5 parasites/mL whereas specific kDNA tests detected 5.10(-3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood. The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3-94.4%, specificity of 85

  6. Antioxidant Activity of Lawsonia inermis Extracts Inhibits Chromium(VI-Induced Cellular and DNA Toxicity

    Directory of Open Access Journals (Sweden)

    Gunjan Guha

    2011-01-01

    Full Text Available Hexavalent chromium Cr(VI is a very strong oxidant which consequently causes high cytotoxicity through oxidative stress. Prevention of Cr(VI-induced cellular damage has been sought in this study in aqueous and methanolic extracts of Lawsonia inermis Linn. (Lythraceae, commonly known as Henna. The extracts showed significant (P < .05 potential in scavenging free radicals (DPPH• and ABTS•+ and Fe3+, and in inhibiting lipid peroxidation. DNA damage caused by exposure of pBR322 to Cr(VI-UV is markedly inhibited by both extracts in varying degrees. A distinct decline in Cr(VI-induced cytotoxicity was noticed in MDA-MB-435S (human breast carcinoma cells with an increase in dosage of both extracts individually. Furthermore, both extracts proved to contain a high content of phenolic compounds which were found to have a strong and significant (P < .05 positive correlation to the radical scavenging potential, lipid peroxidation inhibition capacity and cyto-protective efficiency against Cr(VI-induced oxidative cellular damage. HPLC analysis identified some of the major phenolic compounds in both extracts, which might be responsible for the antioxidant potential and the properties of DNA and cyto-protection. This study contributes to the search for natural resources that might yield potent therapeutic drugs against Cr(VI-induced oxidative cell damage.

  7. High-capacity conductive nanocellulose paper sheets for electrochemically controlled extraction of DNA oligomers.

    Directory of Open Access Journals (Sweden)

    Aamir Razaq

    Full Text Available Highly porous polypyrrole (PPy-nanocellulose paper sheets have been evaluated as inexpensive and disposable electrochemically controlled three-dimensional solid phase extraction materials. The composites, which had a total anion exchange capacity of about 1.1 mol kg(-1, were used for extraction and subsequent release of negatively charged fluorophore tagged DNA oligomers via galvanostatic oxidation and reduction of a 30-50 nm conformal PPy layer on the cellulose substrate. The ion exchange capacity, which was, at least, two orders of magnitude higher than those previously reached in electrochemically controlled extraction, originated from the high surface area (i.e. 80 m(2 g(-1 of the porous composites and the thin PPy layer which ensured excellent access to the ion exchange material. This enabled the extractions to be carried out faster and with better control of the PPy charge than with previously employed approaches. Experiments in equimolar mixtures of (dT(6, (dT(20, and (dT(40 DNA oligomers showed that all oligomers could be extracted, and that the smallest oligomer was preferentially released with an efficiency of up to 40% during the reduction of the PPy layer. These results indicate that the present material is very promising for the development of inexpensive and efficient electrochemically controlled ion-exchange membranes for batch-wise extraction of biomolecules.

  8. Suitability of DNA extracted from archival specimens of fruit-eating bats of the genus Artibeus (Chiroptera, Phyllostomidae for polymerase chain reaction and sequencing analysis

    Directory of Open Access Journals (Sweden)

    Mário Pinzan Scatena

    2008-01-01

    Full Text Available To establish a technique which minimized the effects of fixation on the extraction of DNA from formalin-fixed tissues preserved in scientific collections we extracted DNA samples from fixed tissues using different methods and evaluated the effect of the different procedures on PCR and sequencing analysis. We investigated muscle and liver tissues from museum specimens of five species of fruit-eating (frugivorous bats of the Neotropical genus Artibeus (Chiroptera, Phyllostomidae: A. fimbriatus, A. lituratus, A. jamaicensis, A. obscurus, and A. planirostris. The results indicated that treatment of tissues in buffered solutions at neutral pH and about 37 °C for at least four days improves the quality and quantity of extracted DNA and the quality of the amplification and sequencing products. However, the comparison between the performance of DNA obtained from fixed and fresh tissues showed that, in spite of the fact that both types of tissue generate reliable sequences for use in phylogenetic analyses, DNA samples from fixed tissues presented a larger rate of errors in the different stages of the study. These results suggest that DNA extracted from formalin-fixed tissue can be used in molecular studies of Neotropical Artibeus bats and that our methodology may be applicable to other animal groups.

  9. UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract

    International Nuclear Information System (INIS)

    Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh

    2016-01-01

    UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)

  10. Method for construction of normalized cDNA libraries

    Science.gov (United States)

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  11. Development of DNA elution method to detect irradiated foodstuff

    International Nuclear Information System (INIS)

    Copin, M.P.; Bourgeois, C.M.

    1991-01-01

    The aim of the work is to develop a reliable method to detect whether a fresh and frozen foodstuff has been irradiated. The molecule of DNA is one of the targets of ionizing radiation. The induction of three major classes of lesion have been shown. Double strand breaks, single strand breaks and base damage. Among the different techniques used to observe and quantify the strand breaks, techniques of elution are very interesting. The method proposed consisted of a filtration of the DNA at the atmospheric pressure and in non denaturing conditions. The amount of DNA retained on the filter is measured after being suitably labelled by microfluorometry. A difference in the amount of DNA retained on a filter of 2 μm from a lysed muscular tissue sample between a frozen Norway lobster which has been irradiated and one which has not, is observed. 7 refs

  12. Application of DNA-based methods in forensic entomology.

    Science.gov (United States)

    Wells, Jeffrey D; Stevens, Jamie R

    2008-01-01

    A forensic entomological investigation can benefit from a variety of widely practiced molecular genotyping methods. The most commonly used is DNA-based specimen identification. Other applications include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important insect species. The proper application of these procedures demands that the analyst be technically expert. However, one must also be aware of the extensive list of standards and expectations that many legal systems have developed for forensic DNA analysis. We summarize the DNA techniques that are currently used in, or have been proposed for, forensic entomology and review established genetic analyses from other scientific fields that address questions similar to those in forensic entomology. We describe how accepted standards for forensic DNA practice and method validation are likely to apply to insect evidence used in a death or other forensic entomological investigation.

  13. Pomegranate extract protects against cerebral ischemia/reperfusion injury and preserves brain DNA integrity in rats.

    Science.gov (United States)

    Ahmed, Maha A E; El Morsy, Engy M; Ahmed, Amany A E

    2014-08-21

    Interruption to blood flow causes ischemia and infarction of brain tissues with consequent neuronal damage and brain dysfunction. Pomegranate extract is well tolerated, and safely consumed all over the world. Interestingly, pomegranate extract has shown remarkable antioxidant and anti-inflammatory effects in experimental models. Many investigators consider natural extracts as novel therapies for neurodegenerative disorders. Therefore, this study was carried out to investigate the protective effects of standardized pomegranate extract against cerebral ischemia/reperfusion-induced brain injury in rats. Adult male albino rats were randomly divided into sham-operated control group, ischemia/reperfusion (I/R) group, and two other groups that received standardized pomegranate extract at two dose levels (250, 500 mg/kg) for 15 days prior to ischemia/reperfusion (PMG250+I/R, and PMG500+I/R groups). After I/R or sham operation, all rats were sacrificed and brains were harvested for subsequent biochemical analysis. Results showed reduction in brain contents of MDA (malondialdehyde), and NO (nitric oxide), in addition to enhancement of SOD (superoxide dismutase), GPX (glutathione peroxidase), and GRD (glutathione reductase) activities in rats treated with pomegranate extract prior to cerebral I/R. Moreover, pomegranate extract decreased brain levels of NF-κB p65 (nuclear factor kappa B p65), TNF-α (tumor necrosis factor-alpha), caspase-3 and increased brain levels of IL-10 (interleukin-10), and cerebral ATP (adenosine triphosphate) production. Comet assay showed less brain DNA (deoxyribonucleic acid) damage in rats protected with pomegranate extract. The present study showed, for the first time, that pre-administration of pomegranate extract to rats, can offer a significant dose-dependent neuroprotective activity against cerebral I/R brain injury and DNA damage via antioxidant, anti-inflammatory, anti-apoptotic and ATP-replenishing effects. Copyright © 2014 Elsevier Inc

  14. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    Science.gov (United States)

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  15. CGH and SNP array using DNA extracted from fixed cytogenetic preparations and long-term refrigerated bone marrow specimens

    Directory of Open Access Journals (Sweden)

    MacKinnon Ruth N

    2012-02-01

    Full Text Available Abstract Background The analysis of nucleic acids is limited by the availability of archival specimens and the quality and amount of the extracted material. Archived cytogenetic preparations are stored in many laboratories and are a potential source of total genomic DNA for array karyotyping and other applications. Array CGH using DNA from fixed cytogenetic preparations has been described, but it is not known whether it can be used for SNP arrays. Diagnostic bone marrow specimens taken during the assessment of hematological malignancies are also a potential source of DNA, but it is generally assumed that DNA must be extracted, or the specimen frozen, within a day or two of collection, to obtain DNA suitable for further analysis. We have assessed DNA extracted from these materials for both SNP array and array CGH. Results We show that both SNP array and array CGH can be performed on genomic DNA extracted from cytogenetic specimens stored in Carnoy's fixative, and from bone marrow which has been stored unfrozen, at 4°C, for at least 36 days. We describe a procedure for extracting a usable concentration of total genomic DNA from cytogenetic suspensions of low cellularity. Conclusions The ability to use these archival specimens for DNA-based analysis increases the potential for retrospective genetic analysis of clinical specimens. Fixed cytogenetic preparations and long-term refrigerated bone marrow both provide DNA suitable for array karyotyping, and may be suitable for a wider range of analytical procedures.

  16. Method of extracting tritium from heavy water

    International Nuclear Information System (INIS)

    Tsuchiya, Hiroyuki; Kikuchi, Makoto; Asakura, Yamato; Yusa, Hideo.

    1979-01-01

    Purpose: To extract tritium in heavy water by combining isotope exchange reaction with liquefaction distillation to increase the concentration of recovered tritium, thereby reducing the quantity of radioactive wastes recovered. Constitution: Heavy water containing tritium from a reactor is introduced into a tritium separator through a conduit pipe. On the other hand, a D 2 gas is introduced through the conduit pipe in the lower part of a tritium separator to transfer tritium into D 2 gas by isotope exchange. The D 2 gas containing DT is introduced into a liquefaction distillation tower together with an outlet gas of a converter supplied through a pipeline. The converter is filled with net-like metals of platinum group such as Pt, Ni, Pd and the like, and the D 2 gas affluent in DT, extracted from the distillation tower is converted into D 2 and T 2 . The gas which has been introduced into the liquefaction distillation tower is liquefied. The D 2 gas of low boiling point components reaches the tower top, and the T 2 gas of high boiling point components is concentrated at the tower bottom, and is rendered into tritium water in a recoupler and stored in a water storage apparatus. (Yoshino, Y.)

  17. The fruit extract of Berberis crataegina DC: exerts potent antioxidant activity and protects DNA integrity.

    Science.gov (United States)

    Charehsaz, Mohammad; Sipahi, Hande; Celep, Engin; Üstündağ, Aylin; Cemiloğlu Ülker, Özge; Duydu, Yalçın; Aydın, Ahmet; Yesilada, Erdem

    2015-04-17

    Dried fruits of Berberis crataegina (Berberidaceae) have been frequently consumed as food garniture in Turkish cuisine, while its fruit paste has been used to increase stamina and in particular to prevent from cardiovascular dysfunctions in Northeastern Black Sea region of Turkey. This study investigated this folkloric information in order to explain the claimed healing effects as well as to evaluate possible risks. Total phenolic, flavonoid and proanthocyanidin contents and antioxidant capacity of the methanolic fruit extract were evaluated through several in vitro assays. The cytotoxic and genotoxic effects of B. crataegina fruit extract were also assessed in both cervical cancer cell line (HeLa) and human peripheral blood lymphocytes. The extract showed protective effects against ferric-induced oxidative stress and had a relatively good antioxidant activity. It also ameliorated the H2O2 mediated DNA damage in lymphocytes, suggesting the protective effect against oxidative DNA damage. The methanolic extract of B. crataegina fruits may be a potential antioxidant nutrient and also may exert a protective role against lipid peroxidation as well as oxidative DNA damage.

  18. Effects of Different Extraction Methods and Conditions on the Phenolic Composition of Mate Tea Extracts

    Directory of Open Access Journals (Sweden)

    Jelena Vladic

    2012-03-01

    Full Text Available A simple and rapid HPLC method for determination of chlorogenic acid (5-O-caffeoylquinic acid in mate tea extracts was developed and validated. The chromatography used isocratic elution with a mobile phase of aqueous 1.5% acetic acid-methanol (85:15, v/v. The flow rate was 0.8 mL/min and detection by UV at 325 nm. The method showed good selectivity, accuracy, repeatability and robustness, with detection limit of 0.26 mg/L and recovery of 97.76%. The developed method was applied for the determination of chlorogenic acid in mate tea extracts obtained by ethanol extraction and liquid carbon dioxide extraction with ethanol as co-solvent. Different ethanol concentrations were used (40, 50 and 60%, v/v and liquid CO2 extraction was performed at different pressures (50 and 100 bar and constant temperature (27 ± 1 °C. Significant influence of extraction methods, conditions and solvent polarity on chlorogenic acid content, antioxidant activity and total phenolic and flavonoid content of mate tea extracts was established. The most efficient extraction solvent was liquid CO2 with aqueous ethanol (40% as co-solvent using an extraction pressure of 100 bar.

  19. AFSC/RACE/SAP/Shavey: DNA extraction from archived Giemsa-stained blood smears using polymerase chain reaction to detect host and parasitic DNA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These are the data from a laboratory experiment in which DNA content was removed from blood smears and extracted. The blood smears were either stained with...

  20. Extraction and identification of cyclobutanones from irradiated cheese employing a rapid direct solvent extraction method.

    Science.gov (United States)

    Tewfik, Ihab

    2008-01-01

    2-Alkylcyclobutanones (cyclobutanones) are accepted as chemical markers for irradiated foods containing lipid. However, current extraction procedures (Soxhlet-florisil chromatography) for the isolation of these markers involve a long and tedious clean-up regime prior to gas chromatography-mass spectrophotometry identification. This paper outlines an alternative isolation and clean-up method for the extraction of cyclobutanones in irradiated Camembert cheese. The newly developed direct solvent extraction method enables the efficient screening of large numbers of food samples and is not as resource intensive as the BS EN 1785:1997 method. Direct solvent extraction appears to be a simple, robust method and has the added advantage of a considerably shorter extraction time for the analysis of foods containing lipid.

  1. Impact of different extraction methods on the quality of Dipteryx alata extracts

    Directory of Open Access Journals (Sweden)

    Frederico S. Martins

    2013-05-01

    Full Text Available This study aimed to impact of different extraction methods on the quality of Dipteryx alata Vogel, Fabaceae, extracts from fruits. The major compounds found were the lipids 38.9% (w/w and proteins 26.20% (w/w. The residual moisture was 7.20% (w/w, total fiber 14.50% (w/w, minerals 4.10% (w/w and carbohydrate 9.10 % (w/w. The species studied has great potential in producing oil, but the content and type of fatty acids obtained is dependent on the method of extraction. The Blingh & Dyer method was more selective for unsaturated fatty acids and Shoxlet method was more selective for saturated fatty acids. The tannin extraction by ultrasound (33.70 % w/w was 13.90% more efficient than extraction by decoction (29 % w/w.

  2. Mendel Meets CSI: Forensic Genotyping as a Method to Teach Genetics & DNA Science

    Science.gov (United States)

    Kurowski, Scotia; Reiss, Rebecca

    2007-01-01

    This article describes a forensic DNA science laboratory exercise for advanced high school and introductory college level biology courses. Students use a commercial genotyping kit and genetic analyzer or gene sequencer to analyze DNA recovered from a fictitious crime scene. DNA profiling and STR genotyping are outlined. DNA extraction, PCR, and…

  3. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    Science.gov (United States)

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  4. Prospects for DNA methods to measure human heritable mutation rates

    International Nuclear Information System (INIS)

    Mendelsohn, M.L.

    1985-01-01

    A workshop cosponsored by ICPEMC and the US Department of Energy was held in Alta, Utah, December 9-13, 1984 to examine the extent to which DNA-oriented methods might provide new approaches to the important but intractable problem of measuring mutation rates in control and exposed human populations. The workshop identified and analyzed six DNA methods for detection of human heritable mutation, including several created at the meeting, and concluded that none of the methods combine sufficient feasibility and efficiency to be recommended for general application. 8 refs

  5. Pros and cons of methylation-based enrichment methods for ancient DNA

    Science.gov (United States)

    Seguin-Orlando, Andaine; Gamba, Cristina; Sarkissian, Clio Der; Ermini, Luca; Louvel, Guillaume; Boulygina, Eugenia; Sokolov, Alexey; Nedoluzhko, Artem; Lorenzen, Eline D.; Lopez, Patricio; McDonald, H. Gregory; Scott, Eric; Tikhonov, Alexei; Stafford,, Thomas W.; Alfarhan, Ahmed H.; Alquraishi, Saleh A.; Al-Rasheid, Khaled A. S.; Shapiro, Beth; Willerslev, Eske; Prokhortchouk, Egor; Orlando, Ludovic

    2015-01-01

    The recent discovery that DNA methylation survives in fossil material provides an opportunity for novel molecular approaches in palaeogenomics. Here, we apply to ancient DNA extracts the probe-independent Methylated Binding Domains (MBD)-based enrichment method, which targets DNA molecules containing methylated CpGs. Using remains of a Palaeo-Eskimo Saqqaq individual, woolly mammoths, polar bears and two equine species, we confirm that DNA methylation survives in a variety of tissues, environmental contexts and over a large temporal range (4,000 to over 45,000 years before present). MBD enrichment, however, appears principally biased towards the recovery of CpG-rich and long DNA templates and is limited by the fast post-mortem cytosine deamination rates of methylated epialleles. This method, thus, appears only appropriate for the analysis of ancient methylomes from very well preserved samples, where both DNA fragmentation and deamination have been limited. This work represents an essential step toward the characterization of ancient methylation signatures, which will help understanding the role of epigenetic changes in past environmental and cultural transitions. PMID:26134828

  6. A rapid and inexpensive method for isolation of total DNA from Trichoderma spp (Hypocreaceae).

    Science.gov (United States)

    Vazquez-Angulo, J C; Mendez-Trujillo, V; González-Mendoza, D; Morales-Trejo, A; Grimaldo-Juarez, O; Cervantes-Díaz, L

    2012-05-15

    Extraction of high-quality genomic DNA for PCR amplification from filamentous fungi is difficult because of the complex cell wall and the high concentrations of polysaccharides and other secondary metabolites that bind to or co-precipitate with nucleic acids. We developed a modified sodium dodecyl sulfate/phenol protocol, without maceration in liquid nitrogen and without a final ethanol precipitation step. The A(260/280) absorbance ratios of isolated DNA were approximately 1.7-1.9, demonstrating that the DNA fraction is pure and can be used for analysis. Additionally, the A(260/230) values were higher than 1.6, demonstrating negligible contamination by polysaccharides. The DNA isolated by this protocol is of sufficient quality for molecular applications; this technique could be applied to other organisms that have similar substances that hinder DNA extraction. The main advantages of the method are that the mycelium is directly recovered from culture medium and it does not require the use of expensive and specialized equipment.

  7. Extracting DNA from 'jaws': High yield and quality from archived tiger shark (Galeocerdo cuvier) skeletal material

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Morgan, J. A T; Maher, S. L.

    2017-01-01

    of tiger sharks (Galeocerdo cuvier). Protocols were compared for DNA yield and quality using a qPCR approach. For jaw swarf, all methods provided relatively high DNA yield and quality, while large differences in yield between protocols were observed for vertebrae. Similar results were obtained from samples...... observed, likely reflecting different preparation and storage methods for the trophies. Trial sequencing of DNA capture genomic libraries using 20 000 baits revealed that a significant proportion of captured sequences were derived from tiger sharks. This study demonstrates that archived shark jaws...

  8. Method of extraction under pressure of fossil material

    Energy Technology Data Exchange (ETDEWEB)

    Fredenmark, G L

    1942-02-24

    A method is described of extraction under pressure of fossil material, such as coal, brown coal (lignite), peat, oil shale. It is characterized by carrying out the process of extraction by utilization of fractions of shale oils and/or peat tar with a boiling point above 170/sup 0/C and under such as pressure that the medium of extraction is in a liquid state.

  9. Extraction and detection of Mycobacterium leprae DNA from ZNCF-stained skin smear slides for better identification of negative skin smears

    Directory of Open Access Journals (Sweden)

    Kamble R

    2010-01-01

    Full Text Available Abstract Identification of Mycobacterium leprae, which causes leprosy, is done by Ziehl Neelsen Carbol Fuchsin (ZNCF stained slit skin smear microscopy that aids in the diagnosis and quantification of approximate bacterial load carried by the patient. We attempted M. leprae DNA extraction from 46 stained slit skin smear negative slides, using Proteinase K and SDS lysis, followed by ethanol precipitation. M. leprae specific primers (16SrRNA were used for PCR-based amplification of DNA. We could detect M. leprae DNA in 15 (32.6% samples. The method can be useful in the diagnosis of apparently slit skin smear negative leprosy cases.

  10. A simple method for purification of herpesvirus DNA

    DEFF Research Database (Denmark)

    Christensen, Laurids Siig; Normann, Preben

    1992-01-01

    A rapid and reliable method for purification of herpesvirus DNA from cell cultures is described. The method is based on the isolation of virus particles and/or nucleocapsids by differential centrifugation and exploits the solubilizing and denaturing capabilities of cesium trifluoroacetate during...

  11. An Optimized Protocol for DNA Extraction from Wheat Seeds and Loop-Mediated Isothermal Amplification (LAMP to Detect Fusarium graminearum Contamination of Wheat Grain

    Directory of Open Access Journals (Sweden)

    Mohamed Moslem

    2011-06-01

    Full Text Available A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  12. An optimized protocol for DNA extraction from wheat seeds and Loop-Mediated Isothermal Amplification (LAMP) to detect Fusarium graminearum contamination of wheat grain.

    Science.gov (United States)

    Abd-Elsalam, Kamel; Bahkali, Ali; Moslem, Mohamed; Amin, Osama E; Niessen, Ludwig

    2011-01-01

    A simple, rapid, and efficient method for isolating genomic DNA from germinated seeds of wheat that is free from polysaccharides and polyphenols is reported. DNA was extracted, treated with RNase, measured and tested for completeness using agarose gel electrophoresis. DNA purification from wheat grains yielded abundant, amplifiable DNA with yields typically between 100 and 200 ng DNA/mg. The effectiveness and reliability of the method was tested by assessing quantity and quality of the isolated DNA using three PCR-based markers. Inter-simple sequence repeats (ISSRs) were used to assess the genetic diversity between different wheat varieties. Specific PCR primer pair Tox5-1/Tox5-2 and a loop-mediated isothermal amplification (LAMP) procedure were used to detect genomic DNA of Fusarium graminearum in contaminated wheat seeds. In this method there is no need to use liquid nitrogen for crushing germinated seedlings. The protocol takes approximately one hour to prepare high quality DNA. In combination with the LAMP assay it is a fast and cost-effective alternative to traditional diagnostic methods for the early detection of toxigenic fusaria in cereals.

  13. Assessment of proposed electromagnetic quantum vacuum energy extraction methods

    OpenAIRE

    Moddel, Garret

    2009-01-01

    In research articles and patents several methods have been proposed for the extraction of zero-point energy from the vacuum. None has been reliably demonstrated, but the proposals remain largely unchallenged. In this paper the feasibility of these methods is assessed in terms of underlying thermodynamics principles of equilibrium, detailed balance, and conservation laws. The methods are separated into three classes: nonlinear processing of the zero-point field, mechanical extraction using Cas...

  14. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  15. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  16. Development of an extraction method for perchlorate in soils.

    Science.gov (United States)

    Cañas, Jaclyn E; Patel, Rashila; Tian, Kang; Anderson, Todd A

    2006-03-01

    Perchlorate originates as a contaminant in the environment from its use in solid rocket fuels and munitions. The current US EPA methods for perchlorate determination via ion chromatography using conductivity detection do not include recommendations for the extraction of perchlorate from soil. This study evaluated and identified appropriate conditions for the extraction of perchlorate from clay loam, loamy sand, and sandy soils. Based on the results of this evaluation, soils should be extracted in a dry, ground (mortar and pestle) state with Milli-Q water in a 1 ratio 1 soil ratio water ratio and diluted no more than 5-fold before analysis. When sandy soils were extracted in this manner, the calculated method detection limit was 3.5 microg kg(-1). The findings of this study have aided in the establishment of a standardized extraction method for perchlorate in soil.

  17. Methods for deep examination of DNA

    OpenAIRE

    Neiman, Mårten

    2013-01-01

    The development of sequencing technology has had a rapid pace during the last years and today, the sequencing instruments harbors enormous capacity. This thesis is about the development of methods to make the most out of this capacity and to use it for various applications. In paper I, a dual tagging system for sequencing large sample sets was developed. To proof the concept, 4,700 dogs were subjected to amplicon sequencing of the 2nd exon of the gene DLA-DRB1 using a 454...

  18. Rapid and efficient protocol for DNA extraction and molecular identification of the basidiomycete Crinipellis perniciosa.

    Science.gov (United States)

    Melo, S C O; Pungartnik, C; Cascardo, J C M; Brendel, M

    2006-12-14

    DNA isolation from some fungal organisms is difficult because they have cell walls or capsules that are relatively unsusceptible to lysis. Beginning with a yeast Saccharomyces cerevisiae genomic DNA isolation method, we developed a 30-min DNA isolation protocol for filamentous fungi by combining cell wall digestion with cell disruption by glass beads. High-quality DNA was isolated with good yield from the hyphae of Crinipellis perniciosa, which causes witches' broom disease in cacao, from three other filamentous fungi, Lentinus edodes, Agaricus blazei, Trichoderma stromaticum, and from the yeast S. cerevisiae. Genomic DNA was suitable for PCR of specific actin primers of C. perniciosa, allowing it to be differentiated from fungal contaminants, including its natural competitor, T. stromaticum.

  19. Effects of Extraction Method on the Physicochemical and ...

    African Journals Online (AJOL)

    The effects of improved method of extraction on the physicochemical, mycological and stability of crude Canarium Schweinfurthii fruit oil were studied. The extracted oils were then stored at 25±5oC for 24 months with samples analyzed at 6months interval for; pH, saponification value, acid value, peroxide value and iodine ...

  20. Comparison of protein extraction methods suitable for proteomics ...

    African Journals Online (AJOL)

    An efficient protein extraction method is a prerequisite for successful implementation of proteomics. In this study, seedling roots of Jerusalem artichoke were treated with the concentration of 250 mM NaCl for 36 h. Subsequently, six different protocols of protein extraction were applied to seedling roots of Jerusalem artichoke ...

  1. A Simple Thermoplastic Substrate Containing Hierarchical Silica Lamellae for High-Molecular-Weight DNA Extraction.

    Science.gov (United States)

    Zhang, Ye; Zhang, Yi; Burke, Jeffrey M; Gleitsman, Kristin; Friedrich, Sarah M; Liu, Kelvin J; Wang, Tza-Huei

    2016-12-01

    An inexpensive, magnetic thermoplastic nanomaterial is developed utilizing a hierarchical layering of micro- and nanoscale silica lamellae to create a high-surface-area and low-shear substrate capable of capturing vast amounts of ultrahigh-molecular-weight DNA. Extraction is performed via a simple 45 min process and is capable of achieving binding capacities up to 1 000 000 times greater than silica microparticles. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Evaluation of the efficiency and utility of recombinant enzyme-free seamless DNA cloning methods

    Directory of Open Access Journals (Sweden)

    Ken Motohashi

    2017-03-01

    Full Text Available Simple and low-cost recombinant enzyme-free seamless DNA cloning methods have recently become available. In vivo Escherichia coli cloning (iVEC can directly transform a mixture of insert and vector DNA fragments into E. coli, which are ligated by endogenous homologous recombination activity in the cells. Seamless ligation cloning extract (SLiCE cloning uses the endogenous recombination activity of E. coli cellular extracts in vitro to ligate insert and vector DNA fragments. An evaluation of the efficiency and utility of these methods is important in deciding the adoption of a seamless cloning method as a useful tool. In this study, both seamless cloning methods incorporated inserting DNA fragments into linearized DNA vectors through short (15–39 bp end homology regions. However, colony formation was 30–60-fold higher with SLiCE cloning in end homology regions between 15 and 29 bp than with the iVEC method using DH5α competent cells. E. coli AQ3625 strains, which harbor a sbcA gene mutation that activates the RecE homologous recombination pathway, can be used to efficiently ligate insert and vector DNA fragments with short-end homology regions in vivo. Using AQ3625 competent cells in the iVEC method improved the rate of colony formation, but the efficiency and accuracy of SLiCE cloning were still higher. In addition, the efficiency of seamless cloning methods depends on the intrinsic competency of E. coli cells. The competency of chemically competent AQ3625 cells was lower than that of competent DH5α cells, in all cases of chemically competent cell preparations using the three different methods. Moreover, SLiCE cloning permits the use of both homemade and commercially available competent cells because it can use general E. coli recA− strains such as DH5α as host cells for transformation. Therefore, between the two methods, SLiCE cloning provides both higher efficiency and better utility than the iVEC method for seamless DNA plasmid

  3. A simple procedure for the extraction of DNA from long-term formalin-preserved brain tissues for the detection of EBV by PCR.

    Science.gov (United States)

    Hassani, Asma; Khan, Gulfaraz

    2015-12-01

    Long-term formalin fixed brain tissues are potentially an important source of material for molecular studies. Ironically, very few protocols have been published describing DNA extraction from such material for use in PCR analysis. In our attempt to investigate the role of Epstein-Barr virus (EBV) in the pathogenesis of multiple sclerosis (MS), extracting PCR quality DNA from brain samples fixed in formalin for 2-22 years, proved to be very difficult and challenging. As expected, DNA extracted from these samples was not only of poor quality and quantity, but more importantly, it was frequently found to be non-amplifiable due to the presence of PCR inhibitors. Here, we describe a simple and reproducible procedure for extracting DNA using a modified proteinase K and phenol-chloroform methodology. Central to this protocol is the thorough pre-digestion washing of the tissues in PBS, extensive digestion with proteinase K in low SDS containing buffer, and using low NaCl concentration during DNA precipitation. The optimized protocol was used in extracting DNA from meninges of 26 MS and 6 non-MS cases. Although the quality of DNA from these samples was generally poor, small size amplicons (100-200 nucleotides) of the house-keeping gene, β-globin could be reliably amplified from all the cases. PCR for EBV revealed positivity in 35% (9/26) MS cases, but 0/6 non-MS cases. These findings indicate that the method described here is suitable for PCR detection of viral sequences in long-term formalin persevered brain tissues. Our findings also support a possible role for EBV in the pathogenesis of MS. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    Athas, W.F.

    1988-01-01

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  5. Chemical Compounds and Extraction Methods of ?Maollahm?

    OpenAIRE

    Sadeghpoor, Omid; Dayeni, Manijeh; Razi, Samane

    2016-01-01

    Background: Maollahm or meat juice, a by-product of meat, is a traditional remedy in Persian medicine. This product was used as a nourishment or treatment substance for sick people. According to the ancient Persian medicine, animal meat has more affinity with the human body and the body easily absorbs its nutrition. Therefore, one could resort to maollahm for patients requiring urgent nourishment to boost and strengthen their body. Methods: In this work, different ways of preparing maollahm f...

  6. Comparison of protein extraction methods suitable for proteomics ...

    African Journals Online (AJOL)

    Jane

    2011-07-27

    Jul 27, 2011 ... An efficient protein extraction method is a prerequisite for successful implementation of proteomics. ... research, it is noteworthy to discover a proteome ..... Proteomic analysis of rice (Oryza sativa) seeds during germination.

  7. effects of extraction method on the physicochemical and mycological

    African Journals Online (AJOL)

    DR. AMINU

    Canarium Schweinfurthii fruit oil obtained by the improved method of extraction had better quality and stability ... application due to the believe that it enhances the oil flavours, also the fruit ..... starters on coconut oil recovery. Proceeding.

  8. Solid phase extraction method for determination of mitragynine in ...

    African Journals Online (AJOL)

    All rights reserved. ... 1Department of Pharmacology, 2Department of Applied Science, 3Police Forensic Science Center 10, Yala 95000, 4Natural ... Purpose: To develop a solid phase extraction (SPE) method that utilizes reverse-phase high.

  9. Comparative evaluation of three automated systems for DNA extraction in conjunction with three commercially available real-time PCR assays for quantitation of plasma Cytomegalovirus DNAemia in allogeneic stem cell transplant recipients.

    Science.gov (United States)

    Bravo, Dayana; Clari, María Ángeles; Costa, Elisa; Muñoz-Cobo, Beatriz; Solano, Carlos; José Remigia, María; Navarro, David

    2011-08-01

    Limited data are available on the performance of different automated extraction platforms and commercially available quantitative real-time PCR (QRT-PCR) methods for the quantitation of cytomegalovirus (CMV) DNA in plasma. We compared the pe